ss shcheka & h keppler nature 000 , 1-4 (2012) doi:10.1038/nature11506

1

SS Shcheka & H Keppler Nature 000, 1-4 (2012) doi:10.1038/nature11506 A sample containing phase X (phX) coexisting with MgSiO 3 ilmenite (Ilm), SiO 2 stishovite (St) and K 2 CO 3 carbonate.

Upload: marshall-garrett

Post on 01-Jan-2016

11 views

Category:

Documents

0 download

Report

Download

Tags:

Embed Size (px):

DESCRIPTION

A sample containing phase X (phX) coexisting with MgSiO 3 ilmenite (Ilm), SiO 2 stishovite (St) and K 2 CO 3 carbonate. SS Shcheka & H Keppler Nature 000 , 1-4 (2012) doi:10.1038/nature11506. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: SS Shcheka & H Keppler Nature 000 , 1-4 (2012) doi:10.1038/nature11506

SS Shcheka & H Keppler Nature 000, 1-4 (2012) doi:10.1038/nature11506

A sample containing phase X (phX) coexisting with MgSiO3

ilmenite (Ilm), SiO2 stishovite (St) and K2CO3 carbonate.

GI Motility online (May 2006) | doi:10.1038/gimo46

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Biotechnology: doi:10.1038/nbt

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

GI Motility online (May 2006) | doi:10.1038/gimo31

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

doi:10.1038/nature06481 LETTERS

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

GI Motility online (May 2006) | doi:10.1038/gimo12

Published in Nature Materials (2016) doi:10.1038/nmat4569

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

Nature , 2008, Doi:10.1038/nature07103

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

doi:10.1038/nature12886 Neanderthal from the Altai

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

doi:10.1038/nature05202 LETTERS

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

GI Motility online (May 2006) | doi:10.1038/gimo48

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility