Toxicology in Vitro 27 (2013) 1065–1071

Contents lists available at SciVerse ScienceDirect

Toxicology in Vitro

journal homepage: www.elsevier .com/locate / toxinvi t

Sophocarpine alleviates hepatocyte steatosis through activating AMPKsignaling pathway q

Chun-Yan Song 1, Jian Shi 1, Xin Zeng, Yi Zhang, Wei-Fen Xie, Yue-Xiang Chen ⇑Department of Gastroenterology, Shanghai Changzheng Hospital, Second Military Medical University, Shanghai 200003, China

a r t i c l e i n f o

Article history:Received 4 May 2012Accepted 28 January 2013Available online 8 February 2013

Keywords:SophocarpineAMPKACCHNF-4aSrebp-1cSteatosisPrimary hepatocyte

0887-2333/$ - see front matter � 2013 Elsevier Ltd. Ahttp://dx.doi.org/10.1016/j.tiv.2013.01.020

q This study was supported by the National Natural(Nos. 30971343, 81270486 and 81000167).⇑ Corresponding author.

E-mail address: yuexchen1807@yahoo.com.cn (C.-1 These authors contributed equally to this work.

a b s t r a c t

Sophocarpine, an effective compound derived from foxtail-like sophora herb and seed, has been reportedthat it can alleviate non-alcoholic steatohepatitis (NASH) in rats and affect adipocytokine synthesis.Meanwhile, adipocytokines could adjust hepatic lipid metabolism through AMPK signaling pathway. Inthe work presented here, primary hepatocytes were isolated from specific pathogen-free male SD ratsand incubated with 200 lmol/L oleic acid for 24 h to induce steatotic model, then treated with sophocar-pine for 72 h. Oil red staining was performed to evaluate steatosis, total RNA and protein of primary hepa-tocytes were extracted for real-time RT-PCR and western blot analysis. A cluster of aberrances wereobserved in the model group, including hepatocyte steatosis, increased leptin and decreased adiponectinmRNA expressions. While sophocarpine treatment resulted in: significant improvement of steatosis(>50% decrease), decrease of leptin expression (<0.57-fold) and increase of adiponectin expression(>1.48-fold). Moreover, compared with the model group, sophocarpine could significantly increaseP-AMPKa (>5.82-fold), AMPKa (>1.29-fold) and ACC (>3.27-fold) protein expressions, and reduceP-ACC (<0.30-fold) and HNF-4a (<0.20-fold) protein expression. The mRNA expression of Srebp-1c wasdownregulated significantly simultaneously (<0.68-fold). We concluded that sophocarpine could allevi-ate hepatocyte steatosis and the potential mechanism might be the activated signaling pathway of AMPK.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Nonalcoholic fatty liver disease (NAFLD) is the most common li-ver disease and its incidence is rising rapidly worldwide recently.Epidemiological surveys have revealed that the prevalence ofNAFLD is about 20–40% in western countries (Bedogni et al.,2005) and 15% in eastern and southern regions of China (Zhouet al., 2007). The pathogenesis of NAFLD is still not entirely under-stood, many evidences have indicated the importance of changes(e.g. saturated vs. unsaturated) in dietary fatty acids as potentialmechanisms for the development of NAFLD both in rodent modelsand in humans (Cortez-Pinto et al., 2006; Wang et al., 2006;Hernández et al., 2005; Musso et al., 2003; Nehra et al., 2001).Other findings demonstrated that liver fat composition wasdetermined by liver metabolism disorder rather than dietary fatcomposition (Comhair et al., 2011).

Sophocarpine is a type of sophorae alkaloid derived from fox-tail-like sophora herb and seed, whose structure is similar with

ll rights reserved.

Science Foundation of China

Y. Song).

that of Kushen alkaloids, and is administrated widely in traditionalChinese medicines. Recent studies revealed that sophocarpine,with cheap cost, had little poisonous side effect at safe doses andwide distribution in tissues in vivo (Chen et al., 2005). Besides, fur-ther studies showed that sophocarpine could inactivate endotoxin,control inflammatory response and reduce inflammatory damagein cells in vitro (Zhang et al., 2008; Han et al., 2006; Qavi et al.,2002). Moreover, it is a candidate therapeutic drug for anti-hepati-tis B virus (Ding et al., 2006) and viral myocarditis (Guo et al.,2005) in vivo. In addition, we explored the preventive and thera-peutic effects of sophocarpine on experimental rat non-alcoholicsteatohepatitis (NASH) and found that it could alleviate NASH inrats (Song et al., 2011). Based on the above studies, we intendedto further explore the mechanism of the anti-NASH effect ofsophocarpine.

The adenosine monophosphate-activated protein kinase (AMPK)is an important regulatory protein for cellular energy balance and isconsidered as a master switch of glucose and lipid metabolism invarious organs, especially in skeletal muscle and liver (Gruzmanet al., 2009). Once activated, AMPK leads to a concomitant inhibi-tion of energy consuming biosynthetic pathways, such as fatty acidand sterol synthesis, and activation of ATP-producing catabolicpathways, such as fatty acid oxidation (Viollet et al., 2006). Somestudies found that liver-specific AMPKa2 deletion in mice could

1066 C.-Y. Song et al. / Toxicology in Vitro 27 (2013) 1065–1071

enhance hepatic lipogenesis (Andreelli et al., 2006; Foretz et al.,2005) and certified the modulating function of AMPK in glucoseand lipid metabolism further. In recent years, AMPK has becomeone point of conversion of regulatory signals monitoring systemicand cellular energy status. The transcription factors, including ste-rol regulatory element binding protein 1c (Srebp-1c) and hepato-cyte nuclear factor-4 (HNF-4a), and the enzyme acetyl-CoAcarboxylase (ACC) are the downstreams of AMPK signaling pathwayand have also been regarded as critical transcription activators forhepatic cholesterol and fatty acid biosynthesis, and their homeosta-sis. While AMPK activated, they could be downregulated and inhib-ited fatty acid synthesis and gluconeogenesis (Gruzman et al., 2009;Horton et al., 2002; Zhou et al., 2001).

Adiponectin and leptin are two important adipocytokines andthey can influence AMPK activities in regulating energy metabo-lism (Yamauchi et al., 2002; Hardie, 2007). In our previous study,we found that sophocarpine could increase the mRNA transcriptionof adiponectin and decrease leptin mRNA transcription (Guo et al.,2005). Hereby, we supposed that sophocarpine could adjust the li-pid homeostasis through AMPK signaling pathway. In the workpresented here, we found that sophocarpine could alleviate hepa-tocyte steatosis, upregulate adiponection expression and activateAMPK signaling pathway.

2. Materials and methods

2.1. Reagent

Sophocarpine was purchased from Shanghai Winherb MedicalS&T Development Co. Ltd. (>98%, Shanghai, China). Cell CountingKit-8 (CCK-8) was obtained from Dojindo (Japan). Oleic acid waspurchased from Sigma (St. Louis, MO, USA). Primers for transcriptswere synthesized by Life Technologies (Shanghai, China). The se-quences have been shown in Table 1. Antibodies to phospho-AMPKa (Thr172), total AMPKa, phospho-acetyl-CoA carboxylase(Ser79) and total acetyl-CoA carboxylase (ACC) were obtained fromCell Signaling Technologies (Danvers, MA, 1:1000 dilutions).HNF-4a antibody was obtained from Santa Cruz Biotechnology(CA, USA, 1:500 dilutions).

2.2. Animal and hepatocytes

Specific pathogen-free male Sprague–Dawley (SD) rats, weigh-ing about 120–150 g each, were obtained from Shanghai SLAC Lab-oratory Animal Co. Ltd. (Shanghai, China), and housed understandard animal laboratory conditions in the experimental animalcenter of Second Military Medical University. This experiment wasapproved by the local Ethical Committee of the University. All ani-mals received humane care in compliance with institutional ani-mal care guidelines.

Primary hepatocytes were isolated from non-fasted male SDrats with modified Seglen two-step collagenase perfusion methodand seeded with DEME + 10%FBS (37 �C, 5% CO2, 72 h). About1.2–1.5 � 108 primary hepatocytes were isolated per rat. Rat pri-mary hepatocytes were seeded onto a 96-well plate at 2 � 103/wellin triplicate wells for CCK-8 detection, and a 30 mm plate at

Table 1Primers for adiponectin, leptin, Srebp-1c and b-actin.

Sense (50-30) Antisense (50-30)

Adiponectin ACAGGAGATGTTGGAATGACAG CTGCCGTCATAATGATTCTGTTLeptin CCTGTGGCTTTGGTCCTATCTG AGGCAAGCTGGTGAGGATCTGSrebp-1c ACACCATGGGGAAGCACAC CTTCACTCTCAATGCGCCb-actin CCATTGAACACGGCATTGTC TCATAGATGGGCACACAGTG

2 � 105/well in triplicate wells for red oil staining, real-time RT-PCR and western blot detection. All experiments above had beenreplicated in three independent experiments using hepatocytesisolated from SD rats in three different days.

2.3. CCK-8. (Cell Counting Kit-8) based cell viability assay

Primary hepatocytes isolated from SD rats were seeded for 72 hand then treated with sophocarpine with different dosages. CCK-8original solution was 1:10 diluted. Every plate of the triplicate 96-well was filled with 100ul CKK-8 diluted solution at 0 h, 24 h, 48 h,72 h and 96 h after attachment and then incubated for 0.5 h with37 �C, 5% CO2 condition. The number of metabolically active mito-chondria and viable cells was determined colorimetrically(450 nm, Bio-Tex ELx800, Bio-Rad Inc., USA).

2.4. Hepatocyte group allocations

Primary hepatocytes were divided into five groups: normal,model, sophocarpine 0.2, 0.4 and 0.8 mmol/L group. The normalgroup was incubated with DEME + 10%FBS only, model groupwas incubated with 200 lmol/L oleic acid, and sophocarpine trea-ted groups were incubated with 200 mmol/L oleic acid for 24 h andthen treated with sophocarpine for 72 h. Oil staining was carriedout to detect the degree of hepatocyte steatosis. Total RNAs or pro-teins were extracted for real-time RT-PCR or western blot analysis,respectively.

2.5. Red oil staining

Primary hepatocytes from SD rats were washed twice with PBSin room temperature, immobilizated with 4% paraformaldehydefor 30 min, immersed with 60% isopropanol for 5–10 s, dyed withred oil for 15–30 min and then pictured with microscope (200Xand 400X, Olypus, Japan).

2.6. Total RNA isolation, cDNA synthesis and quantitative real-time RT-PCR

Total RNA was extracted from hepatocytes using Trizol reagent(Invitrogen, Carlsbad, CA), and complementary DNA (cDNA) wasobtained using a RT-PCR kit (Takara, Kusatsu, Japan) according tothe manufacturer’s instructions. The quality and quantity of totalRNA and fragmented cRNA were assessed using the Agilent bioan-alyzer. SYBR dyes were purchased from Takara (Kusatsu, Japan) forreal-time RT-PCR detection (95 �C 10 min, 95 �C 15 s, 60 �C 1 min).The relative amounts of mRNAs were calculated using the compar-ative CT method. b-actin was used as internal control.

2.7. Western blot analysis

After sophocarpine treatment, primary hepatocytes werewashed twice with iced PBS and scrapped from the dish in 40 lliced whole-cell lysis buffer (50 mmol/L Tris-HCl pH8.0,150 mmol/L NaCl, 1% TritonX-100 and 100 lg/ml PMSF). The pro-tein content in the supernatant was determined with PIERCE BCAprotein assay kit (Rockford, IL). Proteins (20 lg/lane) in whole celllysates were separated on SDS/PAGE, transferred to BIO-RAD Im-muno-Blot PVDF membrane (Hercules, CA), blocked with 5% milkfor 2 h. Membranes was probed with specific primary antibody,followed by incubation with an IRDye680-conjugated antirabbitsecondary antibody (Rockland, Inc.). Detection was performedusing an Odyssey IR imaging system (Li-COR Biotechnology). Re-sults were analyzed by image-pro plus 6.0 software.

C.-Y. Song et al. / Toxicology in Vitro 27 (2013) 1065–1071 1067

2.8. Statistical analysis

Results are expressed as mean ± SD. The analysis of variance(ANOVA) and Student’s t test were used for the comparison amongthe groups. P value <0.05 was considered as significance.

3. Results

3.1. Effects of sophocarpine on the viability of primary hepatocytes

To determine the cytotoxic effect, we used CCK-8 to detect theviabilities of primary hepatocytes treated with different concentra-tions of sophocarpine. The viabilities of the hepatocytes treatedwith 0.4 and 0.8 mmol/L of sophocarpine were not significantlydifferent from those of the control group. However, sophocarpineat doses over 0.8 mmol/L reduced cell viabilities (Fig. 1). These re-sults demonstrated that sophocarpine with the dosages60.8 mmol/L could be used to treat rat primary hepatocytes with-out cytotoxic effects.

3.2. Sophocarpine alleviates the steatosis of primary hepatocytes

To address the effect of sophocarpine on hepatocyte steatosis,primary SD hepatocytes were stimulated with 200 mmol/L oleicacid for 24 h and then treated for 72 h with sophocarpine0.2 mmol/L, 0.4 mmol/L and 0.8 mmol/L. At the end, red oil stainingwas performed to judge the degree of fatty degeneration. Asshowed in Fig. 2, there were remarkable differences between thenormal and model groups, the normal hepatocytes had almost nosteatosis, severe steatosis and macro-lipid droplets were observedin the model group. The steatosis relieved significantly in sopho-carpine treated groups compared with model group (the red areasof lipid droplets decreased >50%). The relief of sophocarpine0.4 mmol/L group was more obvious than those of the other twogroups.

3.3. Effect of sophocarpine on the expression of adipocytokines

Considering the important relationship between adipocytokinesand lipid metabolism, we further investigated the effect of sopho-carpine on the transcriptions of leptin and adiponectin. As shownin Fig 3, concomitant with the improvement of steatosis, the mRNA

Fig. 1. Effects of sophocarpine on viability of primary hepatocytes from SD rats.Compared with the normal group, SP 2.4 mmol/L group decreased significantly(P < 0.05) in 24 h (17% decrease), 48 h (23% decrease), 72 h (37% decrease) and 96 h(63% decrease); SP 1.6 mmol/L group decreased significantly (P < 0.05) in 72 h (28%decrease) and 96 h (40% decrease); SP 1.2 mmol/L group decreased significantly(P < 0.05) in 96 h (20% decrease); the others did not show significant decreasing(P > 0.05). The results in the graph were the mean value of the three independentexperiments conducted.

expression of adiponectin was down-regulated in the model group,while its expression increased after sophocarpine treatment (1.65,1.48 and 2.31-fold respectively). In contrast, leptin transcriptionwas notably enhanced in NASH, and it was suppressed by sopho-carpine treating (0.56, 0.46 and 0.16-fold respectively). There wasno significant difference of the two mRNA expressions among thethree sophocarpine treated groups. With these results, we coulddeduce that the protective effect of sophocarpine on hepatocytesteatosis was at least partly due to its regulation onadipocytokines.

3.4. Sophocarpine actives AMPK signaling pathway in steatotichepatocyte

To understand the mechanism of the anti-steatosis effect ofsophocarpine, we detected the activity of the enzymes related toadipocytokines and lipid metabolism. The total RNA and proteinswere collected at the end of this study. As expected (Fig. 4), wes-tern blot analysis showed that AMPK was reduced after steatosiswas induced compared with the normal group, whereas sophocar-pine treatment could activate AMPK and significantly increaseP-AMPKa (5.83, 6.74 and 6.10-fold respectively), AMPKa (1.30,1.37 and 1.48-fold respectively) and ACC (4.15, 3.27 and 3.64-foldrespectively) protein expressions and reduce P-ACC (0.29, 0.20 and0.15-fold respectively) and HNF-4a (0.19, 0.12 and 0.05-foldrespectively) protein expressions. Real-time RT-PCR indicated thatthe mRNA expression of Srebp-1c increased after steatosis was in-duced compared with the normal group and it was downregulatedsignificantly in the sophocarpine treated groups compared withthe model group (0.68, 0.63 and 0.62-fold respectively).

4. Discussion

NASH is a worldwide health problem, which can lead to cirrho-sis, hepatocellular carcinoma, and liver failure, and thus it is ur-gently to find new therapeutic strategies. In the past decades,many traditional Chinese medicines have been attempted to treatliver diseases, including NASH, and exerted potential effects insome clinical studies (Zhang et al., 2010; Gao et al., 2008). Sopho-carpine, a monomer of traditional Chinese medicine with low costand high safety, has been proved to alleviate NASH in rats and reg-ulate adipocytokines synthesis (Guo et al., 2005). Based on theimportant effect of adipocytokines on AMPK signaling pathway,we hypothesized that sophocarpine might have restorative effecton AMPK signaling pathway in the pathogenesis of hepatocyte ste-atosis. In this report, we found that sophocarpine delivery couldalleviate steatosis of primary hepatocytes of SD rats and increasethe synthesis of the protective adipocytokine, adiponectin. Fur-thermore, we demonstrated that activated AMPK signaling path-way might contribute to the anti-NASH effect of sophocarpine.

In previous studies, it has been reported that sophocarpinecould produce dose-dependent anti-inflammation activity, and40 mg/kg/d is a safety dosage for mice (Gao et al., 2009). Our pre-vious study has confirmed that sophocarpine injection subcutane-ously with the dose of 20 mg/kg/d could inhibit experimentalNASH in rats, and has no obvious poisonous side effects (Guoet al., 2005). The dosages used here were similar to the concentra-tions used in previous reports showing activation of signal trans-duction pathways and regulation of gene expressions (Gao et al.,2012). Our results demonstrated that sophocarpine under0.8 mmol/L was well tolerated by primary hepatocytes in the cur-rent experimental settings (Fig. 1). Recently, some attempts havebeen taken to modify the structure of sophocarpine and identifyits analogues for the improvement of its bioavailability and effi-cacy. Whether any of those derivatives and analogues has same ef-

Fig. 2. Red oil staining of steatosis in the five groups. Steatosis degree were relieved significantly after sophocarpine intevention compared with the model group, the redareas of lipid droplets decreased >50%. In the three sophocarpine treating group, 0.4 mmol/L dose was more stronger than the 0.2 mmol/L and 0.8 mmol/L dose. The arrows inthe graph pointed out the typical steatotic hepatocytes (two nuclei structure and macro-lipid droplets in cytoplasm). The results in the three independent experiments weresimilar. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

1068 C.-Y. Song et al. / Toxicology in Vitro 27 (2013) 1065–1071

fect on viability of primary hepatocytes remains unknown. In addi-tion, how sophcarpine and its derivatives are transported andmetabolized in primary hepatocytes also deserves to be investi-gated. Nevertheless, this study provided a reference for future re-search on the effect of sophocarpine.

It has been proved that different dietary fats mainly accumulateas oliec acid in the liver and oleic acid is the main constituent of allfatty acids in hepatic steatosis (Comhair et al., 2011). Hepatic ste-atosis in human beings is associated with accumulation of excess

oleic acid (Cui et al., 2010; Araya et al., 2004) and steatostic hepa-tocytes induced by oleic acid had been widely used in the researchof NAFLD in vitro (Comhair et al., 2011; Cui et al., 2010; Zhang et al.,2011; Ricchi et al., 2009; Okamoto et al., 2002; Janorkar et al.,2009). It has been previously confirmed that stimulated by oleicacid 200 mmol/L for 24 h could successfully establish the hepato-cyte steatosis model (Malhi et al., 2006). With these reports, theprimary SD hepatocytes received oleic acid 200 mmol/L for 24 hshowed marked steatosis and macro-lipid droplets in cytoplasm.

Fig. 3. Gene expression changes of leptin and adiponectin. Real-time RT-PCRshowed adiponectin mRNA was down-regulated in the model group, whileincreased after sophocarpine treatment (1.65, 1.48 and 2.31-fold respectively);leptin transcription was notably enhanced in steatotic hepatocytes, and it wassuppressed by sophocarpine treating (0.56, 0.46 and 0.16-fold respectively). Therewas no significant difference of the two mRNA expressions among the threesophocarpine treated groups. The results of three independent experiments wereshown with mean ± SD, the ‘stars’ in the graph mean P < 0.05 compared with modelgroup.

C.-Y. Song et al. / Toxicology in Vitro 27 (2013) 1065–1071 1069

In this study, sophocarpine was administrated with the doses of0.2 mmol/L, 0.4 mmol/L and 0.8 mmol/L for 72 h after steatosiswas established. As a result, steatosis was obviously relieved aftersophocarpine delivery. At the same time, we found that 0.4 mmol/Lwas the strongest dose for sophocarpine anti-steatosis among thethree groups. Hereby, we concluded that sophocarpine deliverycould alleviate steatosis in primary hepatocytes in SD rats and0.4 mmol/L might be the most suitable dosage for sophocarpine’santi-steatosis effect in vitro.

Fig. 4. Sophocarpine actives AMPK signaling pathway in steatotic hepatocyte. (A and B) Eanalysis showed that AMPK signaling pathway proteins were suppressed after steatosis coP-AMPKa (5.83, 6.74 and 6.10-fold respectively), AMPKa (1.30, 1.37 and 1.48-fold respprotein expression of P-ACC (0.29, 0.20 and 0.15-fold respectively) and HNF-4a (0.19, 0.expressed as ratio of gray value of target band and GAPDH bend. Graph was the represisolated from SD rats in three different days. (C). Effect of sophocarpine on Srebp-1c gencompared with normal group, and it was downregulated significantly in the sophocarespectively). The results in three independent experiments were shown with mean ± S

It has been confirmed that high leptin and low adiponectinexpressions are associated with more advanced form of NASH(Hui et al., 2004; Kaser et al., 2005). Leptin could increase theexpressions of TGFb1 and TNF-a, amplify inflammation and resultin the development of fibrosis in rats (Ikejima et al., 2001; Marra,2002). Adiponectin is described as a protective factor in liverinflammation and fibrosis. It has been reported that adiponectinknockout mice developed more severe hepatic steatosis thanwild-type mice when fed with a high-fat diet (Kamada et al.,2007), and adiponectin treatment could improve the injury in fattyliver disease (Xu et al., 2003) and attenuate liver fibrosis inducedby CCl4 (Masaki et al., 2004). Our study showed that hepatocytesteatosis could reduce the transcription of adiponectin and inducethe mRNA expression of leptin. After sophocarpine delivery withdifferent dosages, these changes were all reversed. These resultswere consistent with the improvement of hepatocyte steatosis. Itis now well understood that the expressions of leptin and adipo-nectin are related to lipid metabolism, but the mechanism of thesetwo adipocytokines in the pathogenesis of sophocarpine’s anti-ste-atosis effect remained unclear. Our study initially founded thatsophocarpine could lead to the changes of these two adipocyto-kines, and the therapeutic effect on hepatocyte steatosis mightpartly attribute to the activated adiponectin and reduced leptinexpressions.

AMPK is an important regulatory protein for cellular energy bal-ance and activation of AMPK in the liver leads to the stimulation offatty acid oxidation and inhibition of lipogenesis, glucose produc-tion and protein synthesis (Viollet et al., 2009). AMPK has beenconsidered as a master switch of glucose and lipid metabolism invarious organs and it augments fatty acid oxidation and decreasesglucose output, cholesterol and triglyceride synthesis in the liver(Gruzman et al., 2009). More interestingly, adipocytokines andAMPK have very close relationship in the regulation of lipid metab-

ffects of sophocarpine on AMPK signaling pathway protein expressions. western blotmpared with normal group. After sophocarpine treatment, the protein expression ofectively) and ACC (4.15, 3.27 and 3.64-fold respectively) increased (P < 0.05) and

12 and 0.05-fold respectively) reduced (P < 0.05) in the graft level. The results wereentative of three independent experiments with similar results using hepatocytese expression. Real-time RT-PCR showed Srebp-1c mRNA increased in model grouprpine treated groups compared with the model group (0.68, 0.63 and 0.62-fold

D, the ‘stars’ in the graph mean P < 0.05 compared with model group.

1070 C.-Y. Song et al. / Toxicology in Vitro 27 (2013) 1065–1071

olism (Viollet et al., 2006; Yamauchi et al., 2002). By responding todiverse hormonal signals, including leptin and adiponectin, AMPKserves as an intertissue signal integrator among peripheral tissues,as well as the hypothalamus, in the control of whole body energybalance (Long and Zierath, 2006). Our study documented thatsophocarpine delivery could increase the expression of adiponectinand suppress the expression of leptin; besides, phosphorylation ofAMPK was also markedly upregulated by sophocarpine treatment.

AMPK could downregulate the enzymes involved in fatty acidsynthesis and gluconeogenesis by inhibiting the transcription fac-tors SREBP-1c, HNF-4a and the enzyme ACC (Gruzman et al.,2009). The phosphorylation of AMPKa in primary hepatocytes cor-related with a decrease of the phosphorylation of its substrate ACC,HNF-4a and Srebp-1c, demonstrating the elevation of AMPK activ-ity after sophocarpine treatment in primary hepatocytes. In thisstudy, we reported the effects of sophocarpine on the expressionof hepatic enzymes and genes involved in lipid metabolism andfound that sophocarpine could activate AMPK signaling pathwayin steatic hepatocyte. To the best of our knowledge, this was thefirst report of the effect of sophocarpine on AMPK signalingpathway.

It was reported that pentoxifylline could alleviate high-fat diet-induced NASH in rats by inhibiting AGE and RAGE expression (Wuet al., 2010). We further detected the AGE and RAGE proteinsexpressions in the normal, model and sophocarpine-treated groups(Supplementary Fig. 1). We found that sophocarpine did not de-crease AGE protein expression in steatostic hepatocytes. However,we did not find the RAGE band on the Western Blot membrane. Inaddition, we further detected the mRNA expression of RAGE byreal-time RT-PCR and found that the quantity of mRNA was alsovery low (the cycles exceeded 30). Hence, we think sophocarpinehad little effect on AGE and RAGE expression.

Taken together, the present investigation provided strong evi-dence for the suppressive effect of sophocarpine on hepatocyte ste-atosis. These results not only deepened our understanding of thesophocarpine’s anti-NASH effect, but also confirmed that sophocar-pine could activate AMPK signaling pathway.

Conflict of interest

Disclosure: none.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.tiv.2013.01.020.

References

Andreelli, F., Foretz, M., Knauf, C., Cani, P.D., Perrin, C., Iglesias, M.A., et al., 2006.Liver adenosine monophosphate activated kinase-alpha2 catalytic subunit is akey target for the control of hepatic glucose production by adiponectin andleptin but not insulin. Endocrinology 147 (5), 2432–2441.

Araya, J., Rodrigo, R., Videla, L.A., Thielemann, L., Orellana, M., Pettinelli, P.,Poniachik, J., 2004. Increase in long-chain polyunsaturated fatty acid n � 6/n� 3 ratio in relation to hepatic steatosis in patients with non-alcoholic fattyliver disease. Clin. Sci. (Lond). 106, 635–643.

Bedogni, G., Miglioli, L., Masutti, F., Tiribelli, C., Marchesini, G., Bellentani, S., 2005.Prevalence of and risk factors for nonalcoholic fatty liver disease: the Dionysosnutrition and liver study. Hepatology 42 (1), 44–52.

Chen, S.X., Xu, J., Wang, P.Q., Zhou, B.B., Cai, M.H., Qian, F.R., et al., 2005. Study ofsophocarpine in human pharmacokinetic. Shanghai Second Medical Univ. J. 25,1164–1166.

Comhair, T.M., Garcia Caraballo, S.C., Dejong, C.H., Lamers, W.H., Köhler, S.E., 2011.Dietary cholesterol, female gender and n � 3 fatty acid deficiency are moreimportant factors in the development of non-alcoholic fatty liver disease thanthe saturation index of the fat. Nutr. Metab. (Lond). 8, 4.

Cortez-Pinto, H., Jesus, L., Barros, H., Lopes, C., Moura, M.C., Camilo, M.E., 2006. Howdifferent is the dietary pattern in non-alcoholic steatohepatitis patients? Clin.Nutr. 25 (5), 816–823.

Cui, Wei, Chen, Stephen L., Ke-Qin, Hu, 2010. Quantification and mechanisms ofoleic acid-induced steatosis in HepG2 cells. Am. J. Transl. Res. 2 (1), 95–104.

Ding, P.L., Liao, Z.X., Huang, H., Zhou, P., Chen, D.F., 2006. (+)-12alpha-Hydroxysophocarpine, a new quinolizidine alkaloid and related anti-HBValkaloids from Sophora flavescens. Bioorg. Med. Chem. Lett. 16, 1231–1235.

Foretz, M., Ancellin, N., Andreelli, F., Saintillan, Y., Grondin, P., Kahn, A., et al., 2005.Short-term over expression of a constitutively active form of AMP-activatedprotein kinase in the liver leads to mild hypoglycemia and fatty liver. Diabetes54 (5), 1331–1339.

Gao, Y., Song, L.X., Jiang, M.N., Ge, G.Y., Jia, Y.J., 2008. Effects of traditional Chinesemedicine on endotoxin and its receptors in rats with non-alcoholicsteatohepatitis. Inflammation 31, 121–132.

Gao, Y., Li, G., Li, C., Zhu, X., Li, M., Fu, C., Li, B., 2009. Anti-nociceptive and anti-inflammatory activity of sophocarpine. J. Ethnopharmacol. 125, 324–329.

Gao, Y., Jiang, W., Dong, C., Li, C., Fu, X., Min, L., et al., 2012. Anti-inflammatoryeffects of sophocarpine in LPS-induced RAW 264.7 cells via NF-jB and MAPKssignaling pathways. Toxicol. In Vitro 26 (1), 1–6.

Gruzman, A., Babai, G., Sasson, S., 2009. Adenosine monophosphate-activatedprotein kinase (AMPK) as a new target for antidiabetic drugs: a review onmetabolic, pharmacological and chemical considerations. Rev. Diabet. Stud. 6(1), 13–36.

Guo, B., Li, C., Deng, Z., Chen, S., Ji, Z., Zhang, J., et al., 2005. A new method formeasurement of (-)-sophocarpine, a candidate therapeutic for viral myocarditis,in plasma: application to a toxicokinetic study in beagle dogs. Rapid Commun.Mass Spectrom. 19, 2840–2848.

Han, Y., Zhou, Y., Liu, Q., 2006. Antiendotoxic effects of Sophora alopecuroides L..Zhong Yao Cai 29, 1066–1069.

Hardie, D.G., 2007. AMP-activated protein kinase as a drug target. Annu. Rev.Pharmacol. Toxicol. 47, 185–210.

Hernández, R., Martínez-Lara, E., Cañuelo, A., del Moral, M.L., Blanco, S., Siles, E.,et al., 2005. Steatosis recovery after treatment with a balanced sunflower orolive oil-based diet: involvement of perisinusoidal stellate cells. World J.Gastroenterol. 11 (47), 7480–7485.

Horton, J.D., Goldstein, J.L., Brown, M.S., 2002. SREBPs: activators of the completeprogram of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109,1125–1131.

Hui, J.M., Hodge, A., Farrell, G.C., Kench, J.G., Kriketos, A., George, J., 2004. Beyondinsulin resistance in NASH: TNF-alpha or adiponectin? Hepatology 40, 46–54.

Ikejima, K., Honda, H., Yoshikawa, M., Hirose, M., Kitamura, T., Takei, Y., Sato, N.,2001. Leptin augments inflammatory and profibrogenic responses in themurine liver induced by hepatotoxic chemicals. Hepatology 34, 288–297.

Janorkar, A.V., King, K.R., Megeed, Z., Yarmush, M.L., 2009. Development of anin vitro cell culture model of hepatic steatosis using hepatocyte-derivedreporter cells. Biotechnol. Bioeng. 102, 1466–1474.

Kamada, Y., Matsumoto, H., Tamura, S., Fukushima, J., Kiso, S., Fukui, K., et al., 2007.Hypoadiponectinemia accelerates hepatic tumor formation in a nonalcoholicsteatohepatitis mouse model. J. Hepatol. 47, 556–564.

Kaser, S., Moschen, A., Cayon, A., Kaser, A., Crespo, J., Pons-Romero, F., et al., 2005.Adiponectin and its receptors in non-alcoholic steatohepatitis. Gut 54, 117–121.

Long, Y.C., Zierath, J.R., 2006. AMP-activated protein kinase signaling in metabolicregulation. J. Clin. Invest. 116 (7), 1776–1783.

Malhi, H., Bronk, S.F., Werneburg, N.W., Gores, G.J., 2006. Free fatty acids induceJNK-dependent hepatocyte lipoapoptosis. J. Biol. Chem. 281 (17), 12093–12101.

Marra, F., 2002. Leptin and liver fibrosis: a matter of fat. Gastroenterology 122,1529–1532.

Masaki, T., Chiba, S., Tatsukawa, H., Yasuda, T., Noguchi, H., Seike, M., Yoshimatsu,H., 2004. Adiponectin protects LPS-induced liver injury through modulation ofTNF-alpha in KK-Ay obese mice. Hepatology 40, 177–184.

Musso, G., Gambino, R., De Michieli, F., Cassader, M., Rizzetto, M., Durazzo, M., et al.,2003. Dietary habits and their relations to insulin resistance and postprandiallipemia in nonalcoholic steatohepatitis. Hepatology 37 (4), 909–916.

Nehra, V., Angulo, P., Buchman, A.L., Lindor, K.D., 2001. Nutritional and metabolicconsiderations in the etiology of nonalcoholic steatohepatitis. Dig. Dis. Sci. 46(11), 2347–2352.

Okamoto, Y., Tanaka, S., Haga, Y., 2002. Enhanced GLUT2 gene expression in an oleicacid induced in vitro fatty liver model. Hepatol. Res. 23, 138–144.

Qavi, H.B., Wyde, P.R., Khan, M.A., 2002. In vitro Inhibition of HHV-6 replication bysophocarpines. Phytother. Res. 16, 154–156.

Ricchi, M., Odoardi, M.R., Carulli, L., Anzivino, C., Ballestri, S., Pinetti, A., et al., 2009.Differential effect of oleic and palmitic acid on lipid accumulation and apoptosisin cultured hepatocytes. J. Gastroenterol. Hepatol. 24 (5), 830–840.

Song, C.Y., Zeng, X., Chen, S.W., Hu, P.F., Zheng, Z.W., Ning, B.F., et al., 2011.Sophocarpine alleviates non-alcoholic steatohepatitis in rats. J. Gastroenterol.Hepatol. 26 (4), 765–774.

Viollet, B., Foretz, M., Guigas, B., Horman, S., Dentin, R., Bertrand, L., et al., 2006.Activation of AMP-activated protein kinase in the liver: a new strategy for themanagement of metabolic hepatic disorders. J. Physiol. 574, 41–53.

Viollet, B., Guigas, B., Leclerc, J., Hébrard, S., Lantier, L., Mounier, R., et al., 2009.AMP-activated protein kinase in the regulation of hepatic energy metabolism:from physiology to therapeutic perspectives. Acta. Physiol. (Oxf). 196 (1), 81–98.

Wang, D., Wei, Y., Pagliassotti, M.J., 2006. Saturated fatty acids promoteendoplasmic reticulum stress and liver injury in rats with hepatic steatosis.Endocrinology 147 (2), 943–951.

Wu, J., Zhao, M.Y., Zheng, H., Zhang, H., Jiang, Y., 2010. Pentoxifylline alleviates high-fat diet-induced non-alcoholic steatohepatitis and early atherosclerosis in rats

C.-Y. Song et al. / Toxicology in Vitro 27 (2013) 1065–1071 1071

by inhibiting AGE and RAGE expression. Acta. Pharmacol. Sin. 31 (10), 1367–1375.

Xu, A., Wang, Y., Keshaw, H., Xu, L.Y., Lam, K.S., Cooper, G.J., 2003. The fat-derivedhormone adiponectin alleviates alcoholic and nonalcoholic fatty liver diseasesin mice. J. Clin. Invest. 112, 91–100.

Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., et al.,2002. Adiponectin stimulates glucose utilization and fatty-acid oxidationby activating AMP-activated protein kinase. Nat. Med. 8 (11), 1288–1295.

Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., et al., 2002.Adiponectin stimulates glucose utilization and fatty-acid oxidation byactivating AMP-activated protein kinase. Nat. Med. 8, 1288–1295.

Zhang, Y., Wang, S., Li, Y., Xiao, Z., Hu, Z., Zhang, J., 2008. Sophocarpine and matrineinhibit the production of TNF-alpha and IL-6 in murine macrophages and

prevent cachexia-related symptoms induced by colon26 adenocarcinoma inmice. Int. Immunopharmacol. 8 (13–14), 1767–1772.

Zhang, L., Wang, G., Hou, W., Li, P., Dulin, A., Bonkovsky, H.L., 2010. Contemporaryclinical research of traditional Chinese medicines for chronic hepatitis B inChina: an analytical review. Hepatology 51, 690–698.

Zhang, D., Xie, L., Jia, G., Cai, S., Ji, B., Liu, Y., et al., 2011. Comparative study onantioxidant capacity of flavonoids and their inhibitory effects on oleic acid-induced hepatic steatosis in vitro. Eur. J. Med. Chem. 46 (9), 4548–4558.

Zhou, G., Myers, R., Li, Y., Chen, Y., Shen, X., Fenyk-Melody, J., et al., 2001. Role ofAMP activated protein kinase in mechanism of metformin action. J. Clin. Invest.108 (8), 1167–1174.

Zhou, Y.J., Li, Y.Y., Nie, Y.Q., Ma, J.X., Lu, L.G., Shi, S.L., et al., 2007. Prevalence of fattyliver disease and its risk factors in the population of South China. World J.Gastroenterol. 13 (47), 6419–6424.