Copyright 0 1997 by the Genetics Society of America

The Salmon SmaI Family of Short Interspersed Repetitive Elements (SINEs): Interspecific and Intraspecific Variation of the Insertion of SINEs

in the Genomes of Chum and Pink Salmon

Nobuyoshi Takasaki*, Toshifumi Yam&*, Mitsuhiro Hamada*, Linda Parkt and Norihiro Okada*

*Faculty of Bioscience and Biotechnology, Tokyo Institute of Technology, Midori-ku, Yokohama 226, Japan, and tNorthwest Fisheries Science Center, Coastal Zone and Estuarine Studies Division, Seattle, Washington 981 12-2097

Manuscript received August 16, 1996 Accepted for publication February 10, 1997

ABSTRACT The genomes of chum salmon and pink salmon contain a family of short interspersed repetitive

elements (SINEs), designated the salmon SmaI family. It is restricted to these two species, a distribution that suggests that this SINE family might have been generated in their common ancestor. When insertions of the SmaI SINEs at 10 orthologous loci of these species were analyzed, however, it was found that there were no shared insertion sites between chum and pink salmon. Furthermore, at six loci where SmaI SINEs have been species-specifically inserted in chum salmon, insertions of SINEs were polymorphic among populations of chum salmon. By contrast, at four loci where SmaI SINEs had been species- specifically inserted in pink salmon, the SINEs were fixed among all populations of pink salmon. The interspecific and intraspecific variation of the SmaI SINEs cannot be explained by the assumption that the SmaI family was amplified in a common ancestor of these two species. To interpret these observations, we propose several possible models, including introgression and the horizontal transfer of SINEs from " -

pink salmon to chum salmon during evolution.

S HORT interspersed repetitive elements (SINEs; SINGER 1982) have been isolated from the genomes of many multicellular organisms from invertebrates to mammals (OKADA 1991a,b; OHSHIMA et al. 1993; OKADA and OHSHIMA 1995 and references therein), and also from plants (MOCHIZUKI et al. 1992; YOSHIOKA et al. 1993; DERAGON et al. 1994). Generally, particular SINEs can be unique to a particular taxonomic rank, for exam- ple, a family, a genus or a few species, although old SINEs that were widely distributed in mammalian ge- nomes were recently characterized (for review, see SMIT 1996). SINEs can be divided into two classes according to their origins. One class of SINEs is derived from the 7SL RNA (WEINER 1980; ULLU and TSCHUDI 1984) in the signal recognition particle (SRP) , which is involved in secretion of polypeptides during protein biosynthe- sis. The primate Alu family and the rodent type 1 (B l ) family belong to this class (for review, see SCHMID and MARAIA 1992; DEININGER and BATZER 1993). The other class of SINEs originated from specific tRNAs. It ap- pears that all SINEs other than the primate Alu and rodent B1 SINEs are members of the second class of SINEs (OKADA 1991a,b; OKADA and OHSHIMA 1995).

Since all SINEs include internal promoters for RNA polymerase 111 within their sequences, they can be tran- scribed independently of the flanking sequences that surround them. The presence of flanking direct repeats

Corresponding author: Norihiro Okada, Faculty of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259 Nagatsutaiho, Midori-ku, Yokohama 226, Japan. E-mail: nokada@bio.titech.ac.jp

Genetics 146: 369-380 (May, 1997)

at the 5' and 3' ends of SINEs, together with a poly(A)- tail at the 3' end, suggests that their amplification oc- curs by an RNA-intermediated process. Thus, SINEs are believed to be amplified by a process of retroposition, whereby RNA transcripts of SINEs are reverse tran- scribed and reinserted at various sites in the genome (JAGADEESWAREN et al. 1981; SINGER 1982; ROGERS 1985). By contrast to DNA transposable elements, which can often be excised quite precisely, SINEs ap- pear to be inserted irreversibly, and, thus, they can be used as effective evolutionary and phylogenetic markers (OKADA 1991b).

The genus Oncorhynchus consists of eight major spe- cies: chum salmon (Oncorhynchus keta), pink salmon (0. gorbuscha), kokanee (sockeye salmon; 0. nerka) , chinook salmon (0. tshaurytscha), coho salmon (0. kzsutch), masu salmon (0. masou), steelhead (0. mykiss) and cutthroat trout (0. tmtta), all of which live in the Pacific Ocean (SMITH and STEARLEY 1989). These species have complex life histories and interesting global distributions. Numer- ous studies have examined the phylogenetic relation- ships among the species in this genus, and a consensus exists for most species (UTTER et al. 1973; FERCUSON and FLEMING 1983; THOMAS et al. 1986; SMITH and STEARLEY 1989; PHILLIPS et al. 1992; SHEDLOCK et al. 1992; MURATA et al. 1993; for review see STEARLEY and SMITH, 1993). The exception to this is the relationship among pink, chum and kokanee salmon: two possible relationships are shown in Figure 1.

Analyses of morphology (STEARLEY and SMITH 1993),

370

(4

N. Takasaki et al.

genomes exclusively (MURATA et nl. 1993, 1996). This designation as sister species is not conclusive, however, since no SINEs that were inserted at orthologous loci in both chum and pink salmon have been isolated. In the present study, we analyzed in greater detail the distribu- tion of members of the SmnI family of SINEs in the genomes of chum and pink salmon, and we demon- strated that the SmaI family is a unique family, in that it exhibits extensive interspecific variation for the presence or the absence of SINEs in the genomes of these fish. These features of the SmaI family of SINEs suggest the possibility that this family of SINEs was transferred hori- zontally or was transferred through introgression from the genome of pink salmon to that of chum salmon during evolution

7 chum salmon

1 -kokanee

I kokanee L pink salmon 1

chum salmon FIGURE 1.-Possible phylogenetic relationships among

pink, chum and kokanee salmon. The relationships in a were obtained from analyses of RFLP of mitochondrial DNA (THOMAS et al. 1986) and of life history (HOAR 1958). The relationships in b were obtained from analyses of morphology (STEARLEY and SMITH 1993), allozymes (UTTER et al. 1973) and the sequences of ribosomal DNA (PHILLIPS et al. 1992) and of mitochondrial control regions (SHEDLOCK et al. 1992).

allozymes (UTTER et al. 1973) and the sequences of ribosomal DNA (PHILLIPS et al. 1992) and of mitochon- drial control regions (SHEDLOCK et al. 1992) suggested a sister relationship between pink salmon and kokanee (Figure 1b). Alternatively, a sister relationship between chum and pink salmon (Figure la) was proposed from analyses of RFLP of mitochondrial DNA (THOMAS et al. 1986) and of life history (HOAR 1958).

In an attempt to elucidate the possible roles of SINEs in the evolution of salmonids, we characterized three different families of SINEs: the salmon SmaI family, the charr FokI family and the salmonid HpaI family (&DO et al. 1991). The salmonid HpuI family of repeats appears to be present in all species in the family Salmonidae (KOISHI and OKADA 1991; DO et al. 1994,1995). Using insertions of the HpaI SINEs as temporal markers, our group looked at the phylogenetic relationships among seven species in the genus Oncorhynchus (KIDO et al. 1991; MURATA et al. 1993, 1996). Our phylogenetic tree is consistent with the consensus deduced from various taxonomic studies. With regard to the phylogenetic rela- tionships among three species described above, our work has suggested that chum and pink salmon are sister spe- cies because the salmon SmaI family is present in their

MATERIALS AND METHODS

DNA samples: Individuals from each of the three species of salmon were sampled from several locations, as shown in Table 1. Total genomic DNA of each species was extracted by the method of BIJN and STAFFORD (1976) for large-scale preparation to establish the genomic library. For the analysis of populations, DNA was extracted from samples of individual fish as follows. One-half gram of liver or a whole fry was ho- mogenized on ice in TNE solution, which contained 10 mM Tris-HC1 (pH 8.0), 100 m~ NaCl and 1 mM EDTA. Lysis buffer, which contained 500 pg/ml proteinase K, 2% sodium dodecyl sulfate (SDS), 10 mM Tris-HC1 (pH 8.0), 150 mM NaCl and 10 mM EDTA, then was added to the solution, with incubation at 50" for 2 to 3 hr. DNA was extracted with phenol and chloroform, washed with chloroform and isoamyl alcohol and collected by ethanol precipitation.

Construction and screening of genomic libraries, subclon- ing and sequencing: Total genomic DNA from chum salmon, pink salmon and kokanee was separately digested with EcoRI for construction of a genomic library for each species. Digests were size fractionated by sucrose gradient (10 to 40%, w/v) centrifugation. DNA fragments of 2 to 4 kilobases were ligated with AgtlO arms (Stratagene, LaJolla, CA) and then packaged in vitro. Scrcening was performed with an [a-"PIGTP-labeled T7 transcript of cloned DNA, designated R-2, that contained the tRNA-related region of the SmaI family as probe. Hybrid- ization was allowed to proceed at 42" overnight in a solution of 50% (v/v) formamide, 6X SSC (SSC is 0.15 M NaCI, 0.015 M trisodium citrate, pH 7), 1% (w/v) SDS in a final volume of 10 ml. Washing was performed in 2X SSC plus 1% SDS at 55" for 80 min. Positive phage clones were isolated and their inserts were subcloned into pUC18 or pUC19. The inserts then were sequenced with primers that corresponded to or were complementary to the consensus sequence for the SmaI family.

Dot blotting and hybridization: For dot-blot hybridization, genomic DNA from each of the three species (20 ng to 10.24 pg) or linearized plasmid DNA (100 pg to 51.2 ng) was ad- justed to 10.24 pg by the addition of mouse genomic DNA as a carrier. After denauration in 0.25 NaOH, each sample of DNA was blotted onto a GeneScreen Plus membrane (Du Pont NEN Products, Boston) with a dot-blotting apparatus (model DP-96; Advantec, Tokyo). The membrane was neutral- ized in a solution of 0.5 M Tris-HCI (pH 7.0) and 1 M NaCl and then it was dried. Hybridization was performed with the R-2 probe described above and was allowed to proceed under the same conditions as the screening. Washing was performed first in 2~ SSC at room temperature for 10 min with constant agitation, and then i n 2X SSC plus 1% SDS at 55" for 60

371 Unique SINEs in Chum and Pink Salmon

TABLE 1

Fish species analyzed

Family Genus Species Common name Geographic source

Salmonidae Oncorhynchus keta Chum salmon Sea of Okhotsk The Amur river in Khabarovsk, Russia The Pacific coast of North America The Chitose River in Hokkaido, Japan The Tokachi River in Hokkaido, Japan

The Chenega Creek in Alaska, United States The Duck River in Alaska, United States Prince William Sound in Alaska, United

The Nishibetsu River in Hokkaido, Japan The Hyoutsu River in Hokkaido, Japan The Tor0 River in Hokkaido, Japan The Syari River in Hokkaido, Japan The Abashiri River in Hokkaido, Japan

gorbuscha Pink salmon Japan Sea

States

nerka adonis Kokanee Lake Shikotsu, Hokkaido, Japan

min with constant agitation and finally in 0.1X SSC at room temperature with constant agitation.

Amplification by PCR When a unit of the family appeared to have been integrated at a single locus within a genome, we synthesized 5' and 3' oligonucleotide primers (OligolOOO DNA synthesizer; Beckman, Fullerton, CA). The sequences are shown in Table 2. The reaction mixtures for amplification by PCR contained Tth buffer (TOYOBO, Tokyo), 0.2 mM dNTPs (Pharmacia, Uppsala, Sweden), 100 ng of each primer, 1 pg of genomic DNA and 2 units of Tth DNA polymerase (TOYOBO) in a final volume of 100 p1. The thermal cycling involved 30 repeats of denaturation at 93" for 1 min, anneal- ing at a particular temperature (as shown in Table 2) for 1 min and extension at 72" for 1 min. The products of PCR were analyzed by electophoresis in 2% (w/v) NuSieve GTG and 1% (w/v) Seakem GTG agarose gels (FMC BioProducts, Rockland, ME).

The nucleotide sequence data reported in this article will appear in the DDBJ database with the following accession numbers: AB001877-ABO01881, AB001921-ABOO1923, and AB001964-AB001976.

RESULTS

Characterization of the sequences in the SmaI family of SINEs: Previous studies in our laboratory showed

that the genomes of chum and pink salmon contain SINEs derived from tRNA',!', designated the salmon SmuI family (MATSUMOTO et al. 1986; KOISHI and OKADA 1991). The sequences of two genomic clones from chum salmon, namely, Sma (OK)-2 and Sma (OK)-3 (where OK stands for 0. ketu) and of two genomic clones from pink salmon, namely Sma (OC)-l05 and Sma (0G)-107 (where OG stands for 0. gorbuscha) were reported in a previous article (Figure 2; MATSUMOTO et al. 1986). Dot hybridization and experiments by PCR in a previous study also demonstrated that this SINE family is confined exclusively to the genomes of these two species (KIL>O et al. 1991).

To obtain more information about the SmaI family of SINEs, we isolated additional clones that contained a SmuI SINE from the genomic libraries of chum and pink salmon and determined their sequences. Figure 2, a and b show a total of 15 sequences of SINEs from chum and a total of 10 sequences of SINEs from pink salmon, respectively. The consensus sequences de- duced from chum and pink salmon were identical. In- terestingly, two subfamilies of the SmaI SINE could be

TABLE 2

Primers for PCR and annealing temperatures

Annealing Locus 5' flanking 3' flanking temperature (")

5' 3' 3' 5' Sma-3 AGGCCCAGAAGCTAGGATAT CCAGTGTGACCACCTGATAC 54 Sma-4 AATCATGAGGAAAGTAGCCG CCCCATACAGAACTAAGACT 55 Sma-21 ATCCTCAGCTTAGGCAACAC ACCCCGTGGTACCCTTTTGA 59 Sma-68 TAGGCTTTAGGAGGGTTCGC CCAGTCTACTTTTGCGCACG 55 Sma-71 TGGCACCTAATTTGAGCCTG TGTCCTTCTCTTCTGTCTAC 59 Sma-80 CCTGTCACATATCGGCCTGT GCAATCAAATGGAGGATACT 55 Sma-105 CTTTCCAGCTCCAGGGTTGGTATTTT GACTTTACGTTCCAAACAGTAGTAC 56 Sma-153 ATGCGCCAACAGTGTGCCTT CTCCCTTTGCAAATGCATAC 60 Sma-171 AACACACGGCACAGGCGTAT TGATCGCAGATACAACGGAA 60 Sma-174 TGCACAACCACCCAACAAAT ACCTCAGTGACACACGTTAG 59

372 N. Takasaki et nE.

a CONSENSUS

1 20 40 60 80

G G T C ~ ~ T A G C T ~ T ~ C ~ ~ ~ T A G ~ ~ G A ~ ~ C ~ C ~ C ~ T A C - G T A ~ ~ A ~ ~

Sma(0K) -2

-(OK) -3 Sma(0K) -4 SmaIOK) -21 Sma IOK) -39 Sma (OK) -41 Sma (OK) -43 SIM (OK) -44 Sma (OK) -51

SmaIOK) -54 %(OK) -66 %(OK) -67 &(OK)-68 Sma(OK)-71 Sma(OK)-80

~..............................................-...............T.................-.......-.......... G] ................................ t ............................. c ....................................

ttcttggttgtcat ......................................................................................................... tgacattgttaatgtgacaa ----..........................................................T.................-..................

gatataggcattgag ~ . . . . . a......................................... .... ...........ct. .................................. t g g t c c t t g t g ~ . . .................................................. ...-...-..T-..... .............................. ggaggcagtct ~.................................a.-........... ..... ........-.T.. ..................................

atcaactggtctgcc btaca1..-..**.*....................................................~. ..... ..a........-...... ............ a a a t t g a g t t a t g ~ t .................................................... ..........T. ................................... ctgcgttcattgtac ~....................................-..-.....a .... ...........~..............a.t-........ .......... atgttctctgcct ............................................... .... ............C.................-.-................

actaacacaaaaaa ...................................................................................................

acatttattgt .............................................. ................ T............ ........................ catttgtttattaggc .......................................................................................................

accttatatgttcaga bta---..*.*..-...-..............-.-.--..--......................~................--.-................ 100 120 140

CONSENSUS 'IGACTGTAA~TAM+AGCGIT7GCTAAAAGCOICTGCTATA"I!-A"I!-AT

SmaIOK)-2 SmaI0K)-3 slra (OK) -4 -(OK) -21 %(OK) -39 Sma(0K) -41

Sma(0K) -43 SIM (OK) -44 Sma(OK)-51 Sma (OK) -54

Sma(OK)-66 SmaIOK) -67 %(OK) -68 Sma(OK)-71

Sma)OK) -80

.......... '.....................................--..-..tatattattatattattattattattattatatatatbt .......... '......-..............................-...-..attattattatat~~~gttttctatggata

....................--.-..*-.-*-***............-...-.-atat attac gtgtgctctaaaatatqgggtatgtcttgattctq a .......... a..................................... --..-..tattattaactgttgttcatcgaatgattaaagtttctaattgtgtgat

................................................-...-..tattattattattattaaactctgcaactgatttaaagtc~~ ......................................... t. ............ t a t t ~ a c a t c g c a g g t g g g ~ ~ t g a c a c a c t a a g

................................................t...-..att t gagcagtct

... a...........-................................-...-..tatt~tatttcggaagataacacaaaaaca

La ....................................... .........--..-..atatatttt~gaa ........ t........................g..............-...-..attttatattattaatatagcgatttcaaactgaaattcattgtctttctcagtcaca ....................................................... atattattata(att)atattattatattattattattagtat6(att)atattactqkgcagt ....................................... r-.--....-...-..atatt~ttccaactcaaatgacacaaaagtattctattacc~atgtt~gggtaaagaat .......................................... r.....-...-..tatatattattatctqqktgtagctcaggt

................................................-...-..tatattattategttttktctgttacttgaactctgtgaagcattta

................................................-...-..tattattattgaaaact~ctgacggca

FIGURE 2.-A compilation of sequences of members of the SmaI family isolated from genomic library of chum salmon and pink salmon, respectively. The general consensus sequence was deduced from the alignment of 25 members of the SmuI family and it is shown at the top of the alignment. The tRNA-related region of the family is underlined. Nucleotides identical to those in the consensus sequence are indicated by dots, and gaps introduced to maximize alignment are indicated by bars. Direct repeats flanking the SmuI SINE are boxed. a and b show the members of the SmuI family isolated from the genomic libraries of chum salmon and pink salmon, respectively. Sma (0G)-105 and Sma (0G)-107 formerly Sma (0G)-5 and Sma (0G)-7, respectively isolated from pink salmon have been described previously (KIDO et al. 1991 ).

observed in both species. The SmuIT subfamily contains a T at position 63, and the SmuIC subfamily has a C at the same position. The average sequence divergence calculated for the SmuIT subfamily was 0.67% and that for the SmuIC subfamily was 0.43%, suggesting that the SmnIT subfamily might be slightly older than the SmuIC subfamily.

To estimate the number of copies of members of the SmuI family in the genomes of chum and pink salmon, we performed the dot hybridization using a T7 tran- script of the tRNA-related region of the DNA clone, designated R-2, as the probe. As shown in Figure 3, the intensity of the hybridization signal for chum was almost the same as that for pink salmon. Moreover, 0.32 pg of DNA from chum or pink salmon gave a spot of the same intensity as 12.5 ng of R-2 DNA. Assuming that the genome of salmon is 2 X IO9 base pairs (bp) in length, we can infer that chum and pink salmon each

have 2.6 x lo4 copies of the SmuI SINE, judging from the intensities of spots on the autoradiogram. In the case of kokanee, which is the species of Oncorhynchus that is most closely related to both chum and pink salmon in this genus, only a weak signal was detected, suggesting that - 100 copies of the SmuI SINE-related sequence might be present in the genome of kokanee. We isolated seven DNA clones from a genomic library of kokanee using R-2 DNA as the probe, and we found that they exhibited weak similarity to the consensus se- quence of the SmuI SINEs (data not shown; see the accompanying article by HAMADA et ul. 1997). These results confirm our previous conclusion that the ampli- fication of the SmuI family is confined to chum and pink salmon.

All the SmuI SINEs exhibit species-specific insertions in each species and there were no shared insertion sites between the genomes of chum and pink salmon: The

Unique SlSEs in Chr~m and Pink Salmon 373

b CONSENSUS

1 20 40 60 BO

G G T ~ A ~ A G I T G G T A G A G C A T G G C G C I T G T A

S m a ( C G ) -105 Sma (E) -107 % ( ' X ) -144 S m a ( C G ) -145 S m a ( C G ) -152 Sma (E) -153 Sma(CG)-162 Sma ( C G ) -168 9 M ( C G ) -171 S m a ( C G ) -184

CCcaCCt........................................-............t........T......-.-............-....-........

cggaagtttccttctggt......c..............................+..+~...........~..~..~..T.......~~.................+......+. gaattgttttttgtttac ------.....................................................a..C................................... agcaaccactgc ~--------........c............................................~................................... tcacaataggctta ........................................................................................................ catggtgccat ~......-........ ................................................................................... atgatctataagttgtqt................................................a.............C...................................

tcataaaccatc ....................................................... a..........a..~................................... ag .............................................................. T...... .............................

tttaatgtgga ......................................... tt...................~................................... 100 120 140

CONSENSUS n;ACPGTAAGPCGCm?T;GATAAAAGCGICII;-CTATA~A~-AT

Sma(E) -105 ....................-..........--...-...............-..tattatattagataaaatttcagtttatgacgggatataa

Sm(CG)-107 ......................................... a . . . . . . . . . . - . . t a t a t t a a a g t t t a c a t a c a c c t t g g c c a t t t a a Sm(CG) -144 ............ ~..-................-...................--.tattatatgattccatgtgtgttatctcatagttttgatgtcttcaccattat Sma(oG)-145 ....................................................... tatt~gttgaagtcgaagtttacatacat~taggttggagtca w ( x ) - 1 5 2 ................................-...............-..--~.22(at)agagagaggctggactgaggqct~ggcc Sma(X)-153 ................................-...............-.-----~tcactgagctcttcagtaatgccaatctactgccaatgtttgt -(m)-162 .........................-.....-......+tagctatc

Sma(oG)-168 ....................................................... tattattattattattaatactg~~gacatgaacttagacattgtttcgctctctctcat Sma(oG)-171 .......................... a....+a...................t..tatatatt~tgtc W ( E ) - 1 8 4 ...............-................-...................-..t~qtttttgtttttttaat=acaaa

FK:I'KF. ! ? . - C i ~ t ; n ~ /

distribution of members of the S~ntr I family of SINEs within chum and pink salmon can be interpreted as an indication that the Sn~nl family was generated and amplified in a common ancestor of chum and pink salmon. To examine this hypothesis, we performed PCR experiments to estimate the time of retroinsertion of each member of the S?nd family of SINEs. M'e detcr- mined the .i'- and 3"flanking regions of each StnnI se- quence and synthesized two primers that flanked the unit, as shown in Table 2. M'e then performed the PCR using genomic DNA from chum, pink and kokancAe salmon as templates. If the SrntrI SINEs had been gener- ated in a common ancestor of chum and pink salmon,

wc would expect that SINEs would be commonly pres- ent at orthologous loci in the genomes of these two species.

To our surprise, all the S m d SINEs at 10 genomic loci that we examined exhibited species-specific inser- tions in each species and there were no shared insertion sites betwcen thcsc hvo species (Figures 4 and .5). For example, Figure 4a shows the results of PCR for the Smtr-4 locus, isolatcd from the genomic library of chum salmon. The primers amplified a DNA fragment of 310 bp whcn thc S m I unit was present (a black arrowhead in Figure 4a) or a fragment of 160 bp in the absence of thc SINOI unit (a white arrowhead in Figure 4a). I n

10.24 5.12 2.56 1.28 0.64 0.32 0.16 0.08 0.04 0.02 pg

(51.2) (25.6) (12.8) (6.4) (3.2) (1.6) (0.8) (0.4) (0.2) (0.1) ng

FKX.RF. 3.-Dot-hlot hybridization for the dctcrmination of the numbers o f copies of . Y r r w l sequences in chum salmon, pink salmon and kokanee. Dot hyhritlization experiments were performed using I~~hc~lccl RNA that had heen transcribed by T i RNA polymerase from t h e tRS .h" l ;md rcgion ol'Sma (OK)-!?. The prohe was tlrsignatrtl R-2 (residues 1-68). The numhers indicated ahow the photograph show the amount of' gcnomic DNA o f rach sprcics t h a t was usrd. Thc nwnhcrs in parenthcses show the amor~nts of the K-2 plasmid, which was used as the standard.

374 N. Takasaki e( nl.

sia: 310- I

FIGURE 4.-(:llar~tctc.1-iz;lrion 01' the t S m d SINES that were species-specifically retroinserted in the genome of chum salmon. Products of PCR were analyzed hy electrophoresis in agarose gels. Loci of Smn-4 (a), Smn-3 (h), Smn-PI (c), Sma- 68 (d), Smn-71 (e) and Smn-80 (0 contained members of the Smnl family of SlNEs that had been specifically integrated into the genomes of chum salmon. Black and white arrowheads indicate positions of DNA with and without a unit of the SmnI SINE, respectively. Lengths of DNA fragments are indicated in hase pairs.

this case, only the genome of chum contained the SmaI SINE at this locus. Similarly, at the other five loci iso- lated from the genomic library of chum, namely, Sma- 3, -21, -68, -71 and -80, each member of the SmaI family of SINEs was found to be present specifically only in the genome of chum (Figure 4, h-0. By contrast, at four loci isolated from a genomic library of pink salmon, namely, Smn-105, -153, -I 71 and -184, the SmaI SINEs were found to be present specifically and exclu-

(a) Sma-105

S l o p 3 6 O P

1 2 3 4 5 1 2 3 4 5

(b) Sma-153

460) 210 P

: 4 420 r FIGURE 5.-Retroinsertion of Smd SINEs specific to pink

salmon. Loci ol' Sma-IO5 (a), Sma-153 (h), Smn-I71 ( c ) and Smn-184 (d) all contained memhers of the SmnI family of SINEs that had been specifically integrated into the genomes of pink salmon. Black and white arrowheads indicate positions of DNAwith and without a unit of the Smnl SINE, respectively. Lengths of DNA are indicated in base pairs.

sively in the genome of pink salmon (Figure 5, a-d). The sequences at each Sma-105 locus in both chum salmon and kokanee were determined, and they con- firmed the species-specific retroposition in pink salmon (data not shown).

In all, we analyzed 23 genomic loci isolated from chum and pink salmon as described above, but we failed to isolate any orthologous loci at which SmaI SINEs were commonly found in both chum and pink salmon (data for the remaining 13 loci were not shown). We certainly did not expect such extensive interspecific variation of insertion of the SmaI SINEs. Although our results do not necessarily exclude the possibility that the SmaI family might have been generated in a common ancestor of chum and pink salmon, they do suggest a new scenario wherein the SmaI SINEs were amplified independently in the respective lineages of chum salmon and pink salmon after their divergence (see DISCUSSION).

The SmaI SINEs specific to chum are dimorphic among populations of this species: At three loci (Sma- 3, -71 and -8O), the insertions of SmaI SINEs were dimor-

Unique SINEs in Chum and Pink Salmon 375

1 2 3 4 5 6 7 8 9101112

B Sma-80

FIGURE &-The SINE unit that was specifically retroin- serted in chum salmon appears to be polymorphic among populations of this species. Loci of Sma-4 (a) and Sma-28 (b) contained or did not contain members of the Smd family of SINEs that had been specifically integrated into the genomes of 10 individual chum salmon. Ten individual chum salmon were collected from the Amur River in Khabarovsk, Russia, in 1993 (lanes 1-10). Black and white arrowheads indicate positions of DNA with and without a unit of the SmnI SINE, respectively. Lengths of DNA are shown in base pairs.

phic in the individual chum salmon sampled from the Okhotsk Sea (Figure 4b, e and 0. To examine whether the insertions of six SmaI SINEs described in the previ- ous section were fixed or dimorphic among each popu- lation of chum, we analyzed DNA from 10 individual chum salmon from four regions: the Amur River in Khabarovsk, Russia; a variety of locations on the Pacific coast of North America; the Chitose River in Hokkaido, Japan; and the Tokachi River in Hokkaido, Japan. As examples, we show in Figure 6, a and b, respectively, the results of PCR with the Sma-4 locus and with the Sma-80 locus for individual chum salmon from the Amur River. In the case of the Sma-4 locus (Figure 6a), individuals were scored as homozygous (+/+; lanes 2, 6 and IO), or heterozygous (+/-; lanes 1,4, 5 and 7) for the presence of the 310-bp band (+) or homozygous (-/-; lanes 3,s and 9) for the presence of the 160-bp band (-). The results indicated that the SmaI SINEs at the Sma-4 locus were highly dimorphic among individu- als in the Amur River in Khabarovsk, Russia. To confirm that orthologous loci were faithfully amplified in these cases, we determined, for example, sequences for the 160-bp band (-) in lanes 1 and 3, as shown in Figure 7. In the case of the Sma-80 locus (Figure 6b), three of 10 individuals were scored as heterozygous (+/-; lanes 2 , s and 10) and the other seven were scored as homozy- gous (-/-; lanes 1, 3, 4, 5, 6, 7 and 9). In this case,

the extent of fixation of the SmaI unit was low as com- pared with that of the Sma-4 locus. The intraspecific polymorphism of the SmaI SINEs at the Sma-4 locus and at the Sma-80 locus was also observed among the other populations of chum, although the extent of fixation differed among populations (see the columns labeled Sma-4 and Sma-80 in Table 3). Moreover, all the SmaI SINEs at the other four loci were polymorphic among the four populations of chum that we examined. The genotypes, expected values and allele frequencies of chum-specific loci were determined by PCR analysis, and they are summarized in Table 3. Of these six loci, two, namely, the Sma-68and Sma-3 loci, are of consider- able interest. In the case of the Sma-68 locus, the fre- quency of insertions in the population in the Amur River was 0.2, whereas the value for the population from the Pacific coast of North America was 0.9, revealing a significant difference in the extent of insertions be- tween the two populations. In the case of the Sma-3 locus, there were no insertions of the SmaI SINEs in the populations from the Chitose and Tokachi Rivers in Hokkaido, Japan, whereas the frequency of insertions in the population from the Pacific coast reached 0.4. These results suggest the possibility that analyses of the frequencies of insertions of the SmaI SINEs might be useful for population studies of chum salmon (see DIS CUSSION).

The SmaI SINEs specific to pink salmon are fixed among populations of this species: We collected sam- ples of pink salmon from various locations in Japan and Alaska (United States), and we assayed for the presence of SINE insertions at four species-specific loci (Sma-I 71, - 184, -105 and -153). The results of PCR demonstrated that these units were fixed in all the populations of pink salmon examined (Figure 8 and data not shown). Pink salmon have a rigid 2-yr anadromous life cycle and excep tions to this pattern are exceedingly rare. The temporal separation resulting from the life cycle of this species has actually produced two genetically distinct lines, which spawn in even and in odd years, respectively (GHARRETT d al. 1988). However, we found no genetic variations among the four SmaI loci that were specific to pink salmon between even- and odd-year populations of pink salmon (data not shown). In contrast to the SmI SINEs that are specific to chum, all SmaI SINEs specific to pink salmon that were examined appear to be fixed among populations of this species.

DISCUSSION

The present study confirmed our previous conclusion that the SmaI family of repeats is confined to the two species in the genus Oncorhynchus, namely, chum and pinksalmon (&DO et al. 1991; KOISHI and OKADA 1991). The number of copies of SmaI SINEs in the genomes of the two species is almost identical. These two sets of observations suggest that the SmaI SINEs were gener- ated in a common ancestor of chum and pink salmon.

376 N. Takasaki et al.

Sma (OK) -4 m G A A G G - TTTTGGGCCCTTTTTTAGACTTAAACATACCTCCTGTACCTCCTGTAATGTAGACCCTATGATCTGTGAACTGTACAT TCTTGGGCCC-TTTTTAGACCTAAACA----------TAATGTAGACCCTATGATCTGTGAAC~TACAT TTTTGGGCCC-TTTTTAGACCTAAACA----------TAAGACCCTATGATCTGTGAACTGTACAT

Amur-1 Amur-3 ......................... ............................. Sma (OK)-4 G G A A C A G T T A A C T T C T T G G T C T C A T T A T A C T C C T T C T G T A T T Amur-1 GGAATGTACAGTTAACATCTTGGTGTCATTATACTCATTATACTCCT---------------------------------------------------- Amur-3 GGAACAGTTAACATCTTGGTCATTATACTCCT---------------------------------------------------- .................................. Sma (OK)-4 CGATCCCCGGGACCACCCATACGTAGAATGTATGTATGCACACATGACTGTAATGTAGTCGCTTTGGATARRAGCGTCTGCT~T~CATATA Amur-1 Amur-3

...........................................

...........................................

Amur-1 Sma (OKI-4 TTATTATATATATATTACAGTGTGCTCTAAAATATGGGGTATGTCTTGATTCTGA

Amur-3 """""""_ TACAGTGTGCTCTARRATAT

TACAGTGTGCTCTARRATAT """""""_ .................... FIGURE 7.-The short DNA fragments were faithfully amplified by PCR from the orthologous loci. Amur 1 and Amur 3

indicate the sequences of 160-bp fragment DNA in lanes 1 and 3 of Figure 6a. The sequence for Sma-4, which contains a unit of the SmaI SINE, was shown at the top line. Gaps are indicated by bars, and dots indicate identical nucleotides among these three sequences. Primer sequences are underlined.

We were therefore surprised to find no shared insertion sites between chum and pink salmon. The fact that we found the chum salmon loci to be polymorphic for SINE insertions and that the pink salmon loci were not only added to the mystery. Thus, at present, we cannot conclude that the SmuI family was generated in the common ancestor of the two species. We can, however, propose several possible models to explain the interspe- cific and intraspecific variation of the insertion of SmuI SINEs in chum and pink salmon.

In general, a SINE is believed to be generated in the genome of one individual and to spread into the population through sexual reproduction and genetic

drift. If the two species diverged before a site became fixed for the SINE insertion, that site might be polymor- phic between the resulting species. If such were the case for chum and pink salmon, and if the time required for fixation in the genome of chum salmon were long because of a large population size, as illustrated in Fig- ure 9a, there might be no shared insertion sites between chum and pink, and SINEs might also be intraspecifi- cally polymorphic in the genome of chum salmon. In this model, we hypothesize that most SmuI SINEs were amplified in a common ancestor of pink and chum. However, we recently demonstrated both that many members of the HpuI family of repeats, another family

TABLE 3

Distribution of members of the SmaI family that are specific to chum salmon

Population Locus Sma-3 (C) Smu-4 (C) Sma-21 (T) Sma-68 (T) Sma-71 (C) Sma-80 (C)

The Amur River in Khabarovsk, Russia ++ 0 (0.625) (0.25) 3 (2.5) (0.5) 1 (1.6) (0.4) 0 (0.4) (0.2) 0 (0.225) (0.15) 0 (0.2251 (0.15)

+- 5 (3.75) 4 (51 6 (4.8) 4 (3.2) 3 (2.55) 3 (2.55) " 5 (5.625) (0.75) 3 (2.5) (0.5) 3 (3.6) (0.6) 6 (6.4) (0.8) 7 (7.225) (0.85) 7 ('7.225) (0.85)

The Pacific coast of North America ++ 0 (1.6) (0.4) 4 (3.6) (0.6) 3 (2.5) (0.5) 9 (8.1) (0.9) 0 (0.225) (0.15) 1 (1.225) (0.35)

+- 8 (4.8) 4 (4.8) 4 (51 0 (1.8) 3 (2.55) 5 (4.55) " 2 (3.6) (0.6) 2 (1.6) (0.4) 3 (2.5) (0.5) 1 (0.1) (0.1) 7 (7.225) (0.85) 4 (4.225) (0.65)

The Chitose River in Hokkaido, Japan ++ 0 IO) (0) 1 (0.9) (0.3) 3 (3.6) (0.6) 6 (6.4) (0.8) 0 (0.1) (0.1) 0 (1.2251 (0.35)

10 (10) (1) 5 (4.9) (0.7) 1 (1.6) (0.4) 0 (0.4) (0.2) 8 (8.1) (0.9) 3 (4.2251 (0.65) +- 0 (0) 4 (2.1) 6 (4.8) 4 (3.2) 2 (1.8) 7 (4.55) "

The Tokachi River in Hokkaido, Japan ++ 0 (01 (0) 4 (3.025) (0.55) 1 (2.5) (0.5) 0 (2.5) (0.5) 0 (0.225) (0.15) 0 (0.625) (0.25)

10 (10) (1) 3 (2.025) (0.45) 4 (2.5) (0.5) 0 (2.5) (0.5) 7 17.225) (0.85) 5 (5.625) (0.75) +- 0 (0) 3 (4.95) 5 (5) 10 (5) 3 (2.55) 5 (3.75) "

Each genotype is followed by expected number in braces and allele frequency in parentheses. The letters C and T after the name of locus indicate members of the SmaIC subfamily and the SmaIT subfamily inserted at each locus, respectively.

Unique SINEs in Chum and Pink Salmon 377

(s & e 8nnnnnnr-V p 9

< e 49

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 1920 21 22 23 2425 26 27 28- Sma-171

380,

FIGURE %-The SINE unit that was spccifically retroinserted in pink salmon appears to he fixed among populations from various locations. Individual pink salmon were collected from the Cllenega Creek (lanes 2-6) and the Duck River and Prince William Sound in Alaska (lanes 7-11); and the Nishihetsu River (lanes 12-14), the Hyoutsu River (lanes 15-17), the Toro River (lanes 18-20), the Syari River (21-23) and the Ahashiri River (lanes 24-26) in Hokkaido, Japan. Lengths of DNA are shown in base pairs. Black and white arrowheads indicate positions of DNA with and without a unit of the SmaI SINE, respectively.

of SINEs that is present in all species in the subfamily Salmoninae ( I n 0 et ul. 1991), have been amplified species specifically in chum and pink, and that they are all fixed among each species (TAKASAKI et al. 1994, 1996). Therefore, we can conclude that the period be- tween the divergence of these two species and the pres- ent time was long enough for SINEs to have become fixed among populations. In other words, the SINEs that exhibit the intraspecific polymorphism in the ge- nome of chum salmon are relatively young so that they were not those amplified in a common ancestor of chum and pink salmon. Namely, the model shown in Figure 9a can not explain consistently both data that we obtained in the present study and those in previous studies.

An alternative scenario (Figure 9b) is a modification of the first model. The active gene of the SmuI family of repeats was generated in a common ancestor of the two species as was postulated in the first model. In the lineage of chum salmon, however, amplification events occurred successively until quite recently, causing the intraspecific polymorphism of SINEs in chum. How- ever, in the lineage of pink salmon, the amplification of SINEs ended at an early stage after divergence, such that all the SINEs remained fixed in all populations. To prove this hypothesis, we must isolate and characterize a few SmaI SINEs that were amplified in a common ances- tor of the two species and that are commonly present at orthologous loci in chum and pink salmon.

The models described in Figure 9, c and d, involve horizontal transfer or introgression of SINEs from one species to the other. Horizontal gene transfer means the transfer of a gene from one species to the other without sexual reproduction, whereas introgression in- volves hybridization of two different species, followed

by transfer of nuclear DNA or mtDNA. In these scenar- ios, the SmuI SINEs were first amplified species specifi- cally in the lineage of pink salmon, and all the units were fixed among the populations of pink salmon, since the amplification was such an ancient event that the SINEs were fixed in the populations. Relatively recently during evolution, the SmaI SINEs were transferred from pink to chum salmon through horizontal gene transfer or introgression. The intraspecific polymorphism of SINEs in chum can be explained by this recent transfer.

With respect to introgression, several individuals gen- erated by hybridization between chum and pink salmon were isolated from the Pacific ocean (K. NUMACHI, un- published results), so it is possible that SINEs were transferred also through introgression. Hybridization and gene introgression, which sometimes follow poly- ploidization and generate alterations in the genetic constitution of populations, are generally more wide- spread in plants than in animals. However, the number of reported cases of introgression in animals is steadily increasing (HARRISON 1990; ARNOLD 1992; SMITH 1992). SMITH (1992) and STEARLEY and SMITH (1993) suggested that introgression of mtDNA occurred be- tween chum and pink salmon during evolution on the basis of the incongruence between the phylogenetic relationships deduced from the analysis of mtDNA (the phylogenetic tree shown in Figure la; THOMAS et al. 1986; GINATULINA et al. 1988) and that deduced from analysis of morphology and allozymes (the phylogenetic tree shown in Figure 1 b; U-ITER et dl. 1973). Hybridiza- tion has generally been examined by contrasting the phylogenies inferred from analyses of allozymes and mtDNA because mtDNA is apparently more susceptible to interspecific gene flow than is nuclear DNA (AUBERT and SOLICNAC 1990; RIESEBERC and SOLTIS 1991; Dow-

N. Takasaki et al.

(c) m

L f chum salmon chum salmon

horizontal transmission or

introgression

pink salmon pink salmon

t- kokanee kokanee

m + t + + t + chum salmon (a) kokanee

+t+

+ w + + pink salmon U pink salmon U 1 horizontal transmission or introgression

kokanee I chum, salmon

FIGURE 9.-Possible models explaining the interspecific and intraspecific variation of the SmaI family of SINEs. Black arrows indicate the time of amplification of the SmaI SINEs. Square brackets indicate the time required for the SINEs to be fixed within a species. The phylogenetic trees shown in a-c reflect the data obtained by analysis of mtDNA (THOMAS et ul. 1986; GINATULINA et al. 1988) and of life history (HOAR 1958). The phylogenetic tree shown in d reflects the data from analysis of morphology (STEARLEY and SMITH 1993) and allozvmes (UTTER et al. 1973). White thin arrows in c and d, respectively, indicate the direction of transfer of members of the SmuI family. '

LING and DEMARAIS 1993). However, hybridization has not prevented the introgession of nuclear DNA. In Daphnia, evidence of nuclear introgression has been found together with evidence of the introgression of mtDNA (TAYLOR and HEBERT 1992). In general, it is difficult to detect the extensive introgression of nuclear DNA by analysis of allozymes except in the case of hy- bridizing populations in a hybrid zone. Studies with random amplified polymorphic DNA (RAPD) markers have demonstrated examples of the introgression of nuclear DNA (STEIT et ul. 1994). Moreover, evidence of intergenomic introgression was recently reported from a study of an unusual ribosomal DNA sequence in allo- polyploid cottons (WENDEL et ul. 1995). For the reasons stated above and in view of the existence of the chum- pink hybrids captured in the wild, it appears possible that introgression of nuclear DNA, in general, which could not be detected by analyses of allozymes, oc- curred between chum salmon and pink salmon through hybridization and, moreover, that the Smd family of repeats generated in the lineage of pink salmon could have been transferred into the genome of chum salmon. If such is the case, because of the fixation of the SmuI SINEs among the populations of pink salmon

and the intraspecific polymorphism of the SmuI SINEs in chum salmon, we can assume that the introgression of the SmuI family of repeats occurred from pink salmon to chum salmon. This assumption is consistent with the direction of introgression of mtDNA that SMITH (1992) suggested on the basis of the sequence divergence of mtDNA. At present, the possibilty of in- trogression allows us to interpret all the phenomena related to the SmuI family that are described in the present report without any incongruity.

If horizontal transfer or introgression of the Smd SINEs occurred from pink to chum salmon, the sister relationship between chum and pink salmon (Figures l a and 9c), which was assumed from the presence of the SmuI SINEs in both species (MURATA et ul. 1993), must be reconsidered. In this case, a phylogenetic rela- tionship in which pink salmon and kokanee have a sister relationship (Figures l b and 9d) is also possible. Such a relationship was suggested from analyses of osteologic data (SMITH and STEARLEY 1989; STEARLEY and SMITH 1993) and allozymes (UTTER et uZ. 1973). To elucidate the phylogenetic relationships of chum, pink and ko- kanee salmon, more detailed studies are required.

In general, within the many SINE sequences of sev-

Unique SINEs in Chum and Pink Salmon 379

era1 families of SINEs examined to date, intraspecific polymorphism of SINEs is very rare and most SINEs are found to be fixed in all the populations of one species (TAKASAKI et al. 1994, 1996). On the basis of this feature of SINEs, we can reconstruct phylogenetic relationships using SINE insertions (MURATA et al. 1993,1996). It has been reported, however, that the insertion of a very few members of the Alu family in the human lineage is polymorphic among human populations ( BATZER and DEININCER 1991; BATZER et al. 1991, 1994; PERNA et al. 1992), and this polymorphism might be useful for stud- ies of the structure of human populations. In the pres- ent study, we found that insertion of the SmaI SINEs was polymorphic among the populations of chum salmon. Extensive intraspecific polymorphism of the SmaI SINEs in chum salmon might also provide a useful and conve- nient method for the determination of population structures of this species. In paticular, the Sma-3 SINE was found in genomes of chum salmon from the Amur River in Russia and the Pacific coast or North America, whereas it was absent from genomes of chum salmon from Japanese rivers. Since it is known that chum salmon return to their natal rivers with greater reliabil- ity than other salmon species (GROOT and MARGOLIS 1991), this kind of locus might be useful for identifying the origin of chum salmon caught in the Pacific ocean.

The authors are grateful to Drs. MINEO SANEYOSHI and SHIGEHIKO URAWA for gifts of salmon samples. This work was supported by a Grant-in-Aid for Specially Promoted Research from the Ministry of Education, Science and Culture ofJapan.

LITERATURE CITED

ARNOI.D, M. L., 1992 Natural hybridization as an evolutionary pro- cess. Annu. Rev. Ecol. Syst. 23: 237-261.

AUBERT, J., and M. SOLIGNAC, 1990 Experimental evidence for mito- chondrial DNA introgression between Dro.yophila species. Evoln- tion. 44: 1272-1282.

BATZER, M. A,, and P. L. DEININGER, 1991 A human-specific subfam- ily of Alu sequences. Genomics 9: 481 -487.

BATZER, M. A,, V. A. Guor, J. C. MENA, D. W. FOL.TZ, R. J. HERREA et al., 1991 Amplification dynamics of human-specific (HS) alu family members. Nucleic Acids Res. 19: 3619-3623

BATZER, M. A,, M. STONEKIN(;, M. ALEGRIA-HARTMAN, H. BAZEN, D. H. KASS et al., 1994 African origin of human-specific polymorphic Alu insertions. Proc. Natl. Acad. Sci. USA 91: 12288-12292.

BI.IN, N. and D. W. SrAFFORD, 1976 A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res. 3: 2303-2308.

DEININGER, P. L. and M. A. BATZER, 1993 Evolution of retroposons, pp. 157-196 in Evolutionary Biology, Vol. 27, edited by M. K. HECHT et al. Plenum Press, New York.

DERAGON,J.-M., B. S. LLUDRY, T. PELISSIER, S. TUTOIS, S. TOURMENTE rt al., 1994 An analysis of retroposition in plants based on a family of SINEs from Brassica napus. J. Mol. Evol. 39: 378-386

DOWI.ING, T. E., and B. D. DEMARAIS, 1993 Evolutionary significance of introgressive hybridization in cyprinid fishes. Nature 362: 444- 446.

FERGUSON, A., and C. C. FLEMING, 1983 Evolutionary and taxonomic significance of protein variation in the brown trout (Salmo trurra L.) and other salmonid fishes, pp. 85-99 in Prot&z Polymorphism: Adaptive and Taxonomic Significance, edited by G. S. OXFORD, and D. ROI.I.INSON. Academic Press, London,

GHARRETT, A. J., C. SMOOT and A. J. MCGREGOR, 1988 Genetic rela-

A m . Fish. Soc. 117: 536-545. tionships of even-yesr northwestern Alaskan pink salmon, Trans.

GINATLU INA, Id. R, S. V. SHEDKO, I. L. MIROSHNICHENKO and A. A.

GINATUI.IN, 1988 Sequence divergence in mitochondrial DNA from the Pacific salmons. Zhurnal Evolyusionnqy Biokhimii Fizio- logzi. J. Mol. Biol. Physiol. 24: 477-483 (in Russian).

GROOT, C., and L. MARGOLIS (Editors), 1991 Pacz$c Salmon Lifp Hi.y- tories, UBC Press, Vancouver, British Columbia, Canada.

HAMADA, M., Y. KIDO, M. HIMBERG, J. D. REIST, Y. CAO rt ab, 1997 A newly isolated family of short interspersed repetitive elements (SINEs) in coregonid fishes (whitefish) with sequences that are almost identical to those of the SmaI family of repeats: possible evidence for the horizontal transfer of SINEs. Genetics 146 355- 367.

HARRISON, R. G., 1990 Hybrid zones: windows on evolutionary pro- cess. Oxf. SUN. Evol. Biol. 7: 69-127.

HOAR, W. S., 1958 The evolution of migratory behaviour among juvenile salmon of the genus Oncorhynchus. J. Fish. Res. Board Can. 15: 391-428.

J A G ~ E E S W A R E N , P., B. G. FORGET and S. M. WEISSMAN, 1981 Short interspersed repetitive DNA elements in eucaryotes: transposable DNA elements generated by reverse transcription of RNA pol I11 transcripts? Cell 26: 141-142.

KIDO, Y., M. AONO, T. YAMAKI, K. MATSUMOTO, S. MURATA et al., 1991 Shaping and reshaping of salmonid genomes by amplification of tRNAderived retroposons during evolution. Proc. Natl. Acad. Sci. USA 88: 2326-2330.

KIDO, Y., M. HIMBERG, N. TAKASAKI and N. OK4DA, 1994 Amplifica- tion of distinct subfamilies of short interspersed elements during evolution of the Salmonidae. J. Mol. Biol. 241: 633-644.

&DO, Y., M. SAITO, S. MURATA and N. OKADA, 1995 Evolution of the active sequences of the Hpal short interspersed elements. J. Mol. Evol. 41: 986-995.

KOISHI, R., and N. OKADA, 1991 Distribution of the salmonid Hpa I family in salmonid species demonstrated by in vitro runoff tran- scription assay of total genomic DNA a procedure to estimate repetitive frequency and sequence divergence of a certain repeti- tive Family with a few known sequences. J. Mol. Evol. 32: 43-52.

MATSUMOTO, R, K. MURAKAMI and N. OKADA, 1986 Gene for lysine tRNA, may be a progenitor of the highly repetitive and transcri- babk sequences present in the salmon genome. Proc. Natl. Acad. Sci. USA 83: 3156-3160.

MOCHIZUKI, R, M. UMEI)A, H. OHTsUBOand E. OHTSUBO, 1992 Char- acterization of a plant SINE, p-SINEI, in rice genome. Jpn. J. Genet. 67: 155-166.

MURATA, S., N. TAKASAKI, M. SAITOH and N. OKADA, 1993 Determina- tion of the phylogenetic relationships among Pacific salmonids by using short interspersed elements (SINEs) as temporal land- marks of evolution. Proc. Natl. Acad. Sci. USA 90: 6995-6999.

MURATA, S., N. TAKASAKI, M. SAITOH, H. TACHIDA and N. OKADA, 1996 Details of retropositional genome dynamics that provide a rationale for a genetic division: the distinct branching of all the pacific salmon and trout (Oncorhynchus) from the Atlantic salmon and trout (Salmo). Genetics 142: 915-926.

OHSHIMA, It, R. KOISHI, M. MATSUO and N. OKADA, 1993 Several short interspersed repetitive element (SINEs) in distant species may have originated from a common ancestral retrovirus: charac- terization o fa squid SINE and a possible mechanism for genera- tion of tRNAderived retroposons. Proc. Natl. h a d . Sci. USA 90:

OKADA, N., 1991a SINEs: Short interspersed repeated elements of the eukaryotic genome. Trends Ecol. Evol. 6: 358-361.

OKADA, N., 1991b SINEs. Curr. Opin. Genet. Dev. 1: 498-504. OKADA, N., and K. OHSHIMA, 1995 Evolution of tRNAderived

SINEs, pp. 61 -79 in The Impact of Short Interspersed Elements (SINES) on the Host Genomr, edited by R. MAKAIA. R. G. Landes Company, Austin, TX.

PERNA, N. T., M. A. BATZER, P. L. DEININCER and M. STONEKING, 1992 Alu insertion polymorphism: a new type of marker for human population studies. Hum. Biol. 6 4 641 -648.

PHILLIPS, R. B., K. A. PLEV~E and M. R. BROWN, 1992 Salmonid phy- logeny inferred from ribosomal DNA restriction maps. Can. J. Fish. Aquat. Sci. 49: 2345-2353.

RIESEBERG, L. H., and D. E. SOI.TIS, 1991 Phylogenetic conse- quences of cytoplasmic gene flow in plants. Evol. Trends Plants

ROGERS, J. H., 1985 The origin and evolution of retroposons. Int.

SCHMII), C. and R. MARAIA, 1992 Transcriptional regulation and

6260-6264.

5: 65-84.

Rev. Cytol. 93: 187-279.

380 N. Takasaki et al.

transpositional selection of active SINE sequences. Curr. Opin. Genet. Dev. 2: 874-882.

SHEDLOCK, A. M., J. D. PARKER, D. A. CRISPIN, T. W. PIETSCH and G. C. BURMER, 1992 Evolution of the salmonid mitochondrial con- trol region. Mol. Phylogenet. Evol. 1: 179-192.

SINGER, M. F., 1982 SINEs and LINES: Highly repeated short and long interspersed sequences in mammalian genomes. Cell 28: 433-434.

SMIT, A. F., 1996 The origin of interspersed repeats in the human genome. Curr. Opin. Genet. Dev. 6: 743-748.

SMITH, G. R., 1992 Introgression in fishes: significance for paleon- tology, cladistics, and evolutionary rates. Syst. Biol. 41: 41 -57.

SMITH, G. R., and R. F. STEARI.EY, 1989 The classification and scien- tific names of rainbow and cutthroat trouts. Fisheries 14: 4-10.

STEARI.EY, R. F., and G. R. SMITH, 1993 Phylogeny of the Pacific trouts and salmons (Oncorhynchus) and genera of the family Sal- monidae. Trans. Am. Fish. Soc. 122: 1-33.

Natural hybridization in freshwater animals; ecological implica- tions and molecular approaches. Natunvissenschaften 81: 65- 73.

TAKASAKI, N., S. MURATA, M. SAITOH, T. KOBAYASHI, L. PARK rl nl., 1994 Species-specific amplification of tRNAderived short inter- spersed repetitive elements (SINEs) by retroposition: a process of parasitization of entire genomes during the evolution of sal- monids. Proc. Natl. Acad. Sci. USA 91: 10153-10157.

TAKASAKI, N., L. PARK, M. KAERIYAMA, A. J. GHARRKII and N. OKADA,

STEIT, B., T. S T ~ I . E R , K. SCIIWNK, A. ENDER, K. KUHN et al., 1994

1996 Characterization of species-specifically amplified SINEs in three salmonid species, chum salmon, pink salmon, and ko- kanee: the local environment of the genome might he important for the generation of a dominant source gene at a newly ret- roposed locus. J. Mol. Evol. 42: 103- 116.

TAYLOR, D. J., and P. D. N. HEBERT, 1992 Daphnia galeatu mendotar as a cryptic species complex with interspecific hybrids. Limnol. Oceanogr. 37: 651-657.

THO MAS,^. R , R . E.WITHI.ERandA. T . B E C K K N B A C : H , ~ ~ S ~ Mitochon- drial DNA analysis of Pacific salmonid evolution. Can. J. Zool. 64: 1058-1064.

UI.l.U, E., and C. TSCHUDI, 1984 A h sequences are processed 7SL RNA genes. Nature 312: 171-172.

UTrKR, F. M., F. W. AI.I.ENDORF and H. 0. HO~XINS, 1973 Genetic variability and relationships in Pacific salmon and related trout based on protein variations. Syst. Zool. 22: 257-270.

WEINER, A. M., 1980 An abundant cytoplasmic 7s RNA is comple- mentary to the dominant interspersed middle repetitive DNA sequence family in the human genome. Cell 22: 209-218.

WENUEI., J. F., A. SCHNABEI. and T. SEEIANAN. 1995 An unusual ribo- somal DNA sequence from Gossypium gossypioidrs reveals ancient, cryptic, intergenomic introgression. Mol. Phylogenet. Evol. 4: 298-313.

rt nl., 1993 Molecular characterization of a short interspersed

ogy to specific tRNAs. Proc. Natl. Acad. Sci. USA 90: 6562-6566. repetitive element from tobacco that exhibits sequence homol-

Communicating editor: N. TAKAHATA

YOSHIOKA, Y., S. MATSU~KITO, S. KOIIMA, K. OHSl?IMA, N. OKr\L>A