Secreted phospholipase A2 group X overexpression in asthma and bronchial hyperresponsiveness

Teal S. Hallstrand, Emil Y. Chi, Alan G. Singer, Michael H. Gelb, and William R. Henderson, Jr.

From the Departments of Medicine (TSH, WRH), Pathology (EYC) and Chemistry (AGS,

MHG), University of Washington, Seattle, WA.

Supported by National Institutes of Health grants K23 HL04231(TSH), R01 AI42989 (WRH),

R01 HL36235 (MHG), a American Lung Association Career Investigator Award CI-22138-N

(TSH), and University of Washington General Clinical Research Center Pilot & Feasibility Grant

(TSH).

Corresponding Author: Teal S. Hallstrand, MD, MPH

Division of Pulmonary and Critical Care

Department of Medicine, University of Washington

Box 356522

Seattle, WA 98195

Phone: (206) 543-3166 Fax: (206) 685-8673

Email: tealh@u.washington.edu

Running Title : Secreted PLA2s in Asthma and BHR

Descriptor Number : Asthma : Immunobiology (63)

Word Count: 3,208

This article has an online data supplement, which is accessible from this issue's table of content

online at www.atsjournals.org.

What is the current scientific knowledge on this subject?

Secreted phospholipase A2s (sPLA2)s have recently emerged as critical regulators of eicosanoid

synthesis, but the specific sPLA2 enzymes expressed in human airways and the role of these

enzymes in asthma pathogenesis are not known.

What does this study add to the field?

Group X sPLA2 (sPLA2-X) is overexpressed in airway epithelial cells and bronchial

macrophages of asthmatic subjects, and released in response to exercise challenge, a stimulus

that causes dysregulated eicosanoid synthesis.

AJRCCM Articles in Press. Published on September 27, 2007 as doi:10.1164/rccm.200707-1088OC

Copyright (C) 2007 by the American Thoracic Society.

1

Abstract

Rationale: Secreted PLA2s (sPLA2)s play key regulatory roles in the biosynthesis of eicosanoids

such as the cysteinyl leukotrienes (CysLT)s, but the role of these enzymes in the pathogenesis of

asthma is not known. Objectives: To establish if sPLA2s are overexpressed in the airways of

asthmatics, and determine if these enzymes may play a role in the generation of eicosanoids in

exercise-induced bronchoconstriction (EIB). Methods: Induced sputum samples were obtained

from asthmatic subjects with EIB, and non-asthmatic controls at baseline, and on a separate day

30 min after exercise challenge. The expression of the PLA2s in induced sputum cells and

supernatant was determined by quantitative PCR, immunocytochemistry, and Western blot. Main

Results: The sPLA2s expressed at the highest levels in airway cells of asthmatics were groups X

and XIIA. Group X sPLA2 (sPLA2-X) was differentially overexpressed in asthma and localized

to airway epithelial cells and bronchial macrophages. The gene expression, immunostaining in

airway epithelial cells and bronchial macrophages, and the level of the extracellular sPLA2-X

protein in the airways increased in response to exercise challenge in the asthma group, while the

levels were lower and unchanged following challenge in non-asthmatic controls. Conclusions:

Increased expression of sPLA2-X may play a key role in the dysregulated eicosanoid synthesis in

asthma.

Abstract Word Count: 207

Key Words: Asthma, Eicosanoid, Epithelial Cell, Leukotriene, and Macrophage.

2

INTRODUCTION

The biosynthesis of eicosanoids in the airways is a key component of asthma

pathogenesis (1). Eicosanoids are the products of arachidonic acid (AA), including the

leukotrienes (LT)s, hydroxyeicosatetraenoic acids (HETE)s, and prostaglandins (PG)s. LTs such

as the cysteinyl leukotrienes (CysLT)s are produced at increased levels in the airways of

asthmatics (2), and inhalation of CysLTs reproduces many of the features of asthma (3).

Members of the PG family include PGD2 that serves as a bronchoconstrictor (4), and PGE2 that

has a bronchodilatory and bronchoprotective role in the airways (5). A major manifestation of

asthma is exercise-induced bronchoconstriction (EIB) that reflects the degree of indirect

bronchial hyperresponsiveness (BHR) (6). Dysregulated eicosanoid synthesis is prominent in

indirect BHR (7-9). The levels of CysLTs in the airways, measured in exhaled breath condensate

(10) or in induced sputum (11), are higher in asthmatics with EIB than asthmatics without EIB.

In particular, the ratio of CysLTs to PGE2 is increased in induced sputum of asthmatics with EIB

(11). Based on our prior work (8) and the results of Mickleborough and colleagues (9)

demonstrating a sustained increase in CysLTs and PGD2 in the airways, and concurrent decrease

in the level of PGE2 (8) following exercise challenge, we undertook this investigation to evaluate

the upstream regulators of eicosanoid production in the airways of asthmatics with EIB.

A key regulatory mechanism for eicosanoid biosynthesis is through phospholipase A2

(PLA2) that hydrolyzes the sn-2 position of membrane phospholipids, liberating unesterified AA

the precursor to the eicosanoids (12). Although the well described cytosolic PLA2α (cPLA2α) is

necessary for efficient eicosanoid biosynthesis (13), a group of secreted PLA2s (sPLA2)s has

been identified that coordinate with cPLA2α to augment synthesis of eicosanoids (14-16). The

sPLA2-mediated release of eicosanoids is upregulated by treatment with the pro-inflammatory

3

cytokines, transforming growth factor-α (TGF-α) and IL-1β (17). In cultured cells, sPLA2s are

strongly linked to the generation of the pro-inflammatory eicosanoids such as CysLTs, while

cPLA2α is more closely associated with the generation of PGE2 (18-20). The sPLA2s are small

(14-16 kDa), Ca2+-dependent (KCa ~ µM to mM) enzymes released into the extracellular fluid by

the classical secretory pathway or by degranulation (12). Nine functional human sPLA2s have

been characterized, including human sPLA2 groups V and X that have the highest AA releasing

activities when added to mammalian cells (21, 22). An increase in sPLA2 enzyme activity in

bronchoalveolar lavage (BAL) fluid and nasal lavage fluid was identified following allergen

challenge in patients with asthma and allergic rhinitis respectively, but the identities of the

sPLA2s involved in asthma remain unknown (23-25).

We assessed the expression of the full set of cytosolic and secreted PLA2s in lower

airway cells obtained by induced sputum in a group of asthmatics with EIB. Based on the results,

we determined if selected sPLA2s were differentially expressed in asthmatic subjects compared

to non-asthmatic controls based on gene expression, immunostaining in induced sputum cells,

and Western blots of the secreted protein. We examined levels of these selected enzymes at

baseline and after exercise challenge in both groups. Our goals were to 1) determine the

identities of the sPLA2s expressed in airway cells of asthmatics, and if these enzymes are

overexpressed in asthma, 2) localize the cellular sources of sPLA2s in airway inflammatory and

epithelial cells, and 3) determine if selected sPLA2s may play a role in the dysregulated synthesis

of eicosanoids in response to exercise challenge in asthma.

Some of the results of this study have been previously reported in the form of an abstract

(26).

4

METHODS

Study Subjects and Protocol

A detailed description of these methods can be found in the online supplement. The

University of Washington Institutional Review Board approved the study protocol, and written

informed consent was obtained from all participants. The asthma group consisted of persons 12-

59 years of age who had a physician diagnosis of asthma for ≥ 1 year, used only an inhaled β2-

agonist for asthma, and had ≥ 15% fall in forced expiratory volume in one second (FEV1)

following exercise challenge (8). The control group consisted of persons 18-59 years of age with

no history of asthma or atopy, baseline FEV1 ≥ 80% predicted, and < 7% fall in FEV1 after

exercise challenge. Induced sputum was conducted with 3% saline for 12 min at baseline and on

a separate day 4-20 days later 30 min after exercise challenge. Albuterol (180 µg via MDI) was

administered 15 min prior to the induced sputum.

Induced Sputum Analysis

Induced sputum was placed on ice and processed within 30 min. The sample was

dispersed with an equal volume of DTT 0.1% in a shaking water bath at 37oC for 15 min. Slides

were prepared of the dispersed induced sputum with a cytocentrifuge, and fixed in methanol and

then methyl Carnoy’s solution for immunocytochemistry. The remaining dispersed induced

sputum sample was centrifuged at 250 g for 10 min, and portions of the supernatant treated with

protease inhibitors, and with iced methanol with 0.2% formic acid for protein and eicosanoid

analysis respectively. The cell pellet was resuspended in RLT buffer (Qiagen, Valencia, CA)

with β-mercaptoethanol, and underwent mechanical lysis. Total RNA was extracted from the

lysed cell pellet using the RNeasy protocol (Qiagen, Valencia, CA).

5

First strand cDNA was transcribed from total RNA using oligo(dT)12-18 primers. Initially,

semi-quantitative PCR was conducted using primers for the secreted and cytosolic PLA2s, based

on the PCR product after 23, 27, 31, and 35 cycles of amplification relative to glyceraldehyde-3-

phosphate dehydrogenase (GAPDH). Quantitative real-time PCR was conducted for sPLA2

groups V, X, and XIIA using SYBR green method. Human K-562 cell line cDNA was used for

the standard curve.

Immunostaining for sPLA2 groups V, X, and XIIA was performed on cytocentrifuge

preparations of induced sputum cells using polyclonal rabbit anti-human sPLA2 antibodies that

were raised against the recombinant proteins (27). The immunostaining was co-localized to

specific inflammatory and epithelial cells based on morphological criteria (28).

Western blots were conducted on induced sputum supernatant using polyclonal rabbit

anti-human sPLA2 groups V, X, and XIIA antibodies. The detection of sPLA2-V was confirmed

with a murine monoclonal antibody (Cayman, Ann Arbor, MI).

Statistical Analysis

The PLA2 expression data are reported as the mean +/- SD. Differences between the

baseline and post-exercise gene expression, protein, and eicosanoid products were analyzed with

a paired t test after log transformation. The differences in the percentage of cells immunostaining

for the different sPLA2s at baseline and post-exercise were analyzed with a paired t test.

Comparisons between the groups were made with unpaired t tests.

Methods Word Count: 500

6

RESULTS

Subject Characteristics and Eicosanoid Levels

The studies were conducted on induced sputum samples obtained from a cohort of 25

subjects with asthma and EIB, and a group of 10 non-asthmatic controls. The baseline lung

function, response to short-acting bronchodilator, and severity of EIB were markedly different

between the two groups (Table 1). The severity of EIB in the asthmatic group ranged from a

maximum fall in FEV1 after exercise of 15.1-63.1%. Induced sputum was collected at baseline

and then on a separate day 30 min after dry-air exercise challenge. The average time between

baseline and post-exercise induced sputum visits was 9.3 days (range 4-18) in the asthma group,

and 10.0 days (range 5-19) in the control group. The levels of the eicosanoids CysLTs, 15S-

HETE and PGE2 were previously reported in the asthma group (8, 29), and are compared to

levels of eicosanoids in the control group in Figures E1 and E2 of the online repository.

Expression and Localization of Secreted PLA2s in Induced Sputum Cells

Semi-quantitative PCR analysis of induced sputum cells from asthmatic subjects was

used to assess the expression of all the known cytosolic and secreted PLA2s (Figure 1). Induced

sputum cells from asthmatics expressed sPLA2 groups IB, IIA, IID, IIF, X, and XIIA. Of note,

sPLA2 groups X and XIIA were expressed at high levels, while groups IIE, III, and V were

below the level of detection. Isoenzymes of cPLA2 were also identified including groups IVα,

IVβ, and IVγ.

Based on the results of the semi-quantitative PCR analysis in asthmatics, we determined

differences in selected sPLA2s between asthmatics and controls by quantitative real-time PCR.

The expression of sPLA2-X was increased in asthmatics relative to controls (Figure 2A), while

7

there was no difference in the expression of sPLA2-XIIA between asthmatics and controls

(Figure 2B). The expression of sPLA2-V was above the threshold cycle (Ct) for detection.

Although we did not detect sPLA2-V by PCR, we conducted ICC for sPLA2-V because of its

high AA releasing capacity. The concentrations of leukocytes and epithelial cells in induced

sputum from both of the groups are presented in the online repository (Figure E3).

Immunostaining for sPLA2-V in induced sputum cells at baseline was no different between

asthmatics and controls (Figure 2C). In contrast, the percentages of cells immunostaining for

sPLA2 groups X and XIIA were greater in induced sputum cells of asthmatics compared to

controls (Figures 2D and 2E). Immunostaining for sPLA2 groups V, X, and XIIA localized

predominantly in columnar epithelial cells and bronchial macrophages, and to a lesser extent in

eosinophils (Figure 3 and Figure E4, online repository).

Effects of Exercise Challenge on sPLA2s in the Airways

To assess the potential role of the identified sPLA2s in the marked release of pro-

inflammatory eicosanoids that occurs following exercise in asthmatics with EIB, we evaluated

paired induced sputum samples obtained at baseline and 30 min post-exercise challenge in

asthmatics and normal controls. The gene expression of sPLA2-X in induced sputum cells

increased following exercise challenge in the asthma group, but not in the control group (Figure

4A). The percentage of cells in induced sputum immunostaining for sPLA2-X increased in

asthmatic subjects following challenge, but not in controls (Figure 4B). The increase in

immunostaining for sPLA2-X in asthmatic subjects was in bronchial macrophages and columnar

epithelial cells but not eosinophils (Figure 4C). No changes occurred in these cells following

exercise challenge in the control group (Figure 4D). The secreted sPLA2-X protein measured in

8

induced sputum increased in the asthma group following challenge (Figure 4E), but not in the

control group (Figure 4F). An additional Western blot comparing the levels of sPLA2-X

following exercise challenge in asthmatic subjects to controls found that the level of sPLA2-X

was higher in the asthmatic subjects (Figure 4G). Reprobing the blot with an antibody to the

intracellular protein β-actin did not reveal any β-actin signal indicating that the source of the

sPLA2 was protein secreted from the cells.

Although the sPLA2-XIIA gene expression was no different in the asthma and control

groups at baseline, the gene expression increased after exercise challenge in the asthma group,

but not in controls (Figure 5A). There was a marked increase in the percentage of induced

sputum cells immunostaining for sPLA2-XIIA following exercise challenge that occurred in the

asthma group that was not seen in the control group (Figure 5B). The increase in immunostaining

in the asthma group was predominantly in bronchial macrophages and columnar epithelial cells,

but also occurred in eosinophils, while no similar changes were observed in induced sputum cell

subtypes in the control group (Figure E5A and B, online repository). The level of sPLA2-XIIA

could not be measured accurately by Western blot as the protein was difficult to detect in either

group by this method.

The percentage of cells immunostaining for sPLA2-V did not increase in either of the

groups in response to exercise challenge (Figure 6A). Immunostaining for sPLA2-V in bronchial

macrophages tended to increase in asthmatic subjects following challenge; while no changes

were observed in columnar epithelial cells or eosinophils in asthmatics, and no changes were

identified in any induced sputum cell type in controls (Figure 5C and D, online repository). The

sPLA2-V protein was difficult to detect in induced sputum supernatant of asthmatics by Western

blot, and could not be detected in normal controls. Exercise challenge did not alter the levels of

9

sPLA2-V by Western blot in asthmatic subjects (Figure 6B).

10

DISCUSSION

In this study, we evaluated the expression of the complete set of functional PLA2

enzymes in the lower airways of asthmatic subjects with BHR, and determined if sPLA2 groups

V, X, and XIIA were differentially expressed in asthmatic subjects compared to non-asthmatic

controls. Marked differences in the levels of pro-inflammatory eicosanoids (e.g. CysLTs, and

15S-HETE) in the airways were present between these two groups, particularly following

exercise challenge. Of the two sPLA2 enzymes with high AA releasing capacity (i.e. groups V

and X), only sPLA2-X was overexpressed in asthmatics relative to controls. The gene expression,

immunostaining in airway epithelial cells and bronchial macrophages, and the level of the

sPLA2-X protein in the airways all increased in response to exercise challenge in the asthma

group, while the levels remained constant following challenge in non-asthmatic controls. These

results indicate that sPLA2-X may play a role in regulating the levels of pro-inflammatory

eicosanoids in asthma, particularly in manifestations of indirect bronchial hyperresponsiveness

where increased production of pro-inflammatory eicosanoids is critical (7-9).

The sPLA2s are attractive therapeutic targets because these enzymes may be

preferentially involved in the production of pro-inflammatory AA metabolites (e.g. LTs, HETEs,

and PGD2) that are key for asthma immunopathogenesis (12). Two prior studies identified

increased sPLA2 enzyme activity in bronchoalveolar lavage (BAL) fluid following whole lung

allergen challenge in allergic asthma (23, 24), and nasal lavage fluid after nasal allergen

challenge in subjects with allergic rhinitis (25). The specific sPLA2s involved in asthma have not

been determined. There are 9 distinct functional sPLA2s that have been identified in the human

genome (12). LY333013, a sPLA2 inhibitor that is active predominantly against sPLA2-II (i.e.

IIA, D, E, and F) failed to inhibit either the early or late response to allergen challenge

11

suggesting that sPLA2 group II enzymes may not be the key sPLA2 enzymes in human asthma

(30). The group II enzymes were expressed at relatively low levels in the present study. Among

the two sPLA2s with high AA releasing capacity (22), we found that only sPLA2-X was

differentially overexpressed in asthma, while sPLA2-V was present at low levels and was not

differentially expressed in asthma. The difference in sPLA2-X function may be greater than the

difference in sPLA2-X protein levels identified in this study because sPLA2-X becomes activated

in inflammatory tissues (31). These results, along with the recent demonstration by our research

group that sPLA2-X deficiency significantly inhibits the development of BHR, airway

inflammation and remodeling in acute and chronic murine models of allergen-induced asthma

(32) indicates that sPLA2-X is a potential therapeutic target in asthma.

Although we focused on the sPLA2 enzymes in this study, we also identified the

expression of 3 cPLA2s in asthmatics, including the well-known cPLA2α that has a pivotal role

in eicosanoid production (13), and two other enzymes cPLA2β and cPLA2γ. In cultured cells

sPLA2s coordinate with cPLA2α to augment the production of eicosanoids (15). Relatively little

is known about the two other cPLA2s, but both enzymes function in eicosanoid synthesis (33,

34). cPLA2β is implicated in lipid mediator release in response to cardiac ischemia (35), and

cPLA2γ is involved in peroxide-induced release of eicosanoids (36). The expression of cPLA2γ is

upregulated in macrophages by the adipocyte-derived cytokine leptin, enhancing cellular LT

synthesis (37).

Dysregulated eicosanoid synthesis is prominent in asthma with EIB as indicated by

elevated basal levels of CysLTs in the lower airways (10, 11), and release of CysLTs and PGD2

into the airways during EIB sustaining bronchoconstriction (8, 9). Selective functions of the

different PLA2 enzymes may be involved in this dysregulated eicosanoid synthesis. We found in

12

the present study that the ratio of CysLTs to PGE2 decreased in controls following exercise

challenge, in contrast to our prior findings that the ratio of CysLTs to PGE2 increases following

exercise challenge in asthmatics with EIB (8). This altered balance of eicosanoids is important

because PGE2 serves protective and bronchodilator functions (5), and inhaled PGE2 prior to

exercise and allergen challenge significantly attenuates bronchoconstriction (38-40). In cultured

cells, activation of cPLA2α alone is more closely associated with the generation of PGE2 (18,

19), while sPLA2s have been strongly implicated in the release of pro-inflammatory eicosanoids

such as CysLTs (18, 19) that can occur in the absence of cPLA2α activation (20).

Localization of sPLA2-X to the epithelium was prominent in the present study, consistent

with the upregulation of sPLA2-X in the epithelium identified in a murine model of asthma (32).

Although the epithelium has limited synthetic capacity for the generation of 5-lipoxygenase (5-

LO) products such as CysLTs (41), the epithelium can augment CysLT production in leukocytes

through mechanisms involving sPLA2s. The synthesis of leukotrienes (LT)s in alveolar

macrophages co-cultured with alveolar epithelial cells is augmented by the transfer of free AA

from the epithelium to the macrophages, shunting AA away from PGE2 synthesis (42). Similarly,

release of sPLA2-V from epithelial cells augments CysLT synthesis in eosinophils without

activation of cPLA2α (43, 44). These findings have strong implications for the pathogenesis of

EIB, since the stimulus for EIB may be the transfer of water and resultant osmotic stress in the

epithelium during exercise (45).

The increase in sPLA2-X in bronchial macrophages in asthmatics is important since

bronchial macrophages are the most prevalent cell the airways of asthmatics under most

circumstances, and there are phenotypic alterations in bronchial macrophages in asthma (46, 47).

In rodent models, bronchial macrophages are important in the development of BHR in response

13

to allergen sensitization (48). Upregulation of sPLA2-X in alveolar macrophages was also

identified following allergen sensitization in the murine model of asthma (32). After migration to

the lungs, bronchial macrophages have increased capacity for LT synthesis (49), although

alterations in eicosanoid synthesis between asthmatic and normal macrophages have not been

identified (50). Further study is necessary to determine if increased expression of sPLA2-X in

macrophages alters the production of eicosanoids in asthma.

An unexpected finding of the present study was that the sPLA2 with the highest

expression by quantitative PCR and ICC was sPLA2-XIIA. Although it was unclear if sPLA2-

XIIA is differentially overexpressed in asthma, there was a marked increase in immunostaining

for epithelial cell and bronchial macrophage sPLA2-XIIA in asthmatics that was not seen in the

control group after exercise challenge. sPLA2-XIIA displays homology to other sPLA2s only

over a short stretch in the active site region (51), has low AA releasing capacity (22), and does

not contribute to AA release in cultured cells that express this enzyme (17). Receptor-mediated

effects of human sPLA2-XIIA either through the M-type or N-type receptor are also possible.

Cells transfected with sPLA2-XIIA exhibit morphological alterations in HEK293 cells that are

unique among the sPLA2 transfected cells (52). Among the sPLA2s, sPLA2-XIIA is also unique

as a bactericidal protein that has activity against both gram-positive and gram-negative bacteria

(53).

In summary, we found that sPLA2-X is differentially overexpressed in asthmatics with

EIB, a component of asthma that is a manifestation of indirect BHR. We found strong evidence

of an increase in sPLA2-X in columnar epithelial cells and bronchial macrophages and an

increase in extracellular sPLA2-X protein in response to exercise challenge in asthmatics, but not

in controls. Collectively, these results indicate that sPLA2-X may play a role in the generation of

14

pro-inflammatory eicosanoids in the airways and the development of BHR. Inhibition of sPLA2-

X may represent an important novel therapeutic target in human asthma.

16

REFERENCES

1. Hallstrand, T. S., and W. R. Henderson, Jr. 2002. Leukotriene modifiers. Med Clin North

Am 86:1009-33.

2. Pavord, I. D., R. Ward, G. Woltmann, A. J. Wardlaw, J. R. Sheller, and R. Dworski.

1999. Induced sputum eicosanoid concentrations in asthma. Am J Respir Crit Care Med

160:1905-9.

3. Griffin, M., J. W. Weiss, A. G. Leitch, E. R. McFadden, Jr., E. J. Corey, K. F. Austen,

and J. M. Drazen. 1983. Effects of leukotriene D on the airways in asthma. N Engl J Med

308:436-9.

4. Hardy, C. C., C. Robinson, A. E. Tattersfield, and S. T. Holgate. 1984. The

bronchoconstrictor effect of inhaled prostaglandin D2 in normal and asthmatic men. N Engl J

Med 311:209-13.

5. Mathe, A. A., and P. Hedqvist. 1975. Effect of prostaglandins F2 alpha and E2 on airway

conductance in healthy subjects and asthmatic patients. Am Rev Respir Dis 111:313-20.

6. Joos, G. F., B. O'Connor, S. D. Anderson, F. Chung, D. W. Cockcroft, B. Dahlen, G.

DiMaria, A. Foresi, F. E. Hargreave, S. T. Holgate, M. Inman, J. Lotvall, H. Magnussen, R.

Polosa, D. S. Postma, and J. Riedler. 2003. Indirect airway challenges. Eur Respir J 21:1050-68.

7. Currie, G. P., K. Haggart, D. K. Lee, S. J. Fowler, A. M. Wilson, J. D. Brannan, S. D.

Anderson, and B. J. Lipworth. 2003. Effects of mediator antagonism on mannitol and adenosine

monophosphate challenges. Clin Exp Allergy 33:783-8.

17

8. Hallstrand, T. S., M. W. Moody, M. M. Wurfel, L. B. Schwartz, W. R. Henderson, Jr.,

and M. L. Aitken. 2005. Inflammatory basis of exercise-induced bronchoconstriction. Am J

Respir Crit Care Med 172:679-86.

9. Mickleborough, T. D., M. R. Lindley, and S. Ray. 2005. Dietary salt, airway

inflammation, and diffusion capacity in exercise-induced asthma. Med Sci Sports Exerc 37:904-

14.

10. Carraro, S., M. Corradi, S. Zanconato, R. Alinovi, M. F. Pasquale, F. Zacchello, and E.

Baraldi. 2005. Exhaled breath condensate cysteinyl leukotrienes are increased in children with

exercise-induced bronchoconstriction. J Allergy Clin Immunol 115:764-70.

11. Hallstrand, T. S., M. W. Moody, M. L. Aitken, and W. R. Henderson, Jr. 2005. Airway

immunopathology of asthma with exercise-induced bronchoconstriction. J Allergy Clin Immunol

116:586-93.

12. Triggiani, M., F. Granata, G. Giannattasio, and G. Marone. 2005. Secretory

phospholipases A2 in inflammatory and allergic diseases: not just enzymes. J Allergy Clin

Immunol 116:1000-6.

13. Uozumi, N., K. Kume, T. Nagase, N. Nakatani, S. Ishii, F. Tashiro, Y. Komagata, K.

Maki, K. Ikuta, Y. Ouchi, J. Miyazaki, and T. Shimizu. 1997. Role of cytosolic phospholipase A2

in allergic response and parturition. Nature 390:618-22.

14. Balboa, M. A., Y. Shirai, G. Gaietta, M. H. Ellisman, J. Balsinde, and E. A. Dennis.

2003. Localization of group V phospholipase A2 in caveolin-enriched granules in activated

P388D1 macrophage-like cells. J Biol Chem 278:48059-65.

18

15. Mounier, C. M., F. Ghomashchi, M. R. Lindsay, S. James, A. G. Singer, R. G. Parton,

and M. H. Gelb. 2004. Arachidonic acid release from mammalian cells transfected with human

groups IIA and X secreted phospholipase A2 occurs predominantly during the secretory process

and with the involvement of cytosolic phospholipase A2-α. J Biol Chem 279:25024-38.

16. Satake, Y., B. L. Diaz, B. Balestrieri, B. K. Lam, Y. Kanaoka, M. J. Grusby, and J. P.

Arm. 2004. Role of group V phospholipase A2 in zymosan-induced eicosanoid generation and

vascular permeability revealed by targeted gene disruption. J Biol Chem 279:16488-94.

17. Ni, Z., N. M. Okeley, B. P. Smart, and M. H. Gelb. 2006. Intracellular actions of group

IIA secreted phospholipase A2 and group IVA cytosolic phospholipase A2 contribute to

arachidonic acid release and prostaglandin production in rat gastric mucosal cells and transfected

human embryonic kidney cells. J Biol Chem 281:16245-55.

18. Kessen, U. A., R. H. Schaloske, D. L. Stephens, K. Killermann Lucas, and E. A. Dennis.

2005. PGE2 release is independent of upregulation of Group V phospholipase A2 during long-

term stimulation of P388D1 cells with LPS. J Lipid Res 46:2488-96.

19. Marshall, L. A., B. Bolognese, J. D. Winkler, and A. Roshak. 1997. Depletion of human

monocyte 85-kDa phospholipase A2 does not alter leukotriene formation. J Biol Chem 272:759-

65.

20. Munoz, N. M., Y. J. Kim, A. Y. Meliton, K. P. Kim, S. K. Han, E. Boetticher, E.

O'Leary, S. Myou, X. Zhu, J. V. Bonventre, A. R. Leff, and W. Cho. 2003. Human group V

phospholipase A2 induces group IVA phospholipase A2-independent cysteinyl leukotriene

synthesis in human eosinophils. J Biol Chem 278:38813-20.

19

21. Calabrese, C., M. Triggiani, G. Marone, and G. Mazzarella. 2000. Arachidonic acid

metabolism in inflammatory cells of patients with bronchial asthma. Allergy 55 Suppl 61:27-30.

22. Singer, A. G., F. Ghomashchi, C. Le Calvez, J. Bollinger, S. Bezzine, M. Rouault, M.

Sadilek, E. Nguyen, M. Lazdunski, G. Lambeau, and M. H. Gelb. 2002. Interfacial kinetic and

binding properties of the complete set of human and mouse groups I, II, V, X, and XII secreted

phospholipases A2. J Biol Chem 277:48535-49.

23. Bowton, D. L., M. C. Seeds, M. B. Fasano, B. Goldsmith, and D. A. Bass. 1997.

Phospholipase A2 and arachidonate increase in bronchoalveolar lavage fluid after inhaled antigen

challenge in asthmatics. Am J Respir Crit Care Med 155:421-5.

24. Chilton, F. H., F. J. Averill, W. C. Hubbard, A. N. Fonteh, M. Triggiani, and M. C. Liu.

1996. Antigen-induced generation of lyso-phospholipids in human airways. J Exp Med

183:2235-45.

25. Stadel, J. M., K. Hoyle, R. M. Naclerio, A. Roshak, and F. H. Chilton. 1994.

Characterization of phospholipase A2 from human nasal lavage. Am J Respir Cell Mol Biol

11:108-13.

26. Hallstrand, T. S., E. Y. Chi, M. H. Gelb, and W. R. Henderson, Jr. 2004. Phospholipase

A2 isoenzymes in airway inflammatory cells of patients with mild asthma and exercise-induced

bronchoconstriction. Am J Respir Crit Care Med 169:A569.

27. Degousee, N., F. Ghomashchi, E. Stefanski, A. Singer, B. P. Smart, N. Borregaard, R.

Reithmeier, T. F. Lindsay, C. Lichtenberger, W. Reinisch, G. Lambeau, J. Arm, J. Tischfield, M.

H. Gelb, and B. B. Rubin. 2002. Groups IV, V, and X phospholipases A2s in human neutrophils:

20

role in eicosanoid production and gram-negative bacterial phospholipid hydrolysis. J Biol Chem

277:5061-73.

28. Fahy, J. V., H. A. Boushey, S. C. Lazarus, E. A. Mauger, R. M. Cherniack, V. M.

Chinchilli, T. J. Craig, J. M. Drazen, J. G. Ford, J. E. Fish, E. Israel, M. Kraft, R. F. Lemanske,

R. J. Martin, D. McLean, S. P. Peters, C. Sorkness, and S. J. Szefler. 2001. Safety and

reproducibility of sputum induction in asthmatic subjects in a multicenter study. Am J Respir

Crit Care Med 163:1470-5.

29. Hallstrand, T. S., J. S. Debley, F. M. Farin, and W. R. Henderson, Jr. 2007. Role of

MUC5AC in the pathogenesis of exercise-induced bronchoconstriction. J Allergy Clin Immunol

119:1092-8.

30. Bowton, D. L., A. A. Dmitrienko, E. Israel, B. G. Zeiher, and G. D. Sides. 2005. Impact

of a soluble phospholipase A2 inhibitor on inhaled allergen challenge in subjects with asthma. J

Asthma 42:65-71.

31. Ohtsuki, M., Y. Taketomi, S. Arata, S. Masuda, Y. Ishikawa, T. Ishii, Y. Takanezawa, J.

Aoki, H. Arai, K. Yamamoto, I. Kudo, and M. Murakami. 2006. Transgenic expression of group

V, but not group X, secreted phospholipase A2 in mice leads to neonatal lethality because of lung

dysfunction. J Biol Chem 281:36420-33.

32. Henderson, W. R., Jr., E. Y. Chi, J. G. Bollinger, Y. T. Tien, X. Ye, L. Castelli, Y. P.

Rubtsov, A. G. Singer, G. K. Chiang, T. Nevalainen, A. Y. Rudensky, and M. H. Gelb. 2007.

Importance of group X-secreted phospholipase A2 in allergen-induced airway inflammation and

remodeling in a mouse asthma model. J Exp Med 204:865-77.

21

33. Song, C., X. J. Chang, K. M. Bean, M. S. Proia, J. L. Knopf, and R. W. Kriz. 1999.

Molecular characterization of cytosolic phospholipase A2-β. J Biol Chem 274:17063-7.

34. Underwood, K. W., C. Song, R. W. Kriz, X. J. Chang, J. L. Knopf, and L. L. Lin. 1998.

A novel calcium-independent phospholipase A2, cPLA2-γ, that is prenylated and contains

homology to cPLA2. J Biol Chem 273:21926-32.

35. Mancuso, D. J., D. R. Abendschein, C. M. Jenkins, X. Han, J. E. Saffitz, R. B.

Schuessler, and R. W. Gross. 2003. Cardiac ischemia activates calcium-independent

phospholipase A2β, precipitating ventricular tachyarrhythmias in transgenic mice: rescue of the

lethal electrophysiologic phenotype by mechanism-based inhibition. J Biol Chem 278:22231-6.

36. Asai, K., T. Hirabayashi, T. Houjou, N. Uozumi, R. Taguchi, and T. Shimizu. 2003.

Human group IVC phospholipase A2 (cPLA2γ). Roles in the membrane remodeling and

activation induced by oxidative stress. J Biol Chem 278:8809-14.

37. Mancuso, P., C. Canetti, A. Gottschalk, P. K. Tithof, and M. Peters-Golden. 2004. Leptin

augments alveolar macrophage leukotriene synthesis by increasing phospholipase activity and

enhancing group IVC iPLA2 (cPLA2γ) protein expression. Am J Physiol Lung Cell Mol Physiol

287:L497-502.

38. Melillo, E., K. L. Woolley, P. J. Manning, R. M. Watson, and P. M. O'Byrne. 1994.

Effect of inhaled PGE2 on exercise-induced bronchoconstriction in asthmatic subjects. Am J

Respir Crit Care Med 149:1138-41.

22

39. Gauvreau, G. M., R. M. Watson, and P. M. O'Byrne. 1999. Protective effects of inhaled

PGE2 on allergen-induced airway responses and airway inflammation. Am J Respir Crit Care

Med 159:31-6.

40. Hartert, T. V., R. T. Dworski, B. G. Mellen, J. A. Oates, J. J. Murray, and J. R. Sheller.

2000. Prostaglandin E2 decreases allergen-stimulated release of prostaglandin D2 in airways of

subjects with asthma. Am J Respir Crit Care Med 162:637-40.

41. Jame, A. J., P. M. Lackie, A. M. Cazaly, I. Sayers, J. F. Penrose, S. T. Holgate, and A. P.

Sampson. 2007. Human bronchial epithelial cells express an active and inducible biosynthetic

pathway for leukotrienes B4 and C4. Clin Exp Allergy 37:880-92.

42. Peters-Golden, M., and A. Feyssa. 1993. Transcellular eicosanoid synthesis in cocultures

of alveolar epithelial cells and macrophages. Am J Physiol 264:L438-47.

43. Munoz, N. M., A. Y. Meliton, A. Lambertino, E. Boetticher, J. Learoyd, F. Sultan, X.

Zhu, W. Cho, and A. R. Leff. 2006. Transcellular secretion of group V phospholipase A2 from

epithelium induces β2-integrin-mediated adhesion and synthesis of leukotriene C4 in eosinophils.

J Immunol 177:574-82.

44. Wijewickrama, G. T., J. H. Kim, Y. J. Kim, A. Abraham, Y. Oh, B. Ananthanarayanan,

M. Kwatia, S. J. Ackerman, and W. Cho. 2006. Systematic evaluation of transcellular activities

of secretory phospholipases A2: High activity of group V PLA2 to induce eicosanoid biosynthesis

in neighboring inflammatory cells. J Biol Chem.

45. Anderson, S. D. 2006. How does exercise cause asthma attacks? Curr Opin Allergy Clin

Immunol 6:37-42.

23

46. Plummeridge, M. J., L. Armstrong, M. A. Birchall, and A. B. Millar. 2000. Reduced

production of interleukin 12 by interferon γ primed alveolar macrophages from atopic asthmatic

subjects. Thorax 55:842-7.

47. Alexis, N. E., J. Soukup, S. Nierkens, and S. Becker. 2001. Association between airway

hyperreactivity and bronchial macrophage dysfunction in individuals with mild asthma. Am J

Physiol Lung Cell Mol Physiol 280:L369-75.

48. Careau, E., L. I. Proulx, P. Pouliot, A. Spahr, V. Turmel, and E. Y. Bissonnette. 2006.

Antigen sensitization modulates alveolar macrophage functions in an asthma model. Am J

Physiol Lung Cell Mol Physiol 290:L871-9.

49. Balter, M. S., G. B. Toews, and M. Peters-Golden. 1989. Different patterns of

arachidonate metabolism in autologous human blood monocytes and alveolar macrophages. J

Immunol 142:602-8.

50. Balter, M. S., W. L. Eschenbacher, and M. Peters-Golden. 1988. Arachidonic acid

metabolism in cultured alveolar macrophages from normal, atopic, and asthmatic subjects. Am

Rev Respir Dis 138:1134-42.

51. Gelb, M. H., E. Valentin, F. Ghomashchi, M. Lazdunski, and G. Lambeau. 2000. Cloning

and recombinant expression of a structurally novel human secreted phospholipase A2. J Biol

Chem 275:39823-6.

52. Murakami, M., S. Masuda, S. Shimbara, S. Bezzine, M. Lazdunski, G. Lambeau, M. H.

Gelb, S. Matsukura, F. Kokubu, M. Adachi, and I. Kudo. 2003. Cellular arachidonate-releasing

24

function of novel classes of secretory phospholipase A2s (groups III and XII). J Biol Chem

278:10657-67.

53. Koduri, R. S., J. O. Gronroos, V. J. Laine, C. Le Calvez, G. Lambeau, T. J. Nevalainen,

and M. H. Gelb. 2002. Bactericidal properties of human and murine groups I, II, V, X, and XII

secreted phospholipases A2. J Biol Chem 277:5849-57.

Figure Legends

Figure 1. Expression of PLA2s in induced sputum cells from asthmatics with EIB. Semi-

quantitative PCR was used to assess the expression of the secreted (A) and cytosolic PLA2s (B)

relative to the expression of GAPDH. The bars represent the mean +/- SD.

Figure 2. Baseline differences in sPLA2 groups V, X, and XIIA between asthmatics with EIB

and non-asthmatic controls. The gene expression of sPLA2-X was increased relative to control

(A), while there was no difference in the expression of sPLA2-XIIA (B). The expression of

sPLA2-V was below the level of detection. No difference was detected for immunostaining in

induced sputum cells for sPLA2-V (C). The percentage of cells immunostaining for sPLA2-X (D)

and sPLA2-XIIA (E) was increased in asthmatic subjects relative to controls.

Figure 3. Immunostaining for sPLA2 groups V, X, and XIIA in induced sputum cells.

Representative photomicrographs of immunocytochemistry for sPLA2-V (A, B), sPLA2-X (C,

D), and sPLA2-XIIA (E, F) demonstrate immunostaining predominantly in columnar epithelial

cells (arrows) and macrophages (arrowheads). The representative slides were from asthmatic

subjects following exercise challenge.

Figure 4. Effects of exercise challenge on sPLA2-X in asthmatics with EIB and non-asthmatic

controls. The gene expression (A) and percentage of cells in induced sputum immunostaining

(B) for sPLA2-X increased in asthmatic subjects following challenge, but not in controls.

Immunostaining for sPLA2-X in asthmatic subjects increased in bronchial macrophages (Mac)

and columnar epithelial cells (Epi), but not eosinophils (EOS) (C); while no changes were

observed in the control group (D). Western blots of induced sputum supernatant revealed

an increase in sPLA2-X protein in asthmatic subjects (E), but not in controls (F), resulting

in a higher level of sPLA2-X in asthmatic subjects than controls post-exercise (G).

Figure 5. Effects of exercise challenge on sPLA2-XIIA in asthmatics with EIB and

nonasthmatic controls. The gene expression (A) and percentage of cells in induced

sputum immunostaining (B) for sPLA2-XIIA increased in asthmatic subjects following

challenge, but not in controls.

Figure 6. Effects of exercise challenge on sPLA2-V in asthmatics with EIB and non-

asthmatic controls. The percentage of cells in induced sputum immunostaining for

sPLA2-V was no different post-exercise compared to baseline in either asthmatics or

controls (A). Western blot of induced sputum supernatant had no increase in sPLA2-V

protein in asthmatic subjects (B), and could not be detected in controls.

Table I. Characteristics of Study Participants*

Asthma with EIB (n=25)

Normal Control (n=10)

Age (yrs)(range) 28.1 (14-55) 31.3 (18-57) Gender (M/F) 11/14 6/4 Baseline

FEV1 (% pred)† 84.8 +/- 8.4 102.7 +/- 10.7 FVC (% pred) 100.1 +/- 10.3 105.2 +/- 13.9 FEV1/FVC‡ 0.78 +/- 0.06 0.81 +/- 0.04

Post Bronchodilator ∆ FEV1 (%)‡ 11.0 +/- 6.2 3.4 +/- 2.0

Post Exercise Max ∆ FEV1 (%)† -29.2 +/- 11.9 -0.4 +/- 3.1

* Values reported are mean +/- standard deviation unless otherwise specified † p < 0.001 ‡ p < 0.01

Figure 1.

Figure 2.

Figure 3.

Figure 4.

Figure 5.

Figure 6.

Secreted phospholipase A2 group X overexpression in asthma and bronchial hyperresponsiveness

Teal S. Hallstrand, Emil Y. Chi, Alan G. Singer, Michael H. Gelb, and William R. Henderson, Jr.

ONLINE DATA SUPPLEMENT

1

METHODS

Subjects

The University of Washington Institutional Review Board approved the study protocol,

and written informed consent was obtained from all participants. Induced sputum samples from

asthmatic for this study were obtained from a cohort of 25 patients enrolled in a study on the

pathogenesis of exercise-induced bronchoconstriction (EIB) (E1). Study subjects consisted of

persons 12-59 years of age who had a physician diagnosis of asthma for 1 year, used only an

inhaled 2-agonist for asthma treatment, and had 15% fall in forced expiratory volume in one

second (FEV1) following exercise challenge. Potential participants with asthma were excluded if

baseline FEV1 was 65% predicted, they had received treatment for acute asthma within the

prior month, or hospitalized for asthma within the prior 3 months, or had a history of life-

threatening asthma. In addition, induced sputum samples were obtained from 10 non-asthmatic

controls, consisting of persons 18-59 years of age with no history of asthma or atopy, baseline

FEV1 80% predicted, and < 7% fall in FEV1 after exercise challenge. Potential participants

were excluded if they had a history of smoking cigarettes within the prior year or 7 pack-year

smoking history. Participants were excluded if they had used an inhaled corticosteroid,

leukotriene modifier, long-acting antihistamine, cromone, or long-acting 2-agonist in the 30

days prior to the start of the study.

Study Protocol

The first visit consisted of a physical examination, spirometry, and in the asthma group

an exercise challenge to determine eligibility for the study. Each subject had 2 induced sputums.

One visit consisted of spirometry before and 15 min after administration of 180 μg of albuterol

2

via a metered dose inhaler, followed by induced sputum. On the other visit, conducted at the

same time of day, 4-10 days apart, participants had an exercise challenge followed by induced

sputum 30 min after the end of exercise. Albuterol (180 μg via MDI) was administered 15 min

prior to the induced sputum. Subjects were asked not to exercise, use short-acting antihistamines

for 48 hours, and 2-agonist and caffeinated beverages for 6 hours prior to each study visit.

Spirometry, Exercise Challenge, and Sputum Induction

Spirometry and exercise challenge tests were conducted in accordance with American

Thoracic Society (ATS) standards (E2, E3). Exercise challenge was performed on a motorized

treadmill such that each subject sustained 85% of their maximum heart rate for the final 6 min

of exercise (E2). Subjects wore nose clips and breathed dry air (0% relative humidity, 22oC)

delivered from a weather balloon reservoir through a one-way valve (Hans Rudolph, Kansas

City, MO) during exercise. Spirometry was conducted 20 and 5 min before each exercise

challenge, and repeated at 0, 3, 6, 10, and 15 min after the end of exercise. The better of at least 2

FEV1 maneuvers within 5% of each other was recorded at each time point. Induced sputum was

conducted with 3% hypertonic saline via an ultrasonic nebulizer (DeVilbiss, Somerset, PA) (E4).

At 2-min intervals, subjects were asked to clear saliva from their mouth and then expectorate

sputum. Sputum was collected over 12 min and was pooled into a single sample container. The

induced sputum was placed on ice immediately and processed within 30 min of collection.

Samples were coded with a subject number, visit number, and date.

3

Induced Sputum Processing

Following the addition of an equal volume of DTT 0.1% (Calbiochem, La Jolla, CA), the

induced sputum sample was mixed gently with a vortex mixer and placed in a shaking water bath

at 37oC for 15 min. A plastic transfer pipette was used periodically to further mix and disperse

the sample. A 1 ml portion of the sample was removed for cell counts and cytocentrifuge

preparations. The remaining dispersed induced sputum sample was centrifuged at 250 x g for 10

min and the supernatant removed from the cell pellet. The supernatant was centrifuged a second

time at 4,000 g for 20 min and the supernatant stored for protein analysis with the addition of

PMSF and EDTA, and for eicosanoid analysis by the addition of 4 volumes of methanol with

0.2% formic acid (E5). The cell pellet was resuspended in RLT buffer (Qiagen, Valencia, CA)

with -mercaptoethanol, and passed through an 18g needle 5-6 times. After lysis, the cell pellet

was stored at –80oC. Total RNA was extracted from the lysed cell pellet using the RNeasy

protocol (Qiagen).

Eicosanoid Measurements

The levels of cysteinyl leukotriene (CysLT)s, prostaglandin (PG)D2, 15S-

hydroxyeicosatetraenoic acid (15S-HETE) and PGE2 were measured in the control group for this

study and compared to values previously measured in the asthma group (E1). The samples were

brought to ~13% methanol by the addition of 5 volumes of 0.03% formic acid in high purity

water, and loaded onto a Oasis HLB column (Waters, Milford, MA). The samples were washed

with 0.03% formic acid in water, 0.03% formic acid in 10% ethanol, and hexanes, and then

eluted with 0.2% formic acid in methanol (E6). The samples were evaporated to dryness in a

4

centrifugal concentrator, and resuspended in assay buffer at their original volume. The levels of

CysLTs, PGD2, 15S-HETE, and PGE2 were measured by enzyme immunoassay (Cayman, Ann

Arbor, MI). PGD2 was measured as the stable PGD2-MOX derivative after treatment of the

sample with methoxylamine hydrochloride. Recovery was 78% for 15S-HETE, and 100% for

CysLTs and PGD2 after solid phase extraction.

Semi-quantitative RT-PCR

Semi-quantitative PCR was conducted on 5 representative asthmatic subjects from RNA

isolated from the baseline induced sputum sample. Ribogreen reagent was used to measure the

RNA concentration. The RNA was precipitated with ethanol, and redissolved in nuclease-free

Tris-EDTA buffer to give an RNA concentration of 100 ng/μl. First strand cDNA was

transcribed from 10 μl of this RNA with SuperScript II RT and oligo(dT)12-18 primers

(Invitrogen, Carlsbad, CA). PCR was conducted using primers for the secretory and cytosolic

PLA2s and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) specified in Table EI. The

amount of cDNA solution from each induced sputum sample was determined empirically by the

amount of cDNA solution that was sufficient to give a just perceptible band from the GAPDH

primers after 23 cycles of PCR. PCR was performed with 0.6 U of Qiagen Hotstar Taq

polymerase and 200 μM of each primer under the following conditions: 95oC, 15 min; (94

oC, 45

sec; 60oC, 1 min; 68

oC, 45 sec) for 23 cycles; 68

oC, 5 min. At the end of this program 5 μl of

reaction product was removed for agarose gel analysis and PCR was continued under the

following conditions: (95oC, 45 sec; 60

oC, 1 min; 68

oC, 45 sec) for 4 cycles; 68

oC, 5 min. A 5

μl analytical sample was taken and this modified PCR program was repeated twice more. The

PCR products after 23, 27, 31, and 35 total cycles were run on separate 2% agarose gels with

5

detection by ethidium bromide. The relative amounts of the mRNAs were calculated based on

the observation that four cycles of PCR results in a ten fold increase in PCR product under these

conditions after the band has become perceptible on an agarose gel through at least eight more

cycles of PCR, corresponding to a linear range of 100-fold increase in product.

Quantitative Real-time PCR

Quantitative PCR was conducted on paired samples from 8 representative asthma

subjects and 10 control subjects collected at baseline and 30 min post-exercise. The primers for

human sPLA2 groups V, X, XIIA, and GAPDH were designed using Primer Express Version 1.0

(Applied Biosystems, Foster City, CA) and are specified in Table EII. All primers crossed large

intronic sequences. Human K-562 cell line cDNA was used to make standard curve. All cDNA

samples were diluted to 50 ng/μl. Quantitative real-time PCR was conducted using SYBR Green

master mix, and monitored on an ABI Model 7900 real-time PCR system (Applied Biosystems,

Foster City, CA). Thermal cycler conditions were as follows: Stage 1: 50oC, 2 min; Stage 2:

95oC, 10 min; Stage 3: step 1: 95

oC 0.15 min, step 2: 60

oC 1 min, for 40 cycles.

Immunocytochemistry

The total and differential cell counts were conducted for this study in the control group

and compared to values previously reported in the asthma group (E1). The total cell count was

determined with a hemocytometer on a 1 ml portion of the induced sputum supernatant, and

slides for differential cell counts and immunocytochemistry were prepared with a cytocentrifuge.

Slides were stained (Hema 3, Fisher Diagnostics, Middletown, VA) and at least 400 non-

6

squamous cells counted per slide. The differential cell count of inflammatory and epithelial cells

was based on morphological criteria (E4).

Immunocytochemistry was conducted on 8 representative asthma subjects and 5

representative control subjects from cytospin preparations of induced sputum obtained at

baseline and 30 min post-exercise. The cytospin slides were initially fixed in methanol, and then

methyl Carnoy’s solution. All immunolabeling was conducted at 24oC. Endogenous peroxidase

activity was inactivated by 0.75% hydrogen peroxide for 30 min. Slides were washed and

incubated with polyclonal rabbit antibodies raised against human sPLA2 groups V, X, and XIIA

at a dilution of 1:100 for 30 min (E7). The slides were washed and incubated with a horseradish

peroxidase (HRP) conjugated goat anti-rabbit antibody (Vector Laboratories, Burlingame, CA) at

a dilution of 1:40 for 30 min. Control preparations were prepared with pre-immune rabbit sera.

Detection of peroxidase was with 0.5% 3’,3’-diaminobenzidine tetrachloride and 0.15%

hydrogen peroxide, which stains the cells brown/black. The nuclei were counterstained with

Vector Hematoxylin QS. For each slide, 280-500 cells were counted and the results were

expressed as the percentages of the total cells.

Western Blots

Western blots were conducted on paired induced sputum samples from 5 representative

subjects at baseline and post-exercise from each of the groups. The protein concentration of the

induced sputum supernatant was measured with the Coomassie Plus Braddford assay (Pierce,

Rockford, IL). Between 3 and 5 μg of total protein was loaded into each well. The same amount

of total protein was loaded for each pair of samples. The optimal loading condition for each of

the proteins was determined empirically using the recombinant protein (data not shown). sPLA2-

7

V was prepared under reducing conditions without heating. sPLA2-X was prepared under

reducing conditions and was heated to 70oC for 10 min. sPLA2-XIIA was not reduced or heated.

The proteins were separated on a 12% NuPAGE Bis-Tris gel (Invitrogen, Carlsbad, CA) at 200V

for 28 min. Proteins were transferred by semi-dry transfer to polyvinyldifluoride (PVDF)

membranes at 110 mAmp for 40 min. For sPLA2-X, non-specific binding was blocked with 5%

nonfat milk in Tris-buffered saline with 0.1% tween-20 (TBST) for 2 hours at RT. The

membrane was incubated with rabbit polyclonal anti-sPLA2-X antibody overnight at 4oC, and

then subsequently incubated with goat anti-rabbit HRP-linked antibody (Cell Signaling, Danvers,

MA) for 1 hour at RT (Figures E6A and B). For sPLA2 groups V and XIIA, non-specific binding

was blocked with NETG-buffer (150 mM NaCl, 5 mM EDTA, 50 mM Tris-HCl, pH 7.5, 0.05%

triton-X, 0.25% gelatin) for 30 min at RT. The membrane was incubated with rabbit polyclonal

anti-sPLA2 antibody for 2 hours at RT, and then subsequently incubated with goat anti-rabbit

HRP-linked antibody for 1 hour at RT (Figure E6C). For sPLA2-V, this procedure was repeated

on samples from one subject with a murine monoclonal anti-sPLA2 hG V antibody and a horse

anti-mouse HRP-linked antibody (Figure E6D). The peroxidase activity of the blots was detected

using LumiGLO ECL reagents (Cell Signaling, Danvers, MA). One membrane was reprobed

with a murine monoclonal anti- -actin antibody and horse anti-mouse HRP-linked antibody to

detect evidence of cell lysis releasing this intracellular protein during induced sputum

processing.

Statistical Analysis

The PLA2 expression data are reported as the mean +/- SD. Differences between the

baseline and post-exercise gene expression, protein, and eicosanoid products were analyzed with

8

a paired t test after log transformation. The differences in the percentage of cells immunostaining

for the different sPLA2s at baseline and post-exercise were analyzed with a paired t test.

Comparisons between the groups were made with unpaired t tests. Comparisons of the

concentrations of cells in induced sputum between the groups were made with a Mann-Whitney

U test. Changes in the concentrations of cells in induced sputum between baseline and post-

exercise were made with the Wilcoxon signed-rank test.

9

RESULTS

Comparison of Eicosanoid Levels

At baseline the ratio of CysLTs to PGE2 was elevated in the asthma group compared to

control (p=0.03), and this ratio increased markedly in the asthmatics, while this ratio decreased

following exercise challenge in controls (Figure E1). The geometric mean levels of CysLTs

(167.6 vs. 132.8 pg/ml, p=0.17), PGD2 (486.5 vs. 483.6 pg/ml, p=0.97), 15S-HETE (26.2 vs.

24.4 ng/ml, p=0.50) in the control group did not increase following exercise challenge as had

been observed in the cohort of asthmatics in this study and in other studies (E1, E8, E9). The

geometric mean level of PGE2 did not decline following exercise challenge in the control group

(125.5 vs. 177.7 pg/ml, p=0.26) as had been observed in the asthma group (E1). A comparison of

the mean baseline level of eicosanoids between the asthma and control groups demonstrated a

trend towards higher levels of CysLTs in the asthma group (641.5 vs. 284.0 pg/ml, p=0.06), but

no detectible difference in the basal levels of 15S-HETE (64.9 vs. 33.0 ng/ml, p=0.32) or PGE2

(321.9 vs. 241.0 pg/ml, p=0.54). Following exercise challenge the levels of CysLTs and 15S-

HETE were markedly elevated in the asthma group compared to control (Figures E2A and B),

while the level of PGE2 was no different between the groups (Figure E2C). The level of PGD2

had not been measured in the asthma group and could not be compared between the groups.

Comparison of Cellular Constituents of Induced Sputum

There were no differences in the volume (4.7 vs. 3.8 ml, p=0.18), concentration of lower

airway cells excluding squamous epithelial cells (1.3 x 106 vs. 1.0 x 10

6 cells, p=0.67), or

percentage of squamous epithelial cells (23.4 vs. 24.6 %, p=0.57) in the baseline induced sputum

between asthma and control groups respectively. The median concentration of eosinophils was

10

increased in the asthma group (2.51 x 104 vs. 0.9 x 10

3 cells/ml, p<0.01); however, there were no

differences in the median concentrations of lymphocytes (1.7 x 104 vs. 1.9 x 10

4 cells/ml,

p=0.33), macrophages (4.8 x 105 vs. 5.6 x 10

5 cells/ml, p=0.65), neutrophils (4.6 x 10

5 vs. 3.2 x

105 cells/ml, p=0.32), or columnar epithelial cells (6.2 x 10

4 vs. 1.7 x 10

4 cells/ml, p=0.62)

between the groups. The concentration of epithelial cells in induced sputum increased in both the

asthma and control groups following exercise challenge (Figure E3). In the asthma group, there

were no changes in the concentration of leukocytes following exercise challenge (Figure E3A);

however, in the control group there was a decrease in the concentration of lymphocytes and an

increase in the concentration of neutrophils following exercise challenge (Figure E3B).

Comparison of the median concentrations of induced sputum cells between the groups following

exercise challenge showed that only eosinophils were higher in the asthma group relative to

controls (2.4 x 104 vs. 0.0, p=0.01), but no differences were identified in the concentrations of

lymphocytes, macrophages, neutrophils, or epithelial cells.

Secreted PLA2 Immunocytochemistry

Immunostaining for sPLA2 groups V, X, and XIIA in the baseline induced sputum

samples localized predominantly to columnar epithelial cells and bronchial macrophages, and to

a lesser degree eosinophils (Figure E4). Control slides immunolabeled with pre-immune rabbit

serum did not have any immunostaining (data not shown). The percentage of cells

immunostaining for sPLA2-V did not increase in either of the groups in response to exercise

challenge (Figure 6A). Immunostaining for sPLA2-V in bronchial macrophages tended to

increase in asthmatic subjects following challenge; while no changes were observed in columnar

epithelial cells or eosinophils in asthmatics (Figure E5A), and no changes were identified in any

11

induced sputum cell type in controls (Figure E5B). The percentage of cells in induced sputum

immunostaining for sPLA2-X increased in asthmatic subjects following challenge, but not in

controls (Figure 4B). The increase in immunostaining for sPLA2-X in asthmatic subjects was in

bronchial macrophages and columnar epithelial cells but not eosinophils (Figure 4C). No

changes occurred in these cells following exercise challenge in the control group (Figure 4D).

There was a marked increase in the percentage of induced sputum cells immunostaining for

sPLA2-XIIA following exercise challenge that occurred in the asthma group that was not seen in

the control group (Figure 5B). The increase in immunostaining in the asthma group was

predominantly in bronchial macrophages and columnar epithelial cells, but also occurred in

eosinophils (Figure E5C). No similar changes were observed in induced sputum cell subtypes in

the control group (Figure E5D).

12

Table EI. Primers sequences for semi-quantitative PCR

Group Sense strand primer Antisense strand primer

GIB cgtgtggcagttccgcaaaatgatcaag gcagatagaggtgatgcttttgagaggtg

GIIA tgatctttggcctactgcaggcccatg gaaattcagcactgggtggaaggtttcc

GIID caagatggtcaagcaagtgactgggaaaatg gagtgtttgaaaagccaggctggttcag

GIIE ctgctttcttctgctgccttttatgctc gcttgttgggataatgggcatatttgcg

GIIF ctcaggtctagcctgggtatgaagaag cagactatctcagtgttgttctcgatggtg

GIII cgaggttaccaacatgctttgggagctg gagattcccaaggcttggcatagccatg

GIV tctcaccctgattttccagagaaagggccagagg ctgcaaacatcagctctgaaacgtcaggtttgac

GIV tgagttgctgaagacccaggtgaccaagaacaag ttctaagaagcagatgcgggactcaggaagcctc

GIV ctcggccttctagacactgtgacctacctgagtg caagttggtgcggacgttgacactggtgtaaatg

GIV ttgttgagtaccagctcgcattgtgccagctaag tggccatacacggaggtcatggatcttgttccac

GIV aagcttgctgacacctacactctagatgtggtgg cttcagctccttggacaccttcttctgaatgacg

GIV accaaacaacattgcagaccaccagagtccttgg ctcgaagtcttcctccttgtaggtcatgttggac

GV gatttgaggccaggccaaagagaaccc ggagcagaggatgttgggaaagtattgg

GX gaactggcaggaactgtgggttgtgttg actgagaggacgctttatttccttgtgc

GXIIA accatccggaacggcgttcataagatag tcatctgtcactagctgtcggcatctcc

GXIIB gacttgggcattccagcaatgacaaagtg cttgaaggctgacagctgtggtgtcac

GAPDH ctctccagaacatcatccctgcctctac gggtctctctcttcctcttgtgctcttg

13

Table EII. Primers sequences for quantitative real-time PCR

Group Sense strand primer Antisense strand primer

GV cgttcttccctgtcaccttc gcttggttcctggcttgtag

GX gcaggaactgtgggttgtgtt ccatggcagcaccagtcaat

GXIIA tgtttggtgttcatcttaacattgg catcacagtcattcttgctttt

GAPDH ggagtcaacggatttggtcgt gcaacaatctccactttaccagagttaa

14

Figure E1. Opposing effects of exercise challenge on the CysLT to PGE2 ratio in induced

sputum. Asthmatics with EIB have an increase in the CysLT to PGE2 ratio in response to

exercise (A), while normal controls have a decrease in the CysLT to PGE2 ratio following

exercise challenge (B). The levels of CysLTs and PGE2 in the asthma group were previously

reported (E1).

15

Figure E2. Comparison of the levels of eicosanoids in induced sputum between asthmatics and

normal controls. The level of CyslTs tended to be higher at baseline, while there were no

baseline differences in the levels of 15S-HETE and PGE2 between the groups (see text).

Following exercise challenge, the levels of CysLTs (A) and 15S-HETE (B) were elevated in the

asthma group compared to the control group, while no difference was detected for PGE2 (C). The

levels of CysLTs, 15S-HETE and PGE2 in the asthma group were previously reported (E1, E8).

16

Figure E3. Concentration of leukocytes and epithelial cells in induced sputum at baseline and on

a separate day 30 min after exercise challenge in asthmatics with EIB (A) and non-asthmatic

controls (B). The concentrations of leukocytes and epithelial cells in the asthma group were

previously reported (E1).

17

Figure E4. Comparison of the baseline immunostaining of sPLA2 groups V, X, and XIIA in

induced sputum cells in asthmatics and controls. The figure shows the percentage of induced

sputum cells immunostaining positive for the sPLA2 out of all induced sputum cells.

18

Figure E5. Effects of exercise challenge on the percentage of induced sputum cells

immunostaining for sPLA2 groups V and XIIA. Immunostaining for sPLA2-V in bronchial

macrophages (Mac) tended to increase in asthmatic subjects following challenge (A), while no

changes were observed in columnar epithelial cells (Epi) or eosinophils (EOS) in asthmatics, and

no changes were identified in any cell type in controls (B). Immunostaining for sPLA2-XIIA in

asthmatic subjects increased in bronchial macrophages (Mac) and columnar epithelial cells (Epi),

and tended to increase in eosinophils (EOS) (C); while no changes were observed in the control

group (D).

19

Figure E6. Western blots of sPLA2 groups V and X. Western blots from asthmatic induced

sputum samples were conducted in 5 representative subjects (labeled 1-5) at baseline (left) and

post-exercise (right) for sPLA2-X (A) and sPLA2-V (C). A Western blot was also conducted on 5

representative asthmatic (left) and non-asthmatic (right) induced sputum samples post-exercise

(B). Western blots for sPLA2-X were conducted with a rabbit polyclonal antibody (A, B).

Western blots for sPLA2-V were conducted with the rabbit polyclonal antibody (C) and a murine

monoclonal antibody (D). The recombinant protein (rhG V or rhG X) is to the right of the ladder.

20

REFERENCES

E1. Hallstrand, T. S., M. W. Moody, M. M. Wurfel, L. B. Schwartz, W. R. Henderson, Jr.,

and M. L. Aitken. 2005. Inflammatory basis of exercise-induced bronchoconstriction. Am J

Respir Crit Care Med 172(6):679-86.

E2. Crapo, R. O., R. Casaburi, A. L. Coates, P. L. Enright, J. L. Hankinson, C. G. Irvin, N. R.

MacIntyre, R. T. McKay, J. S. Wanger, S. D. Anderson, D. W. Cockcroft, J. E. Fish, and P. J.

Sterk. 2000. Guidelines for methacholine and exercise challenge testing-1999. Am J Respir Crit

Care Med 161(1):309-29.

E3. Miller, M. R., J. Hankinson, V. Brusasco, F. Burgos, R. Casaburi, A. Coates, R. Crapo, P.

Enright, C. P. van der Grinten, P. Gustafsson, R. Jensen, D. C. Johnson, N. MacIntyre, R.

McKay, D. Navajas, O. F. Pedersen, R. Pellegrino, G. Viegi, and J. Wanger. 2005.

Standardisation of spirometry. Eur Respir J 26(2):319-38.

E4. Fahy, J. V., H. A. Boushey, S. C. Lazarus, E. A. Mauger, R. M. Cherniack, V. M.

Chinchilli, T. J. Craig, J. M. Drazen, J. G. Ford, J. E. Fish, E. Israel, M. Kraft, R. F. Lemanske,

R. J. Martin, D. McLean, S. P. Peters, C. Sorkness, and S. J. Szefler. 2001. Safety and

reproducibility of sputum induction in asthmatic subjects in a multicenter study. Am J Respir

Crit Care Med 163(6):1470-5.

E5. Konstan, M. W., R. W. Walenga, K. A. Hilliard, and J. B. Hilliard. 1993. Leukotriene B4

markedly elevated in the epithelial lining fluid of patients with cystic fibrosis. Am Rev Respir Dis

148(4 Pt 1):896-901.

21

E6. Kita, Y., T. Takahashi, N. Uozumi, and T. Shimizu. 2005. A multiplex quantitation

method for eicosanoids and platelet-activating factor using column-switching reversed-phase

liquid chromatography-tandem mass spectrometry. Anal Biochem 342(1):134-43.

E7. Degousee, N., F. Ghomashchi, E. Stefanski, A. Singer, B. P. Smart, N. Borregaard, R.

Reithmeier, T. F. Lindsay, C. Lichtenberger, W. Reinisch, G. Lambeau, J. Arm, J. Tischfield, M.

H. Gelb, and B. B. Rubin. 2002. Groups IV, V, and X phospholipases A2s in human neutrophils:

role in eicosanoid production and gram-negative bacterial phospholipid hydrolysis. J Biol Chem

277(7):5061-73.

E8. Hallstrand, T. S., J. S. Debley, F. M. Farin, and W. R. Henderson, Jr. 2007. Role of

MUC5AC in the pathogenesis of exercise-induced bronchoconstriction. J Allergy Clin Immunol

119(5):1092-8.

E9. Mickleborough, T. D., M. R. Lindley, and S. Ray. 2005. Dietary salt, airway

inflammation, and diffusion capacity in exercise-induced asthma. Med Sci Sports Exerc

37(6):904-14.