ribosome-messenger recognition: mrna target sites for ribosomal

Nucleic Acids Research, Vol. 19, No. 1 155

Ribosome-messenger recognition: mRNA target sites forribosomal protein S1

Irina V.Boni*, Dilara M.lsaeva, Maxim L.Musychenko and Nina V.TzarevaM.M.Shemyakin Institute of Bioorganic Chemistry, USSR Academy of Sciences, UI.Miklucho-Maklaya,16/10, 117871 GSP Moscow, USSR

Received June 26, 1990; Revised and Accepted November 29, 1990

ABSTRACT

Ribosomal protein S1 Is known to play an important rolein translational initiation, being directly Involved Inrecognition and binding of mRNAs by 30S ribosomalparticles. Using a specially developed procedure basedon efficient crossllnking of S1 to mRNA induced by UVirradiation, we have identified S1 binding sites onseveral phage RNAs in preinltiation complexes. Targetsfor S1 on Q/3 and fr RNAs are localized upstream fromthe coat protein gene and contain oligo(U)-sequences.In the case of Q/3 RNA, this S1 binding site overlapsthe S-site for Q/3 replicase and the site for S1 bindingwithin a binary complex. It is reasonable that similarU-rich sequences represent S1 binding sites onbacterial mRNAs. To test this idea we have used £. collssb mRNA prepared in vitro with the T7 promoter/RNApolymerase system. By the methods of toeprinting,enzymatic footprinting, and UV crosslinking we haveshown that binding of the ssb mRNA to 30S ribosomesis S1-dependent. The oligo{U)-sequence preceding theSD domain was found to be the target for S1. Wepropose that S1 binding sites, represented bypyrimidine-rich sequences upstream from the SDregion, serve as determinants involved In recognitionof mRNA by the ribosome.

INTRODUCTION

In the regulation of gene expression at the translational level theefficiency by which 30S ribosomal subunits recognize and bindtranslational initiation regions of mRNAs is a major factor thatdetermines the level of protein synthesis (1,2). The mechanismfor specific ribosome-messenger binding is still debated. Thereare two ways by which a ribosome as a ribonucleoprotein mightrecognize a nucleotide sequence of mRNA while searching fora translational start: RNA-RNA and RNA-protein interactions.Both kinds of interactions are known to be involved in initiationof translation (1 —4). Interaction between the 3'-terminal part of16S RNA and a purine-rich sequence preceding the initiationcodon [the Shine -Dalgarno (SD) interaction] has been provenin many experiments (1 -3,5,6). The vast majority of bacterial

and phage mRNAs use the SD interaction during translationalinitiation. But the presence of the 'good' SD domain situated atthe proper distance from the initiation codon is not a guaranteethat a sequence will be bound by the ribosome with highefficiency. To explain a wide variation in rates of translation ofdifferent genes, including different rates for different cistronswithin one polycistronic mRNA (7), other factors must be takeninto account. These could be a secondary structure which masksor on the contrary exposes the initiation signals (2,8 — 10), orother primary structure recognition determinants. Two additionalsites of complementarity between mRNA and 16S-RNA wererecently proposed as extra recognition signals (11 — 12).

In our work we have concentrated on the second type ofribosome-messenger interactions: interactions of mRNA withribosomal proteins. The possibility that site-specific mRNA-protein interactions take place during translational initiation cannotbe excluded and the best candidate to have special targets onmRNAs is ribosomal protein SI. This protein has prominentRNA-binding features with high affinity to pyrimidine-richsequences (13). Numerous observations suggest that SI is directlyinvolved in die process of mRNA recognition and binding(13—16). SI is associated with 30S subunits via its N-terminalglobular domain by means of protein-protein interactions (17,18),while its elongated C-terminal part [containing RNA-bindingcenter(s)] lies free within 30S particles in such a manner as toprovide binding of mRNA to the ribosome.

Our aim in this work was to localize SI binding sites ondifferent mRNAs. We have developed a procedure that allowedus to find target sites for SI on phage RNAs (Q/3 and fr) boundto 30S subunits in preinitiation complexes. These sites are situatedupstream from the coat protein genes and contain oligo(U)-tracts.To test the idea that similar sequences represent targets for SIon bacterial mRNAs we have chosen the ssb gene off. coli whichcontains an oligo(U)-sequence upstream from the SD-domain(19,20). We have shown that in vitro initiation complex formationbetween the ssb mRNA and 30S subunits is dependent on SI:free SI activates the process of mRNA binding by 30S particleslacking SI, and acts as a translational represser if added in amolar excess over the 30S particles. The target for SI on thessb mRNA has been found to be the oligo(U) sequence in theleader of die messenger.

• To whom correspondence should be addressed

Downloaded from https://academic.oup.com/nar/article-abstract/19/1/155/2387568by gueston 18 February 2018

156 Nucleic Acids Research, Vol. 19, No. 1

MATERIALS AND METHODS30S subunits, protein SI, antibodies against SI (anti-Si IgG)E. coli MRE 600 30S ribosomal subunits prepared according to(21) were generously supplied by V.I. Machno and S.V.Kirillow. 30S particles lacking protein SI were prepared usingpoly(U)-Sepharose (13). Protein SI was isolated and purified asdescribed previously (18). Rabbit antiserum against SI wasobtained by a routine procedure (22). Purified IgG fraction wasobtained by affinity chromatography on protein A-SepharoseCL-4B (Pharmacia). Immunoblotting of total 30S ribosomalproteins [fractionated according to Laemmli (23)] indicated thatour preparation of anti-Si IgG reacted only with SI.Electrotransfer of proteins onto Schleicher and Schuell BA85nitrocellulose sheets and development of immunoblots wereperformed according to Towbin et al. (24).

Messenger RNAsRNA-containing bacteriophages were gifts of A.B. Chetverin(phage Qj3) and V.M. Berzin (phage fr). Phage RNAs wereprepared by the SDS-phenol procedure (4).

The plasmid pJA45 bearing the E. coli ssb gene was kindlyprovided by J.A. Brandsma (19). The Pstl-EcoRI fragmentcontaining the ssb gene and its leader part was ligated into thecorresponding sites of pGEM 2 (Promega) under the control ofT7 promoter. The resulting plasmid pGS 2.3 was linearized atthe EcoRI site and used for mRNA preparation in vitro. RNAsynthesis and purification were performed using the reagents andprotocols of the Riboprobe System II (Promega).

Preparation of 30S-phage RNA complexes30S subunits (40 A260 units, 3 nmol) were incubated with thephage RNA QjS or fr (about 40 A260 units) at 37CC for 10 minin 1 ml of binding buffer (20 mM Tris-HCl,pH 7,6/10 mMMgCl2/ 100 mM NH4CI/ 6 mM 2-mercaptoethanol) and thencooled on ice. A portion of the mixture was stored as a control,while another part was irradiated at 0°C with stirring by the fulllight of three low pressure mercury lamps at a dose of 15 quantaper nucleotide (18). The incident light intensity was 2xlO17

quanta/cm2/min (X=254 run). Irradiated and control sampleswere supplemented with SDS and EDTA to give finalconcentrations of 1 % and 0.02 M respectively. The mixtures werethen fractionated on 10—30% linear sucrose gradients in 10 mMTris-HCl, pH 7.6/ 0.1 % SDS/ 0.15 M LiCl/ 10 mM EDTA bycentrifugation in Beckman SW-27 rotor at 12°C for 20 h at 26000rpm. Fractions containing phage RNA were pooled, precipitatedwith ethanol, pelleted, dissolved in binding buffer and stored at-20°C.

Isolation and identification of phage RNA fragments boundto SITo isolate phage RNA crosslinked to protein SI a specificimmunoadsorbent was prepared. 500 fi\ of protein A-SepharoseCL-4B gel swollen in water was shaken with 3.4 mg of purifiedanti-Si IgG in binding buffer at 20°C for 1 h, collected bycentrifugation and washed with the same buffer. The binding ofIgG to the adsorbent was about 100%. Phage RNA isolated fromirradiated and control samples (about 3 —4 A26O units of each)was incubated overnight at 4°C in binding buffer with 40 fil ofthe immunoadsorbent gel. Subsequently 20U of RNase Tl wereadded and samples were kept at 37°C for 30 min to yield partialdigestion, sedimented, washed several times, collected bycentrifugation and resuspended in kinase buffer (10 mM Tris-

HCl.pH 8.0/10 mM Mg acetate/15 mM 2-mercaptoethanol). Tolabel the immobilized fragments, 100 /tCi of 7-32P-ATP(Amersham) and 5U of T4 polynucleotide kinase (BoehringerMannheim) were added and samples were incubated at 37 °C for30 min, washed with water, supplemented with 20 /il of 10%SDS and 40 /il of 10M urea, incubated at 37°C for 2h withshaking, and sedimented. Supernatants were loaded on a 8%acrylamide gel containing 0.1 % SDS and 8M urea. The gels wererun at 40 mA until the xylene cyanol reached the bottom. Labeledfragments crosslinked to SI were visualized by autoradiography,eluted from the gel overnight in a solution containing 0.3 MNaCl/0.1 % SDS and 10 mg/ml proteinase K (Merck), extractedwith phenol, precipitated with ethanol in the presence of carriertRNA, dissolved in 10M urea and fractionated on a 15%sequencing gel. Individual fragments visualized byautoradiography were eluted with 12% NaClO4 at roomtemperature overnight, precipitated with 5 vol. of cold acetonein the presence of 100 /ig of Dextran 110000 (Fluka) .collectedby centrifugation.dried in vacuo, dissolved in water, and subjectedto sequence analysis by the enzymatic method of Donis-Kelleret al. (25) using RNA sequencing kits and the correspondingprotocol of P.L.-Pharmacia.

30S initiation complex formation with the ssb mRNA and itsdependence on SIInitiation complex formation between 30S particles (standard orlacking SI), the prepared in vitro and purified ssb mRNA anduncharged initiator tRNA (Boehringer Mannheim) was testedusing toeprinting techniques according to Hartz et al. (26) withminor modifications. A 17-base primer 5'-GGCAACTGCGCC-ACCAT-3' used in primer extension reactions hadcomplementarity to nucleotides +76 to +92 of the ssb mRNAcoding sequence (20). Usually each reaction contained in 10 /xlof binding buffer 2.5 pmol of 30S subunits, 25 pmol of tRNAj^and 0.5 pmol of the ssb RNA annealed with the 5'-labeled primer.In experiments on SI dependence of initiation complex formation,

30S.IF3* m R N A J & 3OSI1F3) • m RNA 0)

0*C

crou-Linktd coeplt"

dissociation

sucrost graditfitD-30%

20«*1Tns-HClj)H7610CBM EOTAQJ5MUCLaiV.SDS

. V r t M *

W% I 30%

isolation of «*• RNA from cnm-Lmktd coaptn

'\/v\rv\r

tnzyatic ttqutnci(IB

St-otigonucltotilt

prottinast K

(3)

Figure 1. A scheme for the isolation and analysis of phage RNA fragmentscrosslinked to protein SI by UV irradiation.



free S1 in binding buffer or an equal volume of the buffer wasadded to mRNA prior to addition of 30S subunits. Probes werepreincubated with mRNA at 37°C for 10 min, and then incubatedfor 10 min more with 30S subunits and initiator tRNA. Forprimer extension AMV reverse transcriptase (USSR preparation,Omutninsk) was added followed by incubation at 37 °C for 30min.

RNase protection experimentsPartial digestions of the ssb RN A and its complex with S1 wereperformed with RNases U2 (A-specific) and T2 (non specific).The ssb mRNA (0.8 pmol per reaction) was preincubated at 37 °Cfor 10 min in binding buffer with increasing amounts of SI orequal volumes of binding buffer. Subsequendy, 3 /tg of carriertRNA and 3 'sequence units' of RNase U2 (Pharmacia sequencegrade) or 5 X 10~3 U of RNase T2 (Sankyo) were added anddigestion allowed to proceed at 37 °C for 3 min (U2) or 2 min(T2). Reaction volume was 15 jil. Digestions were stopped bythe addition of 15 /il of 0.4 M Na-acetate (pH 4.8)/20 mM EDTAcontaining 0.5 mg/ml of carrier tRNA, followed by phenolextraction and precipitation with ethanol. Probes were analyzedby primer extension.

UV-induced crosslinking of SI to the ssb mRNAEach reaction contained in 10 /il of binding buffer 6 pmol of thessb mRNA, 0,15 or 30 pmol of SI and 1U of RNasin (Promega).5 /A of each probe was irradiated with UV-light (incident lightintensity was 3 X1017 quanta/min/cm2) for 8 min at 0°C.Subsequently each irradiated and non-irradiated sample wasanalyzed by primer extension.

RESULTS AND DISCUSSIONSite-specific interaction of protein SI with RNAs from RNA-containing bacteriophagesIt is well known that on phage RNAs there is only one 'entry'site for the ribosome—the initiation region of the coat proteingene (27). 30S ribosomal subunits are able to recognize this siteeven in the absence of an initiator tRNA, but protein SI appearsto be strongly needed for the recognition process (13-16,27—29). To identify phage RNA regions involved in interactionwith S1 during initiation complex formation we have developeda special procedure which is schematized in Fig. 1. The approachis based on the ability of the RNA-binding center of SI to

uv +

Bi -

a s -

oi —

xc—

8 %

1 5 %

-F L G + + A GU U

1 2 4 7-A

A C AG +G G + +-EIQ2 + Q3)

U U U

t«

1 2 3 4 5 6

B

Figure 2. UV crosslinking of protein SI to Qfi RNA within 30S-Q/? RNA preinitiation complex. A. Isolation of labelled fragments crosslinked to SI (step VII onFig. I). Autoradiogram of a 8% acrylamide gel containing 0.1 % SDS and 8M urea. UV + and - indicates the lanes with irradiated and nonirradiated controlsamples. Exposure time—5 min. This step in the procedure gives the same picture for all phage RNAs tested. The position of the labeled material corresponds tothat of SI in the same gel as was revealed by immunoblotting (indicates by an arrow). B. Separation of Q/J RNA fragments specific for SI after removing oflinked protein by proteinase K treatment (step Vm on Fig. 1). Autoradiogram of a 15% sequencing gel. XC-xylene cyartol. Exposure time- 20 min. Ql—the majorSI bound fragment, Q2,Q3—the minor ones which were revealed with longer exposure. C. UV crosslinking of protein SI to Qfi RNA is sequence specific. Enzymaticsequencing of Ql fragment (B). Lanes: E-control ( - enzyme), L—a ladder prepared by nonspecific cleavage, G-digestion by RNase Tl, U + C - Bacillus cereuspyrimidine specific RNase, A + U—RNase Phy M, A—RNase U2. All RNases were from RNA sequencing kit (P.L.-Pharmacia). D. Comparison of sequence patternsfor major (lane 1) and minor (lanes 2—6) SI linked Q/3 RNA fragments. A gap in digestion patterns indicated by an arrow might point the region where residualcrosslinked peptides are located.



covalently crosslink with bound polynucleotides under UV-irradiation of Sl-polynucleotide complexes (18). This propertyis observed not only in model systems: SI is the most prominentprotein crosslinked to mRNAs under UV-irradiation of intact E.coli cells (30).

We have investigated where SI binds to phage RNAs within30S preinitiation complexes formed in the absence of initiatortRNA in conditions described by Van Duin et al. (28). 30Ssubunits used in this experiments contained almost equimolaramounts of SI and no less than 0.2 mole of IF3 per mole ofribosomes. After irradiation with UV-light (X = 254 nm) at doseswhich don't abolish ribosomal activity (18), the complexes weredissociated by addition of SDS and EDTA and phage RNA wasseparated from 16S RNA and nonlinked proteins on sucrosegradients (step m, Fig. 1). Full length phage RNA isolated fromthe gradient fractions was immobilized on the specificimmunoadsorbent, protein A-Sepharose containing anti-Si IgG,and partially digested with RNase Tl in the presence ofmagnesium ions to conserve the elements of a secondarystructure. All protein-free fragments were washed out and as aresult only oligonucleotides covalently bound to SI remainedattached. They were labeled at 5'-ends with ^P, eluted from theimmunoadsorbent and purified in a SDS and urea containingacrylamide gel. The labeled material was present in the gel onlyin the case of irradiated complex, indicating that only Sl-linkedfragments could be isolated by this procedure (Fig. 2A). Theproducts from the gel were blotted onto nitrocellulose sheets andvisualized with anti-Si IgG using the procedure of Towbin etal. (24) (data not shown). This was an additional proof that labeledmaterial in the gel was specific for Sl-linked fragments. TheSI-bound oligonucleotides eluted from the gel were treated byproteinase K to digest bound protein and fractionated on 15%sequencing gel (Fig. 2B). The autoradiogram revealed one majorand some minor fragments, which were isolated and sequencedusing base-specific ribonucleases (Fig. 2C and D).

A. AUCUIKyUJACUACaJlTOAGUUCGDUOAAACACGUUCUDGAOAGUAUCUnUlWAUDAACCCAACGCG

1 2 4 7 1 2 9 0 1 3 1 0

B . AACGGGCCTAUACCUUAACTXACCUUXX^KGAUIXMCCAUACCUUAGAUOCCUOOCCACmjUDCAG

1 2 2 6 129

U C 6u u

G UA-UU-AU-A

CA-U*GUUC

G AC-GG-C in

A-U C-GU-A C-G

1 A-U C-G

. . .AUCUUG"CUUUUUAUUAA"UCAAUUU6AUCAU6.

Results of sequencing allow us to determine within the phageRNA primary structure the location of SI-bound fragments. Allthe fragments, the major and minor ones, belong to a singleregion of phage RNA sequence which is located upstream fromthe coat protein gene: in the case of Q/J RNA this regioncomprises nucleotides 1247-1322,with A of the coat proteininitiation codon being at 1344 (31 and personal communicationof M. Billeter); in the case of fr RNA nucleotides 1226-1297and 1336, correspondingly (32) (for fr RNA sequencing gels arenot shown). The common features of these Q/3 and fr regionsare the presence of an oligo(lJ)-tracts which appear to be the sitesof Sl-crosslinking (Fig. 3A,B). The site of crosslinking can beidentified on sequence lanes of several fragments due to a gapin the RNase cleavage patterns which can be accounted by thepresence of residual crosslinked peptides (Fig. 2D).

It is of special interest that in the case of Q/3 RNA the regiondirectly involved in SI crosslinking (1292-1306) coincides withthe site bound to SI in a binary complex SI Q/3 RNA (33).Moreover, the region protected by covalendy bound SI againstdigestion with RNase Tl (die main Q/3 fragment identified inour experiments) completely overlaps with the so called S-siteof Q/3 replicase binding (31) (Fig. 3 C). SI is known to be anessential component of phage replicases and is responsible forrecognition and binding of phage RNA (31,34). Apparendy, SIparticipates in recognition of phage RNAs by ribosomes and byreplicases by similar ways: in both cases SI recognizes and bindsthe same region of die phage RNA and thus provides the properpositioning of the RNA on ribosome or replicase surfaces. This

+15

•ltd of SI

croillink ing

protoinl

Figure 3. Nucleotide sequences within Qfi (A) and fr (B) RNAs involved ininteraction with protein SI during translational initiation complex formation. Thesites most likely participating in UV crosslinking are underlined. On the Qfi RNAsequence the site involved in binding to SI within the binary complex (33) isindicated by arrows. C—a secondary structure model proposed for S site of Q0replicase binding (31). Ql fragment is indicated by arrows, the site of SIcrosslinking is underlined.

Figure 4. Extension inhibition analysis (teleprinting) of the ssb mRNA. SI activatesand then inhibits toeprints with 30S subunits lacking SI (3OS(-S1)]. Extensioninhibition reactions were performed as described in Materials and Methods. Lane1: primer extension without addition of 30S subunits. Lanes 2—6: toeprintingin the presence of 0.25 ^M of 3OS(-S1) and 2.5 /iM of tRNAf

Mn.Concentrations of SI in reactions are indicated over lanes. SI atO.6/tM stimulatesribosome binding, but a 4-fold excess of SI over 3OS(-S1) (lane 4) is alreadyinhibitory for 30S initiation complex formation.



SI-dependent binding underlies the repressor function of replicaseon coat protein synthesis (27,31).

During initiation of translation SI-messenger interaction notonly enhances the affinity of the ribosome to phage RNA [30Ssubunits lacking SI cannot bind phage RNAs (16)] but also mightdirect the initiation codon of the coat protein gene to the ribosomaldecoding center (see 16). At the same time, SI is known to bea translational repressor of the coat protein synthesis in vitro whenadded in molar excess over the ribosome (13,35). From our datathis effect can be explained as competition between free S1 (see33) and SI as a part of the 30S subunit for the same site on themessenger. Although this SI-binding site does not overlap theribosome binding site of the coat protein gene determined inRNase protection experiments (3, 36), the secondary structureof the region (Fig. 3C) is such that SI site and the initiation codonare rather close to each other. We propose that the sites containing

oligo(U) sequences in Q/3 and fr RNAs serve as recognitionsignals for 30S ribosomes during initiation complex formation.

Site-specific interaction of SI with bacterial messengersBeing an obligatory component of the translational machineryof E. coli and other Gram-negative bacteria, protein SI isinvolved in initiation of translation of almost all cellular mRNAand plays a general regulatory role in protein biosynthesis (13,37).We have proposed that interaction of S1 with bacterial messengersduring translational initiation might also be site-specific, as inthe case of phage RNAs, with high affinity to U-rich sequences.According to Sherer et al. (38) and Dreyfus (39), the optimalribosome binding site contains a U-rich region proceeding theSD domain. There exist also experimental evidences that U-richsequences located upstream from the SD signal provide highefficiency of translational initiation both in natural context

Table 1. Examples of Esohariohia coli genes which contain

oligo(U)-stretches in 5'-untranslated regions.

Genes AUG

ara BAD ACCCGUUUUUUUUGGAUGGAGUGAAACC AUG

ara FGH UCAAUUCAGUUUUUGCCCUACACAAAACGACACUAAAGCUGGAGAGACCAUG

ara C UGCAAUAUGGACAAyjJGyj2y.Cyj2Cy_CyGAAUGGCGGGAGUAUGAAAAGlJAUG

atp E UUUACCAACACUACUACGUUUUAACUGAAACAAACUGGAGACUGUCAUG

bio A ACCUAAAUCUUUUCAAUUUGGUUUACAAGUCGAUIAUG

deo C AAACUCGCAAGGUGAAUUUUAUUGGCGACAAGCCAGGAGAAUGAfiAUG

dna A 'GGGUCUUUUCGACGUACGUCAACAAUCAUG

eco R1 UAUUUUUUAUUUUAAUAAGGUUUUAAUUJ AUGmethilase

fol A AflUUUUUUU0a0CGGGAA3UC0CflAUG

gal E AUUUCAUACCAUAAGCCUAAUGGAGCGAAUlAUG

(P7J~(P1)his S GGGUUCAUUUUUAUAUUCAGAAAGAGAAUAAAC GUG

met S UAACCCCUUUUCACUAUUAAGAAGUAAUGCCUGCCUACIAUG

mUt H AAUAUUCGGCACAUAAUUGCUGUUUGUUUUUUAAUCAAGGUAUCAUGACAUG

omp A AUAUUCAUGGCGUAUUUUGGAUGAUAACGAGGCGCAAAAAAUG

pho A GUUUUUAUUUUUUAAUGUAUUUGUACAUGGAGAAAAUAAAJGUG

rnh GUUUUACAGUUCGAUUCAAUUACAGGAAGUCUACCAGAGAUG

RF1 GUACAUCAUUUUCUUUUUUUACAGGGUGCAUUUACGCCUAUG

RF2 CAUUUUGACUAGCUCAAUAAAAGAAAUCAGACCAUG

rpi J GAAGUGAGUUCCAGAGAUUUUCUCUGGCAAACAUCCAGGAGCAAAGCUAJAUG

rps B CAACUUUUAUAUAGAGGUUUUAAUC AUG

rps G UUUUGGACAAUCCUGAAUUAACAACGGAGUAUUUCCAUG

rps J UAAUCAUUUUCGUUUAUAAAAUAAUUGGAGCUCUGGUCUCAUG

rps M UUUUAUUAeGUQUUUACaAAGCAAAACCAGGAGCUAUUUaAUG

s sb GUUUACACUUAUUCAGAACGAUUUUUUUCAGGAGACACGAACAUG

tar GAGAUCAACUUAUUUUCAGGAAGGUGCCUU AUG

tra D UUUUUUUCUUCGGAAUAUCAUCAUCAUGAGUUUUAACGCAAAGGAUAUG


160 Nucleic Acids Research, Vol. 19, No. I

Table 2 5 '-Untranslated regions of operons regulated

by attenuation mechanism.

Genes .AUG

his G UUUUUAUUGCGCGGUUGAUAACGGUUCAGACAGGUUUAAAGAGGAAUAACAA7AUG

leu A UUUUUUAUGCCCGAAGCGAGGCGCUCUAAAAGAGACAAGGACCCAAACCAUG

phe A CCUUUUUUAUUGAUAACAAAAAGGCAACAClAUG

thr A UUUUUUUUUCGACCAAAGGUAACGAGGUAACAACCAUG

trp E UUUUUUUGAACAAAAUUAGAGAAUAAC; AUG

pyr B CUUUUUUUUGCCCAGGCGHCAGGASAUAAAAC AUG

(40-42) and when placed before other genes (9,42-44). Webelieve that this U-rich enhancer sequences serve as additionalrecognition signals and are targets for ribosomal protein SI duringinitiation of translation. We have noticed that 5'-untranslatedregions of many E. coli genes contain oligo(U) stretches: amongthese there are many highly expressed in a cell—those ofribosomal proteins, translation^ factors etc. (Table 1). Promoterproximal genes of operons controlled by an attenuationmechanism, where oligo(U) sequences are parts of P-independentterminators, can also be regarded as containing such features(Table 2). Here it should be added, that the SI requirement forthe synthesis of anthranilate synthetase, encoded by two firstgenes of the E. coli trp operon, was shown in direct biochemicalexperiments (45), and crosslinking of SI to the trp mRNA wasobserved as a result of UV-irradiation of intact E. coli cells (30).

To test the idea that oligo(U)-stretches in leader parts ofbacterial genes represent targets for SI, we have studied the ssbgene (see Table 1). 30S initiation complex formation and itsdependence on SI were examined in toeprint (extensioninhibition) experiments (Fig. 4). As was shown for other mRNAs,the 30S particle bound to the messenger in the presence of initiatortRNA inhibits reverse transcription from a primer annealeddownstream on the template that leads to appearance of a toeprintsignal at +15 position from the first base of the initiation codon(2,26). When 30S subunits completely devoided of SI were testedby this method for their ability to bind the ssb mRNA, no toeprintsignal was observed (Fig. 4). The addition of free SI produceda significant stimulation of the mRNA binding ability of the 30Ssubunit that led to appearance of the toeprint at +15 position.Increasing of SI concentration in reactions resulted indisappearance of the toeprint, reflecting an inhibition of initiationcomplex formation. We have obtained similar effects with othermessengers (will be published elsewhere).

Thus SI can act both as a translational 'activator' and repressor,depending on its molar ratio to 30S subunits. It is reasonableto ask how an excess of free SI prevents binding of 30S subunitsto the ssb mRNA. As in the case of Q/3 RNA (see above), thiseffect is expected if free SI binding to the mRNA occurs at thesame site as does binding of SI when it is a part of 30S subunit.This simple competition mechanism can explain the function ofS1 as gene-nonspecific translational repressor in vitro. Accordingto this model, in order to identify the target for SI within

RNas.UI RNasaTZ U G C A

.ACUUAUUCAGAACGAUUUU

t»

6AACAU6GCCAGCA6A6GCG.

Figure 5. Footprinting of protein SI bound to the ssb mRNA. Lanes 1,2,3—partialRNase U2 digestion of the ssb mRNA (0.8 pmol) incubated without (lane 1) orwith increasing amount of SI: 8 pmol (lane 2) and 16 pmol (lane 3). Lanes4,5—partial digestion of the ssb mRNA with RNase T2 without SI (lane 4) andin the presence of 4 /iM SI (lane 5). Below—a part of the leader sequence ofthe ssb mRNA with indication of nucleotklcs protected by SI against RNase U2(small arrows) and RNase T2 (large arrow).

translation initiation complexes, it is sufficient to find the SIbinding site on the messenger within a complex between mRNAand pure SI.

To identify the SI binding site on the ssb mRNA we have usedtwo methods: enzymatic footprinting and UV-inducedcrosslinking. Partial digestions of the free ssb RNA and itscomplex with protein SI with RNases U2 and T2 followed byprimer extension revealed that SI protected a region comprisingan oligo(U)-tract preceding the SD domain and some upstreamnucleotides (A-22,A-25,26). No pronounced protection of othermRNA parts within translational initiation region was observed



SI OUV - +

1.5- 4 UG C A

enhancer-SD

1111 1

fis)RNA/

UG UAUG

—MB—

T1- fmet

30S

-

tRN/f?6'

Figure 7. Structural elements within the translational initiation region of mRNAand corresponding components of translational machinery involved in specificinteractions. SI, attached to the 30S subunit via its N-terminal globular domainconnected with elongated RNA-binding domain by flexible hinge, serves as anmRNA catching arm of the ribosome (see 14).

*•- - i

Figure 6. UV induced crosslinking of SI to the ssb mRNA. Primer extensionanalysis of the ssb mRNA irradiated by UV light (X= 254 nm) with or withoutSI, as indicated over lanes. The position of strong UV- and Sl-dependent signalis indicated by a large arrow, that of UV-independent but Sl-dependent signal—bya thin arrow. UGCA—sequence lanes.

(Fig. 5). Some reducing in intensity of the band A+6 (lane 5)is not typical for all RNase T2 protection experiments (data notshown). Changes in the bands A+9 and A+11 (A+l l decreaseswhile A+9 increases in intensity) in the RNase U2 reactionsreflect rather minor conformational changes than S1 binding atthis site. Thus, SI protects only one extended region on the ssbmRNA that reflects specificity of SI binding to oligo(U)-tract.The size of this protected region (9-12 nucleotides) correspondswell to the average binding site for SI (47).

The interaction of SI with the oligo(U)-stretch was also testedin UV-crosslinking experiments (Fig. 6). The complex of SI withthe ssb mRNA was irradiated with UV-light and was analyzedby primer extension. The stop of reverse transcription within theoligo(U) sequence in the control experiment without addition ofSI appears most likely due to the UV-induced modification ofU-residues (undine photodimerization). Irradiation of the ssbmRNA in the presence of SI with the same dose of light causesintensification and broadening of this signal proportionally to theamount of SI added, suggesting covalent bond formation betweenSI and U-residues of the messenger. Covalent cross-links causetermination of cDNA synthesis at the site of crosslinking. In thepresence of SI the signal is a result of two independentphotoreactions: photomodification of uracil residues and RNA-protein crosslinking. Broadening of the signal probably meansthat all U-residues in a cluster can participate in crosslinking whilefor UV-induced photodimerization certain positions are morefavorable.

Upstream from the oligo(U)-sequence an UV-independent butSl-dependent stop is also observed (Fig. 6). At the present

moment, we do not know the real origin of this signal. It maybe a toeprint from the same or another SI molecule bound tothe leader part of the mRNA; or it may be simply a cut in themRNA chain caused by RNase traces in the SI preparations. Thispart of the ssb RNA is very sensitive to RNase attacks (Fig. 5).More work is required to characterize the mode of S1 bindingwith mRNAs.

Taken together, our results on localization of the SI target siteson the ssb mRNA and phage RNAs QjS and fr suggest that clustersof uracil residues are important elements involved in ribosome-messenger recognition and binding through the interaction withprotein SI. The results also suggest that unstructured regionsupstream from the SD domain could be reactive in the initiationprocess not simply because the absence of secondary structurewould expose the initiation signals as was proposed in (10), butbecause they might serve as recognition signals bound bycomponents of translational machinery such as ribosomal proteinSI.

CONCLUDING REMARKS

Examples of the genes containing in their 5'-untranslated regionsU-clusters are presented in the Tables 1 and 2. As one can seethese clusters are situated at different distances from the initiationcodon thus being a 'drifting' element of mRNA primary structure.Our proposal that these elements work in a process of ribosome-mRNA recognition and binding via interaction with SI requiressome comments. Long distances between the SD domain and SIbinding site may be explained in some cases by the presence ofhairpin-loop structures as in the case of Oj3 RNA. If stablesecondary structure is absent, flexibility of unstructured RNAchain can also allow its folding between two points of attachmentto the ribosome: RNA-binding site of SI and 3'-terminus of 16SRNA, involved in the SD interactions. We cannot also excludethat mRNA-protein SI and SD interactions occur in some casesnot simultaneously but in a consecutive order. The variablespacing from the SD of the proposed SI binding site can explainwhy the distribution of bases more than 20 nucleotides upstreamfrom the initiation codon is random. Additionally, the SI bindingsite cannot be revealed by computer approaches because theaffinity of SI to polynucleotides is not limited only to U-residues.Poly (A), poly(C) and in the general case (-G) sequences [suchas isolated 3'-terminal fragment of 16S RNA (47)] are also good



ligands for SI (13). We cannot exclude that in bacterial genessuch (-G) sequences (and not only oligo(U)-tracts) might alsobe targets for SI during translational initiation. This could explainthe universality of SI function in protein synthesis. It is possiblethat a hierarchy of S1 binding sites with respect to their affinityto SI exists in a cell. In our scheme of arrangement of mRNAsequence elements involved in recognition by components oftranslational machinery (Fig. 7), the SI binding site is designatedas 'enhancer' to reflect its enhancing effect on efficiency oftranslation and its nonfixed position with respect to the initiationcodon.

This model suggests that a wide variety in rates of translationof different bacterial genes can be stipulated not only by usingstrong or weak initiation codons or the SD domains, but alsoby variation in strength of Sl-mRNA interactions. In a wide rangeof various combinations of RNA-RNA and RNA-proteininteractions there exist extreme situations when only one typeof interactions works during translational initiation (here we don'tregard codon-anticodon interactions). This can be illustrated bythe following examples. The A-protein genes of RNA phageshave long SD domains and can be efficiently translated byribosomes of Gram-positive bacteria which don't contain SI (48).30S particles lacking the 3'terminal fragment of 16S RNA (anti-SD sequence) can recognize the coat protein gene of the MS2RNA (49) but in the absence of SI binding 30S to MS2 RNAis negligible (13,15,16). This indicates that the SD interactionsplay not very important role in initiation of coat protein synthesis.5'-Untranslated regions of several plant virus RNAs (alfalfamosaic virus RNA4, TMV RNA etc.) being placed beforereporter genes can provide efficient translation by E. coliribosomes despite of lacking the SD domain (50,51). RNA-protein interactions are likely to work in these cases and SI isthe best candidate to bind (-G) leader sequences of plant virusRNAs thus providing their affinity to E. coli ribosomes.

ACKNOWLEDGEMENTS

The authors thank Drs. V. Machno and S. Kirillow for providing30S subunits of E. coli ribosomes, Dr. A. Chetverin for phageQ/3, Dr. V. Berzin for phage fr, Dr. J. Brandsma for the giftof the plasmid pJA45, Dr. M.Billeter for providing data on Q/3RNA primary structure, Dr. V. Rostapshov for synthesis of theoligonucleotide primer. We thank Prof. L. Gold for hisencouragement and support during the writing of this paper. Wealso thank Kathy Piekarski and Doug Irvine for their help inpreparing the manuscript.

REFERENCES1. Gold, L., Pribnow, D., Schneider, T., Shinedling, S., Singer, B.S., and

Stormo, G. (1981) Annu. Rev. Microbiol. 35, 365-4032. Gold, L. (1988) Annu. Rev. Biochem. 57, 199-233.3. Steitz, J.A., Sprague, K.U., Steege, D.A., Yuan, R.C., Laughrea, M.,

Moore, P.B., and Wahba, A.J. (1977) in Nucleic Acid Protein Recognition,ed. Vogel, H.J. (Academic Press, New York), pp. 493-508.

4. Chang, C , and Craven, G.R. (1977) J. Mol. Biol. 117, 401-418.5. Hui, A., and de Boer, H.A. (1987) Proc. Nat). Acad. Sci. USA 84,

4762-4766.6. Jacob, W.F., Santer, M., and Dahlberg, A.E. (1987) Proc. Nat]. Acad. Sci.

USA 84, 4757-4761.7. Sampson, L.L., Hendrix, R.W., Huang, W.M., and Casjens, S.R. (1988)

Proc. Nat]. Acad. Sci. USA 85, 5439-5443.8. Looman, A.C., Bodlander, J., de Gruyter, M., Vogelaar, A., and Van

Knippenbcrg, P.H. (1986) Nucleic Acids Res. 14, 5481-5497.9. Coleman, J., Inouye, M., and Nakamura, K. (1985) J. Mo). Biol. 181,

139-143.

10. Schauder, B., and McCarthy, J.E.G. (1989) Gene 78, 59-72.11. Petersen, G.B., Stockwell, P.A., and Hill, D.F. (1988) EMBO J. 7,

3957-3962.12. Thanaraj, T.A., and Pandit, M.W. (1989) Nucleic Acids Res. 17,

2973-2985.13. Subramanian, A.R. (1983) Progr. Nucleic Acid Res. Mol. Biol. 28, 101 -142.14. Subramanian, A.R. (1984) Trends Biochem. Sci. 9, 491-494.15. Suryanarayana, T , and Subramanian, A.R. (1983) Biochem. 22, 2715-2719.16. Suryanarayana, T., and Subramanian, A.R. (1984) Biochem. 23, 1047-1051.17. Georgirus.S., and Subramanian, A.R. (1980) J. Mol. Biol. 141,393-408.18. Boni, I.V., Zlatkin, I.V., and Budowsky, E.I. (1982) Eur. J. Biochem 121,

371-376.19. Brandsma, J.A., Bosch, D., de Ruyter, M., and Van de Putte, P. (1985)

Nucleic Acids Res. 13, 5095-5109.20. Sangar, A., Williams, K.R., Chase, J.W., and Rupp, W.D. (1981) Proc.

Natl. Acad. Sci. USA 78, 4274-4278.21. Kirillov.S.V., Machno, V.I., and Semenkov, Yu. P. (1980) Nucleic Acids

Res. 8, 183-196.22. Van Dieijen, G., Zipori, P., Van Prooijen, W., and Van Duin, J. (1978)

Eur. J. Biochem. 90, 571-580.23. Laemmli, U.K. (1970) Nature (London) 227, 680-685.24. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Nad. Acad. Sci.

USA 76, 4350-4354.25. Donis-Keller, H., Maxam, A.M., and Gilbert, W. (1977) Nucleic Acids

Res. 4, 2527-2538.26. Hartz, D., McPheeters, D.S., Traut, R., and Gold, L. (1988) Methods

Enzymol. 164, 419-425.27. Fiers, W. (1979) Comp. Virology 13, 69-204.28. Van Duin, J., Overbeek, G. P., and Backendorf, C. (1980) Eur. J. Biochem.

110, 593-597.29. Backendorf, C , Overbeek, G.P., Van Boom, J.H., Van der Marel, G.,

Veeneman, G., and Van Duin, J. (1980) Eur. J. Biochem. 110, 599-604.30. Schouten, J.P. (1985) J. Biol. Chem. 260, 9916-9928.31. Meyer, F., Weber, H., and Weissman, C.H. (1981) J. Mol. Biol. 153,

631-660.32. Berzin, V.M., Avots, A., Jansone, J., Cintnere, L., and Tzimanis, A. (1987)

Nucleic Acids Res. 15, 6741.33. Goeltz, S., and Steitz, J.A. (1977) J. Biol. Chem. 252, 5177-5179.34. Wahba, A.J., Miller, M.J., Nivelcau, A., Landers, T.A., Carmichael, G.G.,

Weber, K., Hawley, D.A., and Slobin, L.I. (1974) J. Biol. Chem. 249,3314-3316.

35. Van Dieijen, G., Van Knippenberg, P.H., and Van Duin, J. (1976) Eur.J. Biochem. 64, 511-518.

36. Steitz, J.A. (1969) Nature (London) 224, 957-964.37. Shnier, J., Stoffier, G., and Nishi, K. (1986) J. Biol. Chem. 261,

11866-11871.38. Scherer, G.F.E., Walkinshaw, M.D., Amott, S., and Moore, D.J. (1980)

Nucleic Acids Res. 8, 3895-3907.39. Dreyfus, M. (1988) J. Mol. Biol. 204, 79-94.40. Boyen, A., Piette, J., Cunin, R., and Glandsdorf, N. (1982) J. Mol. Biol.

162, 715-720.41. McCarthy, J.E.G., Schairer, H.U., and Sebald, W. (1985) EMBO J. 4,

519-526.42. Olins, P.O., Devine, C.S., Rangwala, Sh.H., and Kavka, K.S. (1988) Gene

73, 227-235.43. McCarthy, J.E.G., Sebald, W., Gross, G., and Lammers, R. (1986) Gene

41,201-206.44. Schauder, B., Blocker, H., Frank, R., and McCarthy, J.E.G. (1987) Gene

52, 279-283.45. Van Dieijen, G., Van Knippenberg, P.H., Van Duin, J., Koekman, B., and

Pouwels, P.H. (1977) Mol. Gen. Genet. 153, 75-80.46. Schneider, T.D., Stormo, G.D., Gold, L., and Ehrenfeucht, A. (1986) J.

Mol. Biol. 188, 415-431.47. Yuan, R.C., Steitz, J.A., Moore, P.B., and Crothers, D. M. (1979) Nucleic

Acids Res. 7, 2399-2418.48. Isono, K., and Isono S. (1976) Proc. Natl. Acad. Sci. USA 73, 767-771.49. Melancon, P., Leclerc, D., Destroimaisons, N., and Brakier-Gingras, L.

(1990) Biochem. 29, 3402-3407.50. Gallie, D.R., Sleat, D.E., Watts, J.W., Turner, Ph.C, and Wilson, T.M.A.

(1987) Nucleic Acids Res. 15, 8693-8711.51. Gallie, D.R. and Kado, C.I. (1989) Proc. Natl. Acad. Sci. USA 86, 129-132.


ribosome-messenger recognition: mrna target sites for ribosomal

Documents