erythromycin- and chloramphenicol-induced ribosomal ......chloramphenicol affect the assembly of the...

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2009, p. 563–571 Vol. 53, No. 20066-4804/09/$08.00�0 doi:10.1128/AAC.00870-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Erythromycin- and Chloramphenicol-Induced Ribosomal AssemblyDefects Are Secondary Effects of Protein Synthesis Inhibition�

Triinu Siibak,1,2 Lauri Peil,1† Liqun Xiong,3 Alexander Mankin,3 Jaanus Remme,1 and Tanel Tenson2*Institute of Molecular and Cell Biology, University of Tartu, Riia 23,1 and Institute of Technology, University of Tartu, Nooruse 1,2

Tartu, Estonia, and Center for Pharmaceutical Biotechnology, University of Illinois at Chicago, 900 S. Ashland Ave.,Chicago, Illinois 606073

Received 1 July 2008/Returned for modification 26 August 2008/Accepted 13 November 2008

Several protein synthesis inhibitors are known to inhibit ribosome assembly. This may be a consequence ofdirect binding of the antibiotic to ribosome precursor particles, or it could result indirectly from loss ofcoordination in the production of ribosomal components due to the inhibition of protein synthesis. Here wedemonstrate that erythromycin and chloramphenicol, inhibitors of the large ribosomal subunit, affect theassembly of both the large and small subunits. Expression of a small erythromycin resistance peptide actingin cis on mature ribosomes relieves the erythromycin-mediated assembly defect for both subunits. Erythro-mycin treatment of bacteria expressing a mixture of erythromycin-sensitive and -resistant ribosomes producedcomparable effects on subunit assembly. These results argue in favor of the view that erythromycin andchloramphenicol affect the assembly of the large ribosomal subunit indirectly.

The ribosome is a target for many medically important an-tibiotics (42, 56, 63). These drugs bind to either the small or thelarge subunit and inhibit essential ribosome functions: decod-ing, peptidyl transfer, transit of the nascent peptide chain, oractivation of ribosome-associated GTPases. In addition, anti-biotics cause many physiological changes; for example, theyinduce stress response pathways and alter gene expressionpatterns in other ways (23, 25, 45, 60).

One of the known ”side effects” of ribosome-targeting anti-biotics is inhibition of ribosome assembly. This effect was orig-inally described for chloramphenicol: defective particles sedi-menting more slowly than mature ribosomal subunits wereobserved in cells treated with this drug (19, 29). Such particlescontain precursor forms of rRNA and an incomplete set ofribosomal proteins (1, 53). During chloramphenicol treatment,ribosomal proteins are produced in nonstoichiometricamounts (20). In addition, the equilibrium between the pro-duction of rRNA and ribosomal proteins is upset, and rRNA isexpressed in excess (30, 37, 49). It has been proposed that thisunbalanced synthesis of components is responsible for thechloramphenicol-induced defects in ribosomal assembly (21).

More recently, Champney and colleagues suggested thatseveral other inhibitors of protein synthesis stall the assemblyof ribosomal subunits by binding to the respective precursorparticles. The drugs proposed to have such an effect includedmacrolides and ketolides (10, 11, 15, 35, 59), streptogramin B(16), lincosamides (16), aminoglycosides (36), evernimicin(14), linezolid (12), and pleuromutilins (13). However, theindirect mechanism of assembly inhibition cannot be excludedfor any of these drugs.

To investigate the mechanism by which ribosome assembly isinhibited, we chose two inhibitors of the 50S subunit, erythro-mycin and chloramphenicol, and carried out experiments de-signed to differentiate between the two alternative hypotheses:(i) direct inhibition due to the binding of antibiotics to theprecursor particles and (ii) indirect inhibition, when an imbal-ance in the production of components disturbs ribosome as-sembly. Our results appear to be more compatible with thelatter model.

MATERIALS AND METHODS

Strains. Strain MG1655 (6) was used in all experiments involving Escherichiacoli. Clinical Staphylococcus aureus strains carrying mutations in chromosomalcopies of rRNA operons (43) were generously provided by Roland Leclercq. Thestrains were UCN14 (carrying an A2058T mutation in four out of five rrl alleles),UCN17 (with A2058G in four out of six rrl alleles), and UCN18 (with A2059Gin three out of five rrl alleles). The MIC for erythromycin in all three strains was512 to 1,024 �g/ml, as determined in 96-well plates by the microbroth dilutionprocedure (3).

Analysis of E. coli ribosomes. Cells were grown at either 25 or 37°C in 200 ml2� YT medium (46) until the A600 reached 0.2. At this point, either erythromycin(final concentration, 100 �g/ml) or chloramphenicol (final concentration, 7 �g/ml) was added; no antibiotic was added to the control culture. The cultures werethen incubated for a further 2 h or 1 h at 25 or 37°C, respectively. The cells werecollected by centrifugation in a Sorvall GS-3 rotor at 4,000 rpm and 4°C for 10min and were resuspended in 1 ml lysis buffer (60 mM KCl, 60 mM NH4Cl, 50mM Tris-HCl [pH 8], 6 mM MgCl2, 6 mM �-mercaptoethanol, 16% sucrose);lysozyme and DNase I (Amresco, GE Healthcare) were added to final concen-trations of 1 mg/ml and 20 U/ml, respectively. The cells were incubated for 15min at �70°C and then thawed in ice-cold water for 30 min. The freeze-thawcycle was repeated twice, followed by centrifugation at 13,000 � g and 4°C for 20min. The supernatant was diluted twofold with buffer D (60 mM KCl, 60 mMNH4Cl, 10 mM Tris-HCl [pH 8], 12 mM MgCl2, 6 mM �-mercaptoethanol).Lysate (2 ml) was first loaded onto a 30-ml, 10 to 25% (wt/wt) sucrose gradientprepared in buffer D and then centrifuged at 23,000 rpm in an SW28 rotor(Beckman) at 4°C for 13.5 h.

Analysis of E. coli rRNA. RNA was precipitated from the sucrose gradientfractions with 0.7 volume of isopropanol. The precipitate was dissolved in 200 �lbuffer D, and 1 ml 5 M guanidinium thiocyanate–4% Triton X-100 was added,followed by vortexing for 20 min at room temperature. An SiO2 suspension (25�l, 50%) in distilled water (7) was added, followed by shaking for 10 min at roomtemperature. The silica was precipitated by centrifugation at 3,000 � g for 1 min.

* Corresponding author. Mailing address: Institute of Technology,University of Tartu, Nooruse 1, Tartu 50411, Estonia. Phone: 372 7374844. Fax: 372 7374 900. E-mail: [email protected].

† Present address: Institute of Technology, University of Tartu,Nooruse 1, Tartu, Estonia.

� Published ahead of print on 24 November 2008.

563

by Alexander M

ankin on January 29, 2009 aac.asm

.orgD

ownloaded from

http://aac.asm.org

The precipitate was washed with 1 ml 5 M guanidinium thiocyanate, followed bya wash with 1 ml 50% ethanol. The RNA was eluted by incubating the silica inwater for 5 min at 55°C. Centrifugation was used to precipitate the silica duringthe washing and elution steps. Samples were stored at �20°C.

Reverse transcription from primers GTTTGGGGTACGATTTGATG andGCCAGCGTTCAATCTGAG was used to map the 5� ends of 23S and 16SrRNA, respectively (31, 32).

For dot blot analysis, purified RNA was denatured by addition of formamide(20 �l), formaldehyde (6 �l), and 4 �l of buffer DB (0.2 M morpholinepropane-sulfonic acid [MOPS; pH 7], 20 mM sodium acetate, 10 mM EDTA [pH 8]),followed by incubation at 65°C for 5 min. The samples were cooled on ice, andan equal volume of 20� SSC (3 M NaCl plus 0.3 M sodium acetate) was added.For every gradient profile, 0.2 pmol of 23S RNA from the 50S fraction was usedper sample. Equal volumes from the other gradient fractions were used toprepare the RNA for dot blotting. Samples were applied to a Hybond N�(Amersham) membrane using a vacuum blotter, followed by UV cross-linking.The oligonucleotides used for primer extension (see above) were 5� end-labeledwith 32P and used for hybridization. Prehybridization was performed for 4 h at50°C in 6� SSC, 5� Denhardt’s solution, 0.5% (wt/vol) sodium dodecyl sulfate(SDS), and 100 �g/ml salmon sperm DNA (46). Labeled probes were added,followed by hybridization for 12 h at 50°C. The filters were washed at 50°C for 5min in 2� SSC–0.1% SDS (wt/vol) and for 10 min in 1� SSC–0.1% SDS,followed by autoradiography.

Peptide-mediated erythromycin resistance. E. coli cells containing plasmidscoding for an erythromycin resistance peptide (sequence MRLFV) (57) or acontrol peptide (MNAIK) (61) were grown at 37°C in 500 ml 2� YT medium(46) until the A600 was 0.1. At this point, synthesis of the peptide was induced byaddition of isopropyl-�-D-thiogalactopyranoside (IPTG) to a final concentrationof 1 mM. When the A600 reached 0.2, the cultures were divided into two 70-mlaliquots. One sample received erythromycin to a final concentration of 50 �g/ml,and the second was grown under the same conditions but without erythromycin.One hour after the addition of erythromycin, the cells were collected and lysed,and the ribosomes were analyzed as described above. No IPTG was added in theotherwise similar control experiments.

Pulse-labeling. E. coli cells were grown at 37°C in 400 ml of tryptone (10g/liter)–yeast extract (1 g/liter)–NaCl (10 g/liter) until the A600 reached 0.2.Erythromycin (final concentration, 100 �g/ml) or chloramphenicol (final con-centration, 7 �g/ml) was added, and the cultures were divided into 50-ml ali-quots. After 5, 10, or 60 min of incubation at 37°C, 2 �Ci of [3H]uridine (38Ci/mmol; GE Healthcare) per 50 ml of culture was added, followed by incubationfor 5 min at 37°C. In the experiment for which results are shown in Fig. 4a,incorporation of the label was stopped by adding ice to the culture. The othersamples were treated by adding rifampin (rifampicin) (final concentration, 500�g/ml) for 5 min at 37°C, followed by ice. Cells were collected by centrifugationand lysed, and ribosomes were analyzed by sucrose gradient centrifugation asdescribed above. Each sucrose gradient was fractionated into 40 fractions. High-molecular-weight material was precipitated by adding an equal volume of 20%trichloroacetic acid (TCA). The precipitates were collected on glass fiber filters,and the radioactivity incorporated was measured by scintillation counting.

Preparation and analysis of S. aureus ribosomal subunits and precursors.Cultures of S. aureus strains UCN14, UCN17, and UCN18 (43) were grown in 2ml of tryptone soy broth (TSB) medium (4). They were diluted 100-fold into two50-ml cultures and grown at 37°C until the A600 reached 0.1. Erythromycin wasadded to one of the flasks to a final concentration of 128 �g/ml, and growth wascontinued until the A600 reached ca. 0.6. Cells were pelleted in a Beckman JA-25rotor (7000 rpm, 10 min, 4°C), and the pellets were washed once with 10 ml coldbuffer S (10 mM Tris-HCl [pH 7.8], 1 mM magnesium diacetate, 50 mM NH4Cl,2 mM �-mercaptoethanol (10). After repelleting, the cells were resuspended in400 �l buffer S. Lysostaphin (Sigma) and an RNase inhibitor (Roche) wereadded to final concentrations of 50 �g/ml and 100 U/ml, respectively. The cellsuspension was incubated for 20 min at room temperature. Two units of RQDNase (Promega) were added to each sample, and after 5 min of incubation atroom temperature, the samples were spun for 10 min at 21,000 � g in a refrig-erated tabletop centrifuge.

The cell lysate (A260, 10 to 20) was loaded onto a 10 to 40% sucrose gradientprepared in buffer S. Gradients were centrifuged in a Beckman SW41 rotor at24,500 rpm for 18 h at 4°C and were then fractionated through the UV monitor;400-�l fractions were collected. The optical density (A260) of the material inindividual fractions was determined using a NanoDrop spectrophotometer, andribosomal material was precipitated by adding sodium acetate to 0.3 M, followedby 2 vol ethanol, and incubating at �20°C overnight. The ribosomal precipitateswere collected by centrifugation for 10 min at 21,000 � g in a refrigeratedtabletop centrifuge, resuspended in 150 �l of buffer R (0.3 M sodium acetate, 5

mM EDTA, 0.5% SDS), and extracted with phenol, phenol-chloroform, andchloroform. Sodium acetate was added to 0.3 M. The RNA was ethanol precip-itated and resuspended in 15 �l water.

Primer extension analysis was carried out as described previously (5) usingprimer SaL2060 (GTAAAGCTCCACGGGGTC) and either 1.5 �l (from the50S peak fractions) or 2.5 �l (from the 30S peak fractions) of RNA solution. Thereaction products were resuspended in 8 �l formamide with loading dyes, and1-�l samples were run on a 12% denaturing polyacrylamide gel. The gel wasdried and exposed to a PhosphorImager screen (Molecular Dynamics). Imageson the screen were scanned and analyzed using ImageQuant software.

RESULTS

Inhibition of ribosome assembly by erythromycin and chlor-amphenicol. As a starting point, we tested the previously de-scribed effects of chloramphenicol and erythromycin by ana-lyzing the ribosomes obtained from antibiotic-treated cells bysucrose gradient centrifugation. The drugs were used at con-centrations causing similar levels of growth inhibition (after 8 hof growth, the optical density of the culture fell to 70% of thatof the untreated control). Particles with sedimentation charac-teristics different from those of mature subunits accumulatedin response to treatment with either of the antibiotics (Fig. 1).These more slowly sedimenting particles indicate ribosomalassembly defects. We reproducibly observed that the defectiveparticles accumulating in response to erythromycin sedimentednotably differently from those accumulating in response tochloramphenicol (compare Fig. 1c and e). Ribosomal assemblydefects are usually more pronounced at lower growth temper-atures (18, 26, 44), so we tested the effects of chloramphenicoland erythromycin at 25°C as well as at 37°C. Antibiotic-in-duced accumulation of several different assembly-defectiveparticles occurred at both growth temperatures; as expected,the more slowly sedimenting particles accumulated in greateramounts at the lower temperature (Fig. 1).

With both antibiotics, we observed an accumulation of par-ticles sedimenting more slowly than 30S. To verify the natureof these particles, we isolated RNA from the sucrose gradientfractions and hybridized it with 16S rRNA- or 23S rRNA-specific probes. As expected, 16S RNA was found in the 30Sand 70S ribosomes, and 23S RNA was found in the 50S and70S fractions, in untreated cells (Fig. 1). For cells treated witheither of the antibiotics, 23S rRNA was found in the 70S and50S fractions and also in particles sedimenting at 40S (Fig. 1),consistent with the idea that large ribosomal subunit assemblyis inhibited. Particles sedimenting more slowly than 30S aftertreatment with both erythromycin and chloramphenicol con-tained 16S RNA (Fig. 1). This shows that in addition to theinhibition of large subunit assembly, both drugs cause defectsin the biosynthesis of small subunits. This observation revealedthat antibiotics that target the large ribosomal subunit exclu-sively in fact impede the assembly of both the 50S and 30Ssubunits.

Effects of the antibiotics on rRNA maturation. During theassembly of ribosomal subunits, pre-rRNA associates with pro-teins and undergoes several cleavage events and nucleotidemodifications (28, 51, 62). rRNA processing depends on ribo-some assembly (51). It is therefore expected that general inhi-bition of assembly will cause defects in rRNA processing. Wecharacterized the state of 5� end processing of 16S and 23SRNA in the antibiotic-induced assembly-defective particles.

During the assembly of the large subunit, RNase III cleaves

564 SIIBAK ET AL. ANTIMICROB. AGENTS CHEMOTHER.

by Alexander M


.orgD

ownloaded from

http://aac.asm.org

the precursor at positions �3 and �7 (2, 8, 50) relative to the5� end of mature 23S rRNA, while the final maturation occursin functional ribosomes. At 37°C, the ribosomes from un-treated cells contain fully processed 23S RNA (marked in Fig.2b as �1). Only traces of longer molecules were observed inthe 50S fraction. At 25°C, processing intermediates that hadbeen cleaved at positions �3 and �7 accumulated, indicatingthat processing is slower at lower growth temperatures.

Partially processed 23S RNA accumulated in the 30S, 40S,and 50S fractions in response to antibiotic treatment. The 5�end of 23S rRNA was either at position �7 or position �3, asin the 50S fraction from untreated cells grown at 25°C. The factthat neither erythromycin nor chloramphenicol treatment cre-ates new processing intermediates suggests that assembly doesnot follow alternative pathways creating dead-end products;rather, the normal pathway is simply slowed down. On the

FIG. 1. Sucrose gradient profiles of ribosomes isolated from untreated (a and b), erythromycin-treated (c and d), or chloramphenicol-treated(e and f) cells. The bacterial cultures were grown either at 37°C (a, c, and e) or at 25°C (b, d, and f). In panels c through f, solid lines representprofiles from antibiotic-treated cells, and profiles from untreated cells (dotted lines) are added for better comparison. Dot blot analyses of 16S and23S rRNAs isolated from the sucrose gradient fractions are shown at the bottom of each panel.

VOL. 53, 2009 ANTIBIOTICS AFFECTING RIBOSOMAL ASSEMBLY 565

by Alexander M


.orgD

ownloaded from

http://aac.asm.org

other hand, quantification of the intermediates shows that themain intermediate in the untreated cells results from RNasecleavage at position �3, whereas the intermediate cleaved atposition �7 accumulates predominantly in response to antibi-otic treatment. These differences might have arisen becausethe different protein contents of the particles influence thespecificity of the RNase. This interpretation is supported bythe previous observation that RNase III cleaves protein-free

pre-RNA at position �7 and RNA assembled into ribosomalsubunits at position �3 (2).

Similar effects were observed for 16S RNA processing. Dur-ing normal 16S processing, the first cleavage is created byRNase III at position �115 (28, 51, 52). This is followed bymaturation steps creating heterogeneous 5� ends. We observedthat the processing intermediate cleaved at position �115 ispresent in the 30S fraction isolated from untreated cells grownat 25°C and, to a lesser extent, in cells grown at 37°C (Fig. 2).The same intermediate accumulated in the 20S and 30S frac-tions from the antibiotic-treated cells, indicating that neithererythromycin nor chloramphenicol treatment created 16SRNA processing patterns different from those in untreatedcells but that they retarded 16S rRNA processing overall.

Expression of erythromycin resistance peptides rescuesdrug-induced assembly defects. The peptide-mediated eryth-romycin resistance mechanism acts in cis only upon activelytranslating mature ribosomes and does not influence the avail-ability of erythromycin in the cell (33, 54). Antibiotic resistanceresults from the synthesis of specific small peptides (E-pep-tides) that promote the dissociation of erythromycin from theribosomes synthesizing those peptides (33). This resistancemechanism should allow one to distinguish between inhibitionof assembly by direct trapping of precursor particles and inhi-bition mediated through the general effect of the drug onprotein synthesis. If E-peptide expression reverses the eryth-romycin-induced assembly defects, that would argue in favor ofthe indirect mechanism of inhibition.

To test the effects of the small peptides, we expressed oneE-peptide (MRLFV) and a control peptide (MNAIK) in E.coli, and we examined ribosome assembly after erythromycintreatment. Without erythromycin, E-peptide synthesis causessome accumulation of precursor particles (Fig. 3). This mightindicate an inhibitory effect on the translational capacity of thecell because of massive translation of the E-peptide minigenepresent on a multicopy plasmid (33), possibly leading to re-duced production of ribosomal proteins. When erythromycinwas added but the E-peptide was not expressed, incompletelyassembled subunits accumulated (Fig. 3). This inhibitory effectof erythromycin on assembly was relieved by E-peptide expres-sion (Fig. 3) but not by the control peptide (data not shown).The observation that the resistance peptide can relieve assem-bly inhibition suggests that erythromycin inhibits ribosome syn-thesis through its general effect on translation rather than viabinding to assembly intermediates.

As described above, we have observed that erythromycinand chloramphenicol cause rRNA processing defects. If E-peptide expression rescues the erythromycin-induced assemblydefect, it is also expected that the inhibition of processing willbe alleviated. We have studied the 5� ends of 23S rRNA iso-lated from 50S fractions (indicated in Fig. 3). In the 50S frac-tion isolated from untreated cells, about 85% of the 23S rRNAwas fully processed at position �1; if the E-peptide was ex-pressed, 60 to 70% of the RNA was fully processed (consistentwith the small assembly defect in response to E-peptide ex-pression); erythromycin treatment reduced the level of matureRNA to 30 to 40%; erythromycin treatment together withE-peptide expression led to 60 to 70% of mature 23S (data notshown). With chloramphenicol treatment, there was about50% mature 23S rRNA in the 50S fraction, and this percentage

FIG. 2. Primer extension analyses of the 5� ends of 16S (a) and 23S(b) RNAs isolated from the sucrose gradient fractions. The materialwas isolated either from untreated cells (none) or from erythromycin(Ery)- or chloramphenicol (Cam)-treated cultures grown at either 25or 37°C. The sequencing lanes are shown on the left.


by Alexander M


.orgD

ownloaded from

http://aac.asm.org

did not change in response to E-peptide expression (data notshown). These results show that E-peptide expression specifi-cally alleviates the erythromycin-induced processing defect.

Effect of erythromycin on the assembly of erythromycin-sensitive and erythromycin-resistant ribosomes in a mixedpopulation. If erythromycin inhibits ribosome assembly viabinding to intermediates, then the assembly of the subunitscarrying 23S rRNA with erythromycin resistance mutationsshould not be affected. If cells express a mixed population ofwild-type and mutant ribosomes, direct binding of erythromy-cin to the intermediates is expected to slow down the assemblyof wild-type but not mutant ribosomes. On the other hand, ifinhibition of ribosome assembly results from the general effectof the drug on protein synthesis, the assembly of both types ofribosomes would be similarly affected. To discriminate be-tween these scenarios, we used clinical strains of S. aureus

carrying erythromycin resistance mutations in several copies ofthe RNA operons (43). We examined ribosome assembly inthree such strains: UCN14 (carrying an A2058T mutation infour out of five rrl alleles), UCN17 (with A2058G in four out ofsix rrl alleles), and UCN18 (with A2059G in three out of five rrlalleles).

S. aureus cells were grown in the absence or presence oferythromycin and then lysed, and ribosomal subunits wereanalyzed in sucrose gradients (Fig. 4a). The ratio betweenwild-type and mutant 23S RNA in various fractions was deter-mined by primer extension (Fig. 4e). The results of analysis ofUCN18 (Fig. 4) reflect the general pattern observed for allthree strains tested. Since these strains are highly resistant toerythromycin (MICs, 512 to 1,024 �g/ml), there was no signif-icant accumulation of assembly-defective particles. Yet the 23SrRNA and 5S rRNA were observed in the 30S peak from cellsgrown with 128 �g/ml erythromycin (data not shown), indicat-ing that some inhibition of ribosome assembly takes place. Theexperimental data plots (Fig. 4d) show no significant prefer-ential accumulation of wild-type 23S rRNA in the fractionsedimenting more slowly than 50S. The assembly of 50S sub-units carrying wild-type 23S rRNA and that of 50S subunitscarrying mutant 23S rRNA were inhibited to comparable ex-tents. This observation suggests that erythromycin does notinhibit assembly by binding to its site in the precursor particles.

Time course of antibiotic-induced inhibition of assembly. Astudy of the kinetics of inhibition might provide additionalinformation about the mechanism involved. If the inhibition ofribosome assembly is due to the lack of ribosomal proteins,exposure to the drug would lead to the accumulation over timeof particles with gradually decreasing masses and thereforegradually changing sedimentation coefficients. Alternatively, ifthe drug blocks one particular step in the assembly pathway,defined intermediate particles would accumulate.

To analyze the time course of inhibition of ribosome assem-bly by chloramphenicol and erythromycin, we profiled ribo-somal particles from cells grown at 25°C for different times inthe presence or absence of the drugs. The RNA was labeledwith [3H]uridine for 5 min, the cells were lysed, and the ribo-somal particles were analyzed by sucrose gradient centrifuga-tion (Fig. 5a). The rate-limiting step of ribosomal subunit as-sembly is the final maturation step, which takes about 1 to 2min at 37°C (32a). Completion of subunit assembly is mani-fested by incorporation of the newly assembled subunits intothe 70S pool. Consistent with this previous report, we observedthat the assembly of ribosomal subunits at 25°C in the absenceof the drugs was completed during the 5-min incubation with[3H]uridine: during this short labeling period, a significant frac-tion of the assembled subunits was already incorporated into70S ribosomes. Subunit assembly was completed during a fur-ther 5-min incubation (Fig. 5b). This additional incubation wasperformed in the presence of rifampin, which inhibits the ini-tiation of transcription, ensuring that no new rRNA precursorsare generated after the initial labeling period.

In the presence of either chloramphenicol or erythromycin,assembly was significantly retarded even when the antibioticswere added only 5 min before the [3H]uridine (Fig. 5a). Withlonger antibiotic treatment, broad peaks of assembly interme-diates accumulated between the 50S and 20S regions of thegradient. This heterogeneity in the sizes of the defective par-

FIG. 3. Effects of resistance E-peptide expression on erythromycin-induced assembly defects. Sucrose gradient profiles of ribosomes iso-lated from cells containing a plasmid for E-peptide expression areshown. Addition of erythromycin (ery) or of IPTG, the inducer ofE-peptide expression, is indicated.


by Alexander M


.orgD

ownloaded from

http://aac.asm.org

FIG. 4. Effect of erythromycin on the assembly of sensitive and resistant ribosomes in a mixed population. S. aureus strain UCN18, carrying anA2059G mutation in three out of five rrl alleles, was grown without (left panels) or with (right panels) erythromycin. The bacteria were lysed, andribosomal subunits were analyzed in sucrose gradients. (a) Flowthrough optical profiles of the sucrose gradient fractions. (b) Optical densities ofindividual gradient fractions corresponding to the 30S-to-50S gradient area used in subsequent experiments. (c) Primer extension analysis ofwild-type and mutant 23S rRNA in individual gradient fractions. (d) Quantification of the gels in panels c. (e) Design of the primer extension assay.


by Alexander M


.orgD

ownloaded from

http://aac.asm.org

ticles agrees better with the indirect inhibition model (thedrugs inhibit ribosome assembly via inhibition of ribosomalprotein production and an imbalance in rRNA and ribosomalprotein synthesis) than with the model that presumes drugbinding to a specific assembly precursor, which would be ex-pected to result in the accumulation of very specific assemblyintermediates. Although both erythromycin and chloramphen-icol caused the accumulation of assembly-defective particles,there was a slight difference between particles that accumu-lated after prolonged treatment with the drugs (Fig. 5, com-pare 10-min and 60-min time points): those that accumulatedin the presence of chloramphenicol sedimented more slowlythan those that accumulated in the presence of erythromycin.This difference may be attributable to differences in the inhi-bition of production of specific ribosomal proteins.

DISCUSSION

It has been shown previously that treatment of cells withprotein synthesis inhibitors can lead to defects in ribosomeassembly. Two alternative explanations for this phenomenonhave been proposed. One model suggests that ribosomal sub-unit assembly is prevented because the production of ribo-somal proteins is inhibited, resulting in an imbalance in the

amounts of individual proteins synthesized and a lack of stoi-chiometry with the newly made rRNA (20, 21). The othermodel suggests that assembly is inhibited by antibiotic bindingto precursor particles (59). Sucrose gradient centrifugationshowed that radioactively labeled erythromycin cosedimentedwith the precursor particles (59).

In this study, we carried out experiments designed to differ-entiate between these two scenarios. We used erythromycinand chloramphenicol as model compounds. These drugs havebeen used in many previous studies of antibiotic-mediatedinhibition of assembly. Both antibiotics bind to the 50S subunit(47, 58). Chloramphenicol inhibits peptide bond formation bypreventing the aminoacyl-tRNA 3� end from binding in thepeptidyl transferase center (47), whereas erythromycin ham-pers the progression of the nascent peptide chain through theribosomal exit tunnel (34, 55, 58).

Analysis of the ribosomal particles that accumulated in thedrug-treated cells revealed precursors that sedimented moreslowly than either the 30S or the 50S subunit (Fig. 1). Inantibiotic-treated cells, 23S RNA was present not only in 50Ssubunits but also in fractions sedimenting more slowly than50S. Similarly, 16S rRNA was also present in fractions sedi-menting more slowly than 30S. This result shows that chlor-amphenicol and erythromycin inhibit the assembly of both the

FIG. 5. Pulse-labeling of rRNA. Schematic representations of the experiments are shown to the left of the experimental data. Solid lines, opticaldensity patterns of the sucrose gradients; shaded histograms, radioactivity profiles of the TCA-precipitated material. Ery, erythromycin; Cam,chloramphenicol; Rif, rifampin. (a) Experiment performed without rifampin addition; (b) experiments in which pulse-labeling was followed byincubation with rifampin.


by Alexander M


.orgD

ownloaded from

http://aac.asm.org

50S and 30S subunits. Because these drugs do not bind to thesmall ribosomal subunit, the finding supports the hypothesisthat the inhibition of assembly is mediated through generalinterference with protein synthesis and is not caused by anti-biotic binding to precursor particles.

Most conventional antibiotic resistance determinants couldnot be used to ascertain whether the assembly defect is causedby the inhibition of precursor particles or mature ribosomes:drug efflux pumps and antibiotic modification systems reducethe concentration of the active compound and would thereforehave an effect in either case; modification of the binding sitemight influence drug binding to both precursors and matureparticles. On the other hand, E-peptide-mediated erythromy-cin resistance (33, 54) involves only actively translating matureribosomes and does not influence the availability of erythro-mycin in the cell. Therefore, if assembly is inhibited by directstalling of the process caused by erythromycin binding to theprecursor particles, E-peptide-mediated resistance would notrelieve the drug-related assembly defects. However, our exper-iments showed that expression of the resistance E-peptide al-leviates the inhibition of assembly (Fig. 3) and defects in 23SrRNA processing (data not shown), arguing that the assemblydefects are not mediated through drug binding to intermedi-ates.

In the mixed population of sensitive and mutant ribosomes,stalling of assembly because of drug binding to the precursorparticles is expected to influence the assembly of wild-typeribosomes much more significantly than that of mutants thatdo not bind erythromycin. Yet our data show that in erythro-mycin-treated cells, the assembly of both sensitive and resistantribosomes is affected to approximately the same extent, argu-ing that drug binding to precursors does not stall assembly.

Finally, if assembly were inhibited because the drug binds toprecursor particles and prevents subsequent assembly steps,defined assembly intermediates should accumulate. Instead,our kinetics experiments (Fig. 5) showed the appearance of abroad assembly-intermediate peak in drug-treated cells, a re-sult more readily compatible with the hypothesis that assemblydefects result from a general inhibition of protein synthesis.

How can the inhibition of protein synthesis lead to defects inribosome assembly? It has been reported that several inhibi-tors of protein synthesis, including chloramphenicol and eryth-romycin, strongly increase the production of rRNA (17, 22, 24,30, 37, 41, 48, 49). This effect is likely to be caused by thedecrease in protein synthesis capacity, activating feedbackmechanisms for rRNA transcription (40). On the other hand,as protein synthesis is inhibited, there is less production ofribosomal proteins. As a result, the molar ratio between rRNAand ribosomal proteins will be skewed (20, 53). The excess ofrRNA over ribosomal proteins would lead to an accumulationof heterogeneous particles characterized by diverse incompletesets of ribosomal proteins (21, 38), a scenario fully compatiblewith our observations (Fig. 5).

In response to treatment with erythromycin or chloram-phenicol, partially processed rRNA accumulates and can bedetected in several sucrose gradient fractions (Fig. 2). Theerythromycin- and chloramphenicol-treated samples containthe same 5� processing intermediates as those observed in theuntreated control; no new cleavage sites are observed. Thisindicates that antibiotic treatment does not induce completely

novel assembly pathways leading to dead-end particles, inagreement with previous reports that upon removal of thedrug, the precursor rRNA from the “chloramphenicol parti-cles” is converted into normal 30S and 50S ribosomes withoutprior degradation (1, 24, 39).

Starting from the middle of the 1990s, Champney and co-workers have reinvestigated the antibiotic-induced ribosomalassembly defects (9, 10). They have described the assemblydefects in response to many inhibitors of protein synthesis,including erythromycin. Our observations fully support theprevious reports that describe erythromycin-induced assemblyinhibition, although our conclusions about the mechanism dif-fer. Usary and Champney have observed binding of radio-labeled erythromycin to precursors of the 50S subunit (59).This was interpreted in the framework of direct inhibition ofassembly by the drug. However, mere binding of the drug tothe precursor need not necessarily lead to the stalling of as-sembly. One can easily imagine that precursor particles withbound antibiotic can progress though the remaining steps ofthe assembly pathway. Furthermore, in assembly experimentsusing a cell-free system, erythromycin and other macrolideinhibitors of protein synthesis notably stimulated the assemblyof the 50S subunit (27).

With both chloramphenicol and erythromycin treatment,precursors of both the large and small ribosomal subunitsaccumulated (Fig. 1). In contrast, in most of their experimentswith several protein synthesis inhibitors acting upon the largeribosomal subunit, Champney et al. observed the accumulationonly of 50S subunit precursors. However, it is noteworthy that30S subunit assembly is inhibited by some macrolides but notothers (11, 15, 35). One possible explanation is that the sucrosegradient centrifugation conditions used in those studies do notallow 30S assembly intermediates to be separated reliably fromthe mature subunits. Another possibility is that the 30S assem-bly intermediates that accumulate in the presence of someantibiotics are preferentially degraded, leading to seeminglysubunit-specific assembly defects.

ACKNOWLEDGMENTS

We thank Roland Leclercq for providing the S. aureus mutantstrains and Dorota Klepacki for help with some experiments. We thankUlo Maivali and Niilo Kaldalu for valuable comments on the manu-script. The English language was corrected by BioMedES, UnitedKingdom.

This work was supported by The Wellcome Trust InternationalSenior Fellowship (070210/Z/03/Z) (to T.T.), Estonian Science Foun-dation Grant 7509 (to J. R.), and NIH grant AI072445 from theNational Institute of Allergy and Infectious Diseases, NIH (to A.M.).

REFERENCES

1. Adesnik, M., and C. Levinthal. 1969. Synthesis and maturation of ribosomalRNA in Escherichia coli. J. Mol. Biol. 46:281–303.

2. Allas, U., A. Liiv, and J. Remme. 2003. Functional interaction betweenRNase III and the Escherichia coli ribosome. BMC Mol. Biol. 4:8.

3. Andrews, J. M. 2001. Determination of minimum inhibitory concentrations.J. Antimicrob. Chemother. 48(Suppl. 1):5–16.

4. Atlas, A. M. 2006. Handbook of microbiological media for the examinationof food, 2nd ed. CRC Press, Boca Raton, FL.

5. Bailey, M., T. Chettiath, and A. S. Mankin. 2008. Induction of erm(C)expression by noninducing antibiotics. Antimicrob. Agents Chemother. 52:866–874.

6. Blattner, F. R., G. Plunkett III, C. A. Bloch, N. T. Perna, V. Burland, M.Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor,N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y.Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science277:1453–1474.


by Alexander M


.orgD

ownloaded from

http://aac.asm.org

7. Boom, R., C. J. Sol, M. M. Salimans, C. L. Jansen, P. M. Wertheim-vanDillen, and J. van der Noordaa. 1990. Rapid and simple method for purifi-cation of nucleic acids. J. Clin. Microbiol. 28:495–503.

8. Bram, R. J., R. A. Young, and J. A. Steitz. 1980. The ribonuclease III siteflanking 23S sequences in the 30S ribosomal precursor RNA of E. coli. Cell19:393–401.

9. Champney, W. S., and R. Burdine. 1996. 50S ribosomal subunit synthesis andtranslation are equivalent targets for erythromycin inhibition in Staphylococ-cus aureus. Antimicrob. Agents Chemother. 40:1301–1303.

10. Champney, W. S., and R. Burdine. 1995. Macrolide antibiotics inhibit 50Sribosomal subunit assembly in Bacillus subtilis and Staphylococcus aureus.Antimicrob. Agents Chemother. 39:2141–2144.

11. Champney, W. S., and M. Miller. 2002. Inhibition of 50S ribosomal subunitassembly in Haemophilus influenzae cells by azithromycin and erythromycin.Curr. Microbiol. 44:418–424.

12. Champney, W. S., and M. Miller. 2002. Linezolid is a specific inhibitor of 50Sribosomal subunit formation in Staphylococcus aureus cells. Curr. Microbiol.44:350–356.

13. Champney, W. S., and W. K. Rodgers. 2007. Retapamulin inhibition oftranslation and 50S ribosomal subunit formation in Staphylococcus aureuscells. Antimicrob. Agents Chemother. 51:3385–3387.

14. Champney, W. S., and C. L. Tober. 2000. Evernimicin (SCH27899) inhibitsboth translation and 50S ribosomal subunit formation in Staphylococcusaureus cells. Antimicrob. Agents Chemother. 44:1413–1417.

15. Champney, W. S., and C. L. Tober. 2003. Preferential inhibition of proteinsynthesis by ketolide antibiotics in Haemophilus influenzae cells. Curr. Mi-crobiol. 46:103–108.

16. Champney, W. S., and C. L. Tober. 2000. Specific inhibition of 50S ribosomalsubunit formation in Staphylococcus aureus cells by 16-membered macrolide,lincosamide, and streptogramin B antibiotics. Curr. Microbiol. 41:126–135.

17. Cortay, J. C., and A. J. Cozzone. 1983. Effects of aminoglycoside antibioticson the coupling of protein and RNA syntheses in Escherichia coli. Biochem.Biophys. Res. Commun. 112:801–808.

18. Dabbs, E. R. 1991. Mutants lacking individual ribosomal proteins as a tool toinvestigate ribosomal properties. Biochimie 73:639–645.

19. Dagley, S., and J. Sykes. 1959. Effect of drugs upon components of bacterialcytoplasm. Nature 183:1608–1609.

20. Dennis, P. P. 1976. Effects of chloramphenicol on the transcriptional activ-ities of ribosomal RNA and ribosomal protein genes in Escherichia coli. J.Mol. Biol. 108:535–546.

21. Dodd, J., J. M. Kolb, and M. Nomura. 1991. Lack of complete cooperativityof ribosome assembly in vitro and its possible relevance to in vivo ribosomeassembly and the regulation of ribosomal gene expression. Biochimie 73:757–767.

22. Drobyshev, V. I., and R. S. Shakulov. 1976. Effect of streptomycin on RNAsynthesis in E. coli cells. Biokhimiia 41:1193–1199. (In Russian.)

23. Goh, E. B., G. Yim, W. Tsui, J. McClure, M. G. Surette, and J. Davies. 2002.Transcriptional modulation of bacterial gene expression by subinhibitoryconcentrations of antibiotics. Proc. Natl. Acad. Sci. USA 99:17025–17030.

24. Hosokawa, K., and M. Nomura. 1965. Incomplete ribosomes produced inchloramphenicol- and puromycin-inhibited Escherichia coli. J. Mol. Biol.12:225–241.

25. Hutter, B., C. Schaab, S. Albrecht, M. Borgmann, N. A. Brunner, C.Freiberg, K. Ziegelbauer, C. O. Rock, I. Ivanov, and H. Loferer. 2004.Prediction of mechanisms of action of antibacterial compounds by geneexpression profiling. Antimicrob. Agents Chemother. 48:2838–2844.

26. Iost, I., and M. Dreyfus. 2006. DEAD-box RNA helicases in Escherichia coli.Nucleic Acids Res. 34:4189–4197.

27. Khaitovich, P., and A. S. Mankin. 1999. Effect of antibiotics on large ribo-somal subunit assembly reveals possible function of 5S rRNA. J. Mol. Biol.291:1025–1034.

28. King, T. C., R. Sirdeskmukh, and D. Schlessinger. 1986. Nucleolytic pro-cessing of ribonucleic acid transcripts in procaryotes. Microbiol. Rev. 50:428–451.

29. Kurland, C. G., M. Nomura, and J. D. Watson. 1962. The physical propertiesof the chloromycetin particles. J. Mol. Biol. 4:388–394.

30. Lazzarini, R. A., and E. Santangelo. 1968. Effect of chloramphenicol on thesynthesis and stability of ribonucleic acid in Bacillus subtilis. J. Bacteriol.95:1212–1220.

31. Liiv, A., and J. Remme. 1998. Base-pairing of 23S rRNA ends is essential forribosomal large subunit assembly. J. Mol. Biol. 276:537–545.

32. Liiv, A., T. Tenson, T. Margus, and J. Remme. 1998. Multiple functions ofthe transcribed spacers in ribosomal RNA operons. Biol. Chem. 379:783–793.

32a.Lindahl, L. 1975. Intermediates and time kinetics of the in vivo assembly ofEscherichia coli ribosomes. J. Mol. Biol. 92:15–37.

33. Lovmar, M., K. Nilsson, V. Vimberg, T. Tenson, M. Nervall, and M. Ehren-berg. 2006. The molecular mechanism of peptide-mediated erythromycinresistance. J. Biol. Chem. 281:6742–6750.

34. Lovmar, M., T. Tenson, and M. Ehrenberg. 2004. Kinetics of macrolide

action: the josamycin and erythromycin cases. J. Biol. Chem. 279:53506–53515.

35. Mabe, S., J. Eller, and W. S. Champney. 2004. Structure-activity relation-ships for three macrolide antibiotics in Haemophilus influenzae. Curr. Mi-crobiol. 49:248–254.

36. Mehta, R., and W. S. Champney. 2002. 30S ribosomal subunit assembly is atarget for inhibition by aminoglycosides in Escherichia coli. Antimicrob.Agents Chemother. 46:1546–1549.

37. Midgley, J. E., and W. J. Gray. 1971. The control of ribonucleic acid syn-thesis in bacteria. The synthesis and stability of ribonucleic acid in chloram-phenicol-inhibited cultures of Escherichia coli. Biochem. J. 122:149–159.

38. Nierhaus, K. H. 1991. The assembly of prokaryotic ribosomes. Biochimie73:739–755.

39. Nomura, M., and K. Hosokawa. 1965. Biosynthesis of ribosomes: fate ofchloramphenicol particles and of pulse-labeled RNA in Escherichia coli. J.Mol. Biol. 12:242–265.

40. Paul, B. J., W. Ross, T. Gaal, and R. L. Gourse. 2004. rRNA transcription inEscherichia coli. Annu. Rev. Genet. 38:749–770.

41. Perel’man, B. V., L. G. Kolibaba, B. R. Belitskii, and R. S. Shakulov. 1979.Effects of different concentrations of chloramphenicol on RNA synthesis inE. coli. Biokhimiia 44:1968–1971. (In Russian.)

42. Poehlsgaard, J., and S. Douthwaite. 2005. The bacterial ribosome as a targetfor antibiotics. Nat. Rev. Microbiol. 3:870–881.

43. Prunier, A. L., B. Malbruny, D. Tande, B. Picard, and R. Leclercq. 2002.Clinical isolates of Staphylococcus aureus with ribosomal mutations confer-ring resistance to macrolides. Antimicrob. Agents Chemother. 46:3054–3056.

44. Roy-Chaudhuri, B., N. Kirthi, T. Kelley, and G. M. Culver. 2008. Suppres-sion of a cold-sensitive mutation in ribosomal protein S5 reveals a role forRimJ in ribosome biogenesis. Mol. Microbiol. 68:1547–1559.

45. Sabina, J., N. Dover, L. J. Templeton, D. R. Smulski, D. Soll, and R. A.LaRossa. 2003. Interfering with different steps of protein synthesis exploredby transcriptional profiling of Escherichia coli K-12. J. Bacteriol. 185:6158–6170.

46. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Har-bor, NY.

47. Schlunzen, F., R. Zarivach, J. Harms, A. Bashan, A. Tocilj, R. Albrecht, A.Yonath, and F. Franceschi. 2001. Structural basis for the interaction ofantibiotics with the peptidyl transferase centre in eubacteria. Nature 413:814–821.

48. Sells, B. H. 1964. RNA synthesis and ribosome production in puromycin-treated cells. Biochim. Biophys. Acta 80:230–241.

49. Shen, V., and H. Bremer. 1977. Chloramphenicol-induced changes in thesynthesis of ribosomal, transfer, and messenger ribonucleic acids in Esche-richia coli B/r. J. Bacteriol. 130:1098–1108.

50. Sirdeshmukh, R., and D. Schlessinger. 1985. Ordered processing of Esche-richia coli 23S rRNA in vitro. Nucleic Acids Res. 13:5041–5054.

51. Srivastava, A. K., and D. Schlessinger. 1990. Mechanism and regulation ofbacterial ribosomal RNA processing. Annu. Rev. Microbiol. 44:105–129.

52. Srivastava, A. K., and D. Schlessinger. 1989. Processing pathway of Esche-richia coli 16S precursor rRNA. Nucleic Acids Res. 17:1649–1663.

53. Sykes, J., E. Metcalf, and J. D. Pickering. 1977. The nature of the proteinsin ‘chloramphenicol particles’ from Escherichia coli A19 (Hfr rel met rns).J. Gen. Microbiol. 98:1–16.

54. Tenson, T., A. DeBlasio, and A. Mankin. 1996. A functional peptide encodedin the Escherichia coli 23S rRNA. Proc. Natl. Acad. Sci. USA 93:5641–5646.

55. Tenson, T., M. Lovmar, and M. Ehrenberg. 2003. The mechanism of actionof macrolides, lincosamides and streptogramin B reveals the nascent peptideexit path in the ribosome. J. Mol. Biol. 330:1005–1014.

56. Tenson, T., and A. Mankin. 2006. Antibiotics and the ribosome. Mol. Mi-crobiol. 59:1664–1677.

57. Tenson, T., L. Xiong, P. Kloss, and A. S. Mankin. 1997. Erythromycinresistance peptides selected from random peptide libraries. J. Biol. Chem.272:17425–17430.

58. Tu, D., G. Blaha, P. B. Moore, and T. A. Steitz. 2005. Structures of MLSBKantibiotics bound to mutated large ribosomal subunits provide a structuralexplanation for resistance. Cell 121:257–270.

59. Usary, J., and W. S. Champney. 2001. Erythromycin inhibition of 50S ribo-somal subunit formation in Escherichia coli cells. Mol. Microbiol. 40:951–962.

60. VanBogelen, R. A., and F. C. Neidhardt. 1990. Ribosomes as sensors of heatand cold shock in Escherichia coli. Proc. Natl. Acad. Sci. USA 87:5589–5593.

61. Vimberg, V., L. Xiong, M. Bailey, T. Tenson, and A. Mankin. 2004. Peptide-mediated macrolide resistance reveals possible specific interactions in thenascent peptide exit tunnel. Mol. Microbiol. 54:376–385.

62. Wilson, D. N., and K. H. Nierhaus. 2007. The weird and wonderful world ofbacterial ribosome regulation. Crit. Rev. Biochem. Mol. Biol. 42:187–219.

63. Yonath, A. 2005. Antibiotics targeting ribosomes: resistance, selectivity, syn-ergism and cellular regulation. Annu. Rev. Biochem. 74:649–679.


by Alexander M


.orgD

ownloaded from

http://aac.asm.org

erythromycin- and chloramphenicol-induced ribosomal ......chloramphenicol affect the assembly of the...

Documents