reverse genetics - ndsu.edumcclean/plsc411/lecture 3. reverse genetics_xl2018sep.pdfreverse genetics...

Reverse genetics

1. A candidate gene with known sequence

2. Identify the mutant of the

candidate gene

3. Evaluate phenotype of the mutants

4. Define gene

function

Wild type Gene 1 Gene 2 Gene n

Mutant Gene 1 Gene 2 Gene n ✗

Reverse genetics with induced mutations

•  Induced mutations by insertional, physical, and chemical mutagens are randomly distributed along the genome

•  Identifying a mutant of the candidate gene needs to screen many mutants

•  This section will cover –  methods to identify a mutant for a candidate gene (insertional, deletion, and point

mutation)

–  methods to create gene-indexed catalogue of mutants

–  and give some examples of reverse genetics to define gene function

•  “Over the past several years, plant biologists have amassed DNA sequence information for thousands of different genes and gene families from many species”

•  “As a means of facilitating reverse genetic analysis in Arabidopsis thaliana, we have developed a method that allows one to search for plants carrying T-DNA insertions within any sequenced Arabidopsis gene.”

•  “Using PCR, we screened a collection of 9100 independent T-DNA-transformed Arabidopsis lines and found 17 T-DNA insertions within the 63 genes analyzed.”

•  “The genes surveyed include members of various gene families involved in signal transduction and ion transport. As an example, data are shown for a T-DNA insertion that was found within CPK-9, a member of the gene family encoding calmodulin-domain protein kinases.”

Krysan et al., PNAS 1996

Example: Identification of a T-DNA insertion within a gene CPK-9

•  A gene specific PCR to find mutation lines for a known target gene

•  Four different combinations of PCR primers can be used (5’+L, 5’+R, 3’+L, and 3’+R)

•  Note: The T-DNA is 17 Kbp long, PCR could generate fragments from 0.1 to 10 Kbp long


Polymerase chain reaction (PCR)

•  A technique of amplifying a few copies of a piece of DNA to generate thousands to millions of copies (https://en.wikipedia.org/wiki/Polymerase_chain_reaction)

•  A pair of primers to amplify a DNA fragment between the two primers; amplify DNA fragment of 0.1 to 10 Kbp.

1. Denatura+on 2. Annealing 3. Elonga+on

Gel analysis to detect DNA fragments •  Gel electrophoresis is a method for separation and analysis of

DNA, protein, and other molecules based on their fragment size •  https://en.wikipedia.org/wiki/Gel_electrophoresis

Pool strategy to reduce work of DNA preparation and PCR screening

Primary PCR screening

Secondary PCR screening

7 super pools: pool of 1,300 lines

91 pools: pool of 100 lines

9,100 lines Identify individual line Isolate DNA from each of 100

lines and do PCR Seeds pool of 100 lines

Isolate DNA for the 91 pools Pool DNA of 13 pools

•  Many mutants need to be screened to identify the mutant for the candidate gene

•  Single line screening, 9,100 DNA isolation and PCR •  Using pool strategy, 191 DNA isolations and 121 PCR screens



•  Screen the seven super pools –  Four different combinations of PCR primers can be used (5’+L, 5’+R, 3’+L, and

3’+R) –  Amplification primed on both sides by the T-DNA primer alone resulted in many

PCR products (Figure A) –  Southern blotting of the agarose gel and subsequent hybridization using wild-

type CPK-9 DNA as a probe (Figure B) to remove spurious PCR products –  Super pool 5 contained a plant carrying a T-DNA within the CPK-9 gene


Procedure of Southern Blotting

•  Gel Electrophoresis to separate the DNA fragments by size

•  Double stranded fragments are then denatured into single strands

•  The single strands are transferred from the gel on to a nitrocellulose membrane via “blotting”

•  This nitrocellulose membrane is treated with probes which are chosen to contain a complimentary message and hybridizes to the target strand of DNA

•  These probes contain some form of label, whether it is a radioactive atom or a fluorescent dye, which can be detected by various equipment

•  Southern Blotting is a technique that employs Gel Electrophoresis and hybridization to determine the presence of a particular segment of DNA


•  Screen the 13 pools of 100 within the super pool 5

–  DNA from the 13 pools of 100 that make up super pool number 5 were subjected to PCR using the primers 3' + L

–  Lanes 1-13 correspond to these 13 pools of 100

–  S, 1-kb DNA ladder size standard

–  m, 300-bp CPK-9/T-DNA product produced by amplification of super pool 5 using primers 3' + L



•  Screen the 100 individual plants –  Lanes 1 and 2 correspond to these two individual plants found to carry

the CPK-9 T-DNA insert

–  m, amplified using DNA from pool of 100 number CS6494, which contains the CPK-9 T-DNA insert

–  S, 1-kb DNA ladder size standard


•  Deletion mutant libraries were generated using fast neutron bombardment

•  Identify and isolate deletion mutants for targeted plant genes by polymerase chain reaction (PCR) using specific primers flanking the targeted genes

•  By adjusting PCR conditions (a short extension time) to preferentially amplify the deletion alleles

•  Pooling of mutants to reduce PCR work

Li et al., Plant Journal 2001

Adjusting PCR conditions to preferentially amplify the deletion alleles

•  PCR was performed using a pair of primers flanking the ga1-3 deletion

•  The extension time required for amplification of the wild-type DNA was first checked empirically for each pair of primers

•  Then screening for deletion mutants was performed using an extension time that suppressed the amplification of the wild-type fragments


Polymerase chain reaction (PCR)

•  A technique of amplifying a few copies of a piece of DNA to generate thousands to millions of copies (https://en.wikipedia.org/wiki/Polymerase_chain_reaction)

•  A pair of primers to amplify a DNA fragment between the two primers; amplify DNA fragment of 0.1 to 10 Kbp.

1. Denatura+on 2. Annealing 3. Elonga+on

Adjusting PCR conditions to preferentially amplify the deletion alleles

a)  WT: 6.4 kb, Mutant: 1.4 kb

b)  Different amount of ga1-3 DNA with 100 ng WT DNA

–  Lane 2: 10 ng

–  Lane 3: 1 ng

–  Lane 4: 0.1 ng

–  Lane 5: 0.01 ng


•  Pooled DNA samples are amplified with a gene-specific primer pair

•  The PCR products are denatured and allowed to re-anneal

•  A mutant strand will most often re-anneal with a wild-type strand, so that a fraction of the pool will have a mismatch at the site of the mutation

Henikoff and Comai, 2003 Annual Review of Plant Biology

Detection of induced point mutation for a

candidate gene --Heteroduplex analysis

Detection of induced point mutation for a

candidate gene --Heteroduplex analysis

•  The mismatch cleavage endonuclease CEL I and gel electrophoresis

•  As pooling levels increase, the proportion of heteroduplexes decreases, and sensitivity is reduced

•  Can not identify position and number of mutations, which need to be characterized by re-sequencing

Colbert et al. 2001 Plant Physiol.; Henikoff and Comai, 2003 Annual Review of Plant Biology

Detection of induced point mutations for a candidate gene

--Denaturing high performance liquid chromatography

•  To find a mutant for a specific gene

–  Pooled DNA samples are amplified with a gene-specific primer pair; one plate 96 pools, 8 plants each pool

–  The PCR products are denatured and allowed to re-anneal

–  A mutant strand will most often re-anneal with a wild-type strand, so that a fraction of the pool will have a mismatch at the site of the mutation

Henikoff and Comai, 2003 Annual Review of Plant Biology

Detection of induced point mutations for a candidate gene

--Denaturing high performance liquid chromatography •  Detection of heteroduplexes in PCR

products by ion-pair reverse phase high-performance liquid chromatography under partially denaturing conditions

•  The more hydrophobic a molecule is, the longer it is retained on the solid support

•  Larger fragments and pooling increase the major homoduplex peak, thus making it increasingly difficult to discern whether or not there is a leading peak

•  Can not identify position and number of mutations, which need to be characterized by re-sequencing

McCallum et al. 2000 Plant Physiol.

Detection of induced point mutations for a candidate gene using next-generation

sequencing (NGS) •  Sequencing cost decreased, which makes directly sequencing PCR

product of a target gene possible to locate position of mutation and cost effectively

•  ~10 million reads per run on MiSeq, cost about $1,000?

•  How big is a pool? How many reads per base?

•  Large pools allow the screening of more individuals for a given labor input, but pool size is limited by the ability to detect a single mutation in a large background (sequence error rate is about 0.3-0.5%)

Detection of induced point mutations using next-generation sequencing (NGS)

•  A mutation: G/A

•  Given 10,000 reads for a pool, cost $1 –  Pool 50 mutants, then A%= 200/10000=2% > 0.5% –  Pool 100 mutants, then A%= 100/10000=1% > 0.5% –  Pool 200 mutants, then A%= 50/10000=0.5% = 0.5%

•  Sequence error rate 0.5%

...TGCAATGGGTCAGAAGGACTCCTATGTGCCT... AATGGGTCAGAAGGACTCCTATGTG AATGGGTCAGAAGGACTCCTATGTG AATGGGTCAGAAGGACTCCTATGTG AATGGGTCAGAAAGACTCCTATGTG AATGGGTCAGAAGGACTCCTATGTG …………………………………………………….. ……………………………………………………..

1 2 3 4 5 . .

Wild type

Pilot experiment: effect of template pooling and sequencing coverage on mutation detection

•  Select a rice mutant with a heterozygous mutation at 808 bp of the gene RDR2

•  Using a large pool of wild-type individuals, the mutant individual were diluted in varied ratios

–  4 dilutions: 64x, 96x, 128x, and 192x

–  3 replications each dilution

•  Illlumina sequence: 40-bp reads

•  Goal is to figure out how confident to detect the mutant from the varied size of pools?

Helen Tsai et al. Plant Physiol. 2011;156:1257-1268

Gene-indexed catalogue of insertional mutants

•  A major drawback of reverse genetic method is that screening has to be repeated for every gene

•  A gene-indexed catalogue, where all mutants are characterized, will make it much easier

•  A method to locate inserts for all mutants –  Get sequence of flanking insertion sites in individual mutant

–  Align the flanking sequence to reference genome to get position

–  Result in a gene-indexed catalogue of mutants

Mutated line

Wild type

T-‐DNA Flanking sequence

Reference genome

Thermal asymmetric interlaced PCR (TAIL-PCR) to obtain flanking sequences

1.  Isolate genomic DNA from a transformed line

2.  Sequence flanking the T-DNA insertions is amplified using TAIL-PCR

3.  Locate insertion sites by BLAST the flanking sequence against refer genome

Primary PCR with SP1 and AD

AD primer SP1 SP2 SP3

SP1 SP1

Secondary PCR with SP2 and AD

SP2

AD primer

Tertiary PCR with SP3 and AD

✗ Specific primer (SP)

Complementary to vector sequence High melting temperature, Tm=~60 0C

Arbitrary degenerate primer (AD) Shorter Lower melting temperature, Tm=~40 0C

Insert target Nontarget

Liu et al., Plant Journal 1995

SP1

Example: A gene-indexed catalogue of insertion mutants in Arabidopsis

•  Screened 127,706 mutants

•  88,122 insertion sites identified in 21,799 genes

•  Fewer T-DNA integration events were consistently observed in regions surrounding each of the five centromeres

•  Cited by 4,632 articles (4,219 articles before 2016)

Alonso et al., Science 2003

Example 2. A mini-transposon for insertional mutagenesis in microorganisms

•  The mini transposon does not contain the transposase gene. And it won’t keep moving around.

KanR MmeI MmeI IR IR

Create a population of insertional mutations using mini-transposon in microorganisms

•  A gene disruption library is constructed by first transposing the mini-transposon into bacterial genomic DNA in vitro and then transforming a bacterial population with the transposed DNA

•  E.g., a transpose requiring only a TA dinucleotide at the insertion site

van Opijnen et al., Nature methods 2009

Restriction enzyme + PCR to obtain flanking sequences

•  MmeI, a type II restriction endonuclease that cuts 20 bases downstream of its recognition site

•  Using a primer specific for this adaptor and specific for the transposon to amplify the sequence by PCR

•  Mapping the flanking sequences to determine genome position

Van Opijnen et al., Nature methods 2009

Wild type

Reference genome

Restriction enzyme

•  An enzyme that cleaves DNA into fragments at or near specific recognition sites

•  Restriction enzymes were found in bacteria and archaea and provide a defense mechanism against invading viruses

•  Over 3000 restriction enzymes have been studied in detail, and more than 600 of these are available commercially

•  These enzymes are routinely used for DNA modification in laboratories, and they are a vital tool in genetics and genomics studies

hJps://en.wikipedia.org/wiki/RestricNon_enzyme

Restriction enzyme

•  Restriction enzymes are classified into several types, which differ in their structure and cut sites

–  Type I: cut at a site that differs and is a random distance (at least 1000 bp) away from their recognition site

–  Type II: recognize and cleave DNA at the same site

–  Type III: cut DNA about 20-30 bp after recognition site

–  Type IV: recognize modified, typically methylated DNA

–  Type V: utilize guide RNAs to target specific sequences

hJps://en.wikipedia.org/wiki/RestricNon_enzyme

Gene-indexed catalogue of physical and chemical mutagen induced mutants

•  Whole genome/exome sequencing to get gene-indexed catalogue of mutants induced by physical and chemical mutagen

•  Sequenced a fast-neutron-induced mutant population of 1504 lines in the model rice cultivar Kitaake at 45-fold coverage

•  Identified 91,513 mutations an average of 61 mutations per line

–  Including 43,483 single base substitutions (SBSs), 31,909 deletions, 7,929 insertions, 3,691 inversions, 4,436 translocations, and 65 tandem duplications

•  In total, the mutations affect 32,307 genes. Deletions affect the greatest number of genes, 27,614, accounting for 70% of the 32,307 genes

•  The average deletion size is 8.8 kb, deletions smaller than 100 bp account for nearly 90% of all deletions

Li et al., Plant Cell 2017

•  Sorghum (Sorghum bicolor) is a versatile C4 crop and a model for research in family Poaceae

•  High-quality genome sequence (~730 Mb) is available for the elite inbred line BTx623

•  6400 pedigreed M4 mutant pools from EMS-mutagenized BTx623 seeds through single-seed descent

Comparison of cost of whole-genome sequencing and whole-exome capture sequencing

Species Analysis Size of Target (Mb)

Reads for 20× Coverage (Million)

Capture Cost ($)

Total Cost ($)

All species Exome capture 40 20 40 307

Arabidopsis WGS 135 13.5 0 180

Rice WGS 380 38 0 507

Tomato WGS 900 90 0 1,200

Maize WGS ∼2,300 230 0 3,067

wheat WGS ∼15,960 1,596 0 21,280

Henry et al., The Plant Cell, 2014

•  $2000 per lane of Illumina HiSeq 2000, 200 million reads

Whole-genome sequencing of 256 phenotyped mutant

•  A mini-collection of 256 mutant lines randomly selected from the library was well phenotyped and sequenced to an average coverage of 16x

•  Revealed >1.8 million canonical EMS-induced mutations, affecting >95% of genes in the sorghum genome.

•  The vast majority (97.5%) of the induced mutations were distinct from natural variations

Jiao et al., The Plant Cell, 2016

Comparison of cost of whole-genome sequencing and whole-exome capture sequencing

Species Analysis Size of Target (Mb)

Reads for 20× Coverage (Million)

Capture Cost ($)

Total Cost ($)

All species Exome capture 40 20 40 307

Arabidopsis WGS 135 13.5 0 180

Rice WGS 380 38 0 507

Tomato WGS 900 90 0 1,200

Maize WGS ∼2,300 230 0 3,067

wheat WGS ∼15,960 1,596 0 21,280

Henry et al., The Plant Cell, 2014

•  $2000 per lane of Illumina HiSeq 2000, 200 million reads

Exome capture sequencing

•  The exome has been defined traditionally as the sequence encompassing all exons of protein coding genes in the genome and covers between 1 and 2% of the genome, depending on species.

•  Exome capture sequencing is a technique for sequencing all of the protein coding genes in the genome

•  It consists of two steps: the first step is to select only the subset of the DNA that encodes proteins; the second step is to sequence the exonic DNA using any high-throughput next-generation sequencing

•  Exome capture sequencing is to identify genetic variants that alter protein sequences, and to do this at a much lower cost than whole genome sequencing

Exome capture sequencing

•  DNA samples are fragmented and biotinylated oligonucleotide probes (baits) are used to selectively hybridize to target regions in the genome. Magnetic streptavidin beads are used to bind to the biotinylated probes, the nontargeted portion of the genome is washed away, and the polymerase chain reaction (PCR) is used to amplify the sample, enriching the sample for DNA from the target region.

Whole-exome capture sequencing of EMS-induced mutations in wheat

•  Whole-genome resequencing of mutant lines has been used for species with small genome, but is a very expensive alternative for the large genomes of tetraploid (12 Gb) and hexaploid (17 Gb) wheat

•  “In this study, we describe the development of a wheat exome capture platform and its use to sequence the coding regions of 2,735 mutant lines” (1535 tetraploid and 1200 hexaploid wheat)

•  The targeted exon space in wheat was selected

–  An 84-Mb exome capture assay including overlapping probes covering 82,511 transcripts

•  Multiplexed captures from eight tetraploid wheat lines or four hexaploid wheat lines per Illumina lane and obtained >20 million 100-bp paired-end reads per sample (about $2000/8 mutants)

Krasileva et al., PNAS, 2017

Whole-exome capture sequencing of EMS-induced mutations in wheat

•  Catalog more than 10 million mutations in the protein-coding regions of 2,735 mutant lines of tetraploid and hexaploid wheat

•  On average, 2,705 and 5,351 mutations per tetraploid and hexaploid line, which resulted in 35–40 mutations per kb in each population

•  Identified an average of 23–24 missense and truncation alleles per gene, with at least one truncation or deleterious missense mutation in more than 90% of the captured wheat genes per population

•  Once the desired mutations are identified, the corresponding M4 seeds can be requested from the UK Germplasm Resources Unit (https://www.seedstor.ac.uk/shopping-cart-tilling.php).

•  In addition, predesigned “Kompetitive Allele Specific PCR” (KASP) primers are available to validate the mutations and to select them for downstream research and breeding applications. In total, we designed 2,771,688 KASP assays for the Kronos population and 3,872,892 assays for Cadenza

Krasileva et al., PNAS, 2017

Secondary Cell Wall

•  Secondary cell walls found in some cell, primary cell wall found in all plant cell

•  Secondary cell walls provide additional protection to cells and rigidity and strength to the larger plant

•  Primary cell wall: consist of cellulose, hemicellulose, and pectin

•  Secondary cell wall: consist of cellulose, hemicellulose, and lignin

•  Lignin makes the secondary cell wall less flexible and less permeable to water; lignin gives strength to stems and imparts hydrophobicity to vascular elements for water transport

Secondary Cell Wall

•  Primary cell wall: found in all plant cell, consist of cellulose, hemicellulose, and pectin

•  Secondary cell wall: found in some cell, consist of cellulose, hemicellulose, and lignin, and different ratios of constituents

•  The inclusion of lignin makes the secondary cell wall less flexible and less permeable to water

•  Wood consists mostly of secondary cell wall, and holds the plant up against gravity

•  https://en.wikipedia.org/wiki/Secondary_cell_wall

Lignin is a major component of plant secondary cell walls

•  Secondary cell wall is the major component of biomass in forages and trees

•  Forage digestibility, paper pulping, and liquid fuel production from biomass through fermentation are all affected by recalcitrance of lignocellulose, primarily due to the presence of lignin, which blocks accessibility of the sugar-rich cell wall polysaccharides cellulose and hemicellulose to enzymes and microorganisms

•  Reduction of lignin content in forages and trees will improve forage quality and enhance processing properties of trees, but it need to be done without lost of biomass

Lignin biosynthetic pathway

Caffeoyl Shikimate Esterase (CSE) Is an Enzyme in the Lignin Biosynthetic Pathway in Arabidopsis

•  CSE as a candidate for involvement in lignification, based on analyses designed to identify genes coexpressed with known components of the lignin biosynthetic Pathway; CSE was also identified as being coexpressed with lignin pathway genes in a set of lignin mutants

•  Two transfer DNA insertion mutants: cse-1, a knockdown mutant with an insertion in the promoter, and cse-2, a knockout mutant with an insertion in the second exon

Vanholme et al., Science, 2013


•  cse-2 mutants had collapsed vessel elements, a phenotype typical of plants with weakened secondary cell walls

•  The mutant phenotype of cse-2 was complemented in stable transgenic lines verifying that the mutation of CSE is the cause of the observed phenotypes

•  The relative proportion of H units increased over 30-fold, suggests that CSE is active in the general phenylpropanoid pathway after the branch leading to H units but before the pathways for G and S units diverge


Validate a gene’s function

•  It is necessary to confirm that the gene is indeed responsible for that phenotype.

•  T-DNA lines contain an average of 1.5 insertions per line, and it is therefore possible that an insertion somewhere else in the genome is responsible for the phenotype.

•  A method for demonstrating that the mutant phenotype is the result of a mutation in the gene of interest is to identify additional mutant alleles that have been isolated.

•  The standard procedure to prove that the mutated gene is responsible for the phenotype, is to perform a gene rescue experiment, transform wild-type gene into the mutant; If the wild-type transgene is able to fully rescue the mutant phenotype, it is safe to conclude that the correct gene has been identified.


•  Phenolic metabolite profiling identified accumulation of the lignin pathway intermediate caffeoyl shikimate in cse mutants

•  Other compounds increased in the cse mutant compared to wild type might be substrates for CSE

–  Incubated purified recombinant CSE enzyme with compounds in vivo

ü  Three compounds decreased in abundance upon treatment with CSE

ü  Caffeoyl shikimate was almost completely hydrolyzed by recombinant CSE into caffeic acid

–  Crude extracts from cse-2 lignifying tissues were less able to hydrolyze caffeoyl shikimate into caffeate

•  Modeling the structure of CSE revealed that caffeoyl shikimate could fit into the active site


Development and commercialization of reduced lignin

•  Alfalfa (Medicago sativa) is the most cultivated forage legume in the world

•  Genetically engineered (GE) glyphosate-resistant alfalfa is deregulated in 2010

•  Since 2015, an alfalfa variety with reduced lignin (RL) has been available as a stacked trait with glyphosate resistance

•  Approximately 15% of the alfalfa currently grown in the U.S. is GE, and this is expected to grow to up to 50% within the next 10 years

Barros et al., 2018


•  Lignin reduction was achieved by downregulating the gene encoding caffeoyl-CoA 3-O-methyltransferase (CCoAOMT), and development of the commercial product, branded as HarvXtra

Barros et al., 2018


a)  With a 5–10 days harvest delay, RL alfalfa harvested on a 35–40 days harvest interval showed 20% gain in forage mass and no significant reduction in RFQ compared to reference cultivars harvested on a 30-day harvest interval

b)  Reducing the cutting frequency improved the persistence of the stand

Barros et al., 2018

Need to know for final exam

•  Methods to identify an insertional/deletion/point mutant for a candidate gene

•  Method to create gene-indexed catalogue of insertional/deletion/point mutants

•  Reverse genetics, TAIL-PCR, exome capture sequencing

•  Paper to read –  Alonso, J.M. and Ecker, J.R., 2006. Moving forward in reverse:

genetic technologies to enable genome-wide phenomic screens in Arabidopsis. Nature Reviews Genetics, 7(7), p.524.

References 1.  Alonso, J.M., Stepanova, A.N., Leisse, T.J., Kim, C.J., Chen, H., Shinn, P., Stevenson, D.K.,

Zimmerman, J., Barajas, P., Cheuk, R. and Gadrinab, C., 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science, 301(5633), pp.653-657.

2.  Alonso, J.M. and Ecker, J.R., 2006. Moving forward in reverse: genetic technologies to enable genome-wide phenomic screens in Arabidopsis. Nature Reviews Genetics, 7(7), p.524.

3.  Barros, J., Temple, S. and Dixon, R.A., 2019. Development and commercialization of reduced lignin alfalfa. Current opinion in biotechnology, 56, pp.48-54.

4.  Henikoff, S. and Comai, L., 2003. Single-nucleotide mutations for plant functional genomics. Annual Review of Plant Biology, 54(1), pp.375-401.

5.  Henry, I.M., Nagalakshmi, U., Lieberman, M.C., Ngo, K.J., Krasileva, K.V., Vasquez-Gross, H., Akhunova, A., Akhunov, E., Dubcovsky, J., Tai, T.H. and Comai, L., 2014. Efficient genome-wide detection and cataloging of EMS-induced mutations using exome capture and next-generation sequencing. The Plant Cell, 26(4), pp.1382-1397.

6.  Jiao, Y., Burke, J.J., Chopra, R., Burow, G., Chen, J., Wang, B., Hayes, C., Emendack, Y., Ware, D. and Xin, Z., 2016. A sorghum mutant resource as an efficient platform for gene discovery in grasses. The Plant Cell, pp.tpc-00373.

7.  Krysan, P.J., Young, J.C. and Sussman, M.R., 1999. T-DNA as an insertional mutagen in Arabidopsis. The Plant Cell, 11(12), pp.2283-2290.

8.  Krysan, P.J., Young, J.C., Tax, F. and Sussman, M.R., 1996. Identification of transferred DNA insertions within Arabidopsis genes involved in signal transduction and ion transport. Proceedings of the National Academy of Sciences, 93(15), pp.8145-8150.

References 8.  Krasileva, K.V., Vasquez-Gross, H.A., Howell, T., Bailey, P., Paraiso, F., Clissold, L., Simmonds,

J., Ramirez-Gonzalez, R.H., Wang, X., Borrill, P. and Fosker, C., 2017. Uncovering hidden variation in polyploid wheat. Proceedings of the National Academy of Sciences, p.201619268.

9.  Li, G., Jain, R., Chern, M., Pham, N.T., Martin, J.A., Wei, T., Schackwitz, W.S., Lipzen, A.M., Duong, P.Q., Jones, K.C. and Jiang, L., 2017. The sequences of 1,504 mutants in the model rice variety Kitaake facilitate rapid functional genomic studies. The Plant Cell, pp.tpc-00154.

10.  Liu, Y.G., Mitsukawa, N., Oosumi, T. and Whittier, R.F., 1995. Efficient isolation and mapping of Arabidopsis thaliana T‐DNA insert junctions by thermal asymmetric interlaced PCR. The Plant Journal, 8(3), pp.457-463.

11.  Page, D.R. and Grossniklaus, U., 2002. The art and design of genetic screens: Arabidopsis thaliana. Nature Reviews Genetics, 3(2), p.124.

12.  Sessions, A., Burke, E., Presting, G., Aux, G., McElver, J., Patton, D., Dietrich, B., Ho, P., Bacwaden, J., Ko, C. and Clarke, J.D., 2002. A high-throughput Arabidopsis reverse genetics system. The Plant Cell, 14(12), pp.2985-2994.

13.  Vanholme, R., Cesarino, I., Rataj, K., Xiao, Y., Sundin, L., Goeminne, G., Kim, H., Cross, J., Morreel, K., Araujo, P. and Welsh, L., 2013. Caffeoyl shikimate esterase (CSE) is an enzyme in the lignin biosynthetic pathway in Arabidopsis. Science, 341(6150), pp.1103-1106.

14.  Vanholme, R., Cesarino, I., Rataj, K., Xiao, Y., Sundin, L., Goeminne, G., Kim, H., Cross, J., Morreel, K., Araujo, P. and Welsh, L., 2013. Caffeoyl shikimate esterase (CSE) is an enzyme in the lignin biosynthetic pathway in Arabidopsis. Science, 341(6150), pp.1103-1106.

15.  van Opijnen, T., Bodi, K.L. and Camilli, A., 2009. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nature methods, 6(10), pp.767-772.

reverse genetics - ndsu.edumcclean/plsc411/lecture 3. reverse genetics_xl2018sep.pdfreverse genetics...

Documents