Flashcard Warm-up

Restriction enzymesEnzymes that will cut DNA at specific places.

This can be used to create DNA fingerprints or to insert genes through gene therapy.

My picture:My definition:

Gel ElectrophoresisTool used to create a DNA fingerprint

My picture:My definition:

Unit 9Biotechnology and Genomics

This is a DNA fingerprint.

This is NOT a DNA fingerprint.

DNA Fingerprint A unique band pattern of DNA fragments. Unique to every individual, unless you

have an identical twin

DNA Fingerprint

Gel Electrophoresis: › a tool used to

create a DNA fingerprint; separates pieces of DNA based on size (the number of

base pairs in each piece).

DNA Fingerprint Steps in DNA Fingerprinting

› Step 1: Restriction enzyme cleaves specific DNA sequence

› Restriction enzyme: the enzymes that “cuts” the DNA between the nitrogen bases

› Cleave: to Cut

DNA Fingerprinting Step 2: DNA loaded into a gel

electrophoresis.. Step 3: Bands are created as electricity

forces DNA fragments through the gel. Small pieces move further than larger pieces.

Running a gel

1 2

cut DNA with restriction enzymes

fragments of DNAseparate out based on size

3

Stain DNA› ethidium bromide

binds to DNA› fluoresces under

UV light

DNA Fingerprint Uses for DNA Fingerprinting:

› Violent Crimes – determines source of DNA left at a crime scene.

› Paternity - used to determine the father of a child

Uses: Evolutionary relationships

Comparing DNA samples from different organisms to measure evolutionary relationships

–

+

DNA

1 32 4 5 1 2 3 4 5

turtlesnakeratsquirrelfruitfly

Example

A DNA sample wasretrieved from a rape kit completed at the hospital. The policehave 3 possible suspects. A DNA fingerprint has been done to narrow done the suspect pool. Who is the police’s MAIN Suspect?

Ticket out the Door1. Why are restriction

enzymes important when making a DNA fingerprint?

2. What do the bands represent on a DNA fingerprint?

3. Using the fingerprint to the right who is a possible suspect for murder?

Flashcard Warm-up

Recombinant DNA/ Genetic

EngineeringTechnology that combines

DNA from two different organisms. One practical application of this process

is making human insulin for people with Diabetes.

Glo fish were the first genetically engineeredPet in 1993!A gene called “green fluorescent protein” was extracted from jellyfish to create the first glo fish. Their goal was to develop a fish that could detect pollution by selectively fluorescing in the presence of environmental toxins

Is the male in the fingerprint the father of the girl?

Can we mix genes from one creature to another?

YES!

We have been manipulating DNA for generations!

Artificial breeding or AKA artificial selection› creating new breeds of animals & new crop plants to

improve our food› A process in which humans consciously select for or

against particular features in organisms. For example, the human may allow only organisms with the desired feature to reproduce or may provide more resources to the organisms with the desired feature

Breeding food plants

Evolution of modern corn (right) from ancestral teosinte (left).

Most practical application of GENETIC ENGINEERING…

Creating Insulin (a protein hormone) for people with Diabetes

Genetic Engineering Genetic Engineering: Modifications of DNA;

AKA Recombinant DNA› Transgenic Organism: an organism which

contains foreign DNA

A gene isolated from a species of jellyfish which causes fluorescence was introduced into marmoset embryos that allows them to build green fluorescent protein (GFP) in their tissues. Which glows green when exposed to blue light.

Genetic Engineering

Process in creating Transgenic organism:› Step 1: Restriction

enzymes cleave DNA sequence at desired gene (ex. Insulin

Genetic Engineering Step 2 : The same

restriction enzyme is used to cleave the vector › Vector: The structure

used to carry the foreign DNA bacterial plasmids commonly used.

› Plasmid: Circular DNA found in bacteria

Genetic Engineering Step 3: Foreign DNA and Vector spliced

together› Splice: Combine

Genetic Engineering

Step 4: The recombinant DNA is inserted into the host (bacteria cell). Host cell will copy and produce the protein

Genetic Engineering

Recombinant DNA: form of artificial DNA that is created by combining two different sources of DNA

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

Why mix genes together?

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

Gene produces protein in different organism or different individual

aa aaaa aa aa aa aa aa aa aa

“new” protein from organismex: human insulin from bacteria

human insulin gene in bacteria

bacteria human insulin

How can bacteria read human DNA?

Bioethical Concerns for Genetic Engineering

Should we produce artificial proteins?

Allergic reactions (adding a peanut gene to a corn plant)

Environmental problems from creating transgenic organisms › (ex. Oil digesting bacteria)

GMO’s –What are they? GMO stands for

Genetically Modified Organisms

http://cls.casa.colostate.edu/transgeniccrops/animation.html

Before GMO’s cross-breeding was the answer

Flashcard Warm-upSteps in genetic Engineering/ Recombinant DNA

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

Gene Therapy Defective genes are

identified and replaced with a functioning gene from another individual

Uses: replace missing of defective genes, Ex. Treating cystic fibrosis and hemophilia

Human Genome Project The Human Genome Project: is a

collaborative effort among scientists from around the world to map the genes of a human.› Uses: determine whether individuals may

carry genes for genetic conditions in the hopes to develop gene therapy or genetically based medicines

Ticket out the Door1. Foreign DNA is spliced into what type of

organism?2. What is a most common use of

Recombinant DNA?3. Tobacco plant displays a bioluminescence

(glows) due to a protein found in fireflies which controls the fireflies luminescence. Which is the transgenic organism, Tobacco plant or the firefly?

4. What was the purpose of the Human Genome Project?

Recombinant DNA Ticket IN the door.

1. Place the lettered steps in the correct order.

2. What organism usually acts as the host cell in the process of genetic engineering?

3. What is a plasmid? 4. What do hydrogen bonds hold together

in a DNA molecule?

C. Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin

D. The same restriction enzyme is used to cleave the vector

A. Foreign DNA and Vector spliced togetherB. The recombinant DNA is inserted into the host (bacteria cell).