respiratory diagnostics

47
Respiratory Diagnostics Brian J. Payne, DVM Carthage Veterinary Service, Ltd.

Upload: ebony

Post on 11-Jan-2016

29 views

Category:

Documents


2 download

DESCRIPTION

Respiratory Diagnostics. Brian J. Payne, DVM Carthage Veterinary Service, Ltd. The Presentation. The actual presentation given at AASV is based on actual case studies. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Respiratory Diagnostics

Respiratory Diagnostics

Brian J. Payne, DVM

Carthage Veterinary Service, Ltd.

Page 2: Respiratory Diagnostics

The Presentation

• The actual presentation given at AASV is based on actual case studies.

• This PowerPoint presentation (based on PRRS diagnostics specifically) describes many of the laboratory tests that were utilized for these actual cases.

Page 3: Respiratory Diagnostics

One more thing…

It has been an enormous benefit for me in a clinical setting to

understand each diagnostic test that I request so that I can better

interpret the results.

I hope this helps!

Page 4: Respiratory Diagnostics

PRRS…Diagnostics

• Serology– PRRSv– PRRS Viral Antigens– PRRS Antibodies

• Tissue– PRRSv

• Other– Semen PRRSv

Page 5: Respiratory Diagnostics

PRRS…Serology

• ELISA

• IFA

• PCR

• RFLP

• Genetic Sequencing

• SVN

Page 6: Respiratory Diagnostics

PRRS…Indirect ELISA

• Enzyme-linked immunosorbent assay

• Extremely high sensitivity ~100%

• 99.5% specificity

• Quick to run

• Indirect method to determine antigen-specific PRRSv antibodies

Page 7: Respiratory Diagnostics

Indirect ELISA…Process

• Polymer substrate

• Enzyme-labeled anti-porcine conjugate

•Serum sample with PRRSv/Viral antibodies

• Antigen

Page 8: Respiratory Diagnostics

Indirect ELISA…Results

• Bound enzyme allows visual detection

• In-house tests usually (+) or (-)

• In-lab tests utilize optical densities to give continuous range of numbers University of AZ, 1993

Page 9: Respiratory Diagnostics

S/P Ratio Pos/Neg Results010.8938 POSITIVE 1-0.002 Neg 02.0789 POSITIVE 12.815 POSITIVE 13.456 POSITIVE 10.089 Neg 0

0.5541 POSITIVE 11.272 POSITIVE 1

0.5865 POSITIVE 10.3701 Suspect 00.4712 POSITIVE 11.3387 POSITIVE 1

ResultsPRRS ELISA

Indirect ELISA...Results

• IDEXX HerdChek• Based on S/P ratio

– sample/positive

• Optical densities (continual range)

• < 0.3 = Negative• 0.3-0.4 = Suspect• > 0.3999 = Positive

Page 10: Respiratory Diagnostics

Indirect ELISA…Antibody Detection

• PRRSv Ab detectable 9-13 days PI

• Peak at 30-50 days

• Rapid decline but still may be detectable in > 10 months (personal experience is > 2 years)

Page 11: Respiratory Diagnostics

Indirect ELISA…Limitations

• Allows evidence of exposure to PRRSv

• However, no information on:– Length of exposure– Severity of infection– Which strain is present– Differentiation of vaccine and wild-type virus

• Variability of immune responses within a given population

Page 12: Respiratory Diagnostics

PRRS…IFA• Indirect fluorescent antibody

• Specificity 99.5%

• Sensitivity (based on laboratory variation)– Culture media– Protocols– Incubation time– Cell types– Technician skill and subjectivity of results– Lab PRRSv genetic sim. to wild-type PRRSv

Page 13: Respiratory Diagnostics

IFA…The Process

• Polymer substrate• PRRSv (lab) infected cells

• Serum with PRRSv Antibodies (IgG)

• Fluorescein-labeled anti-porcine antibody

Page 14: Respiratory Diagnostics

IFA…The Results

• Magnitude of Ab titer can be determined unlike ELISA

Magar, R., 1993

Page 15: Respiratory Diagnostics

IFA…The Results

• < 1:20 or 16 = negative• 1:20 or 16 or greater =

positive• Titer endpoints are

subjectively determined, therefore variation

Titer Pos/Neg Results011:80 Pos 0

<1:20 Neg 0null Neg 01:20 POSITIVE 11:40 POSITIVE 11:20 POSITIVE 11:20 POSITIVE 1

ResultsPRRS IFA

Page 16: Respiratory Diagnostics

IFA…Antibody Detection

• IgG against PRRSv detectable 7-11 days PI

• Peak at 30-50 days

• Rapid decline but still may be detectable in 4-6 months

Page 17: Respiratory Diagnostics

PRRS…PCR

• Polymerase Chain Reaction

• In vitro amplification of DNA– RNA of virus extracted from sample– Reverse transcriptase (RNA to DNA)– PCR amplifies DNA

• Target most conserved genes– ORF 6 and ORF 7

Page 18: Respiratory Diagnostics

PCR…Process

RNA

Reverse Transcriptase

DNA

Heat Denaturing

Primersand

Cooling

Annealing

Taq +Nucleotides

CT G

A

Complementary Strands

30 Cycles

Page 19: Respiratory Diagnostics

PCR…The ProcessAfter 30 cycles, 1000’s of replicates

Gel Electrophoresis(Colorimetric, Radioactive, Fluorometric)(-) (+)

Page 20: Respiratory Diagnostics

PCR…Adv / DisAdv

• Rapid turnaround (RT-PCR) - 1-3 days

• High sensitivity and specificity

• Detects Ag…no need to wait for immune system response

• Detection determined by correlation b/w primers and PRRSv

• Not indicative of replicating virus

Page 21: Respiratory Diagnostics

PRRS…RFLP

• Restriction Fragment Length Polymorphism

• Utilizes RT-PCR of ORF 5 gene– Envelop proteins– Prone to mutation

• 3 Restriction Enzymes Used– Their cutting patterns are assigned numbers– I.e. 1-4-2, 2-1-2, 2-6-2, 1-5-2

Page 22: Respiratory Diagnostics

RFLP…Interpretation

• May differentiate between vaccine virus (2-5-2) and wild-type virus

• No indication of virulence

• No indication on cross-protection

• Change in RFLP can be from 1 base pair substitution…careful interpretation

• Little indication of homology (4%)

Page 23: Respiratory Diagnostics

RFLP…Example

“Open reading frame 5 of PRRSV was sequenced.

This PRRSV has a predicted RFLP cut pattern of

2-5-2 and differs from each of the 3 modified-live

PRRS vaccine viruses (Ingelvac/RespPRRS,

Ingelvac ATP, PrimePac) by more than .5%.”

University of MN

Page 24: Respiratory Diagnostics

RFLP…Example

“RFLP cut patterns are usually an inaccurate

measure of PRRSV relatedness.”

University of MN

Page 25: Respiratory Diagnostics

PRRS Genetic Sequencing

• Provides exact nucleotide sequence of ORF

• Utilize ORF 5 b/c most variable

• Therefore, more informative than RFLP

• Dendograms (phylogenetic tree) can be made and homologies can be seen

Page 26: Respiratory Diagnostics

ORF 5 Genetic SequencingATGTTGGAGAAATGCTTGACCGCGGGCTGTTGCTCGCGATTGCTTTCTTTGTGG

TGTATCGTGCCGTTCTGTTTTGCTGTGCTCGCCAACGCCAGCAACAACAGCAGC

TCCCATCTACAGCTGATTTACAACTTGACGCTATGTGAGCTGAATGGCACAGATT

GGCTAGCTAACAAATTTGATTGGGCAGTGGAGAGTTTTGTCATCTTTCCCGTTTT

GACTCACATTGTCTCCTATGGTGCCCTCACTACCAGCCATTTCCTTGACACAGTC

GCTTTAGTCACTGTGTCTACCGCCGGGTTTGTTCACGGGCGGTATGTCCTAAGT

AGCATCTACGCGGTCTGTGCCCTGGCTGCGTTGACTTGCTTCGTCATTAGGTTT

GCAAAGAATTGCATGTCCTGGCGCTACGCGTGTACCAGATATACCAACTTTCTT

CTGGACACTAAGGGCATACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAA

AAGGGGCAAAGTTGAGGTCGAAGGTCATCTGATCGACCTCAAAAGAGTTGTGC

TTGATGGTTCCGTGGCAACCCCTATAACCAGAGTTTCAGCGGAACAATGGGGTC

GTCCTTAG >550 Nucleotides

Page 27: Respiratory Diagnostics

Percent Identity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

1 99.7 99.5 88.7 99.3 82.8 94.2 98.8 99.2 99.2 89.2 98.8 88.7 89.4 98.8 98.8 99.0 92.9 87.7 85.7 94.2 86.7 85.7 88.7 89.4 88.4 88.7 89.1 89.1 88.9 94.7 99.2 99.2 99.5 89.4 89.6 89.6 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.9 89.2 84.9 86.9 85.6 89.1 99.7 86.9 1 D04-33870 Black Jack/Holtkai

2 0.3 99.8 89.1 99.3 83.3 94.5 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.4 88.1 86.1 94.5 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.0 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 84.9 87.1 85.7 89.4 100.0 87.1 2 D04-29274 Black Jack Pork

3 0.5 0.2 89.1 99.3 83.3 94.7 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.5 88.1 86.1 94.7 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.2 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.4 89.2 84.9 87.1 85.7 89.4 99.8 87.1 3 D04-49976 W eidner, Al

4 11.2 10.9 10.8 89.6 84.6 85.1 89.2 88.9 89.2 98.3 89.1 98.0 98.5 89.1 89.6 89.7 84.9 97.8 89.4 86.1 95.2 89.4 98.7 87.6 87.7 98.5 99.0 99.0 98.8 86.6 88.7 89.6 89.2 87.4 87.9 87.6 87.2 89.1 89.1 87.7 88.7 89.1 89.1 86.9 88.2 88.1 87.1 85.6 99.5 89.1 87.1 4 D06-21801(4-6) H&P

5 0.7 0.7 0.7 10.4 83.1 94.2 99.5 99.3 99.5 90.0 98.8 89.6 90.2 98.8 99.5 99.0 93.7 88.6 86.1 94.9 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.4 99.2 99.2 99.5 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.5 89.6 85.6 87.2 85.9 89.9 99.3 87.2 5 D06-16814(21-25) County Line Pork

6 17.5 17.0 17.0 15.9 17.0 81.9 82.8 82.9 82.9 84.2 83.6 84.1 84.1 83.3 83.1 83.7 82.4 84.4 83.4 82.6 82.8 83.4 85.1 83.3 83.1 84.1 84.6 84.6 84.4 82.4 83.3 83.7 83.4 82.8 83.1 82.9 83.1 83.7 83.7 83.3 83.9 83.7 83.7 83.3 82.8 82.6 87.9 86.2 84.6 83.3 87.9 6 D06-13563-22 Sand Ridge

7 5.6 5.2 5.0 15.0 5.4 17.8 93.9 93.5 94.9 85.7 94.2 85.6 85.9 93.9 94.0 94.4 97.8 84.4 82.6 98.2 82.9 82.6 85.2 87.4 86.4 84.9 85.4 85.4 85.2 98.7 94.7 94.2 94.5 86.7 86.9 86.9 87.2 88.2 88.2 87.6 88.1 88.2 88.2 97.8 87.1 82.4 84.9 83.4 85.4 94.5 84.9 7 D06-6000-1 Huftalin/Dreska

8 1.0 0.8 0.8 10.7 0.3 17.3 5.6 98.8 99.2 89.7 98.5 89.2 89.9 98.5 99.2 98.7 93.4 88.2 85.6 94.5 87.2 85.6 89.2 89.7 88.7 89.2 89.6 89.6 89.4 95.0 98.8 98.8 99.2 89.4 89.6 89.6 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 85.7 87.1 85.7 89.6 99.0 87.1 8 D06-3518(1-5) County Line Pork

9 0.5 0.5 0.5 10.7 0.3 16.8 5.6 0.7 99.0 89.4 98.7 88.9 89.6 98.7 98.8 98.8 92.7 87.9 85.9 93.9 86.9 85.9 88.9 89.4 88.6 88.9 89.2 89.2 89.1 94.4 99.0 99.0 99.3 89.2 89.4 89.4 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.7 88.7 84.2 87.1 85.7 89.2 99.2 87.1 9 D05-65768(1-5) County Line Pork

10 0.8 0.5 0.5 10.7 0.5 17.3 4.8 0.7 0.7 90.0 99.0 89.2 90.2 99.0 99.3 99.5 93.4 88.2 86.1 94.5 87.2 86.1 89.2 90.2 88.9 89.2 89.6 89.6 89.4 95.0 99.3 99.3 99.7 89.6 89.7 89.7 90.2 91.9 91.9 90.5 91.5 91.9 91.9 96.2 89.4 85.2 87.2 85.9 89.6 99.5 87.2 10 D05-56088(16-20) County Line Pork

11 11.1 10.7 10.7 1.7 10.3 16.4 14.3 10.5 10.5 10.1 89.6 98.3 99.8 89.6 90.0 89.6 85.2 97.8 89.7 86.6 96.2 89.7 99.0 87.7 87.4 99.0 99.3 99.3 99.2 86.9 89.2 90.0 89.7 87.1 87.4 87.2 87.6 88.9 88.9 87.9 88.6 88.9 88.9 87.2 87.4 87.7 87.7 86.2 98.5 89.6 87.7 11 D04-14781(1-5) Black Jack Pork

12 1.2 0.8 0.8 10.7 1.2 16.4 5.6 1.3 1.0 1.0 10.5 89.1 89.7 99.3 98.8 98.8 93.2 88.1 85.7 93.9 87.1 85.7 89.1 89.9 88.9 89.1 89.4 89.4 89.2 94.4 99.0 99.3 99.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.5 89.4 85.2 87.1 85.7 89.4 99.2 87.1 12 D04-21622 Future Pork

13 11.4 11.1 11.0 2.0 10.6 16.4 14.8 10.9 10.9 10.9 1.7 10.9 98.5 89.1 89.6 89.7 85.4 97.3 88.9 86.4 95.4 88.9 98.7 87.2 87.4 98.7 99.0 99.0 98.8 86.9 88.7 89.6 89.2 87.1 87.2 87.2 87.1 88.7 88.7 87.4 88.4 88.7 88.7 87.2 87.1 87.4 86.4 84.9 98.2 89.1 86.4 13 D04-17554(1-2) K&K BlackJack Pork

14 10.9 10.5 10.5 1.5 10.1 16.6 14.1 10.3 10.3 9.9 0.2 10.3 1.5 89.7 90.2 89.7 85.4 98.0 89.6 86.7 96.4 89.6 99.2 87.9 87.6 99.2 99.5 99.5 99.3 87.1 89.4 90.2 89.9 87.4 87.6 87.6 87.7 89.1 89.1 88.1 88.7 89.1 89.1 87.4 87.6 87.6 87.6 86.1 98.7 89.7 87.6 14 D04-16905(1-3) Walbexer Black Jack

15 1.2 0.8 0.8 10.7 1.2 16.8 5.9 1.3 1.0 1.0 10.5 0.7 10.9 10.3 98.8 98.8 92.7 88.1 85.6 93.9 87.1 85.6 89.1 89.4 88.4 89.1 89.4 89.4 89.2 94.4 99.0 99.0 99.3 89.6 89.7 89.7 89.4 91.5 91.5 89.7 91.2 91.5 91.5 95.5 89.1 85.2 86.9 85.6 89.4 99.2 86.9 15 D04-16408-1 Illini Swine

16 1.2 0.8 0.8 10.4 0.5 17.0 5.6 0.7 0.8 0.7 10.3 1.2 10.6 10.1 1.2 98.8 93.4 88.6 86.1 94.7 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.2 99.3 99.0 99.3 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.4 89.6 85.6 87.1 85.7 89.9 99.2 87.1 16 D04-33869 County Line Pork

17 1.0 0.7 0.7 10.5 1.0 16.6 5.4 1.2 0.8 0.5 10.3 1.2 10.7 10.1 1.2 1.2 93.2 88.2 86.7 94.0 87.2 86.7 89.7 90.2 89.2 89.7 90.0 90.0 89.9 94.5 99.2 99.2 99.5 89.9 90.0 90.0 90.2 91.9 91.9 90.5 91.5 91.9 91.9 95.7 89.4 85.4 87.1 85.7 90.0 99.3 87.1 17 D05-8868(4-6) County Line

18 6.9 6.5 6.3 15.2 6.3 17.4 2.2 6.5 6.7 6.5 15.0 6.9 15.0 14.8 7.2 6.5 6.7 84.2 82.1 96.7 82.8 82.1 85.1 86.7 86.2 84.7 85.2 85.2 85.1 97.2 93.2 93.0 93.4 86.4 86.6 86.6 86.6 87.9 87.9 86.9 87.7 87.9 87.9 96.5 86.2 81.8 84.2 82.8 85.2 93.4 84.2 18 D05-46346(7-9) S&S Farms

19 11.0 10.6 10.6 1.0 10.2 14.8 14.5 10.4 10.4 10.4 0.8 10.4 1.4 0.7 10.4 10.2 10.4 14.7 88.9 85.4 95.4 88.9 98.0 86.6 87.2 98.0 98.3 98.3 98.2 85.9 88.1 88.6 88.2 86.6 86.7 86.7 86.4 88.4 88.4 86.7 88.1 88.4 88.4 86.2 86.9 87.4 87.1 85.6 98.0 88.1 87.1 19 D03-18981(1,2,4,5) Black Jack Pork

20 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 83.3 88.7 100.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 20 D03-18980(5,8) Black Jack Pork

21 5.4 5.0 4.8 13.9 4.8 17.1 1.9 5.0 5.2 5.0 13.7 5.7 13.9 13.5 5.7 5.0 5.6 3.2 13.5 17.4 84.1 83.3 86.2 87.7 86.9 85.9 86.4 86.4 86.2 99.3 94.7 94.2 94.5 87.4 87.6 87.6 87.6 88.9 88.9 87.9 88.7 88.9 88.9 98.5 87.6 82.9 84.6 83.1 86.4 94.5 84.6 21 D03-19304(20-23) S&S Farms

22 9.9 9.6 9.5 1.6 9.1 14.8 13.7 9.4 9.4 9.4 0.7 9.4 1.4 0.5 9.4 9.1 9.4 13.9 0.7 9.0 12.6 88.7 96.0 85.7 86.6 95.9 96.4 96.4 96.2 84.4 86.7 87.6 87.2 85.6 85.7 85.7 85.6 87.6 87.6 85.9 87.6 87.6 87.6 84.7 86.2 85.4 85.1 83.3 95.4 87.1 85.1 22 D03-16034(1-7-9) Black Jack Pork

23 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 0.0 17.4 9.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 23 D03-16035(5-8) Black Jack Pork

24 11.5 11.1 11.1 1.3 10.7 15.5 15.0 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.7 10.7 15.2 0.7 11.6 13.9 0.9 11.6 87.7 87.7 99.3 99.7 99.7 99.5 86.7 88.7 89.6 89.2 87.6 87.7 87.7 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.7 87.4 85.9 98.8 89.1 87.4 24 D03-14810-23 Black Jack Pork

25 10.9 10.5 10.5 12.8 10.1 17.7 13.2 10.3 10.5 9.9 12.6 10.3 13.4 12.4 10.7 10.1 10.1 14.0 12.5 14.6 12.9 11.5 14.6 12.8 95.7 87.6 87.9 87.9 87.7 87.9 89.9 89.9 89.9 95.5 95.7 95.7 99.3 97.8 97.8 99.5 97.7 97.8 97.8 88.2 96.0 87.2 85.4 84.1 87.9 89.7 85.4 25 D03-13137(11-15) Illini Farm 1904

26 11.3 10.9 10.9 11.7 10.5 16.5 14.0 10.7 10.7 10.7 11.9 10.7 12.3 11.7 11.1 10.5 10.5 14.2 11.2 14.0 13.3 10.0 14.0 11.7 3.6 87.6 88.1 88.1 87.9 87.1 88.9 88.9 88.9 94.2 94.4 94.4 95.7 96.7 96.7 95.9 96.8 96.7 96.7 87.6 94.5 86.2 84.7 83.1 88.1 88.7 84.7 26 D03-10907-3 LincolnLand Farms

27 11.4 11.1 11.0 1.3 10.6 16.4 15.2 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.6 10.7 15.4 0.7 11.5 14.1 0.9 11.5 0.7 13.0 11.9 99.7 99.7 99.5 86.4 88.7 89.6 89.2 87.4 87.2 87.4 87.4 89.1 89.1 87.7 88.7 89.1 89.1 86.7 87.4 87.9 86.9 85.7 98.8 89.1 86.9 27 D03-10033 Black Jack Pork

28 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 100.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 28 D03-10529(1-4) Black Jack Pork

29 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 0.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 29 D03-10935(1-4) Black Jack Pork

30 11.3 10.9 10.9 1.2 10.5 16.2 15.0 10.7 10.7 10.7 0.8 10.7 1.2 0.7 10.7 10.5 10.5 15.2 0.5 10.9 13.9 0.7 10.9 0.5 12.8 11.7 0.5 0.2 0.2 86.7 88.9 89.7 89.4 87.9 88.1 88.1 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.9 87.1 85.6 99.0 89.2 87.1 30 D03-10530-1 Black Jack Pork

31 4.8 4.5 4.3 13.5 4.3 17.4 1.3 4.5 4.7 4.5 13.3 5.2 13.5 13.1 5.2 4.5 5.0 2.7 13.1 16.9 0.7 12.2 16.9 13.5 12.8 13.1 13.7 13.3 13.3 13.5 95.2 94.7 95.0 87.6 87.7 87.7 87.7 89.1 89.1 88.1 88.9 89.1 89.1 99.0 87.7 83.4 85.1 83.6 86.9 95.0 85.1 31 D03-6293-4 S&S Farms (102850)

32 0.8 0.5 0.5 11.1 0.8 16.8 5.2 1.0 0.7 0.7 10.9 1.0 11.3 10.7 1.0 0.7 0.8 6.5 10.6 13.5 5.0 9.8 13.5 11.3 10.3 10.7 11.3 10.9 10.9 11.1 4.5 99.3 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.6 85.2 87.2 85.9 89.1 99.5 87.2 32 D02-48860(4-8) Crescent Pork

33 0.8 0.5 0.5 10.3 0.8 16.4 5.6 1.0 0.7 0.7 10.1 0.7 10.5 9.9 1.0 1.0 0.8 6.9 10.0 13.9 5.4 9.0 13.9 10.5 10.3 10.7 10.5 10.1 10.1 10.3 4.8 0.7 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.9 89.4 84.7 87.2 85.9 89.9 99.5 87.2 33 D02-45742-1 Black Jack Pork

34 0.5 0.2 0.2 10.7 0.5 16.8 5.2 0.7 0.3 0.3 10.5 0.7 10.9 10.3 0.7 0.7 0.5 6.5 10.4 13.5 5.0 9.4 13.5 10.9 10.3 10.7 10.9 10.5 10.5 10.7 4.5 0.3 0.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.4 85.1 87.2 85.9 89.6 99.8 87.2 34 D02-45742-2 Black Jack Pork

35 10.9 10.5 10.5 12.7 10.5 17.7 13.8 10.8 10.6 10.7 13.0 10.3 13.4 12.8 10.7 10.5 10.5 14.5 12.3 13.6 13.2 11.7 13.6 12.8 4.5 4.8 13.0 12.5 12.5 12.3 13.0 10.3 10.3 10.3 99.5 99.7 95.5 96.8 96.8 95.7 96.7 96.8 96.8 87.9 94.5 86.2 84.4 82.9 87.7 89.7 84.4 35 D04-49972-1 Illini Swine Inc

36 10.9 10.5 10.5 12.3 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.4 12.3 13.5 13.1 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 12.9 10.3 10.3 10.3 0.3 99.7 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.9 83.3 87.9 89.9 84.9 36 D04-49972-2 Illini Swine Inc

37 10.9 10.5 10.5 12.7 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.5 12.3 13.5 13.2 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 13.0 10.3 10.3 10.3 0.2 0.3 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.6 82.9 87.9 89.9 84.6 37 D04-49972-3 Illini Swine Inc

38 10.9 10.5 10.5 12.9 10.1 17.9 13.2 10.4 10.6 9.9 12.8 10.3 13.6 12.5 10.7 10.1 10.1 14.3 12.7 14.8 13.0 11.6 14.8 13.0 0.7 3.6 13.2 12.8 12.8 13.0 12.8 10.3 10.3 10.3 4.5 4.5 4.5 97.8 97.8 99.5 97.7 97.8 97.8 88.1 95.2 86.9 85.2 84.1 87.7 89.7 85.2 38 D03-6295-3 Illini-North

39 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 100.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 39 D03-5293(2-4) I llini Swine-Hich Tec

40 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 40 D03-5293(5-7) I llini Swine-High Tec

41 10.3 10.0 9.9 12.3 9.5 17.5 12.6 9.8 10.0 9.4 12.2 9.8 13.0 11.9 10.2 9.5 9.6 13.6 12.1 14.4 12.4 11.0 14.4 12.4 0.3 3.2 12.5 12.2 12.2 12.4 12.2 9.8 9.8 9.8 4.1 4.1 4.1 0.3 1.9 1.9 97.8 98.0 98.0 88.4 95.7 87.4 85.6 84.2 88.1 90.0 85.6 41 D03-5296(3-4) I llini Swine-North

42 9.3 9.0 8.9 11.3 8.6 16.6 12.8 8.8 9.0 8.8 11.5 8.8 11.9 11.3 9.2 8.6 9.0 13.4 11.1 13.3 12.1 9.8 13.3 11.3 2.4 2.5 11.5 11.1 11.1 11.3 12.0 8.8 8.8 8.8 3.1 3.1 3.1 2.4 0.2 0.2 2.0 99.8 99.8 89.6 96.0 87.7 85.9 84.4 89.1 91.4 85.9 42 D02-61015-3 Illini Farms South

43 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 43 D02-61016-1 Illini Farms South

44 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 0.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 44 D02-48857(5-8) I llini South

45 4.1 3.8 3.6 13.5 3.6 16.9 2.2 3.8 4.0 3.8 13.3 4.5 13.5 13.1 4.5 3.8 4.3 3.4 13.0 16.9 1.5 12.2 16.9 13.5 12.5 12.7 13.7 13.3 13.3 13.5 1.0 3.8 4.1 3.8 12.8 12.7 12.8 12.6 11.1 11.1 12.0 11.3 11.1 11.1 87.9 83.6 85.6 84.1 87.2 96.2 85.6 45 D02-48858(7-9) S&S Farms

46 10.9 10.9 10.9 12.2 10.5 18.0 13.4 10.8 11.0 10.7 12.8 10.7 13.4 12.6 11.1 10.5 10.9 14.3 12.1 15.3 13.0 10.9 15.3 12.6 3.8 4.5 12.8 12.4 12.4 12.6 12.8 10.7 10.7 10.7 5.2 5.2 5.2 4.5 3.6 3.6 4.0 3.8 3.6 3.6 12.8 87.9 85.6 83.9 87.9 89.2 85.6 46 D02-47395(1-2) Nipco Farms

47 14.5 14.5 14.5 12.3 14.1 18.5 17.5 13.7 14.6 14.3 13.2 14.3 13.6 13.4 14.3 14.1 14.3 18.0 12.1 13.2 16.9 12.5 13.2 13.2 13.5 14.1 12.9 12.8 12.8 13.0 16.5 14.3 14.7 14.3 14.4 14.4 14.4 13.7 12.7 12.7 13.1 12.9 12.7 12.7 16.9 12.3 84.2 83.1 88.1 84.9 84.2 47 D02-47394(5-8) Prime Pork

48 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 98.7 87.2 87.1 100.0 48 D06-28296-5 Boars

49 13.9 13.7 13.7 13.7 13.5 13.2 16.0 13.5 13.3 13.5 12.8 13.5 14.1 13.1 13.5 13.7 13.3 16.9 12.4 16.6 16.7 12.8 16.6 13.3 14.5 14.7 13.3 13.3 13.3 13.5 16.0 13.5 13.5 13.5 15.7 15.6 15.6 14.5 14.1 14.1 14.1 14.3 14.1 14.1 16.0 14.6 16.7 0.2 85.7 85.7 98.7 49 D06-26717-1 Boars

50 11.0 10.7 10.6 0.5 10.2 15.7 14.7 10.5 10.5 10.5 1.5 10.5 1.9 1.3 10.5 10.2 10.3 15.0 0.8 11.3 13.7 1.4 11.3 1.2 12.5 11.5 1.2 0.8 0.8 1.0 13.3 10.9 10.1 10.5 12.5 12.5 12.5 12.7 10.9 10.9 12.1 11.1 10.9 10.9 13.3 12.4 12.5 13.1 13.5 89.4 87.2 50 IngelvacATP

51 0.3 0.0 0.2 10.9 0.7 17.0 5.2 0.8 0.5 0.5 10.7 0.8 11.1 10.5 0.8 0.8 0.7 6.5 10.6 13.7 5.0 9.6 13.7 11.1 10.5 10.9 11.1 10.7 10.7 10.9 4.5 0.5 0.5 0.2 10.5 10.5 10.5 10.5 8.8 8.8 10.0 9.0 8.8 8.8 3.8 10.9 14.5 13.3 13.7 10.7 87.1 51 RespPRRS

52 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 0.0 0.2 13.1 13.3 52 D06-30617-1 FuturePork

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

Page 28: Respiratory Diagnostics

Percent Identity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

1 99.7 99.5 88.7 99.3 82.8 94.2 98.8 99.2 99.2 89.2 98.8 88.7 89.4 98.8 98.8 99.0 92.9 87.7 85.7 94.2 86.7 85.7 88.7 89.4 88.4 88.7 89.1 89.1 88.9 94.7 99.2 99.2 99.5 89.4 89.6 89.6 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.9 89.2 84.9 86.9 85.6 89.1 99.7 86.9 1 D04-33870 Black Jack/Holtkai

2 0.3 99.8 89.1 99.3 83.3 94.5 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.4 88.1 86.1 94.5 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.0 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 84.9 87.1 85.7 89.4 100.0 87.1 2 D04-29274 Black Jack Pork

3 0.5 0.2 89.1 99.3 83.3 94.7 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.5 88.1 86.1 94.7 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.2 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.4 89.2 84.9 87.1 85.7 89.4 99.8 87.1 3 D04-49976 W eidner, Al

4 11.2 10.9 10.8 89.6 84.6 85.1 89.2 88.9 89.2 98.3 89.1 98.0 98.5 89.1 89.6 89.7 84.9 97.8 89.4 86.1 95.2 89.4 98.7 87.6 87.7 98.5 99.0 99.0 98.8 86.6 88.7 89.6 89.2 87.4 87.9 87.6 87.2 89.1 89.1 87.7 88.7 89.1 89.1 86.9 88.2 88.1 87.1 85.6 99.5 89.1 87.1 4 D06-21801(4-6) H&P

5 0.7 0.7 0.7 10.4 83.1 94.2 99.5 99.3 99.5 90.0 98.8 89.6 90.2 98.8 99.5 99.0 93.7 88.6 86.1 94.9 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.4 99.2 99.2 99.5 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.5 89.6 85.6 87.2 85.9 89.9 99.3 87.2 5 D06-16814(21-25) County Line Pork

6 17.5 17.0 17.0 15.9 17.0 81.9 82.8 82.9 82.9 84.2 83.6 84.1 84.1 83.3 83.1 83.7 82.4 84.4 83.4 82.6 82.8 83.4 85.1 83.3 83.1 84.1 84.6 84.6 84.4 82.4 83.3 83.7 83.4 82.8 83.1 82.9 83.1 83.7 83.7 83.3 83.9 83.7 83.7 83.3 82.8 82.6 87.9 86.2 84.6 83.3 87.9 6 D06-13563-22 Sand Ridge

7 5.6 5.2 5.0 15.0 5.4 17.8 93.9 93.5 94.9 85.7 94.2 85.6 85.9 93.9 94.0 94.4 97.8 84.4 82.6 98.2 82.9 82.6 85.2 87.4 86.4 84.9 85.4 85.4 85.2 98.7 94.7 94.2 94.5 86.7 86.9 86.9 87.2 88.2 88.2 87.6 88.1 88.2 88.2 97.8 87.1 82.4 84.9 83.4 85.4 94.5 84.9 7 D06-6000-1 Huftalin/Dreska

8 1.0 0.8 0.8 10.7 0.3 17.3 5.6 98.8 99.2 89.7 98.5 89.2 89.9 98.5 99.2 98.7 93.4 88.2 85.6 94.5 87.2 85.6 89.2 89.7 88.7 89.2 89.6 89.6 89.4 95.0 98.8 98.8 99.2 89.4 89.6 89.6 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 85.7 87.1 85.7 89.6 99.0 87.1 8 D06-3518(1-5) County Line Pork

9 0.5 0.5 0.5 10.7 0.3 16.8 5.6 0.7 99.0 89.4 98.7 88.9 89.6 98.7 98.8 98.8 92.7 87.9 85.9 93.9 86.9 85.9 88.9 89.4 88.6 88.9 89.2 89.2 89.1 94.4 99.0 99.0 99.3 89.2 89.4 89.4 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.7 88.7 84.2 87.1 85.7 89.2 99.2 87.1 9 D05-65768(1-5) County Line Pork

10 0.8 0.5 0.5 10.7 0.5 17.3 4.8 0.7 0.7 90.0 99.0 89.2 90.2 99.0 99.3 99.5 93.4 88.2 86.1 94.5 87.2 86.1 89.2 90.2 88.9 89.2 89.6 89.6 89.4 95.0 99.3 99.3 99.7 89.6 89.7 89.7 90.2 91.9 91.9 90.5 91.5 91.9 91.9 96.2 89.4 85.2 87.2 85.9 89.6 99.5 87.2 10 D05-56088(16-20) County Line Pork

11 11.1 10.7 10.7 1.7 10.3 16.4 14.3 10.5 10.5 10.1 89.6 98.3 99.8 89.6 90.0 89.6 85.2 97.8 89.7 86.6 96.2 89.7 99.0 87.7 87.4 99.0 99.3 99.3 99.2 86.9 89.2 90.0 89.7 87.1 87.4 87.2 87.6 88.9 88.9 87.9 88.6 88.9 88.9 87.2 87.4 87.7 87.7 86.2 98.5 89.6 87.7 11 D04-14781(1-5) Black Jack Pork

12 1.2 0.8 0.8 10.7 1.2 16.4 5.6 1.3 1.0 1.0 10.5 89.1 89.7 99.3 98.8 98.8 93.2 88.1 85.7 93.9 87.1 85.7 89.1 89.9 88.9 89.1 89.4 89.4 89.2 94.4 99.0 99.3 99.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.5 89.4 85.2 87.1 85.7 89.4 99.2 87.1 12 D04-21622 Future Pork

13 11.4 11.1 11.0 2.0 10.6 16.4 14.8 10.9 10.9 10.9 1.7 10.9 98.5 89.1 89.6 89.7 85.4 97.3 88.9 86.4 95.4 88.9 98.7 87.2 87.4 98.7 99.0 99.0 98.8 86.9 88.7 89.6 89.2 87.1 87.2 87.2 87.1 88.7 88.7 87.4 88.4 88.7 88.7 87.2 87.1 87.4 86.4 84.9 98.2 89.1 86.4 13 D04-17554(1-2) K&K BlackJack Pork

14 10.9 10.5 10.5 1.5 10.1 16.6 14.1 10.3 10.3 9.9 0.2 10.3 1.5 89.7 90.2 89.7 85.4 98.0 89.6 86.7 96.4 89.6 99.2 87.9 87.6 99.2 99.5 99.5 99.3 87.1 89.4 90.2 89.9 87.4 87.6 87.6 87.7 89.1 89.1 88.1 88.7 89.1 89.1 87.4 87.6 87.6 87.6 86.1 98.7 89.7 87.6 14 D04-16905(1-3) Walbexer Black Jack

15 1.2 0.8 0.8 10.7 1.2 16.8 5.9 1.3 1.0 1.0 10.5 0.7 10.9 10.3 98.8 98.8 92.7 88.1 85.6 93.9 87.1 85.6 89.1 89.4 88.4 89.1 89.4 89.4 89.2 94.4 99.0 99.0 99.3 89.6 89.7 89.7 89.4 91.5 91.5 89.7 91.2 91.5 91.5 95.5 89.1 85.2 86.9 85.6 89.4 99.2 86.9 15 D04-16408-1 Illini Swine

16 1.2 0.8 0.8 10.4 0.5 17.0 5.6 0.7 0.8 0.7 10.3 1.2 10.6 10.1 1.2 98.8 93.4 88.6 86.1 94.7 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.2 99.3 99.0 99.3 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.4 89.6 85.6 87.1 85.7 89.9 99.2 87.1 16 D04-33869 County Line Pork

17 1.0 0.7 0.7 10.5 1.0 16.6 5.4 1.2 0.8 0.5 10.3 1.2 10.7 10.1 1.2 1.2 93.2 88.2 86.7 94.0 87.2 86.7 89.7 90.2 89.2 89.7 90.0 90.0 89.9 94.5 99.2 99.2 99.5 89.9 90.0 90.0 90.2 91.9 91.9 90.5 91.5 91.9 91.9 95.7 89.4 85.4 87.1 85.7 90.0 99.3 87.1 17 D05-8868(4-6) County Line

18 6.9 6.5 6.3 15.2 6.3 17.4 2.2 6.5 6.7 6.5 15.0 6.9 15.0 14.8 7.2 6.5 6.7 84.2 82.1 96.7 82.8 82.1 85.1 86.7 86.2 84.7 85.2 85.2 85.1 97.2 93.2 93.0 93.4 86.4 86.6 86.6 86.6 87.9 87.9 86.9 87.7 87.9 87.9 96.5 86.2 81.8 84.2 82.8 85.2 93.4 84.2 18 D05-46346(7-9) S&S Farms

19 11.0 10.6 10.6 1.0 10.2 14.8 14.5 10.4 10.4 10.4 0.8 10.4 1.4 0.7 10.4 10.2 10.4 14.7 88.9 85.4 95.4 88.9 98.0 86.6 87.2 98.0 98.3 98.3 98.2 85.9 88.1 88.6 88.2 86.6 86.7 86.7 86.4 88.4 88.4 86.7 88.1 88.4 88.4 86.2 86.9 87.4 87.1 85.6 98.0 88.1 87.1 19 D03-18981(1,2,4,5) Black Jack Pork

20 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 83.3 88.7 100.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 20 D03-18980(5,8) Black Jack Pork

21 5.4 5.0 4.8 13.9 4.8 17.1 1.9 5.0 5.2 5.0 13.7 5.7 13.9 13.5 5.7 5.0 5.6 3.2 13.5 17.4 84.1 83.3 86.2 87.7 86.9 85.9 86.4 86.4 86.2 99.3 94.7 94.2 94.5 87.4 87.6 87.6 87.6 88.9 88.9 87.9 88.7 88.9 88.9 98.5 87.6 82.9 84.6 83.1 86.4 94.5 84.6 21 D03-19304(20-23) S&S Farms

22 9.9 9.6 9.5 1.6 9.1 14.8 13.7 9.4 9.4 9.4 0.7 9.4 1.4 0.5 9.4 9.1 9.4 13.9 0.7 9.0 12.6 88.7 96.0 85.7 86.6 95.9 96.4 96.4 96.2 84.4 86.7 87.6 87.2 85.6 85.7 85.7 85.6 87.6 87.6 85.9 87.6 87.6 87.6 84.7 86.2 85.4 85.1 83.3 95.4 87.1 85.1 22 D03-16034(1-7-9) Black Jack Pork

23 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 0.0 17.4 9.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 23 D03-16035(5-8) Black Jack Pork

24 11.5 11.1 11.1 1.3 10.7 15.5 15.0 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.7 10.7 15.2 0.7 11.6 13.9 0.9 11.6 87.7 87.7 99.3 99.7 99.7 99.5 86.7 88.7 89.6 89.2 87.6 87.7 87.7 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.7 87.4 85.9 98.8 89.1 87.4 24 D03-14810-23 Black Jack Pork

25 10.9 10.5 10.5 12.8 10.1 17.7 13.2 10.3 10.5 9.9 12.6 10.3 13.4 12.4 10.7 10.1 10.1 14.0 12.5 14.6 12.9 11.5 14.6 12.8 95.7 87.6 87.9 87.9 87.7 87.9 89.9 89.9 89.9 95.5 95.7 95.7 99.3 97.8 97.8 99.5 97.7 97.8 97.8 88.2 96.0 87.2 85.4 84.1 87.9 89.7 85.4 25 D03-13137(11-15) Illini Farm 1904

26 11.3 10.9 10.9 11.7 10.5 16.5 14.0 10.7 10.7 10.7 11.9 10.7 12.3 11.7 11.1 10.5 10.5 14.2 11.2 14.0 13.3 10.0 14.0 11.7 3.6 87.6 88.1 88.1 87.9 87.1 88.9 88.9 88.9 94.2 94.4 94.4 95.7 96.7 96.7 95.9 96.8 96.7 96.7 87.6 94.5 86.2 84.7 83.1 88.1 88.7 84.7 26 D03-10907-3 LincolnLand Farms

27 11.4 11.1 11.0 1.3 10.6 16.4 15.2 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.6 10.7 15.4 0.7 11.5 14.1 0.9 11.5 0.7 13.0 11.9 99.7 99.7 99.5 86.4 88.7 89.6 89.2 87.4 87.2 87.4 87.4 89.1 89.1 87.7 88.7 89.1 89.1 86.7 87.4 87.9 86.9 85.7 98.8 89.1 86.9 27 D03-10033 Black Jack Pork

28 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 100.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 28 D03-10529(1-4) Black Jack Pork

29 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 0.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 29 D03-10935(1-4) Black Jack Pork

30 11.3 10.9 10.9 1.2 10.5 16.2 15.0 10.7 10.7 10.7 0.8 10.7 1.2 0.7 10.7 10.5 10.5 15.2 0.5 10.9 13.9 0.7 10.9 0.5 12.8 11.7 0.5 0.2 0.2 86.7 88.9 89.7 89.4 87.9 88.1 88.1 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.9 87.1 85.6 99.0 89.2 87.1 30 D03-10530-1 Black Jack Pork

31 4.8 4.5 4.3 13.5 4.3 17.4 1.3 4.5 4.7 4.5 13.3 5.2 13.5 13.1 5.2 4.5 5.0 2.7 13.1 16.9 0.7 12.2 16.9 13.5 12.8 13.1 13.7 13.3 13.3 13.5 95.2 94.7 95.0 87.6 87.7 87.7 87.7 89.1 89.1 88.1 88.9 89.1 89.1 99.0 87.7 83.4 85.1 83.6 86.9 95.0 85.1 31 D03-6293-4 S&S Farms (102850)

32 0.8 0.5 0.5 11.1 0.8 16.8 5.2 1.0 0.7 0.7 10.9 1.0 11.3 10.7 1.0 0.7 0.8 6.5 10.6 13.5 5.0 9.8 13.5 11.3 10.3 10.7 11.3 10.9 10.9 11.1 4.5 99.3 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.6 85.2 87.2 85.9 89.1 99.5 87.2 32 D02-48860(4-8) Crescent Pork

33 0.8 0.5 0.5 10.3 0.8 16.4 5.6 1.0 0.7 0.7 10.1 0.7 10.5 9.9 1.0 1.0 0.8 6.9 10.0 13.9 5.4 9.0 13.9 10.5 10.3 10.7 10.5 10.1 10.1 10.3 4.8 0.7 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.9 89.4 84.7 87.2 85.9 89.9 99.5 87.2 33 D02-45742-1 Black Jack Pork

34 0.5 0.2 0.2 10.7 0.5 16.8 5.2 0.7 0.3 0.3 10.5 0.7 10.9 10.3 0.7 0.7 0.5 6.5 10.4 13.5 5.0 9.4 13.5 10.9 10.3 10.7 10.9 10.5 10.5 10.7 4.5 0.3 0.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.4 85.1 87.2 85.9 89.6 99.8 87.2 34 D02-45742-2 Black Jack Pork

35 10.9 10.5 10.5 12.7 10.5 17.7 13.8 10.8 10.6 10.7 13.0 10.3 13.4 12.8 10.7 10.5 10.5 14.5 12.3 13.6 13.2 11.7 13.6 12.8 4.5 4.8 13.0 12.5 12.5 12.3 13.0 10.3 10.3 10.3 99.5 99.7 95.5 96.8 96.8 95.7 96.7 96.8 96.8 87.9 94.5 86.2 84.4 82.9 87.7 89.7 84.4 35 D04-49972-1 Illini Swine Inc

36 10.9 10.5 10.5 12.3 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.4 12.3 13.5 13.1 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 12.9 10.3 10.3 10.3 0.3 99.7 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.9 83.3 87.9 89.9 84.9 36 D04-49972-2 Illini Swine Inc

37 10.9 10.5 10.5 12.7 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.5 12.3 13.5 13.2 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 13.0 10.3 10.3 10.3 0.2 0.3 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.6 82.9 87.9 89.9 84.6 37 D04-49972-3 Illini Swine Inc

38 10.9 10.5 10.5 12.9 10.1 17.9 13.2 10.4 10.6 9.9 12.8 10.3 13.6 12.5 10.7 10.1 10.1 14.3 12.7 14.8 13.0 11.6 14.8 13.0 0.7 3.6 13.2 12.8 12.8 13.0 12.8 10.3 10.3 10.3 4.5 4.5 4.5 97.8 97.8 99.5 97.7 97.8 97.8 88.1 95.2 86.9 85.2 84.1 87.7 89.7 85.2 38 D03-6295-3 Illini-North

39 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 100.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 39 D03-5293(2-4) I llini Swine-Hich Tec

40 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 40 D03-5293(5-7) I llini Swine-High Tec

41 10.3 10.0 9.9 12.3 9.5 17.5 12.6 9.8 10.0 9.4 12.2 9.8 13.0 11.9 10.2 9.5 9.6 13.6 12.1 14.4 12.4 11.0 14.4 12.4 0.3 3.2 12.5 12.2 12.2 12.4 12.2 9.8 9.8 9.8 4.1 4.1 4.1 0.3 1.9 1.9 97.8 98.0 98.0 88.4 95.7 87.4 85.6 84.2 88.1 90.0 85.6 41 D03-5296(3-4) I llini Swine-North

42 9.3 9.0 8.9 11.3 8.6 16.6 12.8 8.8 9.0 8.8 11.5 8.8 11.9 11.3 9.2 8.6 9.0 13.4 11.1 13.3 12.1 9.8 13.3 11.3 2.4 2.5 11.5 11.1 11.1 11.3 12.0 8.8 8.8 8.8 3.1 3.1 3.1 2.4 0.2 0.2 2.0 99.8 99.8 89.6 96.0 87.7 85.9 84.4 89.1 91.4 85.9 42 D02-61015-3 Illini Farms South

43 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 43 D02-61016-1 Illini Farms South

44 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 0.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 44 D02-48857(5-8) I llini South

45 4.1 3.8 3.6 13.5 3.6 16.9 2.2 3.8 4.0 3.8 13.3 4.5 13.5 13.1 4.5 3.8 4.3 3.4 13.0 16.9 1.5 12.2 16.9 13.5 12.5 12.7 13.7 13.3 13.3 13.5 1.0 3.8 4.1 3.8 12.8 12.7 12.8 12.6 11.1 11.1 12.0 11.3 11.1 11.1 87.9 83.6 85.6 84.1 87.2 96.2 85.6 45 D02-48858(7-9) S&S Farms

46 10.9 10.9 10.9 12.2 10.5 18.0 13.4 10.8 11.0 10.7 12.8 10.7 13.4 12.6 11.1 10.5 10.9 14.3 12.1 15.3 13.0 10.9 15.3 12.6 3.8 4.5 12.8 12.4 12.4 12.6 12.8 10.7 10.7 10.7 5.2 5.2 5.2 4.5 3.6 3.6 4.0 3.8 3.6 3.6 12.8 87.9 85.6 83.9 87.9 89.2 85.6 46 D02-47395(1-2) Nipco Farms

47 14.5 14.5 14.5 12.3 14.1 18.5 17.5 13.7 14.6 14.3 13.2 14.3 13.6 13.4 14.3 14.1 14.3 18.0 12.1 13.2 16.9 12.5 13.2 13.2 13.5 14.1 12.9 12.8 12.8 13.0 16.5 14.3 14.7 14.3 14.4 14.4 14.4 13.7 12.7 12.7 13.1 12.9 12.7 12.7 16.9 12.3 84.2 83.1 88.1 84.9 84.2 47 D02-47394(5-8) Prime Pork

48 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 98.7 87.2 87.1 100.0 48 D06-28296-5 Boars

49 13.9 13.7 13.7 13.7 13.5 13.2 16.0 13.5 13.3 13.5 12.8 13.5 14.1 13.1 13.5 13.7 13.3 16.9 12.4 16.6 16.7 12.8 16.6 13.3 14.5 14.7 13.3 13.3 13.3 13.5 16.0 13.5 13.5 13.5 15.7 15.6 15.6 14.5 14.1 14.1 14.1 14.3 14.1 14.1 16.0 14.6 16.7 0.2 85.7 85.7 98.7 49 D06-26717-1 Boars

50 11.0 10.7 10.6 0.5 10.2 15.7 14.7 10.5 10.5 10.5 1.5 10.5 1.9 1.3 10.5 10.2 10.3 15.0 0.8 11.3 13.7 1.4 11.3 1.2 12.5 11.5 1.2 0.8 0.8 1.0 13.3 10.9 10.1 10.5 12.5 12.5 12.5 12.7 10.9 10.9 12.1 11.1 10.9 10.9 13.3 12.4 12.5 13.1 13.5 89.4 87.2 50 IngelvacATP

51 0.3 0.0 0.2 10.9 0.7 17.0 5.2 0.8 0.5 0.5 10.7 0.8 11.1 10.5 0.8 0.8 0.7 6.5 10.6 13.7 5.0 9.6 13.7 11.1 10.5 10.9 11.1 10.7 10.7 10.9 4.5 0.5 0.5 0.2 10.5 10.5 10.5 10.5 8.8 8.8 10.0 9.0 8.8 8.8 3.8 10.9 14.5 13.3 13.7 10.7 87.1 51 RespPRRS

52 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 0.0 0.2 13.1 13.3 52 D06-30617-1 FuturePork

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

Percent Identity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

1 99.7 99.5 88.7 99.3 82.8 94.2 98.8 99.2 99.2 89.2 98.8 88.7 89.4 98.8 98.8 99.0 92.9 87.7 85.7 94.2 86.7 85.7 88.7 89.4 88.4 88.7 89.1 89.1 88.9 94.7 99.2 99.2 99.5 89.4 89.6 89.6 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.9 89.2 84.9 86.9 85.6 89.1 99.7 86.9 1 D04-33870 Black Jack/Holtkai

2 0.3 99.8 89.1 99.3 83.3 94.5 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.4 88.1 86.1 94.5 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.0 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 84.9 87.1 85.7 89.4 100.0 87.1 2 D04-29274 Black Jack Pork

3 0.5 0.2 89.1 99.3 83.3 94.7 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.5 88.1 86.1 94.7 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.2 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.4 89.2 84.9 87.1 85.7 89.4 99.8 87.1 3 D04-49976 Weidner, Al

4 11.2 10.9 10.8 89.6 84.6 85.1 89.2 88.9 89.2 98.3 89.1 98.0 98.5 89.1 89.6 89.7 84.9 97.8 89.4 86.1 95.2 89.4 98.7 87.6 87.7 98.5 99.0 99.0 98.8 86.6 88.7 89.6 89.2 87.4 87.9 87.6 87.2 89.1 89.1 87.7 88.7 89.1 89.1 86.9 88.2 88.1 87.1 85.6 99.5 89.1 87.1 4 D06-21801(4-6) H&P

5 0.7 0.7 0.7 10.4 83.1 94.2 99.5 99.3 99.5 90.0 98.8 89.6 90.2 98.8 99.5 99.0 93.7 88.6 86.1 94.9 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.4 99.2 99.2 99.5 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.5 89.6 85.6 87.2 85.9 89.9 99.3 87.2 5 D06-16814(21-25) County Line Pork

6 17.5 17.0 17.0 15.9 17.0 81.9 82.8 82.9 82.9 84.2 83.6 84.1 84.1 83.3 83.1 83.7 82.4 84.4 83.4 82.6 82.8 83.4 85.1 83.3 83.1 84.1 84.6 84.6 84.4 82.4 83.3 83.7 83.4 82.8 83.1 82.9 83.1 83.7 83.7 83.3 83.9 83.7 83.7 83.3 82.8 82.6 87.9 86.2 84.6 83.3 87.9 6 D06-13563-22 Sand Ridge

7 5.6 5.2 5.0 15.0 5.4 17.8 93.9 93.5 94.9 85.7 94.2 85.6 85.9 93.9 94.0 94.4 97.8 84.4 82.6 98.2 82.9 82.6 85.2 87.4 86.4 84.9 85.4 85.4 85.2 98.7 94.7 94.2 94.5 86.7 86.9 86.9 87.2 88.2 88.2 87.6 88.1 88.2 88.2 97.8 87.1 82.4 84.9 83.4 85.4 94.5 84.9 7 D06-6000-1 Huftalin/Dreska

8 1.0 0.8 0.8 10.7 0.3 17.3 5.6 98.8 99.2 89.7 98.5 89.2 89.9 98.5 99.2 98.7 93.4 88.2 85.6 94.5 87.2 85.6 89.2 89.7 88.7 89.2 89.6 89.6 89.4 95.0 98.8 98.8 99.2 89.4 89.6 89.6 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 85.7 87.1 85.7 89.6 99.0 87.1 8 D06-3518(1-5) County Line Pork

9 0.5 0.5 0.5 10.7 0.3 16.8 5.6 0.7 99.0 89.4 98.7 88.9 89.6 98.7 98.8 98.8 92.7 87.9 85.9 93.9 86.9 85.9 88.9 89.4 88.6 88.9 89.2 89.2 89.1 94.4 99.0 99.0 99.3 89.2 89.4 89.4 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.7 88.7 84.2 87.1 85.7 89.2 99.2 87.1 9 D05-65768(1-5) County Line Pork

10 0.8 0.5 0.5 10.7 0.5 17.3 4.8 0.7 0.7 90.0 99.0 89.2 90.2 99.0 99.3 99.5 93.4 88.2 86.1 94.5 87.2 86.1 89.2 90.2 88.9 89.2 89.6 89.6 89.4 95.0 99.3 99.3 99.7 89.6 89.7 89.7 90.2 91.9 91.9 90.5 91.5 91.9 91.9 96.2 89.4 85.2 87.2 85.9 89.6 99.5 87.2 10 D05-56088(16-20) County Line Pork

11 11.1 10.7 10.7 1.7 10.3 16.4 14.3 10.5 10.5 10.1 89.6 98.3 99.8 89.6 90.0 89.6 85.2 97.8 89.7 86.6 96.2 89.7 99.0 87.7 87.4 99.0 99.3 99.3 99.2 86.9 89.2 90.0 89.7 87.1 87.4 87.2 87.6 88.9 88.9 87.9 88.6 88.9 88.9 87.2 87.4 87.7 87.7 86.2 98.5 89.6 87.7 11 D04-14781(1-5) Black Jack Pork

12 1.2 0.8 0.8 10.7 1.2 16.4 5.6 1.3 1.0 1.0 10.5 89.1 89.7 99.3 98.8 98.8 93.2 88.1 85.7 93.9 87.1 85.7 89.1 89.9 88.9 89.1 89.4 89.4 89.2 94.4 99.0 99.3 99.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.5 89.4 85.2 87.1 85.7 89.4 99.2 87.1 12 D04-21622 Future Pork

13 11.4 11.1 11.0 2.0 10.6 16.4 14.8 10.9 10.9 10.9 1.7 10.9 98.5 89.1 89.6 89.7 85.4 97.3 88.9 86.4 95.4 88.9 98.7 87.2 87.4 98.7 99.0 99.0 98.8 86.9 88.7 89.6 89.2 87.1 87.2 87.2 87.1 88.7 88.7 87.4 88.4 88.7 88.7 87.2 87.1 87.4 86.4 84.9 98.2 89.1 86.4 13 D04-17554(1-2) K&K BlackJack Pork

14 10.9 10.5 10.5 1.5 10.1 16.6 14.1 10.3 10.3 9.9 0.2 10.3 1.5 89.7 90.2 89.7 85.4 98.0 89.6 86.7 96.4 89.6 99.2 87.9 87.6 99.2 99.5 99.5 99.3 87.1 89.4 90.2 89.9 87.4 87.6 87.6 87.7 89.1 89.1 88.1 88.7 89.1 89.1 87.4 87.6 87.6 87.6 86.1 98.7 89.7 87.6 14 D04-16905(1-3) Walbexer Black Jack

15 1.2 0.8 0.8 10.7 1.2 16.8 5.9 1.3 1.0 1.0 10.5 0.7 10.9 10.3 98.8 98.8 92.7 88.1 85.6 93.9 87.1 85.6 89.1 89.4 88.4 89.1 89.4 89.4 89.2 94.4 99.0 99.0 99.3 89.6 89.7 89.7 89.4 91.5 91.5 89.7 91.2 91.5 91.5 95.5 89.1 85.2 86.9 85.6 89.4 99.2 86.9 15 D04-16408-1 Illini Swine

16 1.2 0.8 0.8 10.4 0.5 17.0 5.6 0.7 0.8 0.7 10.3 1.2 10.6 10.1 1.2 98.8 93.4 88.6 86.1 94.7 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.2 99.3 99.0 99.3 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.4 89.6 85.6 87.1 85.7 89.9 99.2 87.1 16 D04-33869 County Line Pork

17 1.0 0.7 0.7 10.5 1.0 16.6 5.4 1.2 0.8 0.5 10.3 1.2 10.7 10.1 1.2 1.2 93.2 88.2 86.7 94.0 87.2 86.7 89.7 90.2 89.2 89.7 90.0 90.0 89.9 94.5 99.2 99.2 99.5 89.9 90.0 90.0 90.2 91.9 91.9 90.5 91.5 91.9 91.9 95.7 89.4 85.4 87.1 85.7 90.0 99.3 87.1 17 D05-8868(4-6) County Line

18 6.9 6.5 6.3 15.2 6.3 17.4 2.2 6.5 6.7 6.5 15.0 6.9 15.0 14.8 7.2 6.5 6.7 84.2 82.1 96.7 82.8 82.1 85.1 86.7 86.2 84.7 85.2 85.2 85.1 97.2 93.2 93.0 93.4 86.4 86.6 86.6 86.6 87.9 87.9 86.9 87.7 87.9 87.9 96.5 86.2 81.8 84.2 82.8 85.2 93.4 84.2 18 D05-46346(7-9) S&S Farms

19 11.0 10.6 10.6 1.0 10.2 14.8 14.5 10.4 10.4 10.4 0.8 10.4 1.4 0.7 10.4 10.2 10.4 14.7 88.9 85.4 95.4 88.9 98.0 86.6 87.2 98.0 98.3 98.3 98.2 85.9 88.1 88.6 88.2 86.6 86.7 86.7 86.4 88.4 88.4 86.7 88.1 88.4 88.4 86.2 86.9 87.4 87.1 85.6 98.0 88.1 87.1 19 D03-18981(1,2,4,5) Black Jack Pork

20 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 83.3 88.7 100.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 20 D03-18980(5,8) Black Jack Pork

21 5.4 5.0 4.8 13.9 4.8 17.1 1.9 5.0 5.2 5.0 13.7 5.7 13.9 13.5 5.7 5.0 5.6 3.2 13.5 17.4 84.1 83.3 86.2 87.7 86.9 85.9 86.4 86.4 86.2 99.3 94.7 94.2 94.5 87.4 87.6 87.6 87.6 88.9 88.9 87.9 88.7 88.9 88.9 98.5 87.6 82.9 84.6 83.1 86.4 94.5 84.6 21 D03-19304(20-23) S&S Farms

22 9.9 9.6 9.5 1.6 9.1 14.8 13.7 9.4 9.4 9.4 0.7 9.4 1.4 0.5 9.4 9.1 9.4 13.9 0.7 9.0 12.6 88.7 96.0 85.7 86.6 95.9 96.4 96.4 96.2 84.4 86.7 87.6 87.2 85.6 85.7 85.7 85.6 87.6 87.6 85.9 87.6 87.6 87.6 84.7 86.2 85.4 85.1 83.3 95.4 87.1 85.1 22 D03-16034(1-7-9) Black Jack Pork

23 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 0.0 17.4 9.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 23 D03-16035(5-8) Black Jack Pork

24 11.5 11.1 11.1 1.3 10.7 15.5 15.0 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.7 10.7 15.2 0.7 11.6 13.9 0.9 11.6 87.7 87.7 99.3 99.7 99.7 99.5 86.7 88.7 89.6 89.2 87.6 87.7 87.7 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.7 87.4 85.9 98.8 89.1 87.4 24 D03-14810-23 Black Jack Pork

25 10.9 10.5 10.5 12.8 10.1 17.7 13.2 10.3 10.5 9.9 12.6 10.3 13.4 12.4 10.7 10.1 10.1 14.0 12.5 14.6 12.9 11.5 14.6 12.8 95.7 87.6 87.9 87.9 87.7 87.9 89.9 89.9 89.9 95.5 95.7 95.7 99.3 97.8 97.8 99.5 97.7 97.8 97.8 88.2 96.0 87.2 85.4 84.1 87.9 89.7 85.4 25 D03-13137(11-15) Illini Farm 1904

26 11.3 10.9 10.9 11.7 10.5 16.5 14.0 10.7 10.7 10.7 11.9 10.7 12.3 11.7 11.1 10.5 10.5 14.2 11.2 14.0 13.3 10.0 14.0 11.7 3.6 87.6 88.1 88.1 87.9 87.1 88.9 88.9 88.9 94.2 94.4 94.4 95.7 96.7 96.7 95.9 96.8 96.7 96.7 87.6 94.5 86.2 84.7 83.1 88.1 88.7 84.7 26 D03-10907-3 LincolnLand Farms

27 11.4 11.1 11.0 1.3 10.6 16.4 15.2 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.6 10.7 15.4 0.7 11.5 14.1 0.9 11.5 0.7 13.0 11.9 99.7 99.7 99.5 86.4 88.7 89.6 89.2 87.4 87.2 87.4 87.4 89.1 89.1 87.7 88.7 89.1 89.1 86.7 87.4 87.9 86.9 85.7 98.8 89.1 86.9 27 D03-10033 Black Jack Pork

28 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 100.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 28 D03-10529(1-4) Black Jack Pork

29 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 0.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 29 D03-10935(1-4) Black Jack Pork

30 11.3 10.9 10.9 1.2 10.5 16.2 15.0 10.7 10.7 10.7 0.8 10.7 1.2 0.7 10.7 10.5 10.5 15.2 0.5 10.9 13.9 0.7 10.9 0.5 12.8 11.7 0.5 0.2 0.2 86.7 88.9 89.7 89.4 87.9 88.1 88.1 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.9 87.1 85.6 99.0 89.2 87.1 30 D03-10530-1 Black Jack Pork

31 4.8 4.5 4.3 13.5 4.3 17.4 1.3 4.5 4.7 4.5 13.3 5.2 13.5 13.1 5.2 4.5 5.0 2.7 13.1 16.9 0.7 12.2 16.9 13.5 12.8 13.1 13.7 13.3 13.3 13.5 95.2 94.7 95.0 87.6 87.7 87.7 87.7 89.1 89.1 88.1 88.9 89.1 89.1 99.0 87.7 83.4 85.1 83.6 86.9 95.0 85.1 31 D03-6293-4 S&S Farms (102850)

32 0.8 0.5 0.5 11.1 0.8 16.8 5.2 1.0 0.7 0.7 10.9 1.0 11.3 10.7 1.0 0.7 0.8 6.5 10.6 13.5 5.0 9.8 13.5 11.3 10.3 10.7 11.3 10.9 10.9 11.1 4.5 99.3 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.6 85.2 87.2 85.9 89.1 99.5 87.2 32 D02-48860(4-8) Crescent Pork

33 0.8 0.5 0.5 10.3 0.8 16.4 5.6 1.0 0.7 0.7 10.1 0.7 10.5 9.9 1.0 1.0 0.8 6.9 10.0 13.9 5.4 9.0 13.9 10.5 10.3 10.7 10.5 10.1 10.1 10.3 4.8 0.7 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.9 89.4 84.7 87.2 85.9 89.9 99.5 87.2 33 D02-45742-1 Black Jack Pork

34 0.5 0.2 0.2 10.7 0.5 16.8 5.2 0.7 0.3 0.3 10.5 0.7 10.9 10.3 0.7 0.7 0.5 6.5 10.4 13.5 5.0 9.4 13.5 10.9 10.3 10.7 10.9 10.5 10.5 10.7 4.5 0.3 0.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.4 85.1 87.2 85.9 89.6 99.8 87.2 34 D02-45742-2 Black Jack Pork

35 10.9 10.5 10.5 12.7 10.5 17.7 13.8 10.8 10.6 10.7 13.0 10.3 13.4 12.8 10.7 10.5 10.5 14.5 12.3 13.6 13.2 11.7 13.6 12.8 4.5 4.8 13.0 12.5 12.5 12.3 13.0 10.3 10.3 10.3 99.5 99.7 95.5 96.8 96.8 95.7 96.7 96.8 96.8 87.9 94.5 86.2 84.4 82.9 87.7 89.7 84.4 35 D04-49972-1 Illini Swine Inc

36 10.9 10.5 10.5 12.3 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.4 12.3 13.5 13.1 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 12.9 10.3 10.3 10.3 0.3 99.7 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.9 83.3 87.9 89.9 84.9 36 D04-49972-2 Illini Swine Inc

37 10.9 10.5 10.5 12.7 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.5 12.3 13.5 13.2 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 13.0 10.3 10.3 10.3 0.2 0.3 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.6 82.9 87.9 89.9 84.6 37 D04-49972-3 Illini Swine Inc

38 10.9 10.5 10.5 12.9 10.1 17.9 13.2 10.4 10.6 9.9 12.8 10.3 13.6 12.5 10.7 10.1 10.1 14.3 12.7 14.8 13.0 11.6 14.8 13.0 0.7 3.6 13.2 12.8 12.8 13.0 12.8 10.3 10.3 10.3 4.5 4.5 4.5 97.8 97.8 99.5 97.7 97.8 97.8 88.1 95.2 86.9 85.2 84.1 87.7 89.7 85.2 38 D03-6295-3 Illini-North

39 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 100.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 39 D03-5293(2-4) I llini Swine-Hich Tec

40 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 40 D03-5293(5-7) I llini Swine-High Tec

41 10.3 10.0 9.9 12.3 9.5 17.5 12.6 9.8 10.0 9.4 12.2 9.8 13.0 11.9 10.2 9.5 9.6 13.6 12.1 14.4 12.4 11.0 14.4 12.4 0.3 3.2 12.5 12.2 12.2 12.4 12.2 9.8 9.8 9.8 4.1 4.1 4.1 0.3 1.9 1.9 97.8 98.0 98.0 88.4 95.7 87.4 85.6 84.2 88.1 90.0 85.6 41 D03-5296(3-4) I llini Swine-North

42 9.3 9.0 8.9 11.3 8.6 16.6 12.8 8.8 9.0 8.8 11.5 8.8 11.9 11.3 9.2 8.6 9.0 13.4 11.1 13.3 12.1 9.8 13.3 11.3 2.4 2.5 11.5 11.1 11.1 11.3 12.0 8.8 8.8 8.8 3.1 3.1 3.1 2.4 0.2 0.2 2.0 99.8 99.8 89.6 96.0 87.7 85.9 84.4 89.1 91.4 85.9 42 D02-61015-3 Illini Farms South

43 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 43 D02-61016-1 Illini Farms South

44 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 0.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 44 D02-48857(5-8) I llini South

45 4.1 3.8 3.6 13.5 3.6 16.9 2.2 3.8 4.0 3.8 13.3 4.5 13.5 13.1 4.5 3.8 4.3 3.4 13.0 16.9 1.5 12.2 16.9 13.5 12.5 12.7 13.7 13.3 13.3 13.5 1.0 3.8 4.1 3.8 12.8 12.7 12.8 12.6 11.1 11.1 12.0 11.3 11.1 11.1 87.9 83.6 85.6 84.1 87.2 96.2 85.6 45 D02-48858(7-9) S&S Farms

46 10.9 10.9 10.9 12.2 10.5 18.0 13.4 10.8 11.0 10.7 12.8 10.7 13.4 12.6 11.1 10.5 10.9 14.3 12.1 15.3 13.0 10.9 15.3 12.6 3.8 4.5 12.8 12.4 12.4 12.6 12.8 10.7 10.7 10.7 5.2 5.2 5.2 4.5 3.6 3.6 4.0 3.8 3.6 3.6 12.8 87.9 85.6 83.9 87.9 89.2 85.6 46 D02-47395(1-2) Nipco Farms

47 14.5 14.5 14.5 12.3 14.1 18.5 17.5 13.7 14.6 14.3 13.2 14.3 13.6 13.4 14.3 14.1 14.3 18.0 12.1 13.2 16.9 12.5 13.2 13.2 13.5 14.1 12.9 12.8 12.8 13.0 16.5 14.3 14.7 14.3 14.4 14.4 14.4 13.7 12.7 12.7 13.1 12.9 12.7 12.7 16.9 12.3 84.2 83.1 88.1 84.9 84.2 47 D02-47394(5-8) Prime Pork

48 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 98.7 87.2 87.1 100.0 48 D06-28296-5 Boars

49 13.9 13.7 13.7 13.7 13.5 13.2 16.0 13.5 13.3 13.5 12.8 13.5 14.1 13.1 13.5 13.7 13.3 16.9 12.4 16.6 16.7 12.8 16.6 13.3 14.5 14.7 13.3 13.3 13.3 13.5 16.0 13.5 13.5 13.5 15.7 15.6 15.6 14.5 14.1 14.1 14.1 14.3 14.1 14.1 16.0 14.6 16.7 0.2 85.7 85.7 98.7 49 D06-26717-1 Boars

50 11.0 10.7 10.6 0.5 10.2 15.7 14.7 10.5 10.5 10.5 1.5 10.5 1.9 1.3 10.5 10.2 10.3 15.0 0.8 11.3 13.7 1.4 11.3 1.2 12.5 11.5 1.2 0.8 0.8 1.0 13.3 10.9 10.1 10.5 12.5 12.5 12.5 12.7 10.9 10.9 12.1 11.1 10.9 10.9 13.3 12.4 12.5 13.1 13.5 89.4 87.2 50 IngelvacATP

51 0.3 0.0 0.2 10.9 0.7 17.0 5.2 0.8 0.5 0.5 10.7 0.8 11.1 10.5 0.8 0.8 0.7 6.5 10.6 13.7 5.0 9.6 13.7 11.1 10.5 10.9 11.1 10.7 10.7 10.9 4.5 0.5 0.5 0.2 10.5 10.5 10.5 10.5 8.8 8.8 10.0 9.0 8.8 8.8 3.8 10.9 14.5 13.3 13.7 10.7 87.1 51 RespPRRS

52 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 0.0 0.2 13.1 13.3 52 D06-30617-1 FuturePork

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

5.14.06

6.2.06

Page 29: Respiratory Diagnostics

Sequencing and Dendograms

• = Phylogenetic analysis

• Nucleotide sequencing

Page 30: Respiratory Diagnostics
Page 31: Respiratory Diagnostics
Page 32: Respiratory Diagnostics

Genetic Sequencing

• Homologies do not indicate cross-protection

• Homologies do not predict pathogenicity

• Homologies only indicate relatedness

Page 33: Respiratory Diagnostics

PRRS…SVN (SN)

• Serum Virus Neutralization

• PRRS SVN not used widely

• Possible direct correlation with protective antibodies in vivo

• Alpha and beta procedures

• Beta utilized for PRRS

Page 34: Respiratory Diagnostics

SVN…Procedure

• Beta Procedure– Known levels of standard virus incubated with

serial dilutions of test serum– Serum is then added to sensitive cell lines– Titer of serum = Highest dilution of serum that

neutralizes known dose of virus– End points are shown by cytopathology

Page 35: Respiratory Diagnostics

SVN Results

• Less sensitive than IFA or ELISA– Neutralizing Ab produced slow PI ( >21 days)– Levels of nAb are pig-dependent

• Detectable 9-28 days PI

• Max titers at 2-3 months PI

• Persistent titers > 1 year PI

Page 36: Respiratory Diagnostics

SVN…Interpretation

• Assumed that shedding of virus is nill if nAb is present

• However, PRRS produces carrier-state animals– REMEMBER:

•ARTERIVIRUS

Page 37: Respiratory Diagnostics

PRRSv Detection in Tissues

• Histopathology

• PCR

• VI

• IHC

• DFA

Page 38: Respiratory Diagnostics

PRRS…Histopathology

• Interstitial pneumonia– Thickened alveolar walls– Pneumocyte hypertrophy/hyperplasia– Alveolar spaces filled with necrotic debris and

WBC’s

Page 39: Respiratory Diagnostics

PRRS…Histopathology

Normal Interstitial pneumonia

T. Opriessnig, 2004

Page 40: Respiratory Diagnostics

PCR…Process

RNA

Reverse Transcriptase

DNA

Heat Denaturing

Primersand

Cooling

Annealing

Taq +Nucleotides

CT G

A

Complementary Strands

30 Cycles

Page 41: Respiratory Diagnostics

PRRS…VI

• Virus Isolation

• Lung, Tonsil, Lymph nodes

• Autolysis greatly affects sensitivity

• Much easier to find in serum

Page 42: Respiratory Diagnostics

PRRS…IHC

• Immunohistochemistry

• Antibody coupled to horseradish peroxidase

• H2O2/Benzidine derivative added

• Colored insoluble precipitate formed

Halbur, AASV

Page 43: Respiratory Diagnostics

PRRS…DFA

• Direct Fluorescent Antibody

• PRRSv infected tissue

• Fluorescein conjugated to antiviral antibody

Page 44: Respiratory Diagnostics

DFA…Results

• Quick, Cheap

• Specific

• Less sensitive…autolysis

Page 45: Respiratory Diagnostics

Semen PRRSv PCR

Page 46: Respiratory Diagnostics

• Specific

• Less Sensitive – Intermittent Shedding– Detectable Levels > Infectious Levels

Semen PRRSv PCR

Page 47: Respiratory Diagnostics

Other Respiratory Diagnostics

• I request many of the same diagnostic tests for different respiratory diseases.

• If you feel like you are lost when you are out in practice, call the lab you are working with and the diagnosticians are more than happy to help you out and explain more about what they do.