Download - Respiratory Diagnostics
![Page 1: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/1.jpg)
Respiratory Diagnostics
Brian J. Payne, DVM
Carthage Veterinary Service, Ltd.
![Page 2: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/2.jpg)
The Presentation
• The actual presentation given at AASV is based on actual case studies.
• This PowerPoint presentation (based on PRRS diagnostics specifically) describes many of the laboratory tests that were utilized for these actual cases.
![Page 3: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/3.jpg)
One more thing…
It has been an enormous benefit for me in a clinical setting to
understand each diagnostic test that I request so that I can better
interpret the results.
I hope this helps!
![Page 4: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/4.jpg)
PRRS…Diagnostics
• Serology– PRRSv– PRRS Viral Antigens– PRRS Antibodies
• Tissue– PRRSv
• Other– Semen PRRSv
![Page 5: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/5.jpg)
PRRS…Serology
• ELISA
• IFA
• PCR
• RFLP
• Genetic Sequencing
• SVN
![Page 6: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/6.jpg)
PRRS…Indirect ELISA
• Enzyme-linked immunosorbent assay
• Extremely high sensitivity ~100%
• 99.5% specificity
• Quick to run
• Indirect method to determine antigen-specific PRRSv antibodies
![Page 7: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/7.jpg)
Indirect ELISA…Process
• Polymer substrate
• Enzyme-labeled anti-porcine conjugate
•Serum sample with PRRSv/Viral antibodies
• Antigen
![Page 8: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/8.jpg)
Indirect ELISA…Results
• Bound enzyme allows visual detection
• In-house tests usually (+) or (-)
• In-lab tests utilize optical densities to give continuous range of numbers University of AZ, 1993
![Page 9: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/9.jpg)
S/P Ratio Pos/Neg Results010.8938 POSITIVE 1-0.002 Neg 02.0789 POSITIVE 12.815 POSITIVE 13.456 POSITIVE 10.089 Neg 0
0.5541 POSITIVE 11.272 POSITIVE 1
0.5865 POSITIVE 10.3701 Suspect 00.4712 POSITIVE 11.3387 POSITIVE 1
ResultsPRRS ELISA
Indirect ELISA...Results
• IDEXX HerdChek• Based on S/P ratio
– sample/positive
• Optical densities (continual range)
• < 0.3 = Negative• 0.3-0.4 = Suspect• > 0.3999 = Positive
![Page 10: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/10.jpg)
Indirect ELISA…Antibody Detection
• PRRSv Ab detectable 9-13 days PI
• Peak at 30-50 days
• Rapid decline but still may be detectable in > 10 months (personal experience is > 2 years)
![Page 11: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/11.jpg)
Indirect ELISA…Limitations
• Allows evidence of exposure to PRRSv
• However, no information on:– Length of exposure– Severity of infection– Which strain is present– Differentiation of vaccine and wild-type virus
• Variability of immune responses within a given population
![Page 12: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/12.jpg)
PRRS…IFA• Indirect fluorescent antibody
• Specificity 99.5%
• Sensitivity (based on laboratory variation)– Culture media– Protocols– Incubation time– Cell types– Technician skill and subjectivity of results– Lab PRRSv genetic sim. to wild-type PRRSv
![Page 13: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/13.jpg)
IFA…The Process
• Polymer substrate• PRRSv (lab) infected cells
• Serum with PRRSv Antibodies (IgG)
• Fluorescein-labeled anti-porcine antibody
![Page 14: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/14.jpg)
IFA…The Results
• Magnitude of Ab titer can be determined unlike ELISA
Magar, R., 1993
![Page 15: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/15.jpg)
IFA…The Results
• < 1:20 or 16 = negative• 1:20 or 16 or greater =
positive• Titer endpoints are
subjectively determined, therefore variation
Titer Pos/Neg Results011:80 Pos 0
<1:20 Neg 0null Neg 01:20 POSITIVE 11:40 POSITIVE 11:20 POSITIVE 11:20 POSITIVE 1
ResultsPRRS IFA
![Page 16: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/16.jpg)
IFA…Antibody Detection
• IgG against PRRSv detectable 7-11 days PI
• Peak at 30-50 days
• Rapid decline but still may be detectable in 4-6 months
![Page 17: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/17.jpg)
PRRS…PCR
• Polymerase Chain Reaction
• In vitro amplification of DNA– RNA of virus extracted from sample– Reverse transcriptase (RNA to DNA)– PCR amplifies DNA
• Target most conserved genes– ORF 6 and ORF 7
![Page 18: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/18.jpg)
PCR…Process
RNA
Reverse Transcriptase
DNA
Heat Denaturing
Primersand
Cooling
Annealing
Taq +Nucleotides
CT G
A
Complementary Strands
30 Cycles
![Page 19: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/19.jpg)
PCR…The ProcessAfter 30 cycles, 1000’s of replicates
Gel Electrophoresis(Colorimetric, Radioactive, Fluorometric)(-) (+)
![Page 20: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/20.jpg)
PCR…Adv / DisAdv
• Rapid turnaround (RT-PCR) - 1-3 days
• High sensitivity and specificity
• Detects Ag…no need to wait for immune system response
• Detection determined by correlation b/w primers and PRRSv
• Not indicative of replicating virus
![Page 21: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/21.jpg)
PRRS…RFLP
• Restriction Fragment Length Polymorphism
• Utilizes RT-PCR of ORF 5 gene– Envelop proteins– Prone to mutation
• 3 Restriction Enzymes Used– Their cutting patterns are assigned numbers– I.e. 1-4-2, 2-1-2, 2-6-2, 1-5-2
![Page 22: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/22.jpg)
RFLP…Interpretation
• May differentiate between vaccine virus (2-5-2) and wild-type virus
• No indication of virulence
• No indication on cross-protection
• Change in RFLP can be from 1 base pair substitution…careful interpretation
• Little indication of homology (4%)
![Page 23: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/23.jpg)
RFLP…Example
“Open reading frame 5 of PRRSV was sequenced.
This PRRSV has a predicted RFLP cut pattern of
2-5-2 and differs from each of the 3 modified-live
PRRS vaccine viruses (Ingelvac/RespPRRS,
Ingelvac ATP, PrimePac) by more than .5%.”
University of MN
![Page 24: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/24.jpg)
RFLP…Example
“RFLP cut patterns are usually an inaccurate
measure of PRRSV relatedness.”
University of MN
![Page 25: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/25.jpg)
PRRS Genetic Sequencing
• Provides exact nucleotide sequence of ORF
• Utilize ORF 5 b/c most variable
• Therefore, more informative than RFLP
• Dendograms (phylogenetic tree) can be made and homologies can be seen
![Page 26: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/26.jpg)
ORF 5 Genetic SequencingATGTTGGAGAAATGCTTGACCGCGGGCTGTTGCTCGCGATTGCTTTCTTTGTGG
TGTATCGTGCCGTTCTGTTTTGCTGTGCTCGCCAACGCCAGCAACAACAGCAGC
TCCCATCTACAGCTGATTTACAACTTGACGCTATGTGAGCTGAATGGCACAGATT
GGCTAGCTAACAAATTTGATTGGGCAGTGGAGAGTTTTGTCATCTTTCCCGTTTT
GACTCACATTGTCTCCTATGGTGCCCTCACTACCAGCCATTTCCTTGACACAGTC
GCTTTAGTCACTGTGTCTACCGCCGGGTTTGTTCACGGGCGGTATGTCCTAAGT
AGCATCTACGCGGTCTGTGCCCTGGCTGCGTTGACTTGCTTCGTCATTAGGTTT
GCAAAGAATTGCATGTCCTGGCGCTACGCGTGTACCAGATATACCAACTTTCTT
CTGGACACTAAGGGCATACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAA
AAGGGGCAAAGTTGAGGTCGAAGGTCATCTGATCGACCTCAAAAGAGTTGTGC
TTGATGGTTCCGTGGCAACCCCTATAACCAGAGTTTCAGCGGAACAATGGGGTC
GTCCTTAG >550 Nucleotides
![Page 27: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/27.jpg)
Percent Identity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
1 99.7 99.5 88.7 99.3 82.8 94.2 98.8 99.2 99.2 89.2 98.8 88.7 89.4 98.8 98.8 99.0 92.9 87.7 85.7 94.2 86.7 85.7 88.7 89.4 88.4 88.7 89.1 89.1 88.9 94.7 99.2 99.2 99.5 89.4 89.6 89.6 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.9 89.2 84.9 86.9 85.6 89.1 99.7 86.9 1 D04-33870 Black Jack/Holtkai
2 0.3 99.8 89.1 99.3 83.3 94.5 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.4 88.1 86.1 94.5 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.0 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 84.9 87.1 85.7 89.4 100.0 87.1 2 D04-29274 Black Jack Pork
3 0.5 0.2 89.1 99.3 83.3 94.7 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.5 88.1 86.1 94.7 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.2 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.4 89.2 84.9 87.1 85.7 89.4 99.8 87.1 3 D04-49976 W eidner, Al
4 11.2 10.9 10.8 89.6 84.6 85.1 89.2 88.9 89.2 98.3 89.1 98.0 98.5 89.1 89.6 89.7 84.9 97.8 89.4 86.1 95.2 89.4 98.7 87.6 87.7 98.5 99.0 99.0 98.8 86.6 88.7 89.6 89.2 87.4 87.9 87.6 87.2 89.1 89.1 87.7 88.7 89.1 89.1 86.9 88.2 88.1 87.1 85.6 99.5 89.1 87.1 4 D06-21801(4-6) H&P
5 0.7 0.7 0.7 10.4 83.1 94.2 99.5 99.3 99.5 90.0 98.8 89.6 90.2 98.8 99.5 99.0 93.7 88.6 86.1 94.9 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.4 99.2 99.2 99.5 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.5 89.6 85.6 87.2 85.9 89.9 99.3 87.2 5 D06-16814(21-25) County Line Pork
6 17.5 17.0 17.0 15.9 17.0 81.9 82.8 82.9 82.9 84.2 83.6 84.1 84.1 83.3 83.1 83.7 82.4 84.4 83.4 82.6 82.8 83.4 85.1 83.3 83.1 84.1 84.6 84.6 84.4 82.4 83.3 83.7 83.4 82.8 83.1 82.9 83.1 83.7 83.7 83.3 83.9 83.7 83.7 83.3 82.8 82.6 87.9 86.2 84.6 83.3 87.9 6 D06-13563-22 Sand Ridge
7 5.6 5.2 5.0 15.0 5.4 17.8 93.9 93.5 94.9 85.7 94.2 85.6 85.9 93.9 94.0 94.4 97.8 84.4 82.6 98.2 82.9 82.6 85.2 87.4 86.4 84.9 85.4 85.4 85.2 98.7 94.7 94.2 94.5 86.7 86.9 86.9 87.2 88.2 88.2 87.6 88.1 88.2 88.2 97.8 87.1 82.4 84.9 83.4 85.4 94.5 84.9 7 D06-6000-1 Huftalin/Dreska
8 1.0 0.8 0.8 10.7 0.3 17.3 5.6 98.8 99.2 89.7 98.5 89.2 89.9 98.5 99.2 98.7 93.4 88.2 85.6 94.5 87.2 85.6 89.2 89.7 88.7 89.2 89.6 89.6 89.4 95.0 98.8 98.8 99.2 89.4 89.6 89.6 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 85.7 87.1 85.7 89.6 99.0 87.1 8 D06-3518(1-5) County Line Pork
9 0.5 0.5 0.5 10.7 0.3 16.8 5.6 0.7 99.0 89.4 98.7 88.9 89.6 98.7 98.8 98.8 92.7 87.9 85.9 93.9 86.9 85.9 88.9 89.4 88.6 88.9 89.2 89.2 89.1 94.4 99.0 99.0 99.3 89.2 89.4 89.4 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.7 88.7 84.2 87.1 85.7 89.2 99.2 87.1 9 D05-65768(1-5) County Line Pork
10 0.8 0.5 0.5 10.7 0.5 17.3 4.8 0.7 0.7 90.0 99.0 89.2 90.2 99.0 99.3 99.5 93.4 88.2 86.1 94.5 87.2 86.1 89.2 90.2 88.9 89.2 89.6 89.6 89.4 95.0 99.3 99.3 99.7 89.6 89.7 89.7 90.2 91.9 91.9 90.5 91.5 91.9 91.9 96.2 89.4 85.2 87.2 85.9 89.6 99.5 87.2 10 D05-56088(16-20) County Line Pork
11 11.1 10.7 10.7 1.7 10.3 16.4 14.3 10.5 10.5 10.1 89.6 98.3 99.8 89.6 90.0 89.6 85.2 97.8 89.7 86.6 96.2 89.7 99.0 87.7 87.4 99.0 99.3 99.3 99.2 86.9 89.2 90.0 89.7 87.1 87.4 87.2 87.6 88.9 88.9 87.9 88.6 88.9 88.9 87.2 87.4 87.7 87.7 86.2 98.5 89.6 87.7 11 D04-14781(1-5) Black Jack Pork
12 1.2 0.8 0.8 10.7 1.2 16.4 5.6 1.3 1.0 1.0 10.5 89.1 89.7 99.3 98.8 98.8 93.2 88.1 85.7 93.9 87.1 85.7 89.1 89.9 88.9 89.1 89.4 89.4 89.2 94.4 99.0 99.3 99.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.5 89.4 85.2 87.1 85.7 89.4 99.2 87.1 12 D04-21622 Future Pork
13 11.4 11.1 11.0 2.0 10.6 16.4 14.8 10.9 10.9 10.9 1.7 10.9 98.5 89.1 89.6 89.7 85.4 97.3 88.9 86.4 95.4 88.9 98.7 87.2 87.4 98.7 99.0 99.0 98.8 86.9 88.7 89.6 89.2 87.1 87.2 87.2 87.1 88.7 88.7 87.4 88.4 88.7 88.7 87.2 87.1 87.4 86.4 84.9 98.2 89.1 86.4 13 D04-17554(1-2) K&K BlackJack Pork
14 10.9 10.5 10.5 1.5 10.1 16.6 14.1 10.3 10.3 9.9 0.2 10.3 1.5 89.7 90.2 89.7 85.4 98.0 89.6 86.7 96.4 89.6 99.2 87.9 87.6 99.2 99.5 99.5 99.3 87.1 89.4 90.2 89.9 87.4 87.6 87.6 87.7 89.1 89.1 88.1 88.7 89.1 89.1 87.4 87.6 87.6 87.6 86.1 98.7 89.7 87.6 14 D04-16905(1-3) Walbexer Black Jack
15 1.2 0.8 0.8 10.7 1.2 16.8 5.9 1.3 1.0 1.0 10.5 0.7 10.9 10.3 98.8 98.8 92.7 88.1 85.6 93.9 87.1 85.6 89.1 89.4 88.4 89.1 89.4 89.4 89.2 94.4 99.0 99.0 99.3 89.6 89.7 89.7 89.4 91.5 91.5 89.7 91.2 91.5 91.5 95.5 89.1 85.2 86.9 85.6 89.4 99.2 86.9 15 D04-16408-1 Illini Swine
16 1.2 0.8 0.8 10.4 0.5 17.0 5.6 0.7 0.8 0.7 10.3 1.2 10.6 10.1 1.2 98.8 93.4 88.6 86.1 94.7 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.2 99.3 99.0 99.3 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.4 89.6 85.6 87.1 85.7 89.9 99.2 87.1 16 D04-33869 County Line Pork
17 1.0 0.7 0.7 10.5 1.0 16.6 5.4 1.2 0.8 0.5 10.3 1.2 10.7 10.1 1.2 1.2 93.2 88.2 86.7 94.0 87.2 86.7 89.7 90.2 89.2 89.7 90.0 90.0 89.9 94.5 99.2 99.2 99.5 89.9 90.0 90.0 90.2 91.9 91.9 90.5 91.5 91.9 91.9 95.7 89.4 85.4 87.1 85.7 90.0 99.3 87.1 17 D05-8868(4-6) County Line
18 6.9 6.5 6.3 15.2 6.3 17.4 2.2 6.5 6.7 6.5 15.0 6.9 15.0 14.8 7.2 6.5 6.7 84.2 82.1 96.7 82.8 82.1 85.1 86.7 86.2 84.7 85.2 85.2 85.1 97.2 93.2 93.0 93.4 86.4 86.6 86.6 86.6 87.9 87.9 86.9 87.7 87.9 87.9 96.5 86.2 81.8 84.2 82.8 85.2 93.4 84.2 18 D05-46346(7-9) S&S Farms
19 11.0 10.6 10.6 1.0 10.2 14.8 14.5 10.4 10.4 10.4 0.8 10.4 1.4 0.7 10.4 10.2 10.4 14.7 88.9 85.4 95.4 88.9 98.0 86.6 87.2 98.0 98.3 98.3 98.2 85.9 88.1 88.6 88.2 86.6 86.7 86.7 86.4 88.4 88.4 86.7 88.1 88.4 88.4 86.2 86.9 87.4 87.1 85.6 98.0 88.1 87.1 19 D03-18981(1,2,4,5) Black Jack Pork
20 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 83.3 88.7 100.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 20 D03-18980(5,8) Black Jack Pork
21 5.4 5.0 4.8 13.9 4.8 17.1 1.9 5.0 5.2 5.0 13.7 5.7 13.9 13.5 5.7 5.0 5.6 3.2 13.5 17.4 84.1 83.3 86.2 87.7 86.9 85.9 86.4 86.4 86.2 99.3 94.7 94.2 94.5 87.4 87.6 87.6 87.6 88.9 88.9 87.9 88.7 88.9 88.9 98.5 87.6 82.9 84.6 83.1 86.4 94.5 84.6 21 D03-19304(20-23) S&S Farms
22 9.9 9.6 9.5 1.6 9.1 14.8 13.7 9.4 9.4 9.4 0.7 9.4 1.4 0.5 9.4 9.1 9.4 13.9 0.7 9.0 12.6 88.7 96.0 85.7 86.6 95.9 96.4 96.4 96.2 84.4 86.7 87.6 87.2 85.6 85.7 85.7 85.6 87.6 87.6 85.9 87.6 87.6 87.6 84.7 86.2 85.4 85.1 83.3 95.4 87.1 85.1 22 D03-16034(1-7-9) Black Jack Pork
23 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 0.0 17.4 9.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 23 D03-16035(5-8) Black Jack Pork
24 11.5 11.1 11.1 1.3 10.7 15.5 15.0 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.7 10.7 15.2 0.7 11.6 13.9 0.9 11.6 87.7 87.7 99.3 99.7 99.7 99.5 86.7 88.7 89.6 89.2 87.6 87.7 87.7 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.7 87.4 85.9 98.8 89.1 87.4 24 D03-14810-23 Black Jack Pork
25 10.9 10.5 10.5 12.8 10.1 17.7 13.2 10.3 10.5 9.9 12.6 10.3 13.4 12.4 10.7 10.1 10.1 14.0 12.5 14.6 12.9 11.5 14.6 12.8 95.7 87.6 87.9 87.9 87.7 87.9 89.9 89.9 89.9 95.5 95.7 95.7 99.3 97.8 97.8 99.5 97.7 97.8 97.8 88.2 96.0 87.2 85.4 84.1 87.9 89.7 85.4 25 D03-13137(11-15) Illini Farm 1904
26 11.3 10.9 10.9 11.7 10.5 16.5 14.0 10.7 10.7 10.7 11.9 10.7 12.3 11.7 11.1 10.5 10.5 14.2 11.2 14.0 13.3 10.0 14.0 11.7 3.6 87.6 88.1 88.1 87.9 87.1 88.9 88.9 88.9 94.2 94.4 94.4 95.7 96.7 96.7 95.9 96.8 96.7 96.7 87.6 94.5 86.2 84.7 83.1 88.1 88.7 84.7 26 D03-10907-3 LincolnLand Farms
27 11.4 11.1 11.0 1.3 10.6 16.4 15.2 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.6 10.7 15.4 0.7 11.5 14.1 0.9 11.5 0.7 13.0 11.9 99.7 99.7 99.5 86.4 88.7 89.6 89.2 87.4 87.2 87.4 87.4 89.1 89.1 87.7 88.7 89.1 89.1 86.7 87.4 87.9 86.9 85.7 98.8 89.1 86.9 27 D03-10033 Black Jack Pork
28 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 100.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 28 D03-10529(1-4) Black Jack Pork
29 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 0.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 29 D03-10935(1-4) Black Jack Pork
30 11.3 10.9 10.9 1.2 10.5 16.2 15.0 10.7 10.7 10.7 0.8 10.7 1.2 0.7 10.7 10.5 10.5 15.2 0.5 10.9 13.9 0.7 10.9 0.5 12.8 11.7 0.5 0.2 0.2 86.7 88.9 89.7 89.4 87.9 88.1 88.1 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.9 87.1 85.6 99.0 89.2 87.1 30 D03-10530-1 Black Jack Pork
31 4.8 4.5 4.3 13.5 4.3 17.4 1.3 4.5 4.7 4.5 13.3 5.2 13.5 13.1 5.2 4.5 5.0 2.7 13.1 16.9 0.7 12.2 16.9 13.5 12.8 13.1 13.7 13.3 13.3 13.5 95.2 94.7 95.0 87.6 87.7 87.7 87.7 89.1 89.1 88.1 88.9 89.1 89.1 99.0 87.7 83.4 85.1 83.6 86.9 95.0 85.1 31 D03-6293-4 S&S Farms (102850)
32 0.8 0.5 0.5 11.1 0.8 16.8 5.2 1.0 0.7 0.7 10.9 1.0 11.3 10.7 1.0 0.7 0.8 6.5 10.6 13.5 5.0 9.8 13.5 11.3 10.3 10.7 11.3 10.9 10.9 11.1 4.5 99.3 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.6 85.2 87.2 85.9 89.1 99.5 87.2 32 D02-48860(4-8) Crescent Pork
33 0.8 0.5 0.5 10.3 0.8 16.4 5.6 1.0 0.7 0.7 10.1 0.7 10.5 9.9 1.0 1.0 0.8 6.9 10.0 13.9 5.4 9.0 13.9 10.5 10.3 10.7 10.5 10.1 10.1 10.3 4.8 0.7 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.9 89.4 84.7 87.2 85.9 89.9 99.5 87.2 33 D02-45742-1 Black Jack Pork
34 0.5 0.2 0.2 10.7 0.5 16.8 5.2 0.7 0.3 0.3 10.5 0.7 10.9 10.3 0.7 0.7 0.5 6.5 10.4 13.5 5.0 9.4 13.5 10.9 10.3 10.7 10.9 10.5 10.5 10.7 4.5 0.3 0.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.4 85.1 87.2 85.9 89.6 99.8 87.2 34 D02-45742-2 Black Jack Pork
35 10.9 10.5 10.5 12.7 10.5 17.7 13.8 10.8 10.6 10.7 13.0 10.3 13.4 12.8 10.7 10.5 10.5 14.5 12.3 13.6 13.2 11.7 13.6 12.8 4.5 4.8 13.0 12.5 12.5 12.3 13.0 10.3 10.3 10.3 99.5 99.7 95.5 96.8 96.8 95.7 96.7 96.8 96.8 87.9 94.5 86.2 84.4 82.9 87.7 89.7 84.4 35 D04-49972-1 Illini Swine Inc
36 10.9 10.5 10.5 12.3 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.4 12.3 13.5 13.1 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 12.9 10.3 10.3 10.3 0.3 99.7 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.9 83.3 87.9 89.9 84.9 36 D04-49972-2 Illini Swine Inc
37 10.9 10.5 10.5 12.7 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.5 12.3 13.5 13.2 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 13.0 10.3 10.3 10.3 0.2 0.3 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.6 82.9 87.9 89.9 84.6 37 D04-49972-3 Illini Swine Inc
38 10.9 10.5 10.5 12.9 10.1 17.9 13.2 10.4 10.6 9.9 12.8 10.3 13.6 12.5 10.7 10.1 10.1 14.3 12.7 14.8 13.0 11.6 14.8 13.0 0.7 3.6 13.2 12.8 12.8 13.0 12.8 10.3 10.3 10.3 4.5 4.5 4.5 97.8 97.8 99.5 97.7 97.8 97.8 88.1 95.2 86.9 85.2 84.1 87.7 89.7 85.2 38 D03-6295-3 Illini-North
39 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 100.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 39 D03-5293(2-4) I llini Swine-Hich Tec
40 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 40 D03-5293(5-7) I llini Swine-High Tec
41 10.3 10.0 9.9 12.3 9.5 17.5 12.6 9.8 10.0 9.4 12.2 9.8 13.0 11.9 10.2 9.5 9.6 13.6 12.1 14.4 12.4 11.0 14.4 12.4 0.3 3.2 12.5 12.2 12.2 12.4 12.2 9.8 9.8 9.8 4.1 4.1 4.1 0.3 1.9 1.9 97.8 98.0 98.0 88.4 95.7 87.4 85.6 84.2 88.1 90.0 85.6 41 D03-5296(3-4) I llini Swine-North
42 9.3 9.0 8.9 11.3 8.6 16.6 12.8 8.8 9.0 8.8 11.5 8.8 11.9 11.3 9.2 8.6 9.0 13.4 11.1 13.3 12.1 9.8 13.3 11.3 2.4 2.5 11.5 11.1 11.1 11.3 12.0 8.8 8.8 8.8 3.1 3.1 3.1 2.4 0.2 0.2 2.0 99.8 99.8 89.6 96.0 87.7 85.9 84.4 89.1 91.4 85.9 42 D02-61015-3 Illini Farms South
43 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 43 D02-61016-1 Illini Farms South
44 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 0.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 44 D02-48857(5-8) I llini South
45 4.1 3.8 3.6 13.5 3.6 16.9 2.2 3.8 4.0 3.8 13.3 4.5 13.5 13.1 4.5 3.8 4.3 3.4 13.0 16.9 1.5 12.2 16.9 13.5 12.5 12.7 13.7 13.3 13.3 13.5 1.0 3.8 4.1 3.8 12.8 12.7 12.8 12.6 11.1 11.1 12.0 11.3 11.1 11.1 87.9 83.6 85.6 84.1 87.2 96.2 85.6 45 D02-48858(7-9) S&S Farms
46 10.9 10.9 10.9 12.2 10.5 18.0 13.4 10.8 11.0 10.7 12.8 10.7 13.4 12.6 11.1 10.5 10.9 14.3 12.1 15.3 13.0 10.9 15.3 12.6 3.8 4.5 12.8 12.4 12.4 12.6 12.8 10.7 10.7 10.7 5.2 5.2 5.2 4.5 3.6 3.6 4.0 3.8 3.6 3.6 12.8 87.9 85.6 83.9 87.9 89.2 85.6 46 D02-47395(1-2) Nipco Farms
47 14.5 14.5 14.5 12.3 14.1 18.5 17.5 13.7 14.6 14.3 13.2 14.3 13.6 13.4 14.3 14.1 14.3 18.0 12.1 13.2 16.9 12.5 13.2 13.2 13.5 14.1 12.9 12.8 12.8 13.0 16.5 14.3 14.7 14.3 14.4 14.4 14.4 13.7 12.7 12.7 13.1 12.9 12.7 12.7 16.9 12.3 84.2 83.1 88.1 84.9 84.2 47 D02-47394(5-8) Prime Pork
48 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 98.7 87.2 87.1 100.0 48 D06-28296-5 Boars
49 13.9 13.7 13.7 13.7 13.5 13.2 16.0 13.5 13.3 13.5 12.8 13.5 14.1 13.1 13.5 13.7 13.3 16.9 12.4 16.6 16.7 12.8 16.6 13.3 14.5 14.7 13.3 13.3 13.3 13.5 16.0 13.5 13.5 13.5 15.7 15.6 15.6 14.5 14.1 14.1 14.1 14.3 14.1 14.1 16.0 14.6 16.7 0.2 85.7 85.7 98.7 49 D06-26717-1 Boars
50 11.0 10.7 10.6 0.5 10.2 15.7 14.7 10.5 10.5 10.5 1.5 10.5 1.9 1.3 10.5 10.2 10.3 15.0 0.8 11.3 13.7 1.4 11.3 1.2 12.5 11.5 1.2 0.8 0.8 1.0 13.3 10.9 10.1 10.5 12.5 12.5 12.5 12.7 10.9 10.9 12.1 11.1 10.9 10.9 13.3 12.4 12.5 13.1 13.5 89.4 87.2 50 IngelvacATP
51 0.3 0.0 0.2 10.9 0.7 17.0 5.2 0.8 0.5 0.5 10.7 0.8 11.1 10.5 0.8 0.8 0.7 6.5 10.6 13.7 5.0 9.6 13.7 11.1 10.5 10.9 11.1 10.7 10.7 10.9 4.5 0.5 0.5 0.2 10.5 10.5 10.5 10.5 8.8 8.8 10.0 9.0 8.8 8.8 3.8 10.9 14.5 13.3 13.7 10.7 87.1 51 RespPRRS
52 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 0.0 0.2 13.1 13.3 52 D06-30617-1 FuturePork
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
![Page 28: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/28.jpg)
Percent Identity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
1 99.7 99.5 88.7 99.3 82.8 94.2 98.8 99.2 99.2 89.2 98.8 88.7 89.4 98.8 98.8 99.0 92.9 87.7 85.7 94.2 86.7 85.7 88.7 89.4 88.4 88.7 89.1 89.1 88.9 94.7 99.2 99.2 99.5 89.4 89.6 89.6 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.9 89.2 84.9 86.9 85.6 89.1 99.7 86.9 1 D04-33870 Black Jack/Holtkai
2 0.3 99.8 89.1 99.3 83.3 94.5 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.4 88.1 86.1 94.5 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.0 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 84.9 87.1 85.7 89.4 100.0 87.1 2 D04-29274 Black Jack Pork
3 0.5 0.2 89.1 99.3 83.3 94.7 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.5 88.1 86.1 94.7 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.2 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.4 89.2 84.9 87.1 85.7 89.4 99.8 87.1 3 D04-49976 W eidner, Al
4 11.2 10.9 10.8 89.6 84.6 85.1 89.2 88.9 89.2 98.3 89.1 98.0 98.5 89.1 89.6 89.7 84.9 97.8 89.4 86.1 95.2 89.4 98.7 87.6 87.7 98.5 99.0 99.0 98.8 86.6 88.7 89.6 89.2 87.4 87.9 87.6 87.2 89.1 89.1 87.7 88.7 89.1 89.1 86.9 88.2 88.1 87.1 85.6 99.5 89.1 87.1 4 D06-21801(4-6) H&P
5 0.7 0.7 0.7 10.4 83.1 94.2 99.5 99.3 99.5 90.0 98.8 89.6 90.2 98.8 99.5 99.0 93.7 88.6 86.1 94.9 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.4 99.2 99.2 99.5 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.5 89.6 85.6 87.2 85.9 89.9 99.3 87.2 5 D06-16814(21-25) County Line Pork
6 17.5 17.0 17.0 15.9 17.0 81.9 82.8 82.9 82.9 84.2 83.6 84.1 84.1 83.3 83.1 83.7 82.4 84.4 83.4 82.6 82.8 83.4 85.1 83.3 83.1 84.1 84.6 84.6 84.4 82.4 83.3 83.7 83.4 82.8 83.1 82.9 83.1 83.7 83.7 83.3 83.9 83.7 83.7 83.3 82.8 82.6 87.9 86.2 84.6 83.3 87.9 6 D06-13563-22 Sand Ridge
7 5.6 5.2 5.0 15.0 5.4 17.8 93.9 93.5 94.9 85.7 94.2 85.6 85.9 93.9 94.0 94.4 97.8 84.4 82.6 98.2 82.9 82.6 85.2 87.4 86.4 84.9 85.4 85.4 85.2 98.7 94.7 94.2 94.5 86.7 86.9 86.9 87.2 88.2 88.2 87.6 88.1 88.2 88.2 97.8 87.1 82.4 84.9 83.4 85.4 94.5 84.9 7 D06-6000-1 Huftalin/Dreska
8 1.0 0.8 0.8 10.7 0.3 17.3 5.6 98.8 99.2 89.7 98.5 89.2 89.9 98.5 99.2 98.7 93.4 88.2 85.6 94.5 87.2 85.6 89.2 89.7 88.7 89.2 89.6 89.6 89.4 95.0 98.8 98.8 99.2 89.4 89.6 89.6 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 85.7 87.1 85.7 89.6 99.0 87.1 8 D06-3518(1-5) County Line Pork
9 0.5 0.5 0.5 10.7 0.3 16.8 5.6 0.7 99.0 89.4 98.7 88.9 89.6 98.7 98.8 98.8 92.7 87.9 85.9 93.9 86.9 85.9 88.9 89.4 88.6 88.9 89.2 89.2 89.1 94.4 99.0 99.0 99.3 89.2 89.4 89.4 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.7 88.7 84.2 87.1 85.7 89.2 99.2 87.1 9 D05-65768(1-5) County Line Pork
10 0.8 0.5 0.5 10.7 0.5 17.3 4.8 0.7 0.7 90.0 99.0 89.2 90.2 99.0 99.3 99.5 93.4 88.2 86.1 94.5 87.2 86.1 89.2 90.2 88.9 89.2 89.6 89.6 89.4 95.0 99.3 99.3 99.7 89.6 89.7 89.7 90.2 91.9 91.9 90.5 91.5 91.9 91.9 96.2 89.4 85.2 87.2 85.9 89.6 99.5 87.2 10 D05-56088(16-20) County Line Pork
11 11.1 10.7 10.7 1.7 10.3 16.4 14.3 10.5 10.5 10.1 89.6 98.3 99.8 89.6 90.0 89.6 85.2 97.8 89.7 86.6 96.2 89.7 99.0 87.7 87.4 99.0 99.3 99.3 99.2 86.9 89.2 90.0 89.7 87.1 87.4 87.2 87.6 88.9 88.9 87.9 88.6 88.9 88.9 87.2 87.4 87.7 87.7 86.2 98.5 89.6 87.7 11 D04-14781(1-5) Black Jack Pork
12 1.2 0.8 0.8 10.7 1.2 16.4 5.6 1.3 1.0 1.0 10.5 89.1 89.7 99.3 98.8 98.8 93.2 88.1 85.7 93.9 87.1 85.7 89.1 89.9 88.9 89.1 89.4 89.4 89.2 94.4 99.0 99.3 99.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.5 89.4 85.2 87.1 85.7 89.4 99.2 87.1 12 D04-21622 Future Pork
13 11.4 11.1 11.0 2.0 10.6 16.4 14.8 10.9 10.9 10.9 1.7 10.9 98.5 89.1 89.6 89.7 85.4 97.3 88.9 86.4 95.4 88.9 98.7 87.2 87.4 98.7 99.0 99.0 98.8 86.9 88.7 89.6 89.2 87.1 87.2 87.2 87.1 88.7 88.7 87.4 88.4 88.7 88.7 87.2 87.1 87.4 86.4 84.9 98.2 89.1 86.4 13 D04-17554(1-2) K&K BlackJack Pork
14 10.9 10.5 10.5 1.5 10.1 16.6 14.1 10.3 10.3 9.9 0.2 10.3 1.5 89.7 90.2 89.7 85.4 98.0 89.6 86.7 96.4 89.6 99.2 87.9 87.6 99.2 99.5 99.5 99.3 87.1 89.4 90.2 89.9 87.4 87.6 87.6 87.7 89.1 89.1 88.1 88.7 89.1 89.1 87.4 87.6 87.6 87.6 86.1 98.7 89.7 87.6 14 D04-16905(1-3) Walbexer Black Jack
15 1.2 0.8 0.8 10.7 1.2 16.8 5.9 1.3 1.0 1.0 10.5 0.7 10.9 10.3 98.8 98.8 92.7 88.1 85.6 93.9 87.1 85.6 89.1 89.4 88.4 89.1 89.4 89.4 89.2 94.4 99.0 99.0 99.3 89.6 89.7 89.7 89.4 91.5 91.5 89.7 91.2 91.5 91.5 95.5 89.1 85.2 86.9 85.6 89.4 99.2 86.9 15 D04-16408-1 Illini Swine
16 1.2 0.8 0.8 10.4 0.5 17.0 5.6 0.7 0.8 0.7 10.3 1.2 10.6 10.1 1.2 98.8 93.4 88.6 86.1 94.7 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.2 99.3 99.0 99.3 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.4 89.6 85.6 87.1 85.7 89.9 99.2 87.1 16 D04-33869 County Line Pork
17 1.0 0.7 0.7 10.5 1.0 16.6 5.4 1.2 0.8 0.5 10.3 1.2 10.7 10.1 1.2 1.2 93.2 88.2 86.7 94.0 87.2 86.7 89.7 90.2 89.2 89.7 90.0 90.0 89.9 94.5 99.2 99.2 99.5 89.9 90.0 90.0 90.2 91.9 91.9 90.5 91.5 91.9 91.9 95.7 89.4 85.4 87.1 85.7 90.0 99.3 87.1 17 D05-8868(4-6) County Line
18 6.9 6.5 6.3 15.2 6.3 17.4 2.2 6.5 6.7 6.5 15.0 6.9 15.0 14.8 7.2 6.5 6.7 84.2 82.1 96.7 82.8 82.1 85.1 86.7 86.2 84.7 85.2 85.2 85.1 97.2 93.2 93.0 93.4 86.4 86.6 86.6 86.6 87.9 87.9 86.9 87.7 87.9 87.9 96.5 86.2 81.8 84.2 82.8 85.2 93.4 84.2 18 D05-46346(7-9) S&S Farms
19 11.0 10.6 10.6 1.0 10.2 14.8 14.5 10.4 10.4 10.4 0.8 10.4 1.4 0.7 10.4 10.2 10.4 14.7 88.9 85.4 95.4 88.9 98.0 86.6 87.2 98.0 98.3 98.3 98.2 85.9 88.1 88.6 88.2 86.6 86.7 86.7 86.4 88.4 88.4 86.7 88.1 88.4 88.4 86.2 86.9 87.4 87.1 85.6 98.0 88.1 87.1 19 D03-18981(1,2,4,5) Black Jack Pork
20 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 83.3 88.7 100.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 20 D03-18980(5,8) Black Jack Pork
21 5.4 5.0 4.8 13.9 4.8 17.1 1.9 5.0 5.2 5.0 13.7 5.7 13.9 13.5 5.7 5.0 5.6 3.2 13.5 17.4 84.1 83.3 86.2 87.7 86.9 85.9 86.4 86.4 86.2 99.3 94.7 94.2 94.5 87.4 87.6 87.6 87.6 88.9 88.9 87.9 88.7 88.9 88.9 98.5 87.6 82.9 84.6 83.1 86.4 94.5 84.6 21 D03-19304(20-23) S&S Farms
22 9.9 9.6 9.5 1.6 9.1 14.8 13.7 9.4 9.4 9.4 0.7 9.4 1.4 0.5 9.4 9.1 9.4 13.9 0.7 9.0 12.6 88.7 96.0 85.7 86.6 95.9 96.4 96.4 96.2 84.4 86.7 87.6 87.2 85.6 85.7 85.7 85.6 87.6 87.6 85.9 87.6 87.6 87.6 84.7 86.2 85.4 85.1 83.3 95.4 87.1 85.1 22 D03-16034(1-7-9) Black Jack Pork
23 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 0.0 17.4 9.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 23 D03-16035(5-8) Black Jack Pork
24 11.5 11.1 11.1 1.3 10.7 15.5 15.0 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.7 10.7 15.2 0.7 11.6 13.9 0.9 11.6 87.7 87.7 99.3 99.7 99.7 99.5 86.7 88.7 89.6 89.2 87.6 87.7 87.7 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.7 87.4 85.9 98.8 89.1 87.4 24 D03-14810-23 Black Jack Pork
25 10.9 10.5 10.5 12.8 10.1 17.7 13.2 10.3 10.5 9.9 12.6 10.3 13.4 12.4 10.7 10.1 10.1 14.0 12.5 14.6 12.9 11.5 14.6 12.8 95.7 87.6 87.9 87.9 87.7 87.9 89.9 89.9 89.9 95.5 95.7 95.7 99.3 97.8 97.8 99.5 97.7 97.8 97.8 88.2 96.0 87.2 85.4 84.1 87.9 89.7 85.4 25 D03-13137(11-15) Illini Farm 1904
26 11.3 10.9 10.9 11.7 10.5 16.5 14.0 10.7 10.7 10.7 11.9 10.7 12.3 11.7 11.1 10.5 10.5 14.2 11.2 14.0 13.3 10.0 14.0 11.7 3.6 87.6 88.1 88.1 87.9 87.1 88.9 88.9 88.9 94.2 94.4 94.4 95.7 96.7 96.7 95.9 96.8 96.7 96.7 87.6 94.5 86.2 84.7 83.1 88.1 88.7 84.7 26 D03-10907-3 LincolnLand Farms
27 11.4 11.1 11.0 1.3 10.6 16.4 15.2 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.6 10.7 15.4 0.7 11.5 14.1 0.9 11.5 0.7 13.0 11.9 99.7 99.7 99.5 86.4 88.7 89.6 89.2 87.4 87.2 87.4 87.4 89.1 89.1 87.7 88.7 89.1 89.1 86.7 87.4 87.9 86.9 85.7 98.8 89.1 86.9 27 D03-10033 Black Jack Pork
28 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 100.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 28 D03-10529(1-4) Black Jack Pork
29 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 0.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 29 D03-10935(1-4) Black Jack Pork
30 11.3 10.9 10.9 1.2 10.5 16.2 15.0 10.7 10.7 10.7 0.8 10.7 1.2 0.7 10.7 10.5 10.5 15.2 0.5 10.9 13.9 0.7 10.9 0.5 12.8 11.7 0.5 0.2 0.2 86.7 88.9 89.7 89.4 87.9 88.1 88.1 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.9 87.1 85.6 99.0 89.2 87.1 30 D03-10530-1 Black Jack Pork
31 4.8 4.5 4.3 13.5 4.3 17.4 1.3 4.5 4.7 4.5 13.3 5.2 13.5 13.1 5.2 4.5 5.0 2.7 13.1 16.9 0.7 12.2 16.9 13.5 12.8 13.1 13.7 13.3 13.3 13.5 95.2 94.7 95.0 87.6 87.7 87.7 87.7 89.1 89.1 88.1 88.9 89.1 89.1 99.0 87.7 83.4 85.1 83.6 86.9 95.0 85.1 31 D03-6293-4 S&S Farms (102850)
32 0.8 0.5 0.5 11.1 0.8 16.8 5.2 1.0 0.7 0.7 10.9 1.0 11.3 10.7 1.0 0.7 0.8 6.5 10.6 13.5 5.0 9.8 13.5 11.3 10.3 10.7 11.3 10.9 10.9 11.1 4.5 99.3 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.6 85.2 87.2 85.9 89.1 99.5 87.2 32 D02-48860(4-8) Crescent Pork
33 0.8 0.5 0.5 10.3 0.8 16.4 5.6 1.0 0.7 0.7 10.1 0.7 10.5 9.9 1.0 1.0 0.8 6.9 10.0 13.9 5.4 9.0 13.9 10.5 10.3 10.7 10.5 10.1 10.1 10.3 4.8 0.7 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.9 89.4 84.7 87.2 85.9 89.9 99.5 87.2 33 D02-45742-1 Black Jack Pork
34 0.5 0.2 0.2 10.7 0.5 16.8 5.2 0.7 0.3 0.3 10.5 0.7 10.9 10.3 0.7 0.7 0.5 6.5 10.4 13.5 5.0 9.4 13.5 10.9 10.3 10.7 10.9 10.5 10.5 10.7 4.5 0.3 0.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.4 85.1 87.2 85.9 89.6 99.8 87.2 34 D02-45742-2 Black Jack Pork
35 10.9 10.5 10.5 12.7 10.5 17.7 13.8 10.8 10.6 10.7 13.0 10.3 13.4 12.8 10.7 10.5 10.5 14.5 12.3 13.6 13.2 11.7 13.6 12.8 4.5 4.8 13.0 12.5 12.5 12.3 13.0 10.3 10.3 10.3 99.5 99.7 95.5 96.8 96.8 95.7 96.7 96.8 96.8 87.9 94.5 86.2 84.4 82.9 87.7 89.7 84.4 35 D04-49972-1 Illini Swine Inc
36 10.9 10.5 10.5 12.3 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.4 12.3 13.5 13.1 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 12.9 10.3 10.3 10.3 0.3 99.7 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.9 83.3 87.9 89.9 84.9 36 D04-49972-2 Illini Swine Inc
37 10.9 10.5 10.5 12.7 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.5 12.3 13.5 13.2 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 13.0 10.3 10.3 10.3 0.2 0.3 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.6 82.9 87.9 89.9 84.6 37 D04-49972-3 Illini Swine Inc
38 10.9 10.5 10.5 12.9 10.1 17.9 13.2 10.4 10.6 9.9 12.8 10.3 13.6 12.5 10.7 10.1 10.1 14.3 12.7 14.8 13.0 11.6 14.8 13.0 0.7 3.6 13.2 12.8 12.8 13.0 12.8 10.3 10.3 10.3 4.5 4.5 4.5 97.8 97.8 99.5 97.7 97.8 97.8 88.1 95.2 86.9 85.2 84.1 87.7 89.7 85.2 38 D03-6295-3 Illini-North
39 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 100.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 39 D03-5293(2-4) I llini Swine-Hich Tec
40 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 40 D03-5293(5-7) I llini Swine-High Tec
41 10.3 10.0 9.9 12.3 9.5 17.5 12.6 9.8 10.0 9.4 12.2 9.8 13.0 11.9 10.2 9.5 9.6 13.6 12.1 14.4 12.4 11.0 14.4 12.4 0.3 3.2 12.5 12.2 12.2 12.4 12.2 9.8 9.8 9.8 4.1 4.1 4.1 0.3 1.9 1.9 97.8 98.0 98.0 88.4 95.7 87.4 85.6 84.2 88.1 90.0 85.6 41 D03-5296(3-4) I llini Swine-North
42 9.3 9.0 8.9 11.3 8.6 16.6 12.8 8.8 9.0 8.8 11.5 8.8 11.9 11.3 9.2 8.6 9.0 13.4 11.1 13.3 12.1 9.8 13.3 11.3 2.4 2.5 11.5 11.1 11.1 11.3 12.0 8.8 8.8 8.8 3.1 3.1 3.1 2.4 0.2 0.2 2.0 99.8 99.8 89.6 96.0 87.7 85.9 84.4 89.1 91.4 85.9 42 D02-61015-3 Illini Farms South
43 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 43 D02-61016-1 Illini Farms South
44 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 0.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 44 D02-48857(5-8) I llini South
45 4.1 3.8 3.6 13.5 3.6 16.9 2.2 3.8 4.0 3.8 13.3 4.5 13.5 13.1 4.5 3.8 4.3 3.4 13.0 16.9 1.5 12.2 16.9 13.5 12.5 12.7 13.7 13.3 13.3 13.5 1.0 3.8 4.1 3.8 12.8 12.7 12.8 12.6 11.1 11.1 12.0 11.3 11.1 11.1 87.9 83.6 85.6 84.1 87.2 96.2 85.6 45 D02-48858(7-9) S&S Farms
46 10.9 10.9 10.9 12.2 10.5 18.0 13.4 10.8 11.0 10.7 12.8 10.7 13.4 12.6 11.1 10.5 10.9 14.3 12.1 15.3 13.0 10.9 15.3 12.6 3.8 4.5 12.8 12.4 12.4 12.6 12.8 10.7 10.7 10.7 5.2 5.2 5.2 4.5 3.6 3.6 4.0 3.8 3.6 3.6 12.8 87.9 85.6 83.9 87.9 89.2 85.6 46 D02-47395(1-2) Nipco Farms
47 14.5 14.5 14.5 12.3 14.1 18.5 17.5 13.7 14.6 14.3 13.2 14.3 13.6 13.4 14.3 14.1 14.3 18.0 12.1 13.2 16.9 12.5 13.2 13.2 13.5 14.1 12.9 12.8 12.8 13.0 16.5 14.3 14.7 14.3 14.4 14.4 14.4 13.7 12.7 12.7 13.1 12.9 12.7 12.7 16.9 12.3 84.2 83.1 88.1 84.9 84.2 47 D02-47394(5-8) Prime Pork
48 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 98.7 87.2 87.1 100.0 48 D06-28296-5 Boars
49 13.9 13.7 13.7 13.7 13.5 13.2 16.0 13.5 13.3 13.5 12.8 13.5 14.1 13.1 13.5 13.7 13.3 16.9 12.4 16.6 16.7 12.8 16.6 13.3 14.5 14.7 13.3 13.3 13.3 13.5 16.0 13.5 13.5 13.5 15.7 15.6 15.6 14.5 14.1 14.1 14.1 14.3 14.1 14.1 16.0 14.6 16.7 0.2 85.7 85.7 98.7 49 D06-26717-1 Boars
50 11.0 10.7 10.6 0.5 10.2 15.7 14.7 10.5 10.5 10.5 1.5 10.5 1.9 1.3 10.5 10.2 10.3 15.0 0.8 11.3 13.7 1.4 11.3 1.2 12.5 11.5 1.2 0.8 0.8 1.0 13.3 10.9 10.1 10.5 12.5 12.5 12.5 12.7 10.9 10.9 12.1 11.1 10.9 10.9 13.3 12.4 12.5 13.1 13.5 89.4 87.2 50 IngelvacATP
51 0.3 0.0 0.2 10.9 0.7 17.0 5.2 0.8 0.5 0.5 10.7 0.8 11.1 10.5 0.8 0.8 0.7 6.5 10.6 13.7 5.0 9.6 13.7 11.1 10.5 10.9 11.1 10.7 10.7 10.9 4.5 0.5 0.5 0.2 10.5 10.5 10.5 10.5 8.8 8.8 10.0 9.0 8.8 8.8 3.8 10.9 14.5 13.3 13.7 10.7 87.1 51 RespPRRS
52 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 0.0 0.2 13.1 13.3 52 D06-30617-1 FuturePork
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
Percent Identity
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
1 99.7 99.5 88.7 99.3 82.8 94.2 98.8 99.2 99.2 89.2 98.8 88.7 89.4 98.8 98.8 99.0 92.9 87.7 85.7 94.2 86.7 85.7 88.7 89.4 88.4 88.7 89.1 89.1 88.9 94.7 99.2 99.2 99.5 89.4 89.6 89.6 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.9 89.2 84.9 86.9 85.6 89.1 99.7 86.9 1 D04-33870 Black Jack/Holtkai
2 0.3 99.8 89.1 99.3 83.3 94.5 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.4 88.1 86.1 94.5 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.0 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 84.9 87.1 85.7 89.4 100.0 87.1 2 D04-29274 Black Jack Pork
3 0.5 0.2 89.1 99.3 83.3 94.7 99.0 99.2 99.5 89.6 99.2 89.1 89.7 99.2 99.2 99.3 93.5 88.1 86.1 94.7 87.1 86.1 89.1 89.7 88.7 89.1 89.4 89.4 89.2 95.2 99.5 99.5 99.8 89.7 89.9 89.9 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.4 89.2 84.9 87.1 85.7 89.4 99.8 87.1 3 D04-49976 Weidner, Al
4 11.2 10.9 10.8 89.6 84.6 85.1 89.2 88.9 89.2 98.3 89.1 98.0 98.5 89.1 89.6 89.7 84.9 97.8 89.4 86.1 95.2 89.4 98.7 87.6 87.7 98.5 99.0 99.0 98.8 86.6 88.7 89.6 89.2 87.4 87.9 87.6 87.2 89.1 89.1 87.7 88.7 89.1 89.1 86.9 88.2 88.1 87.1 85.6 99.5 89.1 87.1 4 D06-21801(4-6) H&P
5 0.7 0.7 0.7 10.4 83.1 94.2 99.5 99.3 99.5 90.0 98.8 89.6 90.2 98.8 99.5 99.0 93.7 88.6 86.1 94.9 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.4 99.2 99.2 99.5 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.5 89.6 85.6 87.2 85.9 89.9 99.3 87.2 5 D06-16814(21-25) County Line Pork
6 17.5 17.0 17.0 15.9 17.0 81.9 82.8 82.9 82.9 84.2 83.6 84.1 84.1 83.3 83.1 83.7 82.4 84.4 83.4 82.6 82.8 83.4 85.1 83.3 83.1 84.1 84.6 84.6 84.4 82.4 83.3 83.7 83.4 82.8 83.1 82.9 83.1 83.7 83.7 83.3 83.9 83.7 83.7 83.3 82.8 82.6 87.9 86.2 84.6 83.3 87.9 6 D06-13563-22 Sand Ridge
7 5.6 5.2 5.0 15.0 5.4 17.8 93.9 93.5 94.9 85.7 94.2 85.6 85.9 93.9 94.0 94.4 97.8 84.4 82.6 98.2 82.9 82.6 85.2 87.4 86.4 84.9 85.4 85.4 85.2 98.7 94.7 94.2 94.5 86.7 86.9 86.9 87.2 88.2 88.2 87.6 88.1 88.2 88.2 97.8 87.1 82.4 84.9 83.4 85.4 94.5 84.9 7 D06-6000-1 Huftalin/Dreska
8 1.0 0.8 0.8 10.7 0.3 17.3 5.6 98.8 99.2 89.7 98.5 89.2 89.9 98.5 99.2 98.7 93.4 88.2 85.6 94.5 87.2 85.6 89.2 89.7 88.7 89.2 89.6 89.6 89.4 95.0 98.8 98.8 99.2 89.4 89.6 89.6 89.7 91.7 91.7 90.0 91.4 91.7 91.7 96.2 89.2 85.7 87.1 85.7 89.6 99.0 87.1 8 D06-3518(1-5) County Line Pork
9 0.5 0.5 0.5 10.7 0.3 16.8 5.6 0.7 99.0 89.4 98.7 88.9 89.6 98.7 98.8 98.8 92.7 87.9 85.9 93.9 86.9 85.9 88.9 89.4 88.6 88.9 89.2 89.2 89.1 94.4 99.0 99.0 99.3 89.2 89.4 89.4 89.4 91.4 91.4 89.7 91.0 91.4 91.4 95.7 88.7 84.2 87.1 85.7 89.2 99.2 87.1 9 D05-65768(1-5) County Line Pork
10 0.8 0.5 0.5 10.7 0.5 17.3 4.8 0.7 0.7 90.0 99.0 89.2 90.2 99.0 99.3 99.5 93.4 88.2 86.1 94.5 87.2 86.1 89.2 90.2 88.9 89.2 89.6 89.6 89.4 95.0 99.3 99.3 99.7 89.6 89.7 89.7 90.2 91.9 91.9 90.5 91.5 91.9 91.9 96.2 89.4 85.2 87.2 85.9 89.6 99.5 87.2 10 D05-56088(16-20) County Line Pork
11 11.1 10.7 10.7 1.7 10.3 16.4 14.3 10.5 10.5 10.1 89.6 98.3 99.8 89.6 90.0 89.6 85.2 97.8 89.7 86.6 96.2 89.7 99.0 87.7 87.4 99.0 99.3 99.3 99.2 86.9 89.2 90.0 89.7 87.1 87.4 87.2 87.6 88.9 88.9 87.9 88.6 88.9 88.9 87.2 87.4 87.7 87.7 86.2 98.5 89.6 87.7 11 D04-14781(1-5) Black Jack Pork
12 1.2 0.8 0.8 10.7 1.2 16.4 5.6 1.3 1.0 1.0 10.5 89.1 89.7 99.3 98.8 98.8 93.2 88.1 85.7 93.9 87.1 85.7 89.1 89.9 88.9 89.1 89.4 89.4 89.2 94.4 99.0 99.3 99.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.5 89.4 85.2 87.1 85.7 89.4 99.2 87.1 12 D04-21622 Future Pork
13 11.4 11.1 11.0 2.0 10.6 16.4 14.8 10.9 10.9 10.9 1.7 10.9 98.5 89.1 89.6 89.7 85.4 97.3 88.9 86.4 95.4 88.9 98.7 87.2 87.4 98.7 99.0 99.0 98.8 86.9 88.7 89.6 89.2 87.1 87.2 87.2 87.1 88.7 88.7 87.4 88.4 88.7 88.7 87.2 87.1 87.4 86.4 84.9 98.2 89.1 86.4 13 D04-17554(1-2) K&K BlackJack Pork
14 10.9 10.5 10.5 1.5 10.1 16.6 14.1 10.3 10.3 9.9 0.2 10.3 1.5 89.7 90.2 89.7 85.4 98.0 89.6 86.7 96.4 89.6 99.2 87.9 87.6 99.2 99.5 99.5 99.3 87.1 89.4 90.2 89.9 87.4 87.6 87.6 87.7 89.1 89.1 88.1 88.7 89.1 89.1 87.4 87.6 87.6 87.6 86.1 98.7 89.7 87.6 14 D04-16905(1-3) Walbexer Black Jack
15 1.2 0.8 0.8 10.7 1.2 16.8 5.9 1.3 1.0 1.0 10.5 0.7 10.9 10.3 98.8 98.8 92.7 88.1 85.6 93.9 87.1 85.6 89.1 89.4 88.4 89.1 89.4 89.4 89.2 94.4 99.0 99.0 99.3 89.6 89.7 89.7 89.4 91.5 91.5 89.7 91.2 91.5 91.5 95.5 89.1 85.2 86.9 85.6 89.4 99.2 86.9 15 D04-16408-1 Illini Swine
16 1.2 0.8 0.8 10.4 0.5 17.0 5.6 0.7 0.8 0.7 10.3 1.2 10.6 10.1 1.2 98.8 93.4 88.6 86.1 94.7 87.6 86.1 89.6 90.0 89.1 89.6 89.9 89.9 89.7 95.2 99.3 99.0 99.3 89.7 89.9 89.9 90.0 92.0 92.0 90.4 91.7 92.0 92.0 96.4 89.6 85.6 87.1 85.7 89.9 99.2 87.1 16 D04-33869 County Line Pork
17 1.0 0.7 0.7 10.5 1.0 16.6 5.4 1.2 0.8 0.5 10.3 1.2 10.7 10.1 1.2 1.2 93.2 88.2 86.7 94.0 87.2 86.7 89.7 90.2 89.2 89.7 90.0 90.0 89.9 94.5 99.2 99.2 99.5 89.9 90.0 90.0 90.2 91.9 91.9 90.5 91.5 91.9 91.9 95.7 89.4 85.4 87.1 85.7 90.0 99.3 87.1 17 D05-8868(4-6) County Line
18 6.9 6.5 6.3 15.2 6.3 17.4 2.2 6.5 6.7 6.5 15.0 6.9 15.0 14.8 7.2 6.5 6.7 84.2 82.1 96.7 82.8 82.1 85.1 86.7 86.2 84.7 85.2 85.2 85.1 97.2 93.2 93.0 93.4 86.4 86.6 86.6 86.6 87.9 87.9 86.9 87.7 87.9 87.9 96.5 86.2 81.8 84.2 82.8 85.2 93.4 84.2 18 D05-46346(7-9) S&S Farms
19 11.0 10.6 10.6 1.0 10.2 14.8 14.5 10.4 10.4 10.4 0.8 10.4 1.4 0.7 10.4 10.2 10.4 14.7 88.9 85.4 95.4 88.9 98.0 86.6 87.2 98.0 98.3 98.3 98.2 85.9 88.1 88.6 88.2 86.6 86.7 86.7 86.4 88.4 88.4 86.7 88.1 88.4 88.4 86.2 86.9 87.4 87.1 85.6 98.0 88.1 87.1 19 D03-18981(1,2,4,5) Black Jack Pork
20 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 83.3 88.7 100.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 20 D03-18980(5,8) Black Jack Pork
21 5.4 5.0 4.8 13.9 4.8 17.1 1.9 5.0 5.2 5.0 13.7 5.7 13.9 13.5 5.7 5.0 5.6 3.2 13.5 17.4 84.1 83.3 86.2 87.7 86.9 85.9 86.4 86.4 86.2 99.3 94.7 94.2 94.5 87.4 87.6 87.6 87.6 88.9 88.9 87.9 88.7 88.9 88.9 98.5 87.6 82.9 84.6 83.1 86.4 94.5 84.6 21 D03-19304(20-23) S&S Farms
22 9.9 9.6 9.5 1.6 9.1 14.8 13.7 9.4 9.4 9.4 0.7 9.4 1.4 0.5 9.4 9.1 9.4 13.9 0.7 9.0 12.6 88.7 96.0 85.7 86.6 95.9 96.4 96.4 96.2 84.4 86.7 87.6 87.2 85.6 85.7 85.7 85.6 87.6 87.6 85.9 87.6 87.6 87.6 84.7 86.2 85.4 85.1 83.3 95.4 87.1 85.1 22 D03-16034(1-7-9) Black Jack Pork
23 14.1 13.7 13.7 11.5 13.7 17.2 17.8 13.9 13.5 13.7 10.9 13.9 12.0 11.2 13.9 13.7 13.1 18.2 10.3 0.0 17.4 9.0 89.4 86.6 85.9 89.4 89.7 89.7 89.9 83.4 86.2 85.9 86.2 86.9 87.2 87.1 86.4 87.4 87.4 86.6 87.2 87.4 87.4 83.7 85.7 87.2 84.2 82.8 89.6 86.1 84.2 23 D03-16035(5-8) Black Jack Pork
24 11.5 11.1 11.1 1.3 10.7 15.5 15.0 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.7 10.7 15.2 0.7 11.6 13.9 0.9 11.6 87.7 87.7 99.3 99.7 99.7 99.5 86.7 88.7 89.6 89.2 87.6 87.7 87.7 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.7 87.4 85.9 98.8 89.1 87.4 24 D03-14810-23 Black Jack Pork
25 10.9 10.5 10.5 12.8 10.1 17.7 13.2 10.3 10.5 9.9 12.6 10.3 13.4 12.4 10.7 10.1 10.1 14.0 12.5 14.6 12.9 11.5 14.6 12.8 95.7 87.6 87.9 87.9 87.7 87.9 89.9 89.9 89.9 95.5 95.7 95.7 99.3 97.8 97.8 99.5 97.7 97.8 97.8 88.2 96.0 87.2 85.4 84.1 87.9 89.7 85.4 25 D03-13137(11-15) Illini Farm 1904
26 11.3 10.9 10.9 11.7 10.5 16.5 14.0 10.7 10.7 10.7 11.9 10.7 12.3 11.7 11.1 10.5 10.5 14.2 11.2 14.0 13.3 10.0 14.0 11.7 3.6 87.6 88.1 88.1 87.9 87.1 88.9 88.9 88.9 94.2 94.4 94.4 95.7 96.7 96.7 95.9 96.8 96.7 96.7 87.6 94.5 86.2 84.7 83.1 88.1 88.7 84.7 26 D03-10907-3 LincolnLand Farms
27 11.4 11.1 11.0 1.3 10.6 16.4 15.2 10.9 10.9 10.9 1.0 10.9 1.3 0.8 10.9 10.6 10.7 15.4 0.7 11.5 14.1 0.9 11.5 0.7 13.0 11.9 99.7 99.7 99.5 86.4 88.7 89.6 89.2 87.4 87.2 87.4 87.4 89.1 89.1 87.7 88.7 89.1 89.1 86.7 87.4 87.9 86.9 85.7 98.8 89.1 86.9 27 D03-10033 Black Jack Pork
28 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 100.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 28 D03-10529(1-4) Black Jack Pork
29 11.1 10.7 10.7 1.0 10.3 15.9 14.8 10.5 10.5 10.5 0.7 10.5 1.0 0.5 10.5 10.3 10.3 15.0 0.3 11.2 13.7 0.5 11.2 0.3 12.6 11.5 0.3 0.0 99.8 86.9 89.1 89.9 89.6 87.7 87.9 87.9 87.7 89.4 89.4 88.1 89.1 89.4 89.4 87.2 87.9 88.1 87.2 85.7 99.2 89.4 87.2 29 D03-10935(1-4) Black Jack Pork
30 11.3 10.9 10.9 1.2 10.5 16.2 15.0 10.7 10.7 10.7 0.8 10.7 1.2 0.7 10.7 10.5 10.5 15.2 0.5 10.9 13.9 0.7 10.9 0.5 12.8 11.7 0.5 0.2 0.2 86.7 88.9 89.7 89.4 87.9 88.1 88.1 87.6 89.2 89.2 87.9 88.9 89.2 89.2 87.1 87.7 87.9 87.1 85.6 99.0 89.2 87.1 30 D03-10530-1 Black Jack Pork
31 4.8 4.5 4.3 13.5 4.3 17.4 1.3 4.5 4.7 4.5 13.3 5.2 13.5 13.1 5.2 4.5 5.0 2.7 13.1 16.9 0.7 12.2 16.9 13.5 12.8 13.1 13.7 13.3 13.3 13.5 95.2 94.7 95.0 87.6 87.7 87.7 87.7 89.1 89.1 88.1 88.9 89.1 89.1 99.0 87.7 83.4 85.1 83.6 86.9 95.0 85.1 31 D03-6293-4 S&S Farms (102850)
32 0.8 0.5 0.5 11.1 0.8 16.8 5.2 1.0 0.7 0.7 10.9 1.0 11.3 10.7 1.0 0.7 0.8 6.5 10.6 13.5 5.0 9.8 13.5 11.3 10.3 10.7 11.3 10.9 10.9 11.1 4.5 99.3 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.6 85.2 87.2 85.9 89.1 99.5 87.2 32 D02-48860(4-8) Crescent Pork
33 0.8 0.5 0.5 10.3 0.8 16.4 5.6 1.0 0.7 0.7 10.1 0.7 10.5 9.9 1.0 1.0 0.8 6.9 10.0 13.9 5.4 9.0 13.9 10.5 10.3 10.7 10.5 10.1 10.1 10.3 4.8 0.7 99.7 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 95.9 89.4 84.7 87.2 85.9 89.9 99.5 87.2 33 D02-45742-1 Black Jack Pork
34 0.5 0.2 0.2 10.7 0.5 16.8 5.2 0.7 0.3 0.3 10.5 0.7 10.9 10.3 0.7 0.7 0.5 6.5 10.4 13.5 5.0 9.4 13.5 10.9 10.3 10.7 10.9 10.5 10.5 10.7 4.5 0.3 0.3 89.9 90.0 90.0 89.9 91.9 91.9 90.2 91.5 91.9 91.9 96.2 89.4 85.1 87.2 85.9 89.6 99.8 87.2 34 D02-45742-2 Black Jack Pork
35 10.9 10.5 10.5 12.7 10.5 17.7 13.8 10.8 10.6 10.7 13.0 10.3 13.4 12.8 10.7 10.5 10.5 14.5 12.3 13.6 13.2 11.7 13.6 12.8 4.5 4.8 13.0 12.5 12.5 12.3 13.0 10.3 10.3 10.3 99.5 99.7 95.5 96.8 96.8 95.7 96.7 96.8 96.8 87.9 94.5 86.2 84.4 82.9 87.7 89.7 84.4 35 D04-49972-1 Illini Swine Inc
36 10.9 10.5 10.5 12.3 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.4 12.3 13.5 13.1 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 12.9 10.3 10.3 10.3 0.3 99.7 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.9 83.3 87.9 89.9 84.9 36 D04-49972-2 Illini Swine Inc
37 10.9 10.5 10.5 12.7 10.5 17.6 13.8 10.7 10.5 10.7 12.9 10.3 13.3 12.7 10.7 10.5 10.5 14.5 12.3 13.5 13.2 11.6 13.5 12.7 4.5 4.8 12.9 12.5 12.5 12.3 13.0 10.3 10.3 10.3 0.2 0.3 95.7 97.0 97.0 95.9 96.8 97.0 97.0 88.1 94.7 86.4 84.6 82.9 87.9 89.9 84.6 37 D04-49972-3 Illini Swine Inc
38 10.9 10.5 10.5 12.9 10.1 17.9 13.2 10.4 10.6 9.9 12.8 10.3 13.6 12.5 10.7 10.1 10.1 14.3 12.7 14.8 13.0 11.6 14.8 13.0 0.7 3.6 13.2 12.8 12.8 13.0 12.8 10.3 10.3 10.3 4.5 4.5 4.5 97.8 97.8 99.5 97.7 97.8 97.8 88.1 95.2 86.9 85.2 84.1 87.7 89.7 85.2 38 D03-6295-3 Illini-North
39 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 100.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 39 D03-5293(2-4) I llini Swine-Hich Tec
40 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 98.0 99.8 100.0 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 40 D03-5293(5-7) I llini Swine-High Tec
41 10.3 10.0 9.9 12.3 9.5 17.5 12.6 9.8 10.0 9.4 12.2 9.8 13.0 11.9 10.2 9.5 9.6 13.6 12.1 14.4 12.4 11.0 14.4 12.4 0.3 3.2 12.5 12.2 12.2 12.4 12.2 9.8 9.8 9.8 4.1 4.1 4.1 0.3 1.9 1.9 97.8 98.0 98.0 88.4 95.7 87.4 85.6 84.2 88.1 90.0 85.6 41 D03-5296(3-4) I llini Swine-North
42 9.3 9.0 8.9 11.3 8.6 16.6 12.8 8.8 9.0 8.8 11.5 8.8 11.9 11.3 9.2 8.6 9.0 13.4 11.1 13.3 12.1 9.8 13.3 11.3 2.4 2.5 11.5 11.1 11.1 11.3 12.0 8.8 8.8 8.8 3.1 3.1 3.1 2.4 0.2 0.2 2.0 99.8 99.8 89.6 96.0 87.7 85.9 84.4 89.1 91.4 85.9 42 D02-61015-3 Illini Farms South
43 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 100.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 43 D02-61016-1 Illini Farms South
44 9.1 8.8 8.8 11.1 8.4 16.8 12.6 8.6 8.8 8.6 11.3 8.6 11.7 11.1 9.0 8.4 8.8 13.2 10.8 13.1 11.9 9.8 13.1 11.1 2.2 2.7 11.3 10.9 10.9 11.1 11.7 8.6 8.6 8.6 2.9 2.9 2.9 2.2 0.0 0.0 1.9 0.2 0.0 89.7 96.2 88.1 86.2 84.7 89.4 91.7 86.2 44 D02-48857(5-8) I llini South
45 4.1 3.8 3.6 13.5 3.6 16.9 2.2 3.8 4.0 3.8 13.3 4.5 13.5 13.1 4.5 3.8 4.3 3.4 13.0 16.9 1.5 12.2 16.9 13.5 12.5 12.7 13.7 13.3 13.3 13.5 1.0 3.8 4.1 3.8 12.8 12.7 12.8 12.6 11.1 11.1 12.0 11.3 11.1 11.1 87.9 83.6 85.6 84.1 87.2 96.2 85.6 45 D02-48858(7-9) S&S Farms
46 10.9 10.9 10.9 12.2 10.5 18.0 13.4 10.8 11.0 10.7 12.8 10.7 13.4 12.6 11.1 10.5 10.9 14.3 12.1 15.3 13.0 10.9 15.3 12.6 3.8 4.5 12.8 12.4 12.4 12.6 12.8 10.7 10.7 10.7 5.2 5.2 5.2 4.5 3.6 3.6 4.0 3.8 3.6 3.6 12.8 87.9 85.6 83.9 87.9 89.2 85.6 46 D02-47395(1-2) Nipco Farms
47 14.5 14.5 14.5 12.3 14.1 18.5 17.5 13.7 14.6 14.3 13.2 14.3 13.6 13.4 14.3 14.1 14.3 18.0 12.1 13.2 16.9 12.5 13.2 13.2 13.5 14.1 12.9 12.8 12.8 13.0 16.5 14.3 14.7 14.3 14.4 14.4 14.4 13.7 12.7 12.7 13.1 12.9 12.7 12.7 16.9 12.3 84.2 83.1 88.1 84.9 84.2 47 D02-47394(5-8) Prime Pork
48 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 98.7 87.2 87.1 100.0 48 D06-28296-5 Boars
49 13.9 13.7 13.7 13.7 13.5 13.2 16.0 13.5 13.3 13.5 12.8 13.5 14.1 13.1 13.5 13.7 13.3 16.9 12.4 16.6 16.7 12.8 16.6 13.3 14.5 14.7 13.3 13.3 13.3 13.5 16.0 13.5 13.5 13.5 15.7 15.6 15.6 14.5 14.1 14.1 14.1 14.3 14.1 14.1 16.0 14.6 16.7 0.2 85.7 85.7 98.7 49 D06-26717-1 Boars
50 11.0 10.7 10.6 0.5 10.2 15.7 14.7 10.5 10.5 10.5 1.5 10.5 1.9 1.3 10.5 10.2 10.3 15.0 0.8 11.3 13.7 1.4 11.3 1.2 12.5 11.5 1.2 0.8 0.8 1.0 13.3 10.9 10.1 10.5 12.5 12.5 12.5 12.7 10.9 10.9 12.1 11.1 10.9 10.9 13.3 12.4 12.5 13.1 13.5 89.4 87.2 50 IngelvacATP
51 0.3 0.0 0.2 10.9 0.7 17.0 5.2 0.8 0.5 0.5 10.7 0.8 11.1 10.5 0.8 0.8 0.7 6.5 10.6 13.7 5.0 9.6 13.7 11.1 10.5 10.9 11.1 10.7 10.7 10.9 4.5 0.5 0.5 0.2 10.5 10.5 10.5 10.5 8.8 8.8 10.0 9.0 8.8 8.8 3.8 10.9 14.5 13.3 13.7 10.7 87.1 51 RespPRRS
52 13.5 13.3 13.3 13.3 13.1 12.8 15.6 13.1 12.9 13.1 12.5 13.1 13.7 12.7 13.1 13.3 12.9 16.5 12.0 16.4 16.2 12.4 16.4 12.9 14.1 14.3 13.3 12.9 12.9 13.1 15.6 13.1 13.1 13.1 15.2 15.2 15.2 14.3 13.7 13.7 13.7 13.9 13.7 13.7 15.6 14.2 16.5 0.0 0.2 13.1 13.3 52 D06-30617-1 FuturePork
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
5.14.06
6.2.06
![Page 29: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/29.jpg)
Sequencing and Dendograms
• = Phylogenetic analysis
• Nucleotide sequencing
![Page 30: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/30.jpg)
![Page 31: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/31.jpg)
![Page 32: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/32.jpg)
Genetic Sequencing
• Homologies do not indicate cross-protection
• Homologies do not predict pathogenicity
• Homologies only indicate relatedness
![Page 33: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/33.jpg)
PRRS…SVN (SN)
• Serum Virus Neutralization
• PRRS SVN not used widely
• Possible direct correlation with protective antibodies in vivo
• Alpha and beta procedures
• Beta utilized for PRRS
![Page 34: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/34.jpg)
SVN…Procedure
• Beta Procedure– Known levels of standard virus incubated with
serial dilutions of test serum– Serum is then added to sensitive cell lines– Titer of serum = Highest dilution of serum that
neutralizes known dose of virus– End points are shown by cytopathology
![Page 35: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/35.jpg)
SVN Results
• Less sensitive than IFA or ELISA– Neutralizing Ab produced slow PI ( >21 days)– Levels of nAb are pig-dependent
• Detectable 9-28 days PI
• Max titers at 2-3 months PI
• Persistent titers > 1 year PI
![Page 36: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/36.jpg)
SVN…Interpretation
• Assumed that shedding of virus is nill if nAb is present
• However, PRRS produces carrier-state animals– REMEMBER:
•ARTERIVIRUS
![Page 37: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/37.jpg)
PRRSv Detection in Tissues
• Histopathology
• PCR
• VI
• IHC
• DFA
![Page 38: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/38.jpg)
PRRS…Histopathology
• Interstitial pneumonia– Thickened alveolar walls– Pneumocyte hypertrophy/hyperplasia– Alveolar spaces filled with necrotic debris and
WBC’s
![Page 39: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/39.jpg)
PRRS…Histopathology
Normal Interstitial pneumonia
T. Opriessnig, 2004
![Page 40: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/40.jpg)
PCR…Process
RNA
Reverse Transcriptase
DNA
Heat Denaturing
Primersand
Cooling
Annealing
Taq +Nucleotides
CT G
A
Complementary Strands
30 Cycles
![Page 41: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/41.jpg)
PRRS…VI
• Virus Isolation
• Lung, Tonsil, Lymph nodes
• Autolysis greatly affects sensitivity
• Much easier to find in serum
![Page 42: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/42.jpg)
PRRS…IHC
• Immunohistochemistry
• Antibody coupled to horseradish peroxidase
• H2O2/Benzidine derivative added
• Colored insoluble precipitate formed
Halbur, AASV
![Page 43: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/43.jpg)
PRRS…DFA
• Direct Fluorescent Antibody
• PRRSv infected tissue
• Fluorescein conjugated to antiviral antibody
![Page 44: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/44.jpg)
DFA…Results
• Quick, Cheap
• Specific
• Less sensitive…autolysis
![Page 45: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/45.jpg)
Semen PRRSv PCR
![Page 46: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/46.jpg)
• Specific
• Less Sensitive – Intermittent Shedding– Detectable Levels > Infectious Levels
Semen PRRSv PCR
![Page 47: Respiratory Diagnostics](https://reader038.vdocuments.site/reader038/viewer/2022102910/56814404550346895db096bb/html5/thumbnails/47.jpg)
Other Respiratory Diagnostics
• I request many of the same diagnostic tests for different respiratory diseases.
• If you feel like you are lost when you are out in practice, call the lab you are working with and the diagnosticians are more than happy to help you out and explain more about what they do.