reduced expression of fukutin related protein in mice results - brain

BRAINA JOURNAL OF NEUROLOGY

Reduced expression of fukutin related protein inmice results in a model for fukutin related proteinassociated muscular dystrophiesM. R. Ackroyd,1,* L. Skordis,1,* M. Kaluarachchi,1 J. Godwin,1 S. Prior,1 M. Fidanboylu,1

R. J. Piercy,1,2 F. Muntoni3 and S. C. Brown1

1 Department of Cellular and Molecular Neuroscience, Hammersmith Hospital, Imperial College, London, UK

2 Department of Veterinary Clinical Sciences, Royal Veterinary College, London, UK

3 Institute of Child Health, UCL, London, UK

�These authors contributed equally to this work.

Correspondence to: S. C. Brown,

Department of Cellular and Molecular Neuroscience,

Hammersmith Hospital, Imperial College, London, UK

E-mail: [email protected]

AbstractMutations in fukutin related protein (FKRP) are responsible for a common group of muscular dystrophies ranging from adult

onset limb girdle muscular dystrophies to severe congenital forms with associated structural brain involvement, including

Muscle Eye Brain disease. A common feature of these disorders is the variable reduction in the glycosylation of skeletal

muscle a-dystroglycan. In order to gain insight into the pathogenesis and clinical variability, we have generated two lines

of mice, the first containing a missense mutation and a neomycin cassette, FKRP-NeoTyr307Asn and the second containing the

FKRPTyr307Asn mutation alone. We have previously associated this missense mutation with a severe muscle–eye–brain pheno-

type in several families. Homozygote Fkrp-NeoTyr307Asn mice die soon after birth and show a reduction in the laminin-binding

epitope of a-dystroglycan in muscle, eye and brain, and have reduced levels of FKRP transcript. Homozygous FkrpTyr307Asn

mice showed no discernible phenotype up to 6 months of age, contrary to the severe clinical course observed in patients

with the same mutation. These results suggest the generation of a mouse model for FKRP related muscular dystrophy requires

a knock-down rather than a knock-in strategy in order to give rise to a disease phenotype.

Keywords: muscular dystrophy; fukutin related protein

Abbreviations: CMD = congenital muscular dystrophies; FKRP = fukutin related protein; ILM = inner limiting membrane;MEB = muscle eye brain disease; WWS = Walker Warburg syndrome

IntroductionThe congenital muscular dystrophies (CMD) are a genetically

heterogeneous group of autosomal recessive disorders, presenting

in infancy with muscle weakness, contractures and dystrophic

changes on skeletal muscle biopsy (Muntoni and Voit, 2004).

A number of forms are now known to be associated with

mutations in genes [POMT1, POMT2, POMGnt1, LARGE, fuku-

tin and fukutin related protein (FKRP)] encoding for proteins that

are either putative or determined glycosyltransferases lending sup-

port to the idea that the aberrant post-translational modification

of proteins may represent a new mechanism of pathogenesis in

the muscular dystrophies (Michele and Campbell, 2003; Muntoni

et al., 2004; Barresi and Campbell, 2006). One characteristic of

doi:10.1093/brain/awn335 Brain 2009: 132; 439–451 | 439

Received April 15, 2008. Revised October 6, 2008. Accepted November 14, 2008. Advance Access publication January 20, 2009

� The Author (2009). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved.

For Permissions, please email: [email protected]

Dow

nloaded from https://academ

ic.oup.com/brain/article/132/2/439/378060 by guest on 24 N

ovember 2021

the muscle of patients with mutations in these six putative

glycosyltransferase genes is a marked hypoglycosylation of

a-dystroglycan (Brown et al., 2004; Brockington et al., 2005;

van Reeuwijk et al., 2005) which has led to the suggestion of

dystroglycanopathies as a general term to describe these condi-

tions. a-Dystroglycan is a central component of the dystrophin

associated complex and is expressed in a number of different

tissues including the brain. Its abnormal glycosylation affects its

interaction with members of the extracellular matrix, including

laminin, perlecan, neurexin and agrin within the basement mem-

brane. This reduction in ligand binding within the basement mem-

brane is thought to underlie both the muscular dystrophy but also

the structural brain defects including cobblestone lissencephaly

(Michele et al., 2002, 2003).

Mutations in POMT1 (Beltran-Valero et al., 2002), POMT2 (van

Reeuwijk et al., 2005), POMGnT1 (Yoshida et al., 2001), LARGE

(Longman et al., 2003; van Reeuwijk et al., 2007) and Fukutin

(Toda, 1999) are typically associated with severe muscular dystro-

phy and structural brain defects, ranging from the fatal Walker

Warburg syndrome (WWS) to variants such as Muscle Eye Brain

disease (MEB) and Fukuyama CMD (FCMD). We originally identi-

fied mutations in the gene encoding for FKRP, and showed them

to be responsible for a variant of CMD (MDC1C) and for a

common form of relatively mild limb girdle muscular dystrophy

(LGMD2I) (Brockington et al., 2001a, b), two conditions without

any brain involvement. However, mutations in FKRP have recently

been identified in patients with severe structural eye and brain

involvement resembling WWS and MEB disease (Beltran-Valero

et al., 2004). More recently, we and others were able to signifi-

cantly expand the phenotypic spectrum associated with mutations

in POMT1, POMT2, fukutin and POMGnT1, to include patients

with minimal or no evidence of central nervous system involve-

ment and with a LGMD phenotype (Balci et al., 2005; Godfrey

et al., 2007; Yanagisawa et al., 2007; Clement et al., 2008). This

lends support to the hypothesis that the phenotype of patients

belonging to this group of disorders depends not so much on

the specific gene primarily affected (i.e. POMT1, POMT2,

POMGnT1, LARGE, FKRP or fukutin) but rather the severity of

the specific mutation and presumably its effect on the structure

and thus the function of the gene product (Godfrey et al., 2007).

In order to better understand the functional consequences of an

alteration in FKRP activity, we have now generated two lines

of mice: the first containing a point mutation FKRPTyr307Asn

and the second containing this missense mutation and a neomycin

cassette, FKRP-NeoTyr307Asn. This mutation in the homozygous

state has previously been associated with MEB in two separate

families (Beltran-Valero et al., 2004; Mercuri et al., 2006), and

more recently in other families of Swedish descent (J. Vissing,

personal communication) and was also identified at the hetero-

zygous state in combination with the Leu276Ile in a patient

with severe LGMD2I (Sveen et al., 2006), suggesting it behaves

as a ‘severe’ FKRP mutation in humans. Surprisingly, however,

mice homozygous for this mutation shows no discernable pheno-

type strongly suggesting that the insertion of missense mutations

into the mouse Fkrp gene may not perturb FKRP function as is the

case for human patients. However, mice with the mutation which

retain the neomycin selection cassette in intron 2 show a marked

depletion in FKRP transcript levels and died at or soon after birth

with a phenotype resembling MEB. The phenotype of these mice

demonstrate a role for FKRP activity in muscle, eye and brain and

suggests that a reduction in the amount of functionally active

FKRP may represent a mechanism of disease in FKRP related

disorders.

Material and methods

Gene targeting and generationof FKRPTyr307Asn miceTo generate FKRPTyr307Asn mice, genomic DNA from E14-1A murine

ES (embryonic stem) cells was used as a template to PCR amplify the

right and left hand arms of the Fkrp targeting construct. The right

hand arm of the construct was 3.5 kb in length and consisted of the

coding region exon 3, flanked by intronic sequences and the 30-UTR

respectively. The left hand arm consisted of �3 kb of intronic

sequences amplified from Fkrp intron 2. In order to allow ease

of cloning and sequencing, both the right and left hand arms were

initially cloned into separate kanamycin resistant TOPO vectors.

Site-directed mutagenesis was used to introduce c.919 T4A

(Tyr307Asn) into the right hand arm. Both the right and left

hand arms were then sub-cloned into the final targeting vector,

a pBluescript II KS+ vector containing a neomycin cassette

(kindly provided by Dr Sue Shackleton, University of Leicester).

This vector contained an ampicillin resistant gene to aid in the

sub-cloning of the Fkrp arms. The neomycin cassette acted as

a positive selection marker and was placed within the region of

Fkrp homology, between two loxP sites. A negative selection

marker consisting of a Herpes simplex thymidine kinase (HSVtk)

cassette was inserted in the construct outside the region of Fkrp

homology.

Southern blot analysisGenomic DNA was extracted from G418-resistant ES cell clones.

To determine whether homologous recombination had occurred we

PCR amplified a 1000 bp probe which anneals to the endogenous

Fkrp mouse sequence 50 to the DNA sequences contained within the

original targeting vector (Fig. 1). DNA derived from each potentially

positive clone was digested with the restriction enzyme HindIII. When

homologous recombination has occurred, the probe identifies a 5-kb

band instead of 6.7-kb band as is the case for the endogenous mouse

sequence. The difference in size is due to an additional HindIII site

present in the targeting vector.

Generating and genotyping of miceOne homologous recombinant ES clone was microinjected into blas-

tocysts from 129J mice. The resulting male chimeras were then bred

with female C57BL6 mice to generate germ line-transmitted het-

erozygous mice. These mice were then crossed to generate mice

homozygous for the mutation and also the ‘neomycin’ cassette

FKRP-NeoTyr307Asn+/+. In order to remove the neomycin cassette

heterozygotes were crossed with b-actin Cre transgenic mice

(Lewandoski et al., 1997) to create mice homozygous for

FkrpTyr307Asn. In order to further test the pathogenesis of the

missense mutation, we also crossed FKRPTyr307Asn+/+ mice with

440 | Brain 2009: 132; 439–451 M. R. Ackroyd et al.

Dow



ovember 2021

FKRPTyr307AsnNeo+/� mice to obtain FKRPTyr307Asn+/+/Neo+/� mice.

Statistical analysis was performed using GraftpadTM (Prism) software.

Offspring from these crosses were genotyped by PCR analysis using

mouse tail/ear DNA. gDNA was prepared from ear clips used for

identification, the tissue were digested in Direct PCR Lysis (Ear)

(Eurogentec) containing proteinase K (0.2 mg/ml) at 55�C overnight.

PCRs were performed with 3 ml gDNA template using G-C rich tem-

plate PCR kit (Roche diagnostics). Genotyping of affected newborns

together with controls was performed on gDNA prepared from

tail tissue. Tails (�0.50 cm) were digested in 500ml of SNET buffer

(1% SDS/400 mM NaCl/5 mM EDTA/20 mM Tris–HCl, pH 8.0) con-

taining proteinase K (0.2 mg/ml) at 55�C overnight. After extraction

with phenol/chloroform and isopropanol precipitation, samples were

washed with 70% ethanol and resuspended in 200ml ddH2O. The

gDNA used as a template for PCR using G-C rich template PCR kit

(Roche diagnostics). Genotyping was performed by PCR and sequen-

cing of the Fkrp gene was used to confirm the point mutation (c.919 T

4A). The following PCR primers used to amplify either the Neomycin

cassette (NeoRPF2:TTCTCCTCTTCCTCATCTCC; NeoRPR2:CCAAGCT

CTTCAGCAATTATC) or the Fkrp gene (LA1F:CCGAGTTTG

TGGCTCTAGT; LA1R: TAGATGGCCCAGATCTACGTC), respectively,

and sequencing was performed in both directions using primers

LA1R and LA2F (GTCTGGTGAGCTGGGAAG) on a 3730XL DNA

Analyser (Applied Biosystems) at the MRC DNA Core laboratory.

Homozygous wild-type, homozygous Tyr307Asn missense mutants

or heterozygous mice were clearly identified using the Vector NTi

advance10 software (Invitrogen).

RT-PCR analysisTissues of interest were dissected out and homogenized with liquid

nitrogen using a mortar and pestle and the lysate passed through a

QiaShredder� (Qiagen). The RNA was isolated from the homogenized

tissue using an RNeasy� kit (Qiagen) and eluted into 30 ml. About 1 mg

of RNA was reverse transcribed with Superscript� III for qRT-PCR kit

(Invitrogen). qRT-PCR was performed on a 7500 FAST Real-Time PCR

system (Applied Biosystems) using a FAM(tm) reporter dye system for

each reaction 0.8 ml of cDNA was used as template in a PCR mix

consisting of 1 ml of primer mix, 10 ml TaqMan Universal PCR

Mastermix (Applied Biosystems) and 8.2 ml H2O. The primers for the

gene expression assays were sourced commercially from Applied

Biosystems: Mm00557870_mL (FKRP) and Mm99999915_gL

(GAPDH) which served as an endogenous control. All reactions were

performed in triplicate.

ImmunohistochemistryMuscle and brain samples were frozen in isopentane cooled in liq-

uid nitrogen. Cryostat sections were incubated with antibodies

to a-dystroglycan (IIH6, Upstate Biotechnology), collagen XVIII

(gift from J. Couchman), GT-20, core peptide to a-dystroglycan

(goat polyclonal, a gift from K. Campbell), RC2 (Developmental

Studies Hybridoma Bank), NeuN (Chemicon), Ctip2 (Abcam), laminin

a2 (Alexis), b1 (Chemicon), g1 (Chemicon), MHCd (Novocastra) and

P6 (Sherratt et al., 1992). All primary antibodies were followed by

biotinylated anti-rat/rabbit/mouse as appropriate and streptavidin-

Alexa 488 or 594 (Molecular Probes) for 30 min. Nuclei were stained

with Hoechst 33342 (Sigma). All dilutions and washings were made in

phosphate buffered saline. Sections were mounted in aqueous

mountant and viewed with epifluorescence using a Leica Diaphot

microscope equipped with Leica HCX PL Fluotar objectives at

�10 (numerical aperture 0.3), �20 (numerical aperture 0.4) and

�40 (numerical aperture 0.75). Images were digitally captured with

CoolSnap HQTM (Photometrics) CCD monochrome camera using a

Metamorph 7� (Universal Imaging Inc.) imaging system. All images

were compiled using Photoshop CS (Adobe). Where direct compari-

sons have been made fluorescent images were captured with equal

exposure and have had equal scaling applied.

SDS–PAGE and western blottingMuscle proteins were extracted in sample buffer consisting of 75 mM

Tris–HCl, 1% SDS, 2-mercaptoethanol, plus a cocktail of protease

inhibitors (antipain, aprotinin and leupeptin). Soluble proteins were

resolved using a NuPageTM Pre-cast gel (4–12% Bis–Tris; Invitrogen)

and then transferred electrophoretically to nitrocellulose membrane

(Hybond-ECL, Amersham). Nitrocellulose strips were blocked in

10% BSA (Jackson) in KC buffer [20 mM Tris, 100 mM NaCl] with

IIH6 (upstate) antibody overnight at 4�C. After washing they were

incubated with HRP-anti-mouse IgM (Jackson) for 1 h at room tem-

perature. Membranes were visualized using chemiluminescence

(ECL+Plus, Amersham). Laminin overlay was performed as described

previously (Michele et al., 2002).

Fig. 1 Targeting strategy. The right hand arm of the construct

was 3.5 kb in length and consisted of the coding region exon 3,

flanked by intronic sequences and the 30-UTR, respectively.

The left hand arm consisted of �3 kb of intronic sequences

amplified from Fkrp intron 2. Site-directed mutagenesis was

used to introduce Tyr307Asn into the right hand arm. The

floxed neomycin cassette acted as a positive selection marker

and was placed within the region of Fkrp homology. A nega-

tive selection marker consisting of a Herpes simplex thymidine

kinase (HSVtk) was inserted in the construct outside the region

of Fkrp homology. Probes were generated for Southern

blotting to identify targeted ES cell clones. To determine

whether homologous recombination had occurred we PCR

amplified a 1000-bp probe which anneals to the endogenous

Fkrp mouse sequence 50 to the DNA sequences contained

within our targeting vector. DNA derived from each potentially

positive clone was digested with the restriction enzyme HindIII.

When homologous recombination has occurred, the probe

identifies a 5-kb band instead of 6.7-kb band as is the case

for the endogenous mouse sequence. The difference in size

is due to an additional HindIII site present in the targeting

vector.

Mutations in FKRP associated muscular dystrophies Brain 2009: 132; 439–451 | 441

Dow



ovember 2021

Distribution of nuclei in the cortexThree transverse sections selected from each of three Fkrp-NeoTyr307Asn

mice and three control littermates were analysed at birth. The distance

from the ventricular zone to the pial basement membrane was divided

into six equal regions. The number of nuclei was then counted within

each layer and expressed as a percentage of the total number of nuclei

across all layers.

Results

Generation of FKRP-NeoTyr307Asn

and FKRPTyr307Asn +/+ miceWe generated and analysed two lines of mice, one with a knock-

in mutation FKRPTyr307Asn+/+ previously associated with a MEB-like

condition in two homozygous patients, and the other FKRP-

NeoTyr307Asn which contained in addition to the knock-in mutation,

a Neo cassette in intron 2. In both lines the number of homozy-

gote mice born was �25%, consistent with there being no embry-

onic lethality. Details of the targeting strategy are shown in Fig. 1.

FKRP-NeoTyr307Asn mice were crossed with b-actin Cre transgenic

heterozygotes (Lewandoski and Martin, 1997) to remove the

floxed Neo cassette and produce FKRPTyr307Asn+/+. Genotyping

was performed by PCR and sequencing of the Fkrp gene.

FKRPTyr307Asn+/+ mice arephenotypically normalBody weights of FKRPTyr307Asn+/+ mice (9.4� 0.4 n = 6 female and

9.4� 0.3 n = 4 male) at 6 weeks of age were not significantly dif-

ferent from wild-type controls (9.0� 0.3 n = 8 female and 10.3� 0.6

n = 5 male). Muscle histology of the lower hindlimb at 4 weeks of

age was indistinguishable from controls, as was immunolabelling for

IIH6, an antibody directed against the laminin binding epitope of

glycosylated a-dystroglycan (Fig. 2) and laminin a2 (data not

shown), the former of which is severely deficient in dystroglycano-

pathy patients. Haematoxylin and eosin staining of frozen sections of

eyes removed from FKRPTyr307Asn+/+ mice showed the presence of a

normal retina, retinal pigmented epithelium, lens, optic nerve, cornea

and ciliary margin in both FKRPTyr307Asn+/+ and control littermates.

Gross anatomy of the brain and heart was also indistinguishable

from controls. To date these mice show no overt clinical pheno-

type and display normal feeding and exploratory behaviour up to

6 months of age. To further test the effect of the missense mutation

we also crossed FKRPTyr307Asn+/+ mice with FKRPTyr307AsnNeo+/�. The

resulting FKRPTyr307Asn+/+/Neo+/� mice were within the normal body

weight range at birth and were viable. Further analyses of the brain

histology of these mice showed them to be indistinguishable from

normal littermate controls.

A reduction in Fkrp transcript levels isassociated with perinatal lethalityMice homozygous for FKRP-NeoTyr307Asn die at or soon after birth.

Some mice died prior to feeding whereas others moved, breathed

independently and suckled. There was no evidence of either

kyphoscoliosis, joint contractures or microcephaly and their exter-

nal anatomy was comparable with that of control or heterozygote

littermates (Fig. 3A). Haematoxylin and eosin stained transverse

sections of the body indicated well-preserved intercostal, para-

spinal and diaphragm muscles. Tongue and cranial muscles were

also apparently normal (data not shown). Body weight at birth

was, on average, approximately one-third less than that of their

littermates (Table 1, P = 0.0001).

Quantitative real time PCR (qRT-PCR) of Fkrp in these mice

indicated that FKRP-NeoTyr307Asn homozygotes expressed only

�40% of the levels of Fkrp mRNA present in wild-type controls

(Fig. 3B). Western blotting showed a reduction in the band

identified by IIH6 in brain, skeletal muscle and heart of the

FKRP-NeoTyr307Asn homozygotes relative to wild-type littermates

(Fig. 3C). A laminin overlay confirmed that this was associated

with a reduction in laminin binding in the mutant relative to con-

trol skeletal muscle and brain (Fig. 3D).

FKRP-NeoTyr307Asn mice display areduced muscle mass andhypoglycosylation of a-dystroglycanAt the time of birth both fore and hindlimb muscles of the FKRP-

NeoTyr307Asn showed a reduction in fibre density relative to their

normal and heterozygote littermates irrespective of whether the ani-

mals were found dead or were euthanized (Fig. 4A). There was no

evidence of fibre necrosis or regeneration although there was a sig-

nificant increase in the percentage of fibres with central nuclei in

the tibialis anterior (TA) and extensor digitorum longus (EDL) in the

mutant homozygotes relative to controls (Table 1). Gomori

Trichrome staining showed that the apparent space in between the

fibres was due to oedema rather than excess connective tissue

(Fig. 4A). NADH staining and immunolabelling for developmental

myosin (MHC-d) showed a similar level of fibre type differentiation

in FKRP-NeoTyr307Asn and control mice (data not shown).

Immunolabelling for IIH6 and laminin a2 was reduced in all mus-

cles of the FKRP-NeoTyr307Asn homozygote mice relative to wild-type

controls (Fig. 4A). With respect to laminin a2 this reduction varied

depending on the individual muscle. The level of immunolabelling for

laminin b1 (data not shown) and g1 were similar in both mutant and

controls suggesting that another laminin a chain might compensate

for the absence of laminin a2. This has previously been demonstrated

in primary laminin a2 deficiency (Sewry et al., 1995). Perlecan immu-

nolabelling was also indistinguishable between FKRP-NeoTyr307Asn

and wild-type muscle indicating that the deposition of this protein

may be less dependent on a-dystroglycan glycosylation than laminin

a2. Collagen IV immunolabelling was used as a general marker for

the basement membrane preservation and showed no discernable

differences between FKRP-NeoTyr307Asn homozygotes and controls

(data not shown). Previous reports suggest that in patients

some FKRP mutations are associated with a disruption of compo-

nents of the dystrophin associated protein complex (DAPC)

(MacLeod et al., 2007) we therefore also immunostained

for dystrophin but found no significant difference between

FKRP-NeoTyr307Asn mice and control littermates (data not shown).


Dow



ovember 2021

The inner limiting membrane of the eyeis perturbed in FKRP-NeoTyr307Asn miceWhilst the eyes of the FKRP-NeoTyr307Asn homozygote mice were

often smaller, this appeared to be a reflection of the reduction in

overall body size rather than a disproportionate reduction in the

size of the eye. Retinal folding in frozen sections of the eye is

known to be a common artefact, however, this change was mar-

ginally more pronounced in eyes from the FKRP-NeoTyr307Asn

homozygote mice. The most striking difference between

Fig. 2 Haematoxylin and eosin staining of transverse frozen sections of diaphragm (A and B), heart (C and D) and gastrocnemius (E and F)

of a wild-type control (A, C and E) and a FKRPTyr307Asn homozygote (B, D and F) mouse. Immunolabelling of a-dystroglycan (IIH6) at the

boundary of the soleus and gastrocnemius in a wild-type control (G) and FKRPTyr307Asn (H) mouse. Whilst the two muscles showed different

intensities of immunolabelling with the highest level apparent in the soleus, this was not different between the two genotypes.


Dow



ovember 2021

FKRP-NeoTyr307Asn homozygote and wild-type eyes was the pres-

ence of ectopic nuclei, outside the inner limiting membrane (ILM),

within the vitreous body of the mutant but not controls (Fig. 5).

Immunostaining for laminin g1 and perlecan (markers of the base-

ment membrane) clearly indicate that the ILM is disrupted in the

FKRPNeoTyr307Asn eye, although it was present in the vasculature

(Fig. 5H and N, respectively). Both these markers were present in

the eyes of age-matched controls (Fig. 5G and M, respectively).

Immunostaining for laminin a1, b1 collagen IV and collagen XVIII

further support these observations (data not shown).

Interestingly no staining was detected for laminin a2 in

either the FKRPNeoTyr307Asn or controls (data not shown) and

similarly, only punctate IIH6 immunostaining was evident in

control retinas that was absent in FKRP-NeoTyr307Asn homo-

zygotes. These data contrast with immunostaining with GT-20

(an antibody to the core protein of a-dystroglycan) that clearly

showed the presence of a-dystroglycan in the ILM of controls

and a reduction in FKRP-NeoTyr307Asn homozygotes indicating

that in specific locations such as the eye. FKRP levels facili-

tate a-dystroglycan binding to a laminin chain other than a2.

This interaction appears to be independent of the IIH6 epitope

and is disrupted when FKRP levels are reduced. Antibodies to

perlecan, collagens IV and XVIII also identify the ILM associated

vasculature which appeared not to be significantly different

between FKRP-NeoTyr307Asn homozygotes and controls (data not

shown).

Alterations in the pial basementmembrane of FKRP-NeoTyr307Asn areassociated with a marked disturbancein neuronal migrationCoronal sections of the brain of FKRP-NeoTyr307Asn mice stained

with haematoxylin and eosin showed a clear disruption of the

neuronal layering of the cerebral cortex and partial fusion of the

intrahemispheric fissue (Fig. 6A–D). Immunolabelling showed a

marked reduction in both IIH6 (Fig. 6A, E and F) and laminin a2

(Fig. 6A, G and H) at the pial basement membrane, whilst the

distribution of laminin g1 (Fig. 6A, K and L), perlecan (Fig. 6A,

I and J) and collagen IV (data not shown) was highly disorganized

and more diffuse compared with controls. The degree to which

this basement membrane was disorganized varied between indi-

vidual mutants. Radial migration is generally guided by the radial

glia cells (identified using the RC2 antibody) which form the scaf-

fold along which neurons migrate. RC2 staining indicated that the

radial glia cell population in the FKRP-NeoTyr307Asn homozygotes

00.5

11.5

22.5

33.5

44.5

5

A

B

C

D

Rel

ativ

e q

uan

tifi

cati

on

Wild Type (n = 4) Het (n = 2) FKRPKD (n = 6)

Fig. 3 (A) External anatomy of two FKRP-NeoTyr 307Asn mice

(A and B) and a wild-type control (C). (B) RT-PCR analysis to

show the relative expression of FKRP in mutant and hetero-

zygote littermates. (C) Western blot of extracts of brain

(lanes 1 and 4), skeletal muscle (lanes 2 and 5) and heart

(lanes 3 and 6) from wild-type mice (lanes 1–3) and FKRP-

NeoTyr307Asn mice (lanes 4–6) immunolabelled with IIH6. The

glycosylation of a-dystroglycan can be seen to be reduced in all

three tissues in the mutant relative to wild-type. (D) Laminin

overlay on extracts from skeletal muscle (lanes 1 and 2) and

brain (lanes 3 and 4) from FKRP-NeoTyr307Asn mice (lanes 2

and 4) and age-matched wild-type controls (lanes 1 and 3).

A reduced laminin binding affinity is observed in both the

skeletal muscle and brain of the FKRP-NeoTyr307Asn mice.


Dow



ovember 2021

was highly disorganized and the radial glial endfeet fail to from a

glial limitans at the pial surface thus resulting in a disruption of the

glial scaffold (Fig. 6A, I and J). There was also a marked alteration

in the density and distribution of nuclei at different levels through-

out the cortex, and a reduction in the total number of nuclei

(Fig. 6B).

Nuclei counts performed on haematoxylin and eosin stained

sections illustrated that there were �48% fewer nuclei present

in the region of the cortex closest to pia surface in the FKRP-

NeoTyr307Asn relative to age-matched controls (Fig. 6B: A–C).

Immunolabelling with the neuronal marker NeuN, which identifies

a population of post mitotic neurons confirmed that many of these

misplaced nuclei were of neuronal origin (Fig. 6A: M and N). This

result was further investigated with immunostaining for Ctip2, a

transcription factor expressed in layer five neurons, cells labelled

with this antibody clearly demonstrate that this population of neu-

rons has mislocalized (Fig. 6A: O and P). Overall these data indi-

cate that the FKRP-NeoTyr307Asn homozygote mice display

a defective basement membrane that results in a disruption of

both radial glia and neurons.

Fig. 4 Haematoxylin and eosin stained transverse sections of the soleus (A and B) and gastrocnemius (C and D) of FKRP-NeoTyr307Asn

(A and C) and control (B and D) littermates showing the reduction in fibre density in the mutant relative to controls. Sequential sections

of each muscle stained with Gomori Trichrome (E–F) show that the interstitial space apparent in the mutant is not connective tissue

but oedema. Immunolabelling for IIH6 (I and J), laminin a2 (K and L) of the plantaris showed the IIH6 epitope to be virtually absent

and the level of laminin a2 significantly reduced in the FKRP-NeoTyr307Asn muscle relative to controls. (Scale bars = A–H = 10 mm,

I–N = 50mm).

Table 1 Summary of body weight, fibre size and central nucleation in FKRPNeoY307N, heterozygote and wild-typelittermates

Genotype Body weight (g) Fibre size (km2) Percentage of fibres with centrally located nuclei

EDL Soleus TA EDL Soleus TA

HomozygoteFKRPNeoY307N

1.14� 0.03 a,b

(n = 36)68.4� 6.2(n = 4)

96.6�3.9(n = 4)

75.3� 8.8(n = 4)

15.6� 3.7c

(n = 4)20.9� 5.6(n = 4)

14.7� 2.6b,c

(n = 4)

HeterozygoteFKRPNeoY307N

1.35� 0.09(n = 9)

ND ND ND 7.9� 1.6(n = 3)

9.7� 1.5(n = 3)

6.7� 0.5(n = 3)

Wild-type 1.52� 0.08(n = 18)

78.5� 5.0(n = 3)

118.0� 18.7(n = 3)

98.7� 15.6(n = 3)

5.2� 0.6(n = 4)

9.5� 1.8(n = 4)

5.8� 0.3(n = 4)

Statistical significance was calculated using either a one-way analysis of variance or t-test.a Significantly different to wild-type (P50.0001).b Significantly different to heterozygote (P50.05).c Significantly different to wild-type (P50.05)


Dow



ovember 2021

Patients with FKRP mutations and brain involvement show evi-

dence of alterations in cerebellar development and work in

Largemyd mice shows that the tangential migration of a subgroup

of hindbrain neurons may be disrupted (Qu et al., 2006). In the

mouse, granule cells originate from the rhombic lip at around

E13-14, subsequently undergo an inward radial migration along

Bergmann glia fibres to the internal granular layer, which peaks

between P5 and P13. A role for a-dystroglycan in this process is

strongly suggested by the phenotype of the Largemyd mouse where

significant numbers of granule neurons are delayed in their migra-

tion due to either a physical disruption of the glial scaffolding

and/or altered neuronal–glial guide interactions (Qu et al., 2006).

Whilst a large part of cerebellar development takes place post-

natally in the mouse we were nonetheless able to examine the base-

ment membrane. At P0 the labelling with either IIH6 or GT-20 in

control mice, was present at only very low levels but was completely

absent in FKRP-NeoTyr307Asn. Laminin a2, g1 and perlecan labelling

was more diffuse in the FKRP-NeoTyr307Asn relative to controls

confirming that as with the pial-glial limitans this basement

membrane is markedly disrupted in the FKRP-NeoTyr307Asn mice.

The consequences of this on the external granule layer were not

apparent at this stage although immunolabelling for RC2, which

identifies the Bergmann glia, showed some disorganization in the

mutant relative to controls (data not shown).

DiscussionIn order to investigate the role of FKRP we have now generated

and analysed two lines of mice, the first of which carries a Fkrp

knock-in mutation (Fkrpc.919T4A) that results in a Tyr307Asn

missense mutation and the second which carries both the

Tyr307Asn mutation and a neomycin cassette in intron 2. The

homozygous inheritance of the Tyr307Asn mutation is associated

with a severe MEB phenotype in the human (Beltran-Valero et al.,

2004; Mercuri et al., 2006). However, mice homozygous for

this mutation have no apparent phenotype suggesting that

this mutation alters FKRP function in the human but not

the mouse despite the high level of sequence homology (94%)

between these two species (NP_077277.1) (NP_775606.1)

Fig. 5 Structural defects in the FKRP-NeoTyr307Asn eye. Control eyes (A, C, E, G, I, K and M) are present in each case in contrast to the

FKRP-NeoTyr307Asn eyes (B, D, F, H, J, L and N). Haematoxylin and eosin (A–D) illustrate abnormal layering of the retina in the FKRP-

NeoTyr307Asn compared with controls. Hoechst 33342 staining (E and F) indicates that ganglion cell layer (GCL) is disturbed and

ganglion cell nuclei are present in the vitreous body (VB) of the eye of the FKRP-NeoTyr307Asn mice. Immunostaining with laminin g1

(red: G and H), indicate that inner limiting membrane (ILM, arrow heads) is perturbed in the FKRP-NeoTyr307Asn mice, despite the

basement membrane surrounding the vasculature (asterisk) remaining in tact. Immunostaining with the GT20 antibody against core

dystroglycan (red, I and J) indicates that dystroglycan expression at the ILM is significantly reduced in the FKRP-NeoTyr307Asn mice

compared with controls. Interestingly however, the hypoglycosylated epitope of dystroglycan, IIH6 (red: K and L) was not present at

the ILM in either the FKRP-NeoTyr307Asn or the control eye. Double labelling with RC2 (red) and Perlecan (green) (M–N0) further

illustrate that the ILM is perturbed in the FKRP-NeoTyr307Asn mouse eye with the RC2 staining indicating that the Muller glia are

disorganized in the affected eyes of the affected mice. Scale bars represent: 200 mm (A and B) or 50 mm (C–N).


Dow



ovember 2021

0

200

400

600

800

1000

1200

Region 1 Region 2 Region 3Controls (n = 3) FkrpKD (n = 4)

Distribution of nuclei in the P0 cortex

0

50

100

150

200

250

Zone 1 Zone 2 Zone 3 Zone 4 Zone 5 Zone 6

FKRP KD (n = 4 litters) Controls (n = 3 litters)

Nu

mb

er o

f n

ucl

eiN

um

ber

of

nu

clei

Average number of nuclei betweenthe ventricular zone and the pia surface

A

B

Fig. 6 (A) Brain abnormalities in the FKRP-NeoTyr307Asn. Haematoxylin and eosin stained cyrosections of FKRP-NeoTyr307Asn (A and C)

and control mice (B and D) illustrating fusion of the intrahemispheric fissure (arrows) and aberrant layering of the cerebral cortex

as a result of reduced FKRP expression. Immunohistochemistry indicates a reduction in IIH6 (red: E and F) and laminin a2 staining

(red: G and H) at the pial basement membrane (arrowheads) between the FKRP-NeoTyr307Asn (E, G, I and K) and control mice (F, H,

J and L). Furthermore, immunostaining for basement membrane markers perlecan (green: I and J) and laminin g1 (red: K and L)

indicate a disruption of the pial basement membrane (arrowheads). RC2 staining, an intermediate filament protein that serves as a

marker for the radial glia, (red: I and J) demonstrates that the radial glia are disorganized in the FKRP-NeoTyr307Asn mice in comparison

to controls and their endfeet do not appear to be correctly attached at the pial surface. Immunostaining with NeuN (red: M and N)

and Ctip2 (green: O and P) clearly show that neurons and in particular layer V neurons mislocalize in the cerebral cortex of the FKRP-

NeoTyr307Asn mice. The position (or absence) of the basement membrane at interhemispheric fissue (I, J and M–P) is indicated with

chevrons. Scale bars represent: 200mm (A and B), 50 mm (C–H) or 100mm (I–P) (B) Nuclei counts performed on Haematoxylin and

eosin stained sections of three different regions in the cortex showing that there were less nuclei present in those layers closest to pial

surface in the FKRP-NeoTyr307Asn relative to age-matched controls.


Dow



ovember 2021

(www.epasy.org/tools/sim-prot.html). Despite these findings,

FKRP is clearly necessary for the mouse as a reduction in the

level of expression induced by inclusion of a neomycin cassette

in intron 2 clearly results in a severe phenotype. This suggests that

the introduction of other missense mutations into the mouse Fkrp

gene may not give rise to a phenotype. Whilst surprising these

findings are not without precedent; mice carrying a Arg142Cys

Notch 3 knock-in mutation do not develop a CADASIL-like phe-

notype despite the fact that human and mouse Notch 3 proteins

display 91% identity at the primary structural level (Lundkvist

et al., 2005). Similarly the introduction of a missense mutation

in the a-sarcoglycan gene, which in human patients is associated

A B

C D

E F

G H

Fig. 7 Cerebellum. 10 mm cerebella cryosections of FKRP-NeoTyr307Asn mice (A, C, E and G) and wild-type controls (B, D, F and H)

immunostained with GT20 (dystroglycan core) (A and B), Laminin a2 (C and D), Laminin g1 (E and F) and perlecan (G and H)

antibodies. A reduction in the staining was observed in each case. Scale bars are 25 mm (A and B) or 50 mm (C–H).


Dow



ovember 2021

with a muscular dystrophy, fails to give rise to this phenotype

when introduced into the mouse genome strongly suggesting

the existence of important species specific quality control pro-

cesses (Kobuke et al., 2008) and the effect of the mutation on

protein folding in the two species.

FKRP-NeoTyr307Asn homozygote mice display a muscle eye brain

phenotype and a quantitative reduction in Fkrp expression which

in homozygotes is �40% of the levels observed in normal control

littermates. Since mice homozygous for the Tyr307Asn mutation

have Fkrp transcript levels comparable with controls and do not

display a disease phenotype, these observations strongly suggest

that this reduction is playing the pathogenic role. The generation

of a hypomorph allele due to the intronic inclusion of a neomycin

resistance cassette has previously been reported for other genes

such as Fgf8 and N-myc and has proved to be particularly useful

when a null is embryonic lethal (Meyers et al., 1998; Nagy et al.,

1998). Indeed homozygosity for Fkrp null alleles has never been

observed in the human and since a 60% reduction of Fkrp tran-

script levels is lethal in the perinatal period, it would seem likely

that a total absence of Fkrp is embryonic lethal in both species.

This observation is of particular significance since it indirectly sug-

gests that the generation of a knock-out for Fkrp might not be a

useful strategy and that the phenotype induced by other ‘milder’

missense mutations such as the Leu276Ile might not produce any

discernable phenotype in this species.

We noted a reduction in muscle mass in both fore and hindlimb

muscles of the FKRP-NeoTyr307Asn mice relative to controls but no

evidence of necrosis or fibrosis, which is similar to previous reports

in the POMGnT1 null mice which were evaluated up to 2 days

after birth (Liu et al., 2006). However, unlike the FKRP-

NeoTyr307Asn homozygotes their lifespan is variable and the

muscle of those which survive to adulthood displays a marked

variability in fibre size and an increase in the incidence of central

myonuclei (Liu et al., 2006). LARGEmyd mice are also smaller at

birth than their littermates (J. Hewitt, personal communication)

and display an age-dependent progressive muscle pathology char-

acterized by necrosis and regeneration, central nuclei and prolifer-

ation of endomysial connective and fatty tissue although there is

no data on the morphology of their muscle at birth (Holzfeind

et al., 2002). On the basis of our findings and those reported

for the POMGnT1 mouse it would seem that the dystrophic phe-

notype develops after birth which is similar to dystrophin deficient

mdx mice which show no morphological abnormalities at birth but

go on to develop a dystrophic phenotype at 4–6 weeks of age.

Nonetheless these observations suggest that an early reduction

in muscle mass may be a significant component of the disease in

dystroglycanopathy patients. Indeed in the tibialis anterior and

extensor digitorum longus there was a reduction in fibre size

and number suggesting that myoblast proliferation and/or fusion

has been perturbed. Interestingly a recent in vitro study of satellite

cells derived from a POMGnT1 null mouse was shown to display a

defect in satellite cell proliferation but not fusion (Miyagoe-Suzuki

et al., 2007). A role for dystroglycan in satellite cell function has

also previously been suggested by the relatively mild phenotype

and efficient muscle regeneration of mice with a skeletal mus-

cle fibre specific loss of dystroglycan (MCK-DG-null) which

retain dystroglycan expression in the satellite cell population

(Cohn et al., 2002; Cohn, 2005). However, the relevance of

these latter observations to our own remains to be proven

particularly since the MCK-DG-null mice are devoid of dystrogly-

can (both a and b) rather than the laminin binding epitope of

a-dystroglycan as in our model.

There was a marked reduction in immunolabelling for IIH6 and

laminin a2 in the FKRP-NeoTyr307Asn mice relative to controls,

which demonstrates a muscle phenotype in these mice at postna-

tal day 0 despite the absence of any obvious dystrophic process.

This reduction in IIH6 and laminin a2 is similar to skeletal muscle

biopsies from patients with FKRP mutations, the absence of dys-

trophy in our model is most likely due to their early developmental

stage.

WWS and MEB are both associated with cobblestone (type II)

lissencephaly (Dobyns et al., 1989)—the pathological correlate of

which is neuronal over-migration during neocortex lamination

secondary to defects in the formation or maintenance of the pial

glial limitans (Yamamoto et al., 2004). Our finding that a reduc-

tion in IIH6 immunolabelling at the pial basement membrane of

the FKRP-NeoTyr307Asn mice was associated with the presence of

cells protruding into the sub-arachnoid space and a more diffuse

labelling with other basement membrane markers such as laminin

g1 and perlecan clearly show that the proper glycosylation of

a-dystroglycan is essential for maintaining the integrity of the

pial basement membrane. In the absence of an intact basement

membrane at the pial surface the endfeet of the radial glia fail to

form the glial limitans, which is necessary to anchor the radial glia

scaffold. A similar finding has been reported by Halfter in the

retina where the Mullar glia irreversibly retract after disruption

of the ILM resulting in apoptosis of the retinal ganglion cells

(Halfter et al., 2005). In our model the result of the disrupted

radial scaffold is a mislocalization of the neurons, in particular

the later migrating neurons, within the cerebral cortex.

Our model bears many similarities with others including those

with a targeted deletion of brain dystroglycan (Moore et al.,

2002), integrin b1 (Graus-Porta et al., 2001) and the nidogen

binding site of laminin g1 (Halfter et al., 2002) all of which, in

common with our model, show a disruption in the glial scaffold

as a secondary consequence of defects in the pial-glial limitans.

Interestingly, the fukutin chimeras were reported to show only

localized disorganization of glia contrary to the widespread disrup-

tion that we observed in our mice. Whilst these differences might

relate to the presence of normal cells in fukutin chimeras, more

recent work in the cerebellar cortex of the POMGnT1 null mouse

has noted that alterations in the Bergmann glial scaffold were

prominent where there were localized breaches in the pial base-

ment membrane (Li et al., 2008). Our observations, therefore,

imply that in the FKRP-NeoTyr307Asn mouse there is a more wide-

spread disturbance of the basement membrane rather than the

localized disruption observed in the other models.

MRI studies of patients with FKRP mutations illustrate both the

heterogeneity in the spectrum of brain changes but also a hierar-

chy of severity, with the cerebellum appearing to be the most

vulnerable structure (Mercuri et al., 2006). The Largemyd mutation

is known to affect tangentially migrating neurons just beneath the

pial surface (Qu et al., 2006). Whilst we observed no irregularities

in the external granule cell layer we did note a marked disruption


Dow



ovember 2021

in the RC2 labelled cells and a significant alteration in the conti-

nuity of the cerebellar basement membrane as indicated by lami-

nin a2, g1 and perlecan immunolabelling. We detected only very

low levels of a-dystroglycan using either GT-20 or IIH6 in control

cerebellum labelling which was absent in the FKRP-NeoTyr307Asn

mice. This suggests, as was seen with the ILM of the eye, that

epitopes other than IIH6 mediate binding to the extracellular

matrix in this part of the brain. The finding that RC2 labelling

was disturbed demonstrates the functional relevance of these

findings to further cerebellar development (Fig. 7).

Eye abnormalities are associated with the more severely affected

secondary dystroglycanopathy disorders such as WWS and MEB

where patients have displayed cataract and opacity of the crystal-

line lens and other posterior chamber defects. The ILM is a base-

ment membrane which effectively separates the retina from the

vitreous body (Candiello et al., 2007) and contains proteins such

as perlecan, collagen IV, laminin-1, nidogen, agrin and collagen

XVIII. Its mechanical strength together with that of the basement

membranes of the ocular vasculature are known to be essential for

normal eye development (Halfter et al., 2005; Candiello et al.,

2007). Enzymatic disruption of the ILM in the chick retina has

been shown to induce irreversible reaction of the glial endfeet

(Halfter et al., 2005). We observed a marked disorganization

of the ILM in the newborn FKRP-NeoTyr307Asn mice which

was associated with an invasion of cells into the vitreous.

Interestingly, whilst dystroglycan was present in the ILM of

controls as detected with the antibody (GT20) this basement

membrane did not label with IIH6. The goat polyclonal GT-20

was raised against the entire dystroglycan glycoprotein complex

and purified against a hypoglycosylated full-length a-dystroglycan

human fusion protein expressed in HEK-293 cells. This antibody

recognizes a form of a-dystroglycan that migrates as a 120 kDa

band on Western blot (Michele et al., 2002). As reported by

others, laminin a2 is not present in the ILM. Several different

dystroglycan isoforms have previously been reported in the adult

rat eye, including that identified by IIH6 which contrasts with the

observed absence of IIH6 staining in the FKRP-NeoTyr307Asn neo-

natal retina (Moukhles et al., 2000). The observations presented in

this article focus on the neonatal mouse eye and it is unclear at

this juncture whether the presence or absence of the IIH6 epitope

at the ILM is a developmental, species or strain specific difference.

Our observations are therefore particularly relevant since they

show for the first time that a disruption of the basement mem-

brane in these mice may be caused by the absence of an epitope

distinct from that identified by IIH6, and a ligand other than lami-

nin a2.

Fukutin chimera mice show various eye anomalies such as lens

opacification, disorganization of the retinal laminar and also retinal

detachment and misfolding (Takeda et al., 2003). The POMGnT1

null mice and the Largemyd mice also have an eye phenotype

including thinner inner and outer neuroblastic layers (Liu et al.,

2006). Despite the disruption in the ILM in FKRP-NeoTyr307Asn

mice, we noted no marked alteration in the thickness of the neu-

roblastic layers suggesting that such changes are most likely man-

ifested during postnatal growth of the retina.

In conclusion, we have demonstrated that it is a reduction in

Fkrp transcript levels that give rise to structural eye, brain and

muscle abnormalities rather than the presence of missense muta-

tions—at least with respect to the mutation (FkrpTyr307Asn) that we

have introduced. Given that our mutation gives rise to a severe

muscle eye brain disease in the homozygous condition it seems

highly likely that other missense mutations associated with milder

phenotypes will also fail to give rise to a phenotype in the mouse.

In summary, this mouse represents a unique model in which to

investigate future therapeutic options in the dystroglycanopathies.

AcknowledgementsWe gratefully acknowledge the support from the Medical

Research Council (UK), Muscular Dystrophy Campaign (UK),

Association Francaise contres les Myopathies (AFM) and

Muscular Dystrophy Association (USA).

ReferencesBalci B, Uyanik G, Dincer P, Gross C, Willer T, Talim B, et al. An auto-

somal recessive limb girdle muscular dystrophy (LGMD2) with mild

mental retardation is allelic to Walker-Warburg syndrome (WWS)

caused by a mutation in the POMT1 gene. Neuromuscul Disord

2005; 15: 271–5.Barresi R, Campbell KP. Dystroglycan: from biosynthesis to pathogenesis

of human disease. J Cell Sci 2006; 119 (Pt 2): 199–207.

Beltran-Valero DB, Currier S, Steinbrecher A, Celli J, van Beusekom E,

van der ZB, et al. Mutations in the O-mannosyltransferase

gene POMT1 give rise to the severe neuronal migration disorder

Walker-Warburg syndrome. Am J Hum Genet 2002; 71: 1033–43.

Beltran-Valero DB, Voit T, Longman C, Steinbrecher A, Straub V,

Yuva Y, et al. Mutations in the FKRP gene can cause muscle-eye-

brain disease and Walker-Warburg syndrome. J Med Genet 2004;

41: e61.

Brockington M, Blake DJ, Prandini P, Brown SC, Torelli S, Benson MA,

et al. Mutations in the fukutin-related protein gene (FKRP) cause a

form of congenital muscular dystrophy with secondary laminin

alpha2 deficiency and abnormal glycosylation of alpha-dystroglycan.

Am J Hum Genet 2001; 69: 1198–209.

Brockington M, Torelli S, Prandini P, Boito C, Dolatshad NF, Longman C,

et al. Localization and functional analysis of the LARGE family of

glycosyltransferases: significance for muscular dystrophy. Hum Mol

Genet 2005; 14: 657–65.

Brockington M, Yuva Y, Prandini P, Brown SC, Torelli S, Benson MA,

et al. Mutations in the fukutin-related protein gene (FKRP) identify

limb girdle muscular dystrophy 2I as a milder allelic variant of

congenital muscular dystrophy MDC1C. Hum Mol Genet 2001; 10:

2851–9.Brown SC, Torelli S, Brockington M, Yuva Y, Jimenez C, Feng L, et al.

Abnormalities in alpha-dystroglycan expression in MDC1C and

LGMD2I muscular dystrophies. Am J Pathol 2004; 164: 727–37.

Candiello J, Balasubramani M, Schreiber EM, Cole GJ, Mayer U,

Halfter W, et al. Biomechanical properties of native basement

membranes. FEBS J 2007; 274: 2897–908.

Clement EM, Godfrey C, Tan J, Brockington M, Torelli S, Feng L, et al.

Mild POMGnT1 mutations underlie a novel limb-girdle muscular

dystrophy variant. Arch Neurol 2008; 65: 137–41.

Cohn RD. Dystroglycan: important player in skeletal muscle and beyond.

Neuromuscul Disord 2005; 15: 207–17.

Cohn RD, Henry MD, Michele DE, Barresi R, Saito F, Moore SA, et al.

Disruption of DAG1 in differentiated skeletal muscle reveals a role for

dystroglycan in muscle regeneration. Cell 2002; 110: 639–48.


Dow



ovember 2021

Dobyns WB, Pagon RA, Armstrong D, Curry CJ, Greenberg F, Grix A,

et al. Diagnostic criteria for Walker-Warburg syndrome. Am J Med

Genet 1989; 32: 195–210.Godfrey C, Clement E, Mein R, Brockington M, Smith J, Talim B, et al.

Refining genotype phenotype correlations in muscular dystrophies with

defective glycosylation of dystroglycan. Brain 2007; 130: 2725–35.Graus-Porta D, Blaess S, Senften M, Littlewood-Evans A, Damsky C,

Huang Z, et al. Beta1-class integrins regulate the development of

laminae and folia in the cerebral and cerebellar cortex. Neuron

2001; 31: 367–79.

Halfter W, Dong S, Schurer B, Ring C, Cole GJ, Eller A. Embryonic

synthesis of the inner limiting membrane and vitreous body.

Invest Ophthalmol Vis Sci 2005; 46: 2202–9.

Halfter W, Dong S, Yip YP, Willem M, Mayer U. A critical function of

the pial basement membrane in cortical histogenesis. J Neurosci 2002;

22: 6029–40.

Holzfeind PJ, Grewal PK, Reitsamer HA, Kechvar J, Lassmann H,

Hoeger H, et al. Skeletal, cardiac and tongue muscle pathology, defec-

tive retinal transmission, and neuronal migration defects in the

Large(myd) mouse defines a natural model for glycosylation-deficient

muscle - eye - brain disorders. Hum Mol Genet 2002; 11: 2673–87.Kobuke K, Piccolo F, Garringer KW, Moore SA, Sweezer E, Yang B, et al.

A common disease-associated missense mutation in alpha-sarcoglycan

fails to cause muscular dystrophy in mice. Hum Mol Genet 2008; 17:

1201–13.

Lewandoski M, Martin GR. Cre-mediated chromosome loss in mice. Nat

Genet 1997; 17: 223–5.

Li X, Zhang P, Yang Y, Xiong Y, Qi Y, Hu H. Differentiation and devel-

opmental origin of cerebellar granule neuron ectopia in protein

O-mannose UDP-N-acetylglucosaminyl transferase 1 knockout mice.

Neuroscience 2008; 152: 391–406.

Liu J, Ball SL, Yang Y, Mei P, Zhang L, Shi H, et al. A genetic model

for muscle-eye-brain disease in mice lacking protein O-mannose

1,2-N-acetylglucosaminyltransferase (POMGnT1). Mech Dev 2006;

123: 228–40.Longman C, Brockington M, Torelli S, Jimenez-Mallebrera C, Kennedy C,

Khalil N, et al. Mutations in the human LARGE gene cause MDC1D, a

novel form of congenital muscular dystrophy with severe mental

retardation and abnormal glycosylation of alpha-dystroglycan. Hum

Mol Genet 2003; 12: 2853–61.

Lundkvist J, Zhu S, Hansson EM, Schweinhardt P, Miao Q, Beatus P,

et al. Mice carrying a R142C Notch 3 knock-in mutation do not

develop a CADASIL-like phenotype. Genesis 2005; 41: 13–22.

MacLeod H, Pytel P, Wollmann R, Chelmicka-Schorr E, Silver K,

Anderson RB, et al. A novel FKRP mutation in congenital muscular

dystrophy disrupts the dystrophin glycoprotein complex.

Neuromuscul Disord 2007; 17: 285–9.

Mercuri E, Topaloglu H, Brockington M, Berardinelli A, Pichiecchio A,

Santorelli F, et al. Spectrum of brain changes in patients with conge-

nital muscular dystrophy and FKRP gene mutations. Arch Neurol 2006;

63: 251–7.

Meyers EN, Lewandoski M, Martin GR. An Fgf8 mutant allelic series

generated by Cre- and Flp-mediated recombination. Nat Genet

1998; 18: 136–41.Michele DE, Barresi R, Kanagawa M, Saito F, Cohn RD, Satz JS, et al.

Post-translational disruption of dystroglycan-ligand interactions in con-

genital muscular dystrophies. Nature 2002; 418: 417–22.

Michele DE, Campbell KP. Dystrophin-glycoprotein complex: post-trans-lational processing and dystroglycan function. J Biol Chem 2003; 278:

15457–60.

Miyagoe-Suzuki Y, Miyamoto K, Saito F, Matsumura K, Manya H,

Endo T, et al. POMGnT1-null myoblasts poorly proliferate in vitro.Neuromuscul Disord 2007; 17: 873.

Moore SA, Saito F, Chen J, Michele DE, Henry MD, Messing A, et al.

Deletion of brain dystroglycan recapitulates aspects of congenital mus-

cular dystrophy. Nature 2002; 418: 422–5.Moukhles H, Roque R, Carbonetto S. alpha-dystroglycan isoforms are

differentially distributed in adult rat retina. J Comp Neurol 2000;

420: 182–94.Muntoni F, Brockington M, Torelli S, Brown SC. Defective glycosylation

in congenital muscular dystrophies. Curr Opin Neurol 2004; 17:

205–9.

Muntoni F, Voit T. The congenital muscular dystrophies in 2004: a cen-tury of exciting progress. Neuromuscul Disord 2004; 14: 635–49.

Nagy A, Moens C, Ivanyi E, Pawling J, Gertsenstein M,

Hadjantonakis AK, et al. Dissecting the role of N-myc in development

using a single targeting vector to generate a series of alleles. Curr Biol1998; 8: 661–4.

Qu Q, Crandall JE, Luo T, McCaffery PJ, Smith FI. Defects in tangential

neuronal migration of pontine nuclei neurons in the Largemyd mouse

are associated with stalled migration in the ventrolateral hindbrain. EurJ Neurosci 2006; 23: 2877–86.

Sewry CA, Philpot J, Mahony D, Wilson LA, Muntoni F, Dubowitz V.

Expression of laminin subunits in congenital muscular dystrophy.Neuromuscul Disord 1995; 5: 307–16.

Sherratt TG, Vulliamy T, Strong PN. Evolutionary conservation of the

dystrophin central rod domain. Biochem J 1992; 287 (Pt 3): 755–9.

Sveen ML, Schwartz M, Vissing J. High prevalence and phenotype-genotype correlations of limb girdle muscular dystrophy type 2I in

Denmark. Ann Neurol 2006; 59: 808–15.

Takeda S, Kondo M, Sasaki J, Kurahashi H, Kano H, Arai K, et al.

Fukutin is required for maintenance of muscle integrity, cortical histio-genesis and normal eye development. Hum Mol Genet 2003; 12:

1449–59.

Toda T. [Fukutin, a novel protein product responsible for Fukuyama-typecongenital muscular dystrophy]. Seikagaku 1999; 71: 55–61.

van Reeuwijk J, Grewal PK, Salih MA, Beltran-Valero de BD,

McLaughlan JM, Michielse CB, et al. Intragenic deletion in the

LARGE gene causes Walker-Warburg syndrome. Hum Genet 2007;121: 685–90.

van Reeuwijk J, Janssen M, van den Elzen C, Beltran-Valero de BD,

Sabatelli P, Merlini L, et al. POMT2 mutations cause alpha-

dystroglycan hypoglycosylation and Walker-Warburg syndrome.J Med Genet 2005; 42: 907–12.

Yamamoto T, Kato Y, Karita M, Kawaguchi M, Shibata N, Kobayashi M.

Expression of genes related to muscular dystrophy with lissencephaly.

Pediatr Neurol 2004; 31: 183–90.Yanagisawa A, Bouchet C, Van den Bergh PY, Cuisset JM, Viollet L,

Leturcq F, et al. New POMT2 mutations causing congenital muscular

dystrophy: identification of a founder mutation. Neurology 2007; 69:1254–60.

Yoshida A, Kobayashi K, Manya H, Taniguchi K, Kano H, Mizuno M,

et al. Muscular dystrophy and neuronal migration disorder caused by

mutations in a glycosyltransferase, POMGnT1. Dev Cell 2001; 1:717–24.


Dow



ovember 2021

reduced expression of fukutin related protein in mice results - brain

Documents