rationale protein engineering of tip1/tip1lig interaction
TRANSCRIPT
Rationale protein engineering of Tip1/Tip1lig interaction to improve
CutA-Tip1/CutA-S-SH3lig-L-Tip1lig protein hydrogel
Ivan Felipe Barrera Rincón
Universidad de los Andes
Facultad de Ingeniería
Departamento de Ingeniería Química
Bogotá D.C.
2013
Rationale protein engineering of Tip1/Tip1lig interaction to improve
CutA-Tip1/CutA-S-SH3lig-L-Tip1lig protein hydrogel
Ivan Felipe Barrera Rincón
Monografía para optar a título de Profesional en Ingeniería Química
Asesora: Dra. Zhilei Chen, Texas A&M University
Co-asesor: Carlos Garnica, Universidad de los Andes
Universidad de los Andes
Facultad de Ingeniería
Departamento de Ingeniería Química
Bogotá D.C
2013
Este proyecto es dedicado a mis papas,
mis hermanos, mi familia
AGRADECIMIENTOS
El autor quiere expresar sus agradecimientos a:
A mis papas por su apoyo económico y sobretodo moral n este proyecto, a
la Dra Dongli Guan y el candidato a doctorado Miguel Ramírez por su apoyo
intelectual en el proyecto. A mis amigos por su apoyo moral
CONTENIDO
Pág
1. Introducción. 1
2. Diseño de un nuevo hidrogel. 2
2.1. Introducción del fragmento SH3. 3
2.2. Introducción del fragmento S. 3
2.3. Introducción del fragmento L. 4
3. Métodos. 5
3.1. Construcción del vector de expresión MalE-L-Tip1. 5
3.2. Construcción del vector de expresión GFP-L-Tip1lig. 5
3.3. Mutación del vector de expresión MalE-L-Tip1. 6
3.4. Mutación del vector de expresión GFP-L-Tip1lig. 6
3.5. Expresión de las proteínas. 6
3.6. Purificación de las proteínas. 6
3.7. Formación del hidrogel 7
3.8. Prueba de reología. 7
3.9. Prueba de erosión. 7
3.10. Pruebas de debilitamiento de la unión 7
4. Resultados y Discusión 7
4.1. Expresión y purificación de la proteína CutA-Tip1. 7
4.2. Expresión y purificación de la proteína CutA-S-SH3-L-Tip1lig. 8
4.3. Formación del hidrogel e inmovilización de la proteína SH3-L-GFP. 9
4.4. Prueba de reología. 9
4.5. Prueba de erosión. 11
4.6. Mutaciones de las proteínas Tip1 y Tip1lig. 12
4.7. Experimentos de debilitamiento de la unión 13
5. Conclusiones. 14
6. Trabajo futuro. 15
7. Agradecimientos. 15
8. Bibliografía. 15
LISTA DE TABLAS
Pág
1. Tabla1. Análisis cuantitativo de los experimentos de debilitamiento de
la unión 14
LISTA DE FIGURAS
Pág
1. Figura 1. Dominios usados para la formación del hidrogel. 4
2. Figura 2. Construcción de los bloques de ensamblaje. 4
3. Figura 3. Estructura propuesta para la red del hidrogel. 4
4. Figura 4. Construcciones para los experimentos de unión de
Tip1/Tip1lig. 5
5. Figura 5. Purificación de la proteína CutA-Tip1. 8
6. Figura 6. Purificación de la proteína CutA-S-SH3-L-Tiplig. 8
7. Figura 7. Formación del hidrogel. 9
8. Figura 8. Test de reología para el hidrogel CutA-Tip1/CutA-S-SH3-
L-Tip1lig 9
9. Figura 9. Test de reología para el hidrogel CutA-Tip1/CutA-S-SH3-
L-Tip1lig, datos inconsistentes. 10
10. Figura 10. Test de erosión para el hidrogel CutA-Tip1/CutA-S-SH3-
L-Tip1lig, 11
11. Figura 11. Análisis tridimensional Tip1. 11
12. Figura 12. Análisis tridimensional mutaciones Tip1/Tip1lig. 12
13. Figura 13. Experimentos de debilitamiento de la unión, diluciones. 13
14. Figura 14. Experimentos de debilitamiento de la unión, diluciones
comparando mutación T58C-D-3C y sin mutación . 14
15. Figura 15. Experimentos de debilitamiento de la unión bajo luz UV. 14
16. Figura A1. Geles de ensayos de unión WT. 17
17. Figura A2. Geles de ensayos de unión L-7C. 18
18. Figura A3. Geles de ensayos de unión D-3C. 18
19. Figura A4. Geles de ensayos de unión C+1. 19
LISTA DE ANEXOS
Pág
1. Anexo A. Ensayos de unión 17
2. Anexo B. Resultados de secuenciación 20
Pág
ina1
1 INTRODUCTION
A hydrogel can be described as a three-
dimensional network cross-linked physically or co-
valently (Banta, Wheeldon, & Blenner, 2010) be-
cause of its hydrophilic nature these materials have a
high physical, chemical and mechanical stability in
its swollen state (Ottenbrite, Park, & Okano, 2010).
There are a widely known synthesis methods for
such materials including cross-linking, co-
polymerization, cross-linking of reactive polymer
precursors and cross-linking via polymer-polymer
reaction and others, nonetheless, these methods were
lack on their detailed structure control (Barbucci,
2009)
Polymeric hydrogels have attracted much atten-
tion and have been applied in many fields because of
their sensitivity to environmental stimuli such as
temperature, pH, pressure, ionic strength and electric
fields. However, the application of the conventional
polymeric hydrogels is often limited because of the
low gel strength or the poor stability of the hydrogel
(Weian, Wei, & Yue'e, 2005). These traditional
methods for polymeric hydrogels does not allow an
exact control of the some structure properties such
as chain length and sequence, although some new
developments in radical polymerization allow to get
a more accurate performance in chain length, some
of these methods require catalyst such as metal tran-
sition complex or different process conditions
(Deming, 2006)
In addition, some of the chemical cross-linking
are toxic or result in non-injectable hydrogels (Foo,
Lee, Mulyasasmita, Parisi-Amon, & Heilshorn,
2009) which is an important criterion for noninva-
sive cell, drug delivery or other bioengineering ap-
plications. As a result researches have used a variety
of amino acid sequences which fold into three-
dimensional forms and shapes, which are called do-
mains, for hydrogel formation (Banta, Wheeldon, et
al., 2010)
These protein-based hydrogel are ideal materials
for implantation because they introduce low levels
of foreign matter into the body and allow high diffu-
sivity of bio-molecules, they also provide a good
environment for molecular-level biological interac-
tions and inert surfaces that prevent nonspecific ad-
sorption of proteins (Brandl, Sommer, &
Goepferich, 2007). Furthermore, many biological
molecules can be covalently incorporated into hy-
drogel structures, and mechanical properties can be
tunable, like elasticity which can be modified by
changing cross-link densities (Ulijn et al., 2007)
Rationale protein engineering of Tip1/Tip1lig interaction to improve CutA-Tip1/CutA-S-SH3lig-L-Tip1lig protein hydrogel
I.F. Barrera R. Chemical engineering department. Universidad de los Andes, Bogotá, Colombia.
Z. Chen Advisor, Texas A&M University, College Station, Texas.
RESUMEN: Un nuevo hidrogel a base de proteínas fue desarrollado en el laboratorio, a través de la ingeniería de proteínas varios dominios y fragmentos fueron unidos para formar dos proteínas base. Estas proteínas de-mostraron comportarse como un hidrogel bifuncional, exhibiendo propiedades de auto ensamblaje y bioacti-vidad. Sin embargo las propiedades reológicas y los perfiles de erosión confirmaron la debilidad del hidrogel. Por esta razón la interacción entre los dominios Tip1/Tip1lig fue analizada y tres mutaciones de cada proteína fueron propuestas para aumentar la fuerza de enlace. De todas las mutaciones propuestas un par demostró mejorar la interacción de estas dos proteínas.
ABSTRACT: A new protein-based hydrogel is proposed and developed; the backbone proteins engineered perform as a bifunctional hydrogel, showing self-assembling and bioactive properties. Nonetheless the me-chanical properties and erosion profiles of confirmed the weakness of the assembled hydrogel. For that reason rationale designs was used to engineering Tip1/Tip1lig interaction and enhance its strength. Three mutations for each protein was proposed from which one pair demonstrate improvements in the binding interaction
Pág
ina2
As a result potential application of protein-based
hydrogels are tissue engineering (Mooney & Drury,
2003), drug delivery, synthetic extracellular matrix,
implantable devices(Peppas, Hilt, Khademhosseini,
& Langer, 2006), separation systems (Eddington &
Beebe, 2004), materials controlling the activity of
enzymes (Banta, Lu, & Wheeldon, 2010), nanoreac-
tors with precisely placed reactive groups in three-
dimensional space, and energy conversion systems.
Due to some domains which have a temperature, pH
or other external stimuli-response they may be used
as biosensors (Hoffman, 2002).
Some protein domains interactions can be used to
create self-assembling proteins backbones (Banta,
Lu, et al., 2010) hydrogels may self-assemble from
those backbones driven by hydrophobic interactions.
In addition the fact that self-assembly proteins into
hydrogels take place in aqueous environments at
physiological conditions gives a great variety of ap-
plications. The goal is to develop in situ self-
assembling hydrogels suitable for the delivery of a
wide range of biologically active compounds
(Kopecek, 2007).
There is also a new trend of design bifunctional
protein building blocks (Wheeldon, Gallaway,
Barton, & Banta, 2008), these blocks take advantage
of the secondary and tertiary structure of a biofunc-
tional protein to form a hydrogel. Examples of such
proteins are enzymatic, optically active and signal-
ing protein which will self-assemble into supramo-
lecular structures (Wheeldon, Barton, & Banta,
2007). These hydrogels have the advantage of being
tunable not just its physical properties but also bio-
activities.
Protein-based hydrogel are also well known by
the potential for the formation of precisely defined
three-dimensional structures (Kopecek, 2007). Be-
cause there are many domains and peptide motif
with interesting binding properties, with structures
that suffer conformation changes, and that have
complex functions, it gives an opportunity for diver-
sity in protein backbones. Thus far, the protein do-
mains and peptide motifs used in responsive materi-
als have been quite successful in imparting specific
and controllable action (Banta, Wheeldon, et al.,
2010).
Given the diversity of motif and domains which
are the reason of the responsive action (or ‘smart’
phenomena), manipulation of such domain can be
used to control hydrogel properties. Using protein
engineering it is allowed to manipulate natural or ar-
tificial DNA sequences encoding the amino acid se-
quence of interest, and then the subsequent biologi-
cal production of the translated protein (Van Hest &
Tirrell, 2001). This methodology allows an exact
control in the residue sequence and consequently an
exact control in the folding pattern of the protein.
Consequently temperature or pH- responsiveness
may be achieved or improved by manipulation of the
amino acid sequence of the domains: minor modifi-
cations have a strong impact in macro-properties,
stimuli-sensitive and/or self-assembled hydrogels
(Banta, Wheeldon, et al., 2010)
2 DESIGN OF A NEW HYDROGEL
Different strategies for protein hydrogel for-mation have been used, from leucine zippers coiled coils, camodulin, elastin to elastin-like peptides, some of those strategies draw upon of domain spe-cific ligand binding, conformational change, physi-cal cross-linking or phase change to achieve and hy-drogel formation (Banta, Wheeldon, et al., 2010). More specific strategies use self-assembling proteins as building blocks to assemble the hydrogel.
One of the most promising protein domains is the
CutA which is believed to take an active role in heavy metal control in microorganism by binding cupric ions (Tanaka et al., 2004). CutA protein is a stable triangular-shaped trimer which has the ad-vantage of having its C-terminus in the apex of the triangle (Ito et al., 2010). This C-terminus can be fuse by protein engineering to another self-assembling protein or a binding protein to form a building block which is able to form a hydrogel.
Researchers had fused CutA domain to Tip1 mo-
tif (Ito et al., 2010). Tip1 is a protein which is formed by a single PDZ domain (Durney, Birrane, Anklin, Soni, & Ladias, 2009). The PDZ domains are believed to play an important role in signaling, scaffolding (Gianni et al., 2005) and attaching pro-teins to the cytoskeleton (Wiedemann et al., 2004). PDZ domains usually attach to the C termini of their target proteins. A PDZ recognizing peptide had been designed to specifically binding Tip1 protein and the it was attached to a four armed poly(ethylene glycol)
Pág
ina3
or PEG. In this way tri-functional CutA-Tip1 and quadri-functional PEG-peptide were used to assem-ble a hydrogel spontaneously after stoichiometric mixture (Ito et al., 2010).
CutA-Tip1/Tip1lig-PEG hydrogel has unique
characteristics such as shear stress solution to gel behavior, that is, at low shear stress rates it performs as a gel, but at higher stress rates behaves as a solu-tion and vice versa, which make it a potential inject-able tissue-engineering application. It is also pre-sented as a good matrix for cell entrapment and it was shown a relative homogeneous dispersion of cells (Ito et al., 2010).
Although trimeric structure of wild type CutA,
four-armed PEG, and Tip1-peptide binding was used for hydrogel formation, it presents a weak perfor-mance: its transition from gel to solution is given at an angular frequency of 0.8 rad/s (0.13 s
-1) which is
really low. CutA-Tip1/Tip1lig-PEG hydrogel was designed for cell entrapment, but cells were not completely able to adhere to the matrix and they were properly dispersed just in an x-y plane, round cells were shown as the only ones to attach to the matrix (Ito et al., 2010). Also, the Tip1lig-PEG block is mainly formed by the PEG polymer which may introduce foreign matter for injectable applica-tions
In order to achieve a stronger structure and bi-
functional hydrogels that will be able to achieve not only self-assembling properties but bioactive proper-ties as well (Wheeldon et al., 2007) a new hydrogel should be designed. In the first place with the inten-tion of minimize any foreign matter, PEG polymer was remove from the hydrogel structure, therefore, CutA trimeric structure was conserved for both building blocks. Tip1/Tip1lig interaction was pre-served as the hydrogel formation trigger upon mix-ing of the two building constructs, in this way these two interactions (trimer structure of CutA and Tip1/Tip1lig binding interaction) will achieve self-assembling properties.
2.1 Introducing SH3 fragment
Aiming a bioactive hydrogel an anchoring protein strategy was addressed. In this methodology a pro-tein-protein interaction domain is used to anchor the target protein to the matrix, in this way one of the protein interacting domains is attached to the matrix in which the target want to be immobilized. In the other hand the recognizing domain is connected to
the target protein and by ligand specificity the target protein is immobilized into the matrix.
One of the most suitable protein domains which
have been already used for scaffolding is the SH3 motif. This domain allows protein attachment and has been successfully used for enzyme anchoring (Dueber et al., 2009). The SH3 is a domain formed by a β-sandwich consisting of five strands, three loops and a short helix (Saksela & Permi, 2012), this domain is believed to take role in signaling proteins bind proline-enriched sequences of the type P-x-xP (with x, any residue) (Morton et al., 1996). This pro-tein domain has a high affinity for its ligand peptide and could be docked in two opposite directions de-pending whether a positive charge is located at the beginning of the binding sequence or at the end of the sequence (+xxPxxP or xPxxPx+) (Saksela & Permi, 2012)
For these reasons anchoring protein domain SH3
and its ligand was selected for being used at the bio-active hydrogel backbone. Given spatial restrictions the ligand is the only one which is included in the protein backbone and it is present in just one of the two assembling blocks. In this way target protein (for example an enzyme) can be attached to the SH3 domain and then immobilized in the hydrogel matrix through binding to the SH3ligand motif present in the hydrogel backbone.
2.2 Introducing S fragment
On the other hand given that the hydrogel synthe-sized by Ito (Ito et al., 2010) was designed for cell entrapment the backbone structure needed to be changed aiming a more general protein/enzyme im-mobilization matrix, assembling blocks have to be designed to accommodate large proteins and so the porous size needed to be expanded. To do so a new section has to be added to the protein backbone. The S fragment is a widely used fragment for protein hy-drogel assembling (Shen, Zhang, Kornfield, & Tirrell, 2006) which accomplishes all the require-ments for our hydrogel design.
The S fragment is a random coil midblock which
usually is used at neutral pH or biological pH (Shen, Kornfield, & Tirrell, 2007). This random coil usual-ly works as a bridge in the constructs when the bio-active domains participate in different network asso-ciations (Shen, Lammertink, Sakata, Kornfield, & Tirrell, 2005). The S fragment is also well know for enhance the solubility of the protein construct
Pág
ina4
(Banta, Lu, et al., 2010), this is due to lack on regu-lar secondary structure preventing precipitation un-der aggregation favoring conditions (Shen et al., 2005). For these reasons the S fragment was includ-ed in one of the protein backbones to increase matrix solubility and act as a bridge for the bioactive pro-tein domains increasing the porous size of the ma-trix.
2.3 Introducing L fragment
In the final phase of the hydrogel designing, with the requirements fulfilled, one more element was added to the protein backbones: it is a linker struc-ture designed to ensure proper performance of the bioactive domains, keeping away one from each other to avoid malfunctioning. This linker was added between SH3lig domain and Tip1lig domain to guarantee a good yield of bioactivity of these two essential domains for the hydrogel structure.
In figure 1 it is shown a graphic abstract of the
domains used for the design of the hydrogel pro-posed. It is important to notice that the size or shape of each domain shown does not have any relation with the actual size or shape of each domain; it is just for explanatory purposes. In figure 2 each pro-tein backbone is shown as a descriptive shape: In first place it is shown the construct CutA-S-SH3lig-L-Tip1lig, this construct is intended to have the im-mobilization site for the target protein/enzyme and enhance the solubility of the matrix, it includes the same binding peptide for Tip1 used by (Ito et al., 2010), this construct is shown in its monomeric form. In the other hand, it is the CutA-Tip1 protein which is also presented in its monomeric form, this protein also follow the structure presented by (Ito et al., 2010). Finally it is the SH3-protein/enzyme complex which is used for immobilization in the ma-trix, it is important to notice that depending of the application the protein/enzyme immobilized can change (this means the hydrogel matrix can be use-
Figure 1 Domains used for the hydrogel formation: a) Trimeric structure of CutA; b) Tip1/Tip1lig interaction; c) SH3/SH3lig in-
teraction; d) S fragment; e) Linker (L) fragment; f) Target protein/enzyme for immobilization
Figure 2 Constructs for assembling blocks: a) CutA-S-SH3lig-
L-Tip1lig; b) CutA-Tip1; c) SH3-Target protein
Figure 3 Proposed structure for hydrogel network
Pág
ina5
ful for many hydrogel applications depending the protein/enzyme immobilized). In figure 3 a rationale arrangement of the network structure for the hydro-gel formation is proposed, the trimeric nature of Cu-tA protein work as a junction point in the network, while the other bioactive domains (such as Tip1/Tip1lig) complete the unification of the net-work and the immobilization of the target pro-tein/enzyme. This figure reveals the bifunctional na-ture of the hydrogel (bioactive and self-assembling).
After designing the new hydrogel each protein
was successfully expressed and purified individual-ly. In the next step the two protein backbones (Cu-tA-Tip1 and CutA-S-SH3lig-L-Tip1lig) were mixed in order to form the hydrogel, mixes with a target protein and anchoring protein also were tested and hydrogel formation was successfully proved. None-theless, the structure was not strong as it was thought, the hydrogel presented fast erosion rates and it did not have a consistent rheology profile in-dicating weakened hydrogel. For that reason, a ra-tionale design was used to improve the hydrogel properties, through protein engineering disulfide bonds were introduced in the hydrogel structure in order to develop better erosion and rheology profiles as suggested by (Shen et al., 2005). Tip1/Tip1lig in-teraction was thought having the lowest strength of the protein domain interactions used for the hydro-gel formation; this interaction was strengthened through the insertion of disulfide bonds in key resi-dues of the binding site.
Two new constructs were used with the objective
of analyze Tip1/Tip1lig binding interaction. The single PDZ domain protein Tip1 was fused with MalE protein which is a maltose-binding protein (MBP) widely used for affinity chromatography to cross-linked amylose resin (Maina et al., 1988), this domain is also well-known for improving expression level and solubility for target proteins (Eliseev, Alexandrov, & Gunter, 2004). On the other hand Tip1lig peptide was fused with Green Fluorescent Protein (GFP) which is a protein widely use in bio-
logical studies because of its fluorescence, it has been used in the study of the dynamic molecular events within living cells (Pollok & Heim, 1999), but in this study was used in order to recognize Tip1lig peptide binding to the Tip1 protein easily.
To attach one domain to another (MalE to Tip1
and GFP to Tip1lig) and avoid malfunctioning of the fused domains a L fragment was added between the two domains to be attached. In figure 4 a graphic ab-stract model of the constructs is shown.
3 METHODS
3.1 Construction of MalE-L-Tip1 expression vector
Tip1 gene was amplified from a Tip1 containing template by polymerase chain reaction (PCR) with the following primers: F-BamHI-Tip1 5’-AATAT TAGGATCCGTAGTGCAAAGAGTTGAAATTCTAAGTT-3’ (BamHI site underlined) and R-XhoI-Tip1 5’- ATT AATACTCGAGAGACTGCCGAGT CACC-3’ (XhoI site underlined), then Tip1 PCR product was digested with BamHI and XhoI re-striction enzymes to form sticky ends. On the other hand MalE-L encoding vector was used as DNA backbone, and it was digested with BamHI and XhoI restriction enzymes to form sticky ends. Both back-bone and Tip1 insert were mixed and ligated with T4 ligase, transformed in DH5α cells and incubated overnight at 37°C. Colonies containing target vector were grown overnight in LB + antibiotic culture and target vector was isolated using Plasmid recovery kit (OMEGA Bio-Tek). It is important to notice that pI-MalE-L-Tip1 expression vector was designed to have a hexahistidine (His6) tag at the C-terminus of the protein, this way it can be purified by Ni-NTA affinity column.
3.2 Construction of GFP-L-Tip1lig expression vector
Tip1lig encoding primers were prepared by an-nealing; these primers were designed to have sticky ends: NheI-Tip1lig-XhoI 5-CTAGCCAGCTGGCG TGGTTTGATACCGATCTGTGATAAC-3’ (sticky ends underlined) and XhoI-Tip1lig-NheI 5´-TCGAGTTATCACAGATCGGTATCAAACCACGCCAGCTGG-3’(sticky ends underlined). On the other hand GFP-L encoding vector was used as backbone, and it was digested with NheI and XhoI restriction enzymes to form sticky ends. Both back-bone and Tip1lig insert were mixed in 1:10 ratio and
Figure 4 Tip1/Tip1ligand binding analysis constructs: a)
MalE-L-Tip1; b) GFP-L-Tip1lig
Pág
ina6
ligated with T4 ligase, transformed in DH5α cells and incubated overnight at 37°C. Colonies contain-ing target vector were grown overnight in LB + an-tibiotic culture and target vector was isolated using Plasmid recovery kit (OMEGA Bio-Tek)
3.3 Mutation of MalE-L-Tip1 expression vector
In order to analyze Tip1/Tip1lig binding interac-tion and enhance its strength three mutations in Tip1 binding site were proposed; all the mutations replace a residue with cysteine residue with the objective of introduce disulfide bonds in the binding site. The three different mutations proposed were: substitution of a glutamine in the position 39 (Q39C), substitu-tion of an Isoleucine the position 28 (I28C) and a substitution of a Threonine in the position 58 (T58C). All of those mutations were done separately (single mutation). With the intention of introduce the specific desired mutation a site-directed mutagenesis by overlap extension method was addressed; in this strategy two different fragments containing the de-sired mutation are amplified by PCR, then the two fragments are annealed and amplified by PCR to-gether (in this phase is important to remove any primer used to amplify the fragments before). In the last step the whole Tip1 fragment containing the mu-tation is amplified by PCR and digested with BamHI and XhoI restriction enzymes to create sticky ends. Finally mutated Tip1 insert is fused with MalE-L backbone and protocol for ligate, transform and iso-late DNA plasmid is followed as usual. The primers used for site-directed mutagenesis by overlap exten-sion were: for Q39C mutation F 5’-TGGGATCGAC TGCGACCCGTCT-3’ and R 5’-AGACGGGTCGC AGTCGATCCCA-3’; for I28C mutation F 5’- GTG AGAACTTATGCTTGGGCTTCAGTAT-3’ and R 5’- ATACTGAAGCCCAAGCATAAGTTCTCAC-3’; finally for T58C mutation F 5’-GCATTTAC GTCTGCCGAGTATCAGAG-3’ and R 5’- CTCTGATACTCGGCAGACGTAAATGC-3’ (mu-tation sites underlined).
3.4 Mutation of GFP-L-Tip1lig expression vector
Tip1lig binding peptide was also mutated to form disulfide bonds in the Tip1/Tip1lig binding site. For each Tip1 mutation a corresponding Tip1lig muta-tion was designed. The three corresponding muta-tions are: substitution of Leucine in the position -7 (L-7C), addition of a cysteine at the end of the lig-and peptide (C+1) and substitution of an Aspartic Acid in the position -3 (D-3C). Primers containing the specific mutations were designed so they have
sticky ends (as the Tip1lig wild type primers), pri-mers were annealed and fused to GFP-L vector backbone and ligation, transformation and isolation of target plasmid were followed as usual. The pri-mers used for site-directed mutagenesis were: for L-7C mutation F 5’-CTAGCCAGTGCGCGTGGTTT GATACCGATCTGTGATAAC-3’ and R 5’- TCGAGTTATCACAGATCGGTATCAAACCACGCGCACTGG -3’; for C+1 addition F 5’- CTAGC CAGCTGGCGTGGTTTGATACCGATCTGTGCTGATAAC-3’ and R 5’- TCGAGTTATCAGCACA GATCGGTATCAAACCACGCCAGCTGG -3’; fi-nally for T58C mutation F 5’- CTAGCCAGCTGG CGTGGTTTTGCACCGATCTGTGATAAC-3’ and R 5’- TCGAGTTATCACAGATCGGTGCAAAA CCACGCCAGCTGG-3’ (mutation sites underlined, sticky ends in bold).
3.5 Protein expression
For the protein expression E. coli strain BL21 (DE3) competent cells were transformed with the desired plasmid encoding target protein and plated in LB + Agar + antibiotic plate. Competent cells were incubated at 37°C overnight (less than 15 hours). A single colony was picked and grown in 1L LB culture at 37°C and 250 rpm until OD600 reaches ~0.6, then induction took place by adding IPTG to final concentration of 1mM and incubating 16-18 hours at 18°C and 250 rpm. Cultures were centrifuged at 8000 x g for 20 min at 4°C and pellets were stored at -80°C until protein purification.
3.6 Protein purification
Cell pellets were resuspended with 10 ml lysis buffer (0.5 M NaCl, 10 mM Tris-HCl, pH 8.0) per gram wet pellet. Cells were sonicated with a Miso-nix sonicator (model S-400) and lysates were clari-fied by centrifugation at 16000 x g for 20 min at 4°C. Supernatants were collected and loaded into a 5 ml HisTrap SP FF Ni
2+ -NTA affinity column, impu-
rities bound to the column were eluted with wash buffer (85% lysis buffer + 15% elution buffer), while target proteins bound to the column were elut-ed with elution buffer (0.5 M NaCl, 10 mM Tris-HCl, 150 mM Imidazole, pH 8.0). Buffer exchange was carried on with purified protein in 50 kD cut-off spin columns (Millipore Amicol Ultra) until imidaz-ole concentration < 1 mM. For hydrogel backbones proteins buffer exchange was carried either on modi-fied lysis buffer (0.5 M NaCl, 10 mM Tris-HCl, 1mM EDTA, pH 8.0) or HEPES buffer (0.5 M , 10 mM HEPES, 5mM EDTA, pH 8.0) depending on
Pág
ina7
the application and the protein was concentrated to >100 mg/ml. For Tip1/Tip1lig binding analysis pro-teins buffer exchange was carried on lysis buffer (0.5 M NaCl, 10 mM Tris-HCl, pH 8.0).
3.7 Hydrogel formation
For the hydrogel casting, high concentrated back-bone proteins were used. Both backbone proteins (CutA-Tip1 and CutA-S-SH3lig-L-Tip1lig) were always mixed in 1:1 molar ratio. In case of immobi-lization of a target protein, it should be mixed with anchoring containing assembling block (CutA-S-SH3lig-L-Tip1lig) prior the hydrogel formation.
3.8 Rheology test
Hydrogel samples for rheology test were prepared the same day of the analysis; the rheology test was carried out in a modular compact rheometer (Physi-ca mcr 300, Paar Physica). Four experiments were performed in the analysis: In first place a Timed gel formation was carried out, in this test the hydrogel behavior under constant strain and frequency was analyzed, the objective of this experiment is to find if there is any changes in the hydrogel properties within time, it is performed overnight. The second experiment performed is the Frequency Sweep in which frequency is varied between values range from 0.1 to 500 Hz at constant strain rate, the objec-tive of this test is determine the frequency profile of the hydrogel structure, it is possible to determine if the hydrogel is a concentrated solution, a weak gel or a strong gel with this experiment. The third exper-iment is the Strain Sweep in which strain is varied between values range from 0.1 to 100 % at constant frequency, the objective of this test is determine the strain profile of the hydrogel assembling; it is also an objective to establish the break strain in which the hydrogel transforms from gel to solution . Final-ly a Recovery test is performed, in which strain is varied between values range from 0.1 to 100% at a constant frequency, then both strain and frequency remain constant for a short period of time (usually 2 min), and the cycle is repeated 4-5 times, the objec-tive of this test is verify the recovery capacity of the hydrogel structure, this is if the hydrogel losses (or not) strength after diverse reversible breaking cy-cles.
3.9 Erosion test
Hydrogel samples were prepared in small glass vials, Erosion buffer (same buffer in buffer ex-
change was carried out with 0.5% NaN3) was added to glass vials and it was replaced at different time points; erosion buffer was replaced until most (or all) of the gel was destroyed into the buffer. Sam-ples from each removed erosion buffer were taken and analyzed with Nanodrop 1000 spectrophotome-ter (Thermo Scientific) in order to determine the amount of protein coming out at the different time points Percentage of protein eroded was calculated with the volume and concentration of protein into the erosion buffer.
3.10 Pull down experiments
With the objective of analyze Tip1/Tip1lig inter-
action and find out if the mutations proposed either improve or weaken the interaction, a pull down ex-periment was addressed. This experiment was pro-posed taking advantage the MalE-L-Tip1 construct can be purified and bound to a Ni
2+ -NTA affinity
column and the GFP-L-Tip1lig don´t. Purified MalE-L-Tip1 was loaded into a Ni
2+ -NTA affinity
column, in the next step GFP-L-Tip1lig was loaded into the same column so it binds to MalE-L-Tip1 through Tip1/Tip1lig interaction, then several wash steps were followed in order to try to unbound some GFP-L-Tip1lig from the column. Finally both MalE-L-Tip1 and remaining GFP-L-Tip1lig were eluted with elution buffer (0.5 M NaCl, 10 mM Tris-HCl, 150 mM Imidazole, pH 8.0). Several samples of the experiment were analyzed through SDS-PAGE gel and quantification with Quantity One 1-D analysis software ® was made. Photographic record of some steps of the process was made taking advantage of the green color of the GFP-L-Tip1lig protein. The same protocol was addressed with 4x4 combinations of the mutants and wild types proteins. To probe the formation of the disulfide bonds negative controls with DTT, which is a reducing agent known for re-duce disulfide bonds.
4 RESULTS AND DISCUSSION
4.1 CutA-Tip1 Expression and purification
CutA-Tip1 construct was successfully trans-formed and expressed in E. coli strain BL21 (DE3) cell. Multiple purifications were made and about 3.3-3.5 grams of cell pellets were used for each puri-fication. Cell pellets were resuspended, sonicated and clarified following protocol (for details see sec-tion 3.5). Soluble protein was loaded Ni
2+ -NTA af-
Pág
ina8
finity column using a Fast Protein Liquid Chroma-tography (FPLC) machine (BioRad). Column was washed first with about 40-50 mL of lysis buffer and then with 35-40 mL of wash buffer (15% elution
buffer and 85% lysis buffer). Finally CutA-Tip1 was eluted with 22-24 mL of elution buffer and concen-tration was measured and average concentration is about to 3.15 mg/ml giving 69-77 mg of CutA-Tip1 protein per purification. Purified protein was used for buffer exchange in which two different set of di-lutions were used (1:40 and 1:4 to get a total dilution of 1:160), then protein was concentrated about 100-115 mg/ml and about 500 uL of solution was ob-tained (giving a recovery percentage of about 72-75%); several aliquots of 80 uL were prepared, fro-zen and kept at -80°C until hydrogel formation. Some samples of the purification steps were ana-lyzed with SDS-PAGE gel electrophoresis.
It is possible to notice the purity of the target pro-
tein which is about 24.8 kD (monomer), although some impurities are shown, their amounts are not
significant. It has been previously shown that the trimer shows up at about 68 kD (Ito et al., 2010) which is corroborated in Figure 5. However, the tri-mer to monomer ratio is lower than expected (about 4:1) which is a problem for hydrogel formation be-cause only trimers can effectively assemble in an hydrogel network. It is also noticeable the trimer structure is weaker after buffer exchange, it can be perceived that after buffer exchange and diluting in water all the trimers are changed into monomers (Figure 5i), this phenomena is not seen before buffer exchange.
4.2 CutA-S-SH3lig-L-Tip1lig purification
Similar procedure as CutA-Tip1 purification was followed for CutA-S-SH3lig-L-Tip1lig protein puri-fication. Elution solutions of CutA-S-SH3lig-L-Tip1lig were analyzed with Nanodrop spectropho-tometer and concentration was measured, average concentration was about 3.43 mg/ml and volume was about 22-25 ml, giving 75-82 mg of a total Cu-tA-S-SH3lig-L-Tip1lig per purification. Purified protein was used for buffer exchange in a similar way that CutA-Tip1 and the concentrated to 110-130 mg/ml, 500 uL of total volume was obtained giving a recover of 73-80%. Aliquots were prepared, frozen and kept at -80°C and samples of different purifica-tion steps were analyzed by SDS-PAGE electropho-resis.
Purity of CutA-S-SH3lig-L-Tip1lig is confirmed
in Figure 6, although there are some impurities, es-pecially at molecular weights near the trimer region. However, the expected size of the monomer is about 26.2 kD which does not correspond to the monomer band shown in Figure 6 (about 35 kD), this could be explained because of the S fragment included in the protein construct which has been demonstrated in the lab that does not run at its expected size in this kind of gels due to its globular conformation. None-theless, trimer stability was very good; it does not present such weakening after buffer exchange as Cu-tA-Tip1 protein.
Figure 5 CutA-Tip1 protein purification: a) ladder; b) whole
lysate; c) soluble protein; d) flow through; e) wash; f) purified
protein; g) purified protein in water (1:10 dilution); h) purified
protein after buffer exchange; i) purified protein after buffer ex-
change in water (1:10 dilution)
Figure 6 CutA-S-SH3lig-L-Tip1lig protein purification: a)
ladder; b) whole lysate; c) soluble protein; d) flow through; e)
wash; f) purified protein; g) purified protein in water (1:10 dilu-
tion); h) purified protein after buffer exchange; i) purified protein
after buffer exchange in water (1:10 dilution)
Pág
ina9
4.3 Hydrogel formation and SH3-L-GFP immobilization
Purified backbone proteins were used in the hy-drogel formation; about 75 uL of each protein were used for assembling hydrogel, protein concentration was adjusted to 110 mg/ml so that final concentra-
tion of each protein was about 50 mg/ml. Both pro-teins were inserted in a small glass vial and mixed carefully either through pipetting or just slow agita-tion. Figure 7a shows the hydrogel formed and Fig-ure 7b shows inverted hydrogel proving the hydro-gel nature of both assembling blocks together. On the other hand, SH3-L-GFP bioactive protein was immobilized in the hydrogel matrix: first SH3-L-GFP was mixed with purified CutA-S-SH3-L-Tip1lig protein and then purified CutA-Tip1 was added and solution was mixed carefully; hydrogel was prepared so protein backbone proteins final concentration was 40 mg/ml and bioactive protein final concentration was 3 mg/ml. Because of green color of bioactive protein, immobilization can be no-ticed by naked eye, figure 7c and 7d shows the hy-drogel formation and the hydrogel inverted respec-tively; it can be noticed the hydrogel nature of the mixed proteins and effective immobilization of the bioactive protein.
4.4 Rheology test
Purified and concentrated protein backbones were carefully mixed and placed into a modular compact rheometer to analyze the hydrogel rheology; several tests were carried out (for more information refer to
Figure 7 Hydrogel formation: a) Hydrogel backbone proteins
mixed together; b) hydrogel inverted; c) SH3-L-GFP immobilized
in hydrogel; d) bioactive hydrogel inverted
Figure 8 Rheology test for CutA-Tip1/CutA-S-SH3lig-L-Tip1lig hydrogel: a) Timed gel formation; b) frequency sweep; c) strain
sweep; d) recovery test
Pág
ina1
0
section 3.8) and results are shown in Figure 8. From Figure 8a it is possible to conclude that the mixed solution becomes an hydrogel after about 250 min (4 hours), because the storage modulus becomes higher than the loss modulus; this indicates that the elastic behavior (which gives information about energy dis-sipated in form of heat during deformation) is more relevant than the viscous behavior (which represents energy stored in material during deformation) (Ottenbrite et al., 2010). It can me notice that the strength of the hydrogel increases while the time goes by and reaches its maximum at about 1000 minutes (18 hours), this is an unexpected and until today, unexplained phenomena because hydrogel strength should remain constant within time.
On the other hand the frequency (or mechanical)
spectra (Figure 8b )shows a relative independence of both modulus upon frequency, this behavior is typi-cal of an hydrogel and because of the Storage modu-lus is barely 10 times higher than the loss modulus, it can be classified as a weak hydrogel (Ottenbrite et al., 2010)
Figure 8c shows the strain spectra for the hydro-gel, it is noticed that at low strain percentage the mix conserve its hydrogel nature, but at high strain per-centage the mix becomes a solution (loss modulus is higher than the storage modulus). The break point is given at 45% strain, which is low compared with previous results of other hydrogel constructs devel-oped in the lab in which the break point is about 130% strain.
Finally the recovery results are shown in Figure
8d, it can be observed the hydrogel has good recov-ery properties because it conserve its strength after several reversible breaking cycles: at low strain per-centage the mix behaves as an hydrogel and while the strain increases the hydrogel breaks into a solu-tion, when strain percentage is lowered the solution becomes an hydrogel again, this behavior is particu-larly appropriate for injectable hydrogels (Ito et al., 2010) & (Tan, Chu, Payne, & Marra, 2009)
However, when the rheology experiments are re-
tested with different hydrogel samples with the same concentration and casting protocol, the results are not consistent. Figure 9 shows the results for a dif-
Figure 9 Rheology test for CutA-Tip1/CutA-S-SH3lig-L-Tip1lig hydrogel, inconsistent data: a) Timed gel formation; b) frequen-
cy sweep; c) strain sweep; d) recovery test
Pág
ina1
1
ferent hydrogel sample; the first thing noticed is the difference between Figure 8a and Figure 9a, in the last one a sudden formation of a gel at 1000 min (18 hours) which is slower than the previous results, also the gradual increase of the hydrogel strength is not shown.
For the mechanical spectra and strain spectra
(Figures 9 b and 9c) the trend is the same as the pre-vious results, nonetheless there are discrepancies in the data; for the frequency spectra the mix still pre-sent a characteristic weak gel spectra but the numer-ical values are different (about 100 fold difference), actually the numerical shown in Figure 9 are more comparable with those obtained for (Ito et al., 2010). Also for the strain spectra the breaking point shown in Figure 9 is 18% which is lower than the one shown in figure 8.
Finally the recovery test shows comparable re-
sults between Figure 8 and 9 indicating a reversible gel formation suitable for injection applications. Nevertheless, the discrepancies shown with the comparison of Figures 8 and 9, and other several rheology test samples (data not shown) confirm that rheology properties of the proposed hydrogel are highly dependent of the hydrogel formation proto-col, and it is thought that the discrepancies are ob-tained due to mixing problems during the hydrogel casting. However it can be concluded from all the experiments that CutA-Tip1/CutA-S-SH3lig-L-Tip1lig hydrogel formed is a weak gel and it breaks with low percentage of strain.
4.5 Erosion test
Samples containing backbone protein and back-bone proteins with a bioactive immobilization pro-tein were prepared for erosion test in a small glass vial. For this test SH3-L-Slac protein was immobi-lized into the hydrogel matrix. Figure 10 shows the results for the erosion tests, it is evident that the that CutA-Tip1/CutA-S-SH3lig-L-Tip1lig hydrogel by itself is a really weak gel which at 1440 min (24 hours) is broke completely and about at 60 min (1 hour) have a erosion fraction of 70%. On the other hand the sample containing bioactive protein immo-bilized has an erosion profile much better, showing a erosion rate of 50% after 3180 min (53 hours); this behavior can be explained due to the dimer nature of Slac protein (Wheeldon et al., 2008) which may con-tribute to the hydrogel network structure. Nonethe-less these results are low compared with those ob-tained previously in the lab with another protein
backbones self-assembling hydrogel which demon-strate about 45% of erosion fraction after 9 days (216 hrs) of erosion.
Figure 10 Erosion test for CutA-Tip1/CutA-S-SH3lig-L-
Tip1lig hydrogel
Figure 11 Tip1 3D analysis: a) Tip1 and Tip1lig b)
closer view of the binding site
Pág
ina1
2
4.6 Tip1 and Tip1lig mutations
Due to fast erosion rates and rheology profiles showing a weak hydrogel formation, Tip1/Tip1lig interaction was studied and rationale design was used to propose three different mutations in the binding site in order to introduce disulfide bonds in the interaction as suggested by (Shen et al., 2006) and thus achieve a stronger interaction which en-hances the hydrogel properties.
It has been previously shown that PDZ domains
interact with its binding peptides in a long and deep groove formed between β2 and β3 sheet (Skelton et al., 2003); specifically for Tip1 PDZ domain it has been demonstrated that the residues Ile28, Ley29, Gly30, Gln39 and Phe46 which are located in the β2- β3 loop have an important role in the binding interaction (Durney et al., 2009). Anyway, Tip1/Tip1lig interaction was analyzed with 3-D pro-tein analysis software (Discovery Studio 3.1), in Figure 11a is shown the whole Tip1/Tip1lig interac-tion, the PDZ domain of Tip1 protein is shown in white/blue/green and red colors while the Tip1lig
binding peptide is shown in gray atoms structure. In Figure 11b a closer view of the interaction is shown and it is clear how the binding peptide is inserted be-tween the β2- β3 loop of the PDZ domain.
However, relevant residues were analyzed and three different mutations were proposed for the Tip1 protein and for Tip1lig binding peptide. In Figure 12 is shown the different Tip1 mutations proposed and its paired Tip1lig mutations; in the first place in Fig-ure 12a Tip1 Gln39Cys (Q39C) and its correspond-ent Tip1lig Leu-7Cys (L-7C), disulfide bond is shown by a green line and yellow dots represent sul-fide atoms, also the distance between the disulfide atoms was calculated with Discovery studio soft-ware and gave a result of 4.475 ̇. In the second place in Figure 12b is Tip1 Thr58Cys (T58C) and its correspondent Tip1lig Asp-7Cys (D-7C), the calcu-lated distance of the disulfide atoms is 3.485 ̇. Fi-nally in Figure 12c is Tip1 Ile28Cys (I28C) and its correspondent Tip1lig Cys+1 (C+1), the calculated distance of the disulfide atoms is 2.622 ̇. This means that in theory Tip1 I28C and Tip1lig C+1 in-teraction should be the stronger interaction because disulfide bonds forms at about 2.05 ̇
Figure 12 Tip1/Tip1lig mutants 3D analysis: a) Tip1 Gln39Cys and Tip1lig Leu-7Cys; b) Tip1 Thr58Cys and
Tip1lig Asp-3Cys; c) Tip1 Ile28Cys and Tip1lig Cys+1
Pág
ina1
3
4.7 Pull down binding experiments
Pull down experiments were made to find out which interaction has the stronger binding; Tip1, Tip1 Q39C, Tip1 I28C, Tip1 T58C were cloned into a MalE-L- DNA backbone and a hexahistidne (His6) tag was placed at the C-terminus of the protein con-struct to allow purification by Ni
2+ NTA affinity
binding column. Also, Tip1lig, Tip1lig L-7C, Tip1lig D-3C and Tip1lig C+1 were cloned into a GFP-L- DNA backbone without hexahistidine tag. Sequencing analysis were carried out for each con-struct to verify the presence of the desired mutation in the right place, sequencing analysis can be found in the annex of this document. Pull down experi-ments were carried out in a 4x4
experiment design,
in which every Tip1 mutant and Tip1 wild type (Tip1 WT) were tested with all the Tip1lig mutants and Tip1lig wild type (Tip1lig WT), several samples from the pull down experiments were taken and ana-lyzed in SDS-PAGE electrophoresis; (images of those analysis are shown in the annex of this docu-ment). The elution samples of the pull down exper-iments are shown in Figure 13; in Figure 13a elution samples of Tip1lig WT with all the Tip1 mutations and Tip1 WT are shown; in Figure 13b elution sam-ples of Tip1lig L-7C with all the Tip1 mutations and Tip1 WT are shown; in Figure 13c elution samples
of Tip1lig D-3C with all the Tip1 mutations and Tip1 WT are shown; in Figure 13d elution samples of Tip1lig C+1 with all the Tip1 mutations and Tip1 WT are shown. The first thing to notice is how in all the samples both proteins (MalE-L-Tip1 and GFP-L-Tip1lig) and its different mutants run at the expected size: 53.2 kD for MalE-L-Tip1 (and its mutants) and 28.8 kD for GFP-L-Tip1lig (and its mutants).
It is important to notice that the amount of GFP-
L-Tip1lig bound to MalE-L-Tip1 is significantly low when the following set ups are tried: Tip1 I28C + Tip1lig WT, Tip1 T58C + Tip1lig WT, Tip1 I28C + Tip1lig L-7C, Tip1 T58C + Tip1lig L-7C, Tip1 WT + Tip1lig C+1, Tip1 Q39C + Tip1lig C+1 and Tip1 T48C + Tip1lig C+1, which its first duplicate is marked with a small circle in the bottom; in those combinations the GFP-L-Tip1lig band is barely no-ticeable.
On the other hand, the combination Tip1 T58C-
Tip1lig D-3C (marked with a star in the bottom of the lane) presented the stronger thickness in the GFP-L-Tip1lig D-3C band indicating the stronger interaction (it seems stronger than the Tip1 WT-Tip1lig WT interaction), also the elution has a strong green color indicating the largest amount of GFP-L-Tip1lig D-3C protein; a quantification analy-sis of the bands was made with Quantity One ®
Figure 13 Pull down experiment elutions: a) Tip1lig WT elutions; b) Tip1lig L-7C elutions; c) Tip1lig D-3C elutions; d) Tip1lig
C+1 elutions; WT: Tip1 WT; Q39C: Tip1 Q39C; I28C: Tip1 I28C; T58C: Tip1 T58C
Pág
ina1
4
software and the relative percentage of Tip1lig/Tip1 was calculated, the results are shown in Table 1. This quantification analysis confirmed what is shown in Figure 13; it is also evident that Tip1 T58C-Tip1lig D-3C interaction is the strongest of the 16 combinations studied because it has the high-est percentage of Tip1lig binding with 29.7% of binding after washes.
Further experiments were carried out to confirm
the improvement of the Tip1 T58C-Tip1lig D-3C in-teraction, another pull down experiment comparing Tip1 WT-Tip1lig WT and Tip1 T58C-Tip1lig D-3C was made, also negative DTT controls were made to check the reducing of possible disulfide bonds formed. Several samples were taken during pull down experiments and analyzed through SDS-PAGE electrophoresis (shown in the annex of this document); Figure 14 shows the elutions samples of the pull down experiments comparing Tip1 WT-Tip1lig WT, Tip1 T58C-Tip1lig D-3C and pull down experiments with DTT. It is important to no-tice that Tip1 T58C-Tip1lig D-3C represented in lanes c) and d) of Figure 14 shows an improvement compared with wild type interaction. When quantifi-cation of band intensity was made with Quantity One ® software an improvement of 50% was ob-tained, comparable with the 60% improvement ob-tained from Figure 13 analysis.
On the other hand lanes e-h of figure 14 proves
that DTT containing pull down experiments have less Tip1lig bound to Tip1 protein. The quantifica-tion analysis shows a binding interaction 71% and 62% weaker for wild type and mutated interaction respectively. Also figure 15 shows an image of the elution samples under UV light; taking advantage GFP tag fluorescence, it can be shown the amount of Tip1lig present in each sample. It is evident that sample b) which correspond to Tip1 T58C-Tip1lig D-3C interaction have a stronger interaction than the wild type interaction represented in Figure 15a. Also DTT experiments (Figure 15c-d) shows low fluores-
cence indicating low Tip1lig WT and D-3C binding, indicating the importance of disulfide bonds in the binding interaction.
5 CONCLUSIONS
CutA-Tip1/CutA-S-SH3lig-L-Tip1lig based pro-tein hydrogel was successfully formed upon mixing proving self-assembling property of the protein backbones. Also target proteins attached to SH3 domain was successfully immobilized in the hydro-gel matrix demonstrating bioactive property of the hydrogel.
Rheology and erosion tests were conducted for
CutA-Tip1/CutA-S-SH3lig-L-Tip1lig based protein hydrogel and the results show a weak hydrogel be-havior with low percentage break point, inconsistent data and fast erosion rates which creates a need of improve hydrogel mechanical properties
Tip1/Tip1lig binding was studied in order to
strength its interaction; rationale design was used and three mutations of each protein were proposed
Tip1lig WT L-7C D-3C C+1
Tip1
WT 18.50% 13.90% 21.70% 4.90%
Q39C 10.30% 6.60% 24.90% 5.20%
T58C 2.90% 4.30% 29.70% 3.10%
I28C 4.20% 4.90% 9.90% 13.5
Table 1 Pull down binding experiments quantification analysis
Figure 14 Pull down experiments elutions comparing WT-
WT, T58C-D-3C and DTT controls: a)&b) Tip1 WT-Tip1lig WT
elutions; c)&d) Tip1 T58C-Tip1lig D-3C elutions; e)&f) Tip1 WT-
Tip1lig WT with DTT elutions; g)&h) Tip1 T58C-Tip1lig D-3C
with DTT elutions
Figure 15 Pull down elutions under UV light: a) Tip1 WT-
Tip1lig WT; b) Tip1 T58C-Tip1lig D-3C; c) Tip1 WT-Tip1lig WT
with DTT; d) Tip1 T58C-Tip1lig D-3C with DTT
Pág
ina1
5
to enhances binding, a 4x4 experiment was proposed to screen the different mutants and wild type interac-tions finding a enhanced binding with the Tip1 Thr58Cys – Tip1lig Asp-3Cys interaction.
Tip1 Thr58Cys – Tip1lig Asp-3Cys interaction
was probed have a stronger binding than the wild type interaction, and importance of disulfide bonds in the ligand interaction was also confirmed.
6 FUTURE WORK
Further disulfide bond presence and its role in the enhancing of Tip1 T58C-Tip1lig D-3C binding has to be confirmed. Also a protein based hydrogel with mutated residues of Tip1/Tip1lig interaction has to be developed and created, rheology profiles and ero-sion rates enhancement has to be additional proved.
7 ACKNOWLEDGMENTS
The author expresses its gratitude to Zhilei Chen’s group in the Texas A&M university; special recog-nition to Miguel Ramirez for his major collaboration during the development of the project. Also the help received from Dan Jacobsen and Dongli Guan was crucial for the development of the project
8 BIBLIOGRAPHY
Banta, S., Lu, H. D., & Wheeldon, I. R. (2010). Catalytic biomaterials: engineering organophosphate hydrolase to form self-assembling enzymatic hydrogels. Protein Engineering Design & Selection, 23(7), 559-566. doi: 10.1093/protein/gzq026
Banta, S., Wheeldon, I. R., & Blenner, M. (2010). Protein Engineering in the Development of Functional Hydrogels. Annual Review of Biomedical Engineering, 167-186.
Barbucci, R. (2009). Hydrogels and Tissue EngineeringHydrogels Biological Properties and Applications (pp. 2-20): Springer Science + Business. Retrieved from http://www.springerlink.com/content/978-88-470-1103-8/#section=740990&page=1&locus=6.
Brandl, F., Sommer, F., & Goepferich, A. (2007). Rational design of hydrogels for tissue engineering: Impact of pysical factors on cell behavior. Biomaterials, 28, 134-146.
Deming, T. (2006). Polypeptide and polypeptide hybrid copolymer synthesis via NCA polymerization. . Adv Polym Sci 202:201–218.
Dueber, J. E., Wu, G. C., Malmirchegini, G. R., Moon, T. S., Petzold, C. J., Ullal, A. V., . . . Keasling, J. D. (2009). Synthetic protein scaffolds provide modular control over metabolic flux. Nature Biotechnology, 27(8), 753-U107. doi: Doi 10.1038/Nbt.1557
Durney, M. A., Birrane, G., Anklin, C., Soni, A., & Ladias, J. A. (2009). Solution structure of the human Tax-interacting protein-1. J Biomol NMR, 45(329-334).
Eddington, D. T., & Beebe, D. J. (2004). Flow control with hydrogels. Advanced Drug Delivery Reviews, 56, 199-210.
Eliseev, R., Alexandrov, A., & Gunter, T. (2004). High-yield expression and purification of p18 form of Bax as an MBP-fusion protein. Protein Expression and Purification, 35(2), 206-209. doi: 10.1016/j.pep.2004.01.015
Foo, C. T. S. W. P., Lee, J. S., Mulyasasmita, W., Parisi-Amon, A., & Heilshorn, S. C. (2009). Two-component protein-engineered physical hydrogels for cell encapsulation. Proceedings of the National Academy of Sciences of the United States of America, 106(52), 22067-22072. doi: DOI 10.1073/pnas.0904851106
Gianni, S., Engstrom, A., Larsson, M., Calosci, N., Malatesta, F., Eklund, L., . . . Jemth, P. (2005). The Kinetics of PDZ Domain-Ligand Interactions and Implications for the Binding Mechanism. The Journal of Biological Chemistry, 280(41), 34805-34812.
Hoffman, A. S. (2002). Hydrogels for biomedical applications. Advanced Drug Delivery Reviews, 54, 3-12.
Ito, F., Usui, K., Kawahara, D., Suenaga, A., Maki, T., Kidoaki, S., . . . Matsuda, T. (2010). Reversible hydrogel formation driven by protein-peptide-specific interaction and chondrocyte entrapment. Biomaterials, 31(1), 58-66. doi: S0142-9612(09)00956-9 [pii]
10.1016/j.biomaterials.2009.09.026 Kopecek, J. (2007). Hydrogel biomaterials: A
smart future? Biomaterials, 28(34), 5185-5192. doi: 10.1016/j.biomaterials.2007.07.044
Maina, C. V., Riggs, P. D., Grandea Iii, A. G., Slatko, B. E., Moran, L. S., Tagliamonte, J. A., . . . Chu, d. G. (1988). An Escherichia coli vector to express and purify foreign proteins by fusion to and separation from maltose-binding protein. Gene, 74(2), 365-373. doi: 10.1016/0378-1119(88)90170-9
Pág
ina1
6
Mooney, D. J., & Drury, J. L. (2003). Hydrogels for tissue engineering: scaffold design variables and applications. Biomaterials, 24(24), 4337-4351. doi: 10.1016/S0142-9612(03)00340-5
Morton, C. J., Pugh, D., Brown, E. L., Kahmann, J. D., Renzoni, D. A., & Campbell, I. D. (1996). Solution structure and peptide binding of the SH3 domain from human fyn. Structure, 4(6), 705-714.
Ottenbrite, R. M., Park, K., & Okano, T. (2010). Biomedical Applications of Hydrogel Handbook (pp. 19-43). Retrieved from http://www.springerlink.com/content/978-1-4419-5918-8/#section=761629&page=4&locus=56
Peppas, N. A., Hilt, J. Z., Khademhosseini, A., & Langer, R. (2006). Hydrogels in biology and medicine: from molecular principles to bionanotechnology. Advanced Materials, 18, 1345-1360.
Pollok, B. A., & Heim, R. (1999). Using GFP in FRET-based applications. Trends in Cell Biology, 9(2), 57-60.
Saksela, K., & Permi, P. (2012). SH3 domain ligand binding: What's the consensus and where's the specificity? FEBS Letters.
Shen, W., Kornfield, J. A., & Tirrell, D. A. (2007). Structure and mechanical properties of artificial protein hydrogels assembled through aggregation of leucine zipper peptide domains. Soft Matter, 3(1), 99-107. doi: Doi 10.1039/B610986a
Shen, W., Lammertink, R. G. H., Sakata, J. K., Kornfield, J. A., & Tirrell, D. A. (2005). Assembly of an artificial protein hydrogel through leucine zipper aggregation and disulfide bond formation. Macromolecules, 38(9), 3909-3916. doi: Doi 10.1021/Ma048348s
Shen, W., Zhang, K., Kornfield, J. A., & Tirrell, D. A. (2006). Tuning the erosion rate of artificial protein hydrogels through control of network topology. Nat Mater, 5(2), 153-158. doi: nmat1573 [pii]
10.1038/nmat1573 Skelton, N. J., Koehler, M. F. T., Zobel, K.,
Wong, W. L., Yeh, S., Pisabarro, M. T., . . . Sidhu, S. S. (2003). Origins of PDZ domain ligand specificity - Structure determination and mutagenesis of the erbin PDZ domain. Journal of Biological Chemistry, 278(9), 7645-7654. doi: DOI 10.1074/jbc.M209751200
Tan, H., Chu, C. R., Payne, K. A., & Marra, K. G. (2009). Injectable in situ forming biodegradable chitosan-hyaluronic acid based hydrogels for cartilage tissue engineering. Biomaterials, 30(13), 2499-2506. doi: S0142-9612(08)01075-2 [pii]
10.1016/j.biomaterials.2008.12.080
Tanaka, Y., Tsumoto, K., Nakanishi, T., Yasutake, Y., Sakai, N., Yao, M., . . . Kumagai, I. (2004). Structural implications for heavy metal-induced reversible assembly and aggregation of a protein: the case of Pyrococcus horikoshii CutA. FEBS Lett, 556(1-3), 167-174. doi: S0014579303014029 [pii]
Ulijn, R. V., Bibi, N., Jayawarna, V., Thornton, P., Todd, S. J., Mart, R. J., . . . Gough, J. E. (2007). Bioresponsive Hydrogels. Materials Today, 10(4), 40-48.
Van Hest, J. C., & Tirrell, D. A. (2001). Protein-based materials, toward a new level of structural control. Chemical Communications, 34, 91-118.
Weian, Z., Wei, L., & Yue'e, F. (2005). Synthesis and properties of a novel hydrogel nanocomposites. Material Letters, 59, 2876-2880.
Wheeldon, I. R., Barton, S. C., & Banta, S. (2007). Bioactive proteinaceous hydrogels from designed bifunctional building blocks. Biomacromolecules, 8(10), 2990-2994. doi: 10.1021/bm700858p
Wheeldon, I. R., Gallaway, J. W., Barton, S. C., & Banta, S. (2008). Bioelectrocatalytic hydrogels from electron-conducting metallopolypeptides coassembled with bifunctional enzymatic building blocks. Proceedings of the National Academy of Sciences of the United States of America, 105(40), 15275-15280. doi: DOI 10.1073/pnas.0805249105
Wiedemann, U., Boisguerin, P., Leben, R., Leitner, D., Krause, G., Moelling, K., . . . Oschkinat, H. (2004). Quantification of PDZ Domain Specificity, Prediction of Ligand Affinity and Rational Design of Super-binding Peptides. Journal of Molecular Biology, 343(703-718).
Pág
ina1
7
Annexes
Annex A: Binding essays
Figures A1-A4 shows different steps for the binding essays performed with different
mutants and wild type combinations. The steps shown are the following: PP stands for the
MalE-L-Tip1 purified protein (either mutant or wild type depending the case) through Ni2+
NTA affinity column taking advantage of the Hexahistidine tag added in the C-Terminus of
the protein; WL stands for the whole lysate of the GFP-L-Tip1lig (either mutant or wild
type depending the case); FT corresponds to the flow through of MalE-L-Tip1 (WT or
mutants) after passing through the a Ni2+
NTA affinity column; FT2 represents the flow
through of GFP-L-Tip1lig protein through the column; there are also several washes
represented by the letter W and the wash number; finally E stands for the final elution of
the binding essays. It is important to notice Figure A1a and A3d are represented the Tip1
WT-Tip1lig WT interaction and Tip1 T58C-Tip1lig D-3C interaction respectively; the
T58C-D-3C interaction was the best interaction obtained from all the combinations proved.
It is possible to see that in Figure A3d all the washes and elution shows a thicker GFP-L-
Tip1lig band compared with all the other experiments and specially with Figure A1a.
Figure A1 Binding essays gels WT: a) WT-WT; b) Q39C-WT; c) I28C-WT; d) T58C-WT; L: Protein Ladder; PP:
Purified MalE-L-Tip1 protein; WL: Whole GFP-L-Tip1lig lysate; FT: Flow through MalE-L-Tip1; FT2: Flow
through GFP-L-Tip1lig; Wi: Wash number i; E: Elution
Pág
ina1
8
Figure A2 Binding essays gels L-7C: a) WT-L-7C; b) Q39C- L-7C; c) I28C- L-7C; d) T58C- L-7C; L: Protein
Ladder; PP: Purified MalE-L-Tip1 protein; WL: Whole GFP-L-Tip1lig lysate; FT: Flow through MalE-L-Tip1;
FT2: Flow through GFP-L-Tip1lig; Wi: Wash number i; E: Elution
Figure A3 Binding essays gels D3-C: a) WT-D-3C; b) Q39C- D-3C; c) I28C- D-3C; d) T58C- D-3C; L: Protein
Ladder; PP: Purified MalE-L-Tip1 protein; WL: Whole GFP-L-Tip1lig lysate; FT: Flow through MalE-L-Tip1;
FT2: Flow through GFP-L-Tip1lig; Wi: Wash number i; E: Elution
Pág
ina1
9
Figure A4 Binding essays gels C+1: a) WT-C+1; b) Q39C- C+1; c) I28C- C+1; d) T58C- C+1; L: Protein Ladder;
PP: Purified MalE-L-Tip1 protein; WL: Whole GFP-L-Tip1lig lysate; FT: Flow through MalE-L-Tip1; FT2:
Flow through GFP-L-Tip1lig; Wi: Wash number i; E: Elution
Pág
ina2
0
Annex B: Sequencing results
MalE-L-Tip1 Q39C mutation
pI-MalE-L-Tip1_Q39C GCGGAGGGAGCGGAGGCGGAGGGAGCGGATCCGTAGTGCAAAGAGTTGAA
401_IB052912_sequenciation_r GCGGAGGGAGCGGAGGCGGAGGGAGCGGATCCGTAGTGCAAAGAGTTGAA
**************************************************
pI-MalE-L-Tip1_Q39C ATTCATAAGTTGCGTCAAGGTGAGAACTTAATCTTGGGCTTCAGTATTGG
401_IB052912_sequenciation_r ATTCATAAGTTGCGTCAAGGTGAGAACTTAATCTTGGGCTTCAGTATTGG
**************************************************
pI-MalE-L-Tip1_Q39C AGGTGGGATCGACTGCGACCCGTCTCAGAATCCCTTCTCGGAAGATAAAA
401_IB052912_sequenciation_r AGGTGGGATCGACTGCGACCCGTCTCAGAATCCCTTCTCGGAAGATAAAA
**************************************************
pI-MalE-L-Tip1_Q39C CAGACAAGGGCATTTACGTCACACGAGTATCAGAGGGAGGTCCTGCTGAA
401_IB052912_sequenciation_r CAGACAAGGGCATTTACGTCACACGAGTATCAGAGGGAGGTCCTGCTGAA
**************************************************
pI-MalE-L-Tip1_Q39C ATTGCTGGGCTGCAGATTGGAGACAAGATCATGCAGGTGAATGGCTGGGA
401_IB052912_sequenciation_r ATTGCTGGGCTGCAGATTGGAGACAAGATCATGCAGGTGAATGGCTGGGA
**************************************************
pI-MalE-L-Tip1_Q39C CATGACCATGGTCACTCACGACCAGGCTCGGAAGCGGCTCACCAAGCGCT
401_IB052912_sequenciation_r CATGACCATGGTCACTCACGACCAGGCTCGGAAGCGGCTCACCAAGCGCT
**************************************************
pI-MalE-L-Tip1_Q39C CGGAGGAGGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTCGAGCACCAC
401_IB052912_sequenciation_r CGGAGGAGGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTCGAGCACCAC
**************************************************
pI-MalE-L-Tip1_Q39C CACCACCACCAC--------------------------------------
401_IB052912_sequenciation_r CACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGA
Q39C mutation
XhoI restriction site
6His tag
Pág
ina2
1
MalE-L-Tip1 I28C mutation
pI-MalE-L-Tip1_I28C GGAGCGGAGGCGGAGGGAGCGGATCCGTAGTGCAAAGAGTTGAAATTCAT
402_IB052912_sequenciation_r GGAGCGGAGGCGGAGGGAGCGGATCCGTAGTGCAAAGAGTTGAAATTCAT
**************************************************
pI-MalE-L-Tip1_I28C AAGTTGCGTCAAGGTGAGAACTTATGCTTGGGCTTCAGTATTGGAGGTGG
402_IB052912_sequenciation_r AAGTTGCGTCAAGGTGAGAACTTATGCTTGGGCTTCAGTATTGGAGGTGG
**************************************************
pI-MalE-L-Tip1_I28C GATCGACCAGGACCCGTCTCAGAATCCCTTCTCGGAAGATAAAACAGACA
402_IB052912_sequenciation_r GATCGACCAGGACCCGTCTCAGAATCCCTTCTCGGAAGATAAAACAGACA
**************************************************
pI-MalE-L-Tip1_I28C AGGGCATTTACGTCACACGAGTATCAGAGGGAGGTCCTGCTGAAATTGCT
402_IB052912_sequenciation_r AGGGCATTTACGTCACACGAGTATCAGAGGGAGGTCCTGCTGAAATTGCT
**************************************************
pI-MalE-L-Tip1_I28C GGGCTGCAGATTGGAGACAAGATCATGCAGGTGAATGGCTGGGACATGAC
402_IB052912_sequenciation_r GGGCTGCAGATTGGAGACAAGATCATGCAGGTGAATGGCTGGGACATGAC
**************************************************
pI-MalE-L-Tip1_I28C CATGGTCACTCACGACCAGGCTCGGAAGCGGCTCACCAAGCGCTCGGAGG
402_IB052912_sequenciation_r CATGGTCACTCACGACCAGGCTCGGAAGCGGCTCACCAAGCGCTCGGAGG
**************************************************
pI-MalE-L-Tip1_I28C AGGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTCGAGCACCACCACCAC
402_IB052912_sequenciation_r AGGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTCGAGCACCACCACCAC
**************************************************
pI-MalE-L-Tip1_I28C CACCAC--------------------------------------------
402_IB052912_sequenciation_r CACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTAAGTGGCT
******
BamHI restriction
site
I28C mutation
XhoI restriction site
6His tag
Pág
ina2
2
MalE-L-Tip1 T58C units
pI-MalE-L-Tip1_T58C CGGAGGGAGCGGAGGCGGAGGGAGCGGATCCGTAGTGCAAAGAGTTGAAA
402_IB052912_sequenciation_r CGGAGGGAGCGGAGGCGGAGGGAGCGGATCCGTAGTGCAAAGAGTTGAAA
**************************************************
pI-MalE-L-Tip1_T58C TTCATAAGTTGCGTCAAGGTGAGAACTTAATCTTGGGCTTCAGTATTGGA
402_IB052912_sequenciation_r TTCATAAGTTGCGTCAAGGTGAGAACTTAATCTTGGGCTTCAGTATTGGA
**************************************************
pI-MalE-L-Tip1_T58C GGTGGGATCGACCAGGACCCGTCTCAGAATCCCTTCTCGGAAGATAAAAC
402_IB052912_sequenciation_r GGTGGGATCGACCAGGACCCGTCTCAGAATCCCTTCTCGGAAGATAAAAC
**************************************************
pI-MalE-L-Tip1_T58C AGACAAGGGCATTTACGTCTGCCGAGTATCAGAGGGAGGTCCTGCTGAAA
402_IB052912_sequenciation_r AGACAAGGGCATTTACGTCTGCCGAGTATCAGAGGGAGGTCCTGCTGAAA
**************************************************
pI-MalE-L-Tip1_T58C TTGCTGGGCTGCAGATTGGAGACAAGATCATGCAGGTGAATGGCTGGGAC
402_IB052912_sequenciation_r TTGCTGGGCTGCAGATTGGAGACAAGATCATGCAGGTGAATGGCTGGGAC
**************************************************
pI-MalE-L-Tip1_T58C ATGACCATGGTCACTCACGACCAGGCTCGGAAGCGGCTCACCAAGCGCTC
402_IB052912_sequenciation_r ATGACCATGGTCACTCACGACCAGGCTCGGAAGCGGCTCACCAAGCGCTC
**************************************************
pI-MalE-L-Tip1_T58C GGAGGAGGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTCGAGCACCACC
402_IB052912_sequenciation_r GGAGGAGGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTCGAGCACCACC
**************************************************
pI-MalE-L-Tip1_T58C ACCACCACCAC---------------------------------------
402_IB052912_sequenciation_r ACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAG
***********
BamHI restriction
site
T58C mutation
XhoI restriction site
6His tag
Pág
ina2
3
GFP-L-Tip1lig L-7C mutation
pI-GFP-L-Tip1lig_L774C CACTCTCGGCATGGACGAGTTAGAAGCTTGTGGAGGCGGAGGGAGCGGAG
404_IB052912_sequenciation_r CACTCTCGGCATGGACGAGTTAGAAGCTTGTGGAGGCGGAGGGAGCGGAG
**************************************************
pI-GFP-L-Tip1lig_L774C GCGGAGGGAGCGCTAGCCAGTGCGCGTGGTTTGATACCGATCTGTGATAA
404_IB052912_sequenciation_r GCGGAGGGAGCGCTAGCCAGTGCGCGTGGTTTGATACCGATCTGTGATAA
**************************************************
pI-GFP-L-Tip1lig_L774C CTCGAGCACCACCACCACCACCACTGAGATC-------------------
404_IB052912_sequenciation_r CTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCG
*******************************
GFP-L-Tip1lig D-3C mutation
pI-GFP-L-Tip1lig_C782 ACTCTCGGCATGGACGAGTTAGAAGCTTGTGGAGGCGGAGGGAGCGGAGG
406_IB0523112_sequenciation_ ACTCTCGGCATGGACGAGTTAGAAGCTTGTGGAGGCGGAGGGAGCGGAGG
**************************************************
pI-GFP-L-Tip1lig_C782 CGGAGGGAGCGCTAGCCAGCTGGCGTGGTTTGATACCGATCTGTGCTGAT
406_IB0523112_sequenciation_ CGGAGGGAGCGCTAGCCAGCTGGCGTGGTTTGATACCGATCTGTGCTGAT
**************************************************
pI-GFP-L-Tip1lig_C782 AACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCC
406_IB0523112_sequenciation_ AACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCC
**************************************************
pI-GFP-L-Tip1lig_C782 CGAAAGGAAGCTGAGTT---------------------------------
406_IB0523112_sequenciation_ CGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCGAGCAATAACTAGCAAAC
*****************
L-7C mutation
XhoI restriction site
D-3C mutation
XhoI restriction site
NheI restriction site
Pág
ina2
4
GFP-L-Tip1lig C+1 mutation
pI-GFP-L-Tip1lig_C782 ACTCTCGGCATGGACGAGTTAGAAGCTTGTGGAGGCGGAGGGAGCGGAGG
406_IB0523112_sequenciation_ ACTCTCGGCATGGACGAGTTAGAAGCTTGTGGAGGCGGAGGGAGCGGAGG
**************************************************
pI-GFP-L-Tip1lig_C782 CGGAGGGAGCGCTAGCCAGCTGGCGTGGTTTGATACCGATCTGTGCTGAT
406_IB0523112_sequenciation_ CGGAGGGAGCGCTAGCCAGCTGGCGTGGTTTGATACCGATCTGTGCTGAT
**************************************************
pI-GFP-L-Tip1lig_C782 AACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCC
406_IB0523112_sequenciation_ AACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCC
**************************************************
pI-GFP-L-Tip1lig_C782 CGAAAGGAAGCTGAGTT---------------------------------
406_IB0523112_sequenciation_ CGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCGAGCAATAACTAGCAAAC
*****************
C+1 mutation
XhoI restriction site
NheI restriction site
