product - oxford nanopore technologies · input amount 1,000 ng dsdna400 ng hmw gdna (>30 kb)...

1

Product

2 3

Sequencing with 1D and 1D2 reads

Library prepWhether using 1D or 1D2, library preparation results in the addition of a sequencing adapter at each end of the fragment. Both the template and complement strands carry the motor protein which means both strands are able to translocate the nanopore.

Translocation – 1DThe template and the complement strands are sequenced as individual strands. 1D analysis delivers high data yields from a wide variety of sample types.

Translocation – 1D2

1D2 library preparation deploys special adapters that increase the probability that the complement strand will immediately follow the template strand. This method of sequencing when used with 1D2 analysis produces a higher accuracy read.

Y-adapter Y-adapter

Library DNA

Template...

Template...

Next molecule…

...Complement

(Exit)

(Exit)

...Template...

...Template...

3

Nanopore sequencing How it works

Nanopore readerDNA or RNA fragments pass through a nano-scale hole. The fluctuations in current during translocation are used to determine the DNA or RNA sequence.

The nanopore processes the length of DNA or RNA presented to it. The user can control fragment length through the library preparation protocol utilised. (e.g. >2 Mb DNA has been recorded1.)

An electrically resistant membrane means all current must pass through the nanopore, ensuring a clean signal.

An enzyme motor controls the translocation of the DNA or RNA strand through the nanopore. Once the DNA or RNA has passed through, the motor protein detaches and the nanopore is ready to accept the next fragment.

The nanopore signal, captured by the ASIC in the device, is characteristic of the sequence of the DNA or RNA fragment. Algorithms are used to convert the signal into basecalled sequence data.

Sequence SequencePrepare PrepareAnalyse Analyse

4 5

DNA library preparationFor maximum throughput For minimal preparation time

Ligation Sequencing Kit Rapid Sequencing Kit with transposase

• The transposase simultaneously cleaves template molecules and attaches tags to the cleaved ends

• Rapid sequencing adapters are added to the tagged ends• Fragment lengths are a result of the random cleavage

• DNA ends are repaired and dA-tailed• Sequencing adapters are ligated onto the prepared ends• Fragment lengths can be controlled by fragmentation or size selection

60 min

High molecular weight gDNA

Optional fragmentationor size selection

End-prep

Tether attachment

Loading

1D PCR-free gDNA

Ligation of sequencingadapters T

pA

Ap

5 min

5 min

Attachment ofsequencing adapters

Loading

Transposome complex

Cleavage and addition oftransposase adapters

gDNA

LSK108

RAD004

60 min



End-prep and nick repair

Loading

1D PCR-free gDNA


pA

Ap

LSK109

60 min



End-prep

Tether attachment

Loading

1D PCR-free gDNA


pA

Ap

5 min

5 min


Loading

Transposome complex


gDNA

LSK108

RAD004

60 min




Loading

1D PCR-free gDNA


pA

Ap

LSK109

Which DNA kit?These library preparation kits are all PCR-free, allowing sequencing without PCR bias

Use for… Highest throughput Rapid and simple prep Highest raw read accuracy

Prep time 60 mins 10 mins 80 mins

Input amount 1,000 ng dsDNA 400 ng HMW gDNA (>30 kb) 1,000 ng dsDNA

Fragmentation Optional Transposase based Optional

Read length Equal to fragment length Random distribution, dependent on input fragment length Equal to fragment length

Ligation 1D2 (SQK-LSK309)

Rapid (SQK-RAD004)

Ligation 1D (SQK-LSK109)

Also available:

• Optimised PCR-based kits for low input amounts • Application-specific library preparation kits (e.g. 16S sequencing)• Barcoding kits for cost-effective analysis of multiple samples

60 min



End-prep

Tether attachment

Loading

1D PCR-free gDNA


pA

Ap

5 min

5 min


Loading

Transposome complex


gDNA

LSK108

RAD004

60 min




Loading

1D PCR-free gDNA


pA

Ap

LSK109

View all kits and full specifications at store.nanoporetech.com


6 7

• Optional reverse transcription step improves throughput – cDNA strand is not sequenced

• Sequencing adapters attached to prepared ends• Read length reflects length of molecules in sample

• cDNA is synthesised using reverse transcription and strand-switching method, and then is amplified with PCR

• Strand-switching before PCR enriches for full-length transcripts• Sequencing adapters are attached to the amplified cDNA

Barcoding options for the cDNA kits are available, and are in development for the Direct RNA Sequencing Kit.

Use for…Sequence RNA molecules directly and preserve base

modificationsFull-length transcripts with

high throughputFull-length transcripts

without PCR bias

Prep time 105 mins 165 mins 275 mins

Input recommendation 500 ng RNA (poly-A+) 1 ng RNA (poly-A+) 100 ng RNA (poly-A+)

Read length Equal to RNA length Enriched for full-length cDNA Enriched for full-length cDNA

PCR required No Yes No

Reverse transcription Optional Yes Yes

Direct cDNA (SQK-DCS109)

cDNA-PCR (SQK-PCS109)

Direct RNA (SQK-RNA002)

80 min

Loading

Reverse transcription(optional)

Full-length RNA

Primer annealingand ligation

Attachment of 1Dsequencing adapter

25 min

10 min

Loading

Reverse transcription

AAAAAAAAAAAAAAAAA

Full-length poly-A+ RNA

Splint ligation

Cleanup andadapter attachment

70 min

AAAAAAAAAAAAAAAAAATTTTTTTTTT

AAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTT

AAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTT

TTTTTT

Loading

Reverse transcription

Primer annealing TTTTTT

Full-length poly-A+ RNA

PCR

Strand Switching

105 min

5 min

55 min

AAAAAAAAAAAAAAAAA

TTTTTTTTTTAAAAAAAAAA AA

AAAAA

TTTTTTTTTTCCC AAAAAAAAAAAA

AAAAA

GGGCCC

AAAAAAAAAATTTTTTTTTT

GGGCCC

25 min

Adapter attachment

FR

AAAAAAAAAATTTTTTTTTT

GGGCCC

TTTTTTTTTTAAAAAAAAAAAA

AAAAA

Which RNA kit? RNA library preparationFor sequencing the RNA molecule directly For full-length transcript analysis with high throughput

Direct RNA Sequencing Kit cDNA-PCR Sequencing Kit

For full specifications visit store.nanoporetech.com


8 9

VolTRAXTM

Automated library preparation solution for nanopore sequencingMaximising flow cell usage

Barcoding

Barcoding kits allow users to multiplex samples to generate maximumdata from a single flow cell, to separate the reads from sequential libraryloadings and to lower the cost per sample.

• Native Barcoding Kit for a PCR-free approach• PCR Barcoding Kits for up to 96 samples• Barcode libraries of gDNA, amplicon or cDNA either with

a dedicated barcoding kit or a barcoding expansion pack

Washing

The wash kit allows re-use of flow cells after short sequencingruns, meaning multiple libraries can be run sequentially.

Consumable cartridge converting any biological samples to a form ready for application to a nanopore sensing device.

Only minutes of hands-on time, even for novel/complex experiments. USB powered and portable,

liquids are moved around the cartridge in a path programmed

by software, performing individual reactions in sequence.

Fluorescence detector for DNA and RNA QC.

Barcode multiple samples

Separate and analyse

Pool and sequence

Automation of library preparation methods integrating

capabilities such as PCR.

Size (Device & cartridge): L 134 mm, W 58 mm, H 64 mm

Weight 301 g including cartridgeVisit store.nanoporetech.com for more details

VolTRAX Starter Pack $8,000 (includes VolTRAX device, Configuration Kit, 4x Cartridge Packs, 4x Sequencing Kits and 6x MinION Flow Cells). Buy now at store.nanoporetech.com/devices


10 11

SizeW 105 mm, H 23 mm, D 33 mm

Compatible with MinITTM preconfigured IT solution.Compatible with FlongleTM for smaller, rapid tests. Buy now at store.nanoporetech.com

Weight 87 g (103 g with a flow cell)

Consumable flow cell where the biology and electronics come together for nanopore sequencing.

Sample added to flow cell here.

USB powered device; link to laptop, computer or MinIT to operate.

Flow cell with 512 active channels.

Sensor chip works with custom ASIC for control and data acquisition.

Bespoke sensor array with multiple nanopores for scaled-up sequencing.

MinION Portable DNA/RNA sequencing for anyone Which MinION Starter Pack?

Basic Enhanced Project

MinION device 1 1 1

Flow cells 2 8 14

Sequencing kits 1 2 3

Wash kits 1 1 1

Community Support Included Included Included

Training / Services included Optional 1-day workshop Project support

$1,000 $4,500 $12,700

A wide range of training and support services are available to help make the most of your nanopore sequencing experiments.Visit store.nanoporetech.com/services for full explanation of the options.

Add MinIT if you would like a simple, preconfigured IT solution for MinION sequencing.

Recommended


12 13

Flongle Adapting MinION for smaller rapid tests and analyses


Consumable flow cell with 126 channels.

Reusable adapter that allows docking of smaller flow cell.

Same MinION device.

MinIT Simple, preconfigured IT solution for MinION and Flongle sequencing

Ability to perform basecalling; fastq files are written to an onboard SSD, data can then be transferred to your own system.

Multiple ports; including USB 3.0, USB 2.0 and ethernet.

Small footprint; under 300 g and designed to replace your current laptop.

Pre-installed software; including Linux OS and MinKNOWTM

(control software for nanopore sequencing).

Bluetooth and Wi-Fi enabled; control your experiments using a

laptop, tablet or smartphone.

Individual MinIT $2,400, or available as part of MinION Starter Pack.Compatible with MinION and Flongle.Buy now at store.nanoporetech.com/devices

Flongle Evaluation Pack $5,250 (includes 1x adapter, 48 flow cells and adapter delivery. Flow cell delivery charged separately). Individual flow cells $90 each. Compatible with GridION X5, MinION and MinIT.Buy now at store.nanoporetech.com/devices



Weight 20 g

Weight 290 g

14 15

Professor Todd Michael J. Craig Venter Institute

Researchers no longer have to send out their samples to core labs or service providers, they can do it now at their own bench, and within a week have an answer to their question – they should do it.

MinION Mk1CFully integrated, fully portable sequencing and analysis

Integrated, powerful, real-time compute with pre-installed basecalling and analysis software.

High-resolution touch screen display allowing complete device control and easy visualisation of results. Bluetooth, Wi-Fi and

cellular network enabled — upload and share your data, wherever you are.

Get as much as 30 Gb data using MinION Flow Cells or, for smaller tests and analyses, use Flongle for as much as 1.8 Gb data.

Data files are written to an onboard, high-capacity SSD; data can then be transferred to your own system.

Coming soon

Anticipated availability Q3 2019. For full specifications and ordering information, visit store.nanoporetech.com


Weight 420 g


16 17

Consumable flow cell where the biology and electronics come together for nanopore sequencing.


Up to 2,560 active channels can be sequencing at one time on the GridIONTM X5.

Onboard data analysis offering real-time local analysis, generating as much as 150 Gb data.

5 individual flow cells can be operated individually or together, suitable for fee-for-service operations.


OxfordNANOPORE

ServiceCertifiedWeight

11 kg

Which GridION X5 plan? GridION X5 High-throughput, benchtop system with integrated compute module

Compatible with Flongle. For full specifications visit store.nanoporetech.com

Service provider certification is available for the GridION X5.

Starter Pack CapEx

GridION X5 device 1 1*

Flow cells 60† 60†

Sequencing kits 10 10

Wash kits 5 5

Software licence and device warranty‡ 4 months 3 years

Delivery of device and consumables Included Included

Remote Installation Assurance Included Included

$49,955 $95,455

Additional starter pack options and a wide range of training services are available online.Buy now at store.nanoporetech.com

* Device purchase. † To be shipped within 4 months of device delivery according to user’s schedule.‡ Subsequent charge is $12,500 per annum.

18 19

The PromethION is a real game changer, combining ultra-long reads with high sequence output for the production of contiguous, high-quality reference genomes. Using this platform, we sequenced the 2.56 Gb lettuce genome at >100X coverage using just a few flow cells.

Alexander Wittenberg KeyGene, PromethION service provider

PromethIONTM 24 and 48 High-throughput, high-sample number benchtop systems


20 21

PromethION 24 and PromethION 48High-throughput, high-sample number benchtop systems


Inside the PromethION

Each flow cell comprises up to 3,000 active channels.

Up to 72,000 (P24) or 144,000 (P48) active channels can be sequencing at one time on the PromethION

Sequencing module Compute module

24 (P24) or 48 (P48) individual flow cells can be operated individually or together for flexible, on-demand sequencing.

SizeMain unit: W 590 mm, H 190 mm, D 430 mmCompute module: W 178 mm, H 440 mm, D 470 mm

WeightMain unit: 28 kgCompute module: 25 kg

PromethION 24 PromethION 48

Starter Pack CapEx Starter Pack CapEx

PromethION sequencing device and compute 1 1* 1 1*

Flow cells† 60 60 120 120

Sequencing kits 14 14 24 24

Software licensing and device warranty‡ 4 months 3 years 4 months 3 years

Delivery of device and consumables Included Included Included Included

On-site Assurance and Familiarisation Included Included Included Included

$165,000 $297,000 $285,000 $595,000

Which PromethION plan?

OxfordNANOPORE

ServiceCertified Service provider certification is

also available for the PromethION.

* Device purchase. † To be shipped within 4 months of device delivery according to user’s schedule.‡ Subsequent charge is $20,000 per annum.

Cost-effective annual flow cell packs and smaller top-up packs are available to suit your project needs – with flow cells from $2,000 - $625.Buy now at store.nanoporetech.com


22 23

Data analysis and basecalling

As a DNA or RNA strand passes through the nanopore, the current is measured several thousand times per second. These current samples are known as raw data.

The raw data:

• is processed using machine-learning techniques into basecalled data – the sequence of DNA or RNA bases

• captures biological features such as base modifications. It is down to the algorithm to correctly interpret that information

• can be accessed for the development of new analysis tools

Tools such as new basecallers can be accessed through a developerlicence available to nanopore technology users.

For more information visit nanoporetech.com/analyse

Data structure

Raw data

Sequence

Basecalled

Data analysis and basecalling

Control of the sequencing device and primary data analysis are performed by MinKNOW. The same software is used across all devices.

The channel panel and duty time plots give you real-time insight into the progress and performance of your sequencing run, visualising the number of pores that are sequencing. This allows you to quality check your run, and if there’s a problem with the library: stop sequencing, wash the flow cell, and start again.

MinKNOW can output basecalled reads in .fastq or .fast5 formats live, or the data can be basecalled after the run with a range of algorithms. These include basecallers trained to identify modifications, or community-developed tools.

Raw data straight off ASIC

CCGACTCCGGTTACCCGCGTTGATTTGCTGGGGCAGGGCCG

More +

Apply30100

90

80

70

60

50

40

30

20

10

0

Auto scale bucket size

Bucket size (minutes)

Duty TimeSummary of channel states over time

Display channels proportionately

30m 3h 5h 30m 8h 10h 30m 13h 15h 30m 18h 20h 30m 23h

Stat

e Ti

me

Equi

vale

nt (%

)

Time

Sequencing Pore Recovering Inactive Unclassified


24 25

After the output of data from MinKNOW, there are several possible avenues for downstream data analysis, dependent on the level of bioinformatic capability available.

Bioinformatic capability needed

How Use the cloud-based EPI2ME platform for real-time analysis workflows.

Get analysis recommendations and clear tutorials on the use of open-source tools.

Run open-source tools written and developed by the Nanopore Community.

All the data, raw or basecalled, can be used in custom analysis pipelines written by the user for specific applications.

Where epi2me.nanoporetech.com/workflow

community.nanoporetech.com/knowledge

community.nanoporetech.com

User defined

Onward analysis options Onward analysis with EPI2ME

The What’s In My Pot (WIMP) workflow harnesses the benefits of long reads and real-time data streaming to supply rapid identification and quantification of bacteria, fungi, archaea and viruses from mixed metagenomics samples.

The 16S workflow is compatible with the 16S Barcoding Kit and unravels heavily complex metagenomics samples, resolving to genus level. You can multiplex for a lower cost per sample.

The ARMA workflow uses the highly-curated Comprehensive Antibiotic Resistance Database (CARD) to identify antibiotic resistance markers and to provide information about the drugs they confer resistance to.

Human genome and exome alignments are available against the GRCh38 reference, generating real-time coverage plots at either chromosomal or gene level.

Why EPI2ME for data analysis?

• Scalable analysis of your data

• Reproducible analysis, uses docker images

• No need to install anything aside from EPI2ME agent locally

• Real-time monitoring of your experiments

• Simple workflow configuration

• Clear figures: shareable, interactive, printableEPI2ME workflows can classify and identify species in real time, displaying their taxonomy in clear, interactive figures.

The cloud-based EPI2ME platform provides easy access to real-time data analysis workflows. An intuitive graphical interface provides easy interpretation of individual or multiple barcoded samples. Full QC metrics give feedback on run performance and include number of reads, read length distribution and quality scores.

Protocol builder & analysis tutorials

EPI2METM Community-developed tools

Custom analysis pipelines

In development In development

26 27

Designed for use with a smartphone in any location.

The smallest sequencing device so far.

Same nanopore sensing technology.

SmidgIONTM

Towards the analysis of any living thing, by any person, in any environment

Visit nanoporetech.com/products/smidgION for more details www.nanoporetech.com

Mk1C

In development

28

Oxford Nanopore Technologies, the Wheel icon, EPI2ME, Flongle, GridION, Metrichor, MinION, MinIT, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore Technologies in various countries. All other brands and names are the property of their respective owners. © 2019 Oxford Nanopore Technologies. All rights reserved. Oxford Nanopore Technologies products are currently for research use only. BR_1009(EN)_V2_19Mar2019

www.nanoporetech.com

Oxford Nanopore Technologies phone +44 (0)845 034 7900email [email protected] @nanopore

product - oxford nanopore technologies · input amount 1,000 ng dsdna400 ng hmw gdna (>30 kb)...

Documents