THE JOURNAL OF BIOLOGICAL. CHEMISTRY Vol. 265, No. 7, Issue of March 5. pp. 3757-3762, 1990 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S. A.

The N-terminal Domain of the Insertion Sequence 30 Transposase Interacts Specifically with the Terminal Inverted Repeats of the Element*

(Received for publication, October 2, 1989)

Rolf Stalder& Patrick Caspers?, Ferenc Olasz$ll , and Werner Arber$** From the SDepartment of Microbiology, Biozentrum der Uniuersitiit Base!, Base1 CH-4056, Switzerland and the Wentral Research Units, F. Hoffmann-La Roche & Company Ltd., Bose1 CH-4002, Switzerland

The gene for the insertion sequence (IS)30 transpos- ase is placed under the control of the tat promoter, and large quantities of transposase are expressed upon in- duction. The resulting protein precipitates inside the Escherichia coli cells in the form of inclusion bodies which, upon cell lysis, cannot be dissolved under non- denaturing conditions. In contrast, the N-terminal third of the transposase, a 17-kDa protein produced by a truncated gene, can be purified and is able to interact site specifically with the ends of the IS30 element. In DNase I footprint experiments, regions of 26 nucleo- tides on one DNA strand and 19 nucleotides on the other strand at either end of the element are protected from nuclease digestion. It is concluded that a func- tional DNA-binding domain can be formed by expres- sion of only one-third of the complete IS30 transposase. Sequence comparison shows a homology of the IS30 ends to the ends of IS4351 and to the Ll end of bacte- riophage Mu.

Insertion sequences or IS’ elements are an important class of mobile genetic elements found in prokaryotes. They con- tribute to the plasticity of the bacterial chromosome by pro- moting different kinds of genomic rearrangements (1, 2).

A number of the IS elements have been well studied on a genetic level, whereas little is known about the protein factors involved in the transpositional recombination process. Re- sults from studies of related systems such as bacteriophage Mu (3) or transposon (Tn)3 (4) indicate that in an initial step of the transposition process, the transposase interacts site specifically with the ends of the mobile genetic element. This is followed by a strand transfer from the donor to the target DNA (5, 6).

The mobile genetic element IS30 is a resident in the chro- mosome of Escherichia coli K-12 and E. coli C strains (7). The 1221-bp-long IS30 element contains one large open reading

* This work was supported by the Swiss National Science Foun- dation Grants 3.111.85 and 3624.87. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accord- ance with 18 U.S.C. Section 1734 solely to indicate this fact.

J Present address: Service de Biochimie, Centre d’Etudies Nu- cliaires de Saclay, Gif-sur-Yvette F-91191, France.

II Present address: Biotechnological Research Center of Agriculture, P.f.170, G6diill8 H-2101, Hungary.

**TO whom correspondence should be sent: Dept. of Microbiology, Biozentrum der Universitht Basel, Klingelbergstrasse 70, Base1 CH- 4056, Switzerland. Tel: 061.25 38 80; fax: 61-256760.

’ The abbreviations used are: IS, insertion sequence; bp, base pair(s); IPTG, isopropyl-l-thio-@-D-galactopyranoside; SDS, sodium dodecyl sulfate; Tn, transposon; ORFA, open reading frame A.

frame, ORFA, which has the coding capacity for the putative transposase with a molecular mass of 44.3 kDa (8). A promoter sequence (P30A) is located upstream of ORFA (9), overlap- ping with the left end terminal inverted repeated sequence, whereas a transcription termination signal (T30A) is con- tained about 300 nucleotides upstream of the translational stop (10). IS30 preferentially inserts into specific DNA se- quences (7, 11). A similar preference for specific target sites is observed for Tn7 (12). The low transposition frequency of IS30 is probably a consequence of its restricted target selec- tion.

The present work describes the overexpression of the IS30 transposase and of its truncated 17-kDa N-terminal domain. In DNase I footprint analysis, the latter is shown to interact specifically with the ends of the IS30 element. Computer analysis of the amino acid sequence predicts the presence of a helix-turn-helix motif in the N terminus of the protein.

MATERIALS AND METHODS

Bacterial Strains and Plasmids-The E. coli strains JMlOl (13), JM109 (14), and MC1061 (15) were used for cloning and overexpres- sion of the transposase gene. The repressor plasmid pDMI,l (16) and the 6 X histidine plasmid pDS78 were kind gifts of D. Stiiber. pKK223-3 was obtained from Pharmacia LKB Biotechnology Inc. pAW376, was formed by deletion of the tat promoter containing a BamHI fragment of pKK223-3, followed by the introduction of an EcoRI linker. Cloning of the IS30 element from pAW304 (11) into the PstI site of pUC9 (14) gave pAW305. Deletion of the 0.8-kilobase pair Hind111 fragment of pAW380 yielded the plasmid pAW387. Cloning procedures were done according to the protocols given in (17). The cells were grown in 2 x YT liquid medium (18).

Construction of the Expression Plasmid pAW380-Ba131 nuclease treatment of the plasmid pAW305 (Fig. lA), containing one copy of IS30 in the PstI site, deleted the promoter P30A. The plasmid was linearized by cleavage with SalI, and after Bal31 nuclease treatment, an EcoRI linker was introduced. An EcoRI-PstI fragment carrying a deleted IS30 element was then cloned into the expression vector pKK223-3, which contains the tat promoter. Sequence analysis of the resulting plasmid, pAW358 (Fig. lB), showed that the distance between the Shine-Dalgarno sequence present in the EcoRI-PstI sites of the expression plasmid and the ATG start codon of ORFA was 20 nucleotides, which is not the optimal spacing found in comparative studies (19). As a consequence, no high level expression of the transposase protein was obtained with this plasmid upon induction with IPTG. To shorten the distance between the Shine-Dalgarno sequence and the start codon, a site-directed mutagenesis using the oligonucleotide 5’-GTTCGTCTCATTTCTGTTTCCT-3’ was made. This 22-mer loops out the additional bases and reduces the distance to 7 bp (Fig. 1, D and E). The mutagenesis was performed by the gapped duplex method (20) on the deleted IS30 element from pAW358, cloned as an EcoRI-PstI fragment into the EcoRI-PstI sites of M13mp8. Following the mutagenesis, candidates were sequenced in order to verify the deletion, and the correct sequence was cloned as an EcoRI-PstI fragment into the plasmid pAW376, yielding the expression plasmid pAW380 (Fig. 1C).

3757

by guest on April 4, 2018

http://ww

w.jbc.org/

Dow

nloaded from

N Terminus of IS30 Transposase Has DNA-binding Activity

tat

B

tat

C

T G T

D Li’T C T E

-.35Hrl ” CAGGAAACAGAA--ATGAGACGAACATTT

TCCTTTGTCTT--TACTCTGCTTG ---EHHl ,-a-Tame-T

I I 22-mer Oligonucleotide s/D start

FIG. 1. Replacement of the original transposase promoter by the inducible tat promoter. A, the IS30 element from plasmid pAW304 (11) was cloned as a PstI fragment into the polylinker sequence of pUC9, yielding pAW305. The element is shown as a black bar with the terminal inverted repeated sequences as dotted areas. L and R indicate the left and the right ends, respectively. B, the left end of IS30 was deleted, and the element was cloned into the expression plasmid pKK223-3, resulting in the formation of pAW358. A filled arrowhead represents the tat promoter placed upstream of the transposase gene and its direction. C, the expression plasmid pAW380 containing the IS30 transposase gene under the control of the tat promoter. D, oligonucleotide-directed mutagenesis of the tat promoter region of pAW358. The two boxes represent the -35 and the -10 regions of the tat promoter. The nonmatching nucleotides between the 22-mer oligonucleotide and pAW358 are looped out. E, the nucleotide sequence of the promoter region of pAW380 shown in 5’ to 3’ direction from left to right. S/D indicates the ribosomal binding site. The two arrows show a sequence variation at positions 74 and 75 (AT) with respect to the original IS30 sequence (TA) (8). The first codon of ORFA is indicated by Start. The following abbreviations are used for restriction enzymes cleavage sites: B, BarnHI; Bg, BgZII; E, EcoRI; H, HindID; P, PstI; and S, SalI. The plasmid maps are not drawn to scale.

Purification of the 17-kDa Protein-The strain JM109 (pAW387; pDMI,l) was grown in 8 liters of 2 x YT medium containing ampi- cillin (200 pg/ml) and kanamycin (25 rg/ml) to OD,,, = 0.8 and then induced with IPTG (1 mM final concentration). After 2 h of induction, the cells were centrifuged for 20 min at 5,000 x g, and the pellet was suspended in 40 ml of buffer A containing 150 mM KC1 (buffer A = 20 mM Tris, pH 7.5, 10% glycerol, 1 mM EDTA, 7 mM 2-mercapto- ethanol). The cells were opened by French press, and cell debris was removed by low speed centrifugation for 15 min at 5,000 x g. The supernatant was centrifuged for 60 min at 150,000 x g. 5.5 ml of protamine sulfate (20 mg/ml; pH 7.0) was added to the supernatant from the high speed centrifugation (50 ml), stirred for 60 min at 4 “C, and centrifuged for 20 min at 15,000 X g. The resulting pellet was resuspended in 2 ml of buffer A containing 1.5 M KCl. Unsoluble debris was removed by a 20-min centrifugation at 15,000 X g. After adding 8 ml of buffer A (leading to a final salt concentration of 300 mM KCl), a precipitate was formed. Centrifugation for 20 min at 27,000 x g yielded a pellet that was resuspended in 2 ml of buffer A containing 0.9 M KCl. This preparation contained about 7 mg/ml protein, approximately 90% of it being the truncated 17-kDa trans- posase protein (see also Fig. 2).

Footprint Experiments-The plasmid pAW305 was cleaved with the enzymes FnuDII, P&I, or BglII, dephosphorylated, and end labeled with [y-32P]ATP. After the labeling reaction, the FnuDII- digested pAW305 was cleaved with PuuII, yielding a 368-bp fragment labeled at the FnuDII site and which contained the left end of IS30. Similarly, cleavage of PuuII-cleaved and end-labeled plasmid DNA with FnuDII yielded the same 368-bp fragment containing the left end of IS30 labeled on the other strand. Cleavage of the PuuII-cleaved and end-labeled DNA with BglII gave rise to a fragment containing the right end of the IS30 element. Cleavage of the BglII-cleaved and end-labeled DNA with PuuII yielded the same fragment containing the right end but labeled on the other strand. The labeled DNA fragments containing the left or the right ends of IS30, respectively, were isolated from a 6% polyacrylamide gel. For the footprint reac- tions, 10,000 cpm of the labeled DNA fragments were used. The reactions were done in a final volume of 10 ~1 containing 2 ~1 of 5 x footprint buffer (100 mM Tris, pH 7.5, 50% glycerol, 25 mg/ml calf

thymus DNA), 1 pl of bovine serum albumin (10 mg/ml), 1 ~1 of potassium glutamate (1 M), and 1 ~1 of the 17-kDa truncated trans- posase protein (7 mg/ml, in buffer A containing 0.9 M KCl). The reaction was incubated for 20 min at 25 “C. Then 1 ~1 of DNase I (1 mg/ml) was added, and the reaction was stopped after 2 min by adding 25 gl of DNase I stop (10 mM Tris, pH 8.0, 20 mM EDTA, 0.2% SDS, 200 pg/ml calf thymus DNA), 50 ~1 of TE (10 mM Tris, 1 mM EDTA) containing 0.3 M sodium acetate and 100 ~1 of phenol/ chloroform. The DNA was precipitated with ethanol, and the pellets were lyophylized. The samples were resuspended in sample dye, loaded onto a 6% sequencing gel, and autoradiographed for 2 days at room temperature.

Production of Antiserum against the Transposase Protein-The 1.4-kilobase pair EcoRI-BgLII fragment from pAW380 (Fig. 1C) con- taining the tat promoter and ORFA up to the unique EglII site was cloned into the plasmid pDS78 (21). Cells carrying the recombinant plasmid were grown in 2 x YT medium and induced with IPTG, leading to the formation of a fusion protein having 6 X histidine fused to the C-terminal end of the truncated IS30 transposase. The fusion protein was solubilized by denaturation in 6 M guanidine HCl, purified as described by Hochuli et al. (21), and injected into rabbits. The so produced polyclonal antiserum is able to interact specifically with the 17-kDa N-terminal fragment as well as with the full-length IS30 transposase (see Fig. 2).

RESULTS AND DISCUSSION

Overexpression of the IS30 Transposase-The original IS30 transposase promoter P30A has a relative strength of about 10% of that of the lacUV5 promoter (9) and is located in the left end of the element. It is replaced by the strong, inducible tat promoter (22) present on the plasmid pKK223-3 (Fig. 1B). The new expression plasmid pAW380 (Fig. 1C) is only stably maintained in cells carrying the lad9 gene on the compatible repressor plasmid pDMI,l (16). Upon induction with IPTG (1 mM final concentration), a strong protein band of about 42 kDa appears upon SDS-polyacrylamide gel elec-

by guest on April 4, 2018

http://ww

w.jbc.org/

Dow

nloaded from

N Terminus of IS30 Transposase Has DNA-binding Activity 3759

trophoresis of cell extracts (Fig. 2, lane 5). This is in good agreement with the expected size (44.3 kDa) of the IS30 transposase. Antibodies directed against a truncated form of the transposase expressed up to the single BglII site in the gene interact specifically with the 42-kDa protein (Fig. 2, right side, lane 5). At the same position as that of the IS30 transposase, a strong protein band is also present on SDS- polyacrylamide gel electrophoresis of noninduced E. coli ex- tracts (Fig. 2, left side, lanes 1 and 4). However, the fact that the antibodies react only with extracts of induced cells strongly suggests that the 42-kDa band seen in Fig. 2, lane 5, does contain the overexpressed transposase. The lower mo- lecular mass protein bands visible in the immunoblot (Fig. 2, right side, lane 5) represent probably proteolytic degradation products of the transposase and/or truncated products due to premature transcription termination at T30A. They are only observed in induced cell cultures carrying the plasmid pAW380 but not in noninduced isogenic strains (Fig. 2, lane 4) or in strains carrying different deletion derivatives of the expression plasmid pAW380 under either inducing or nonin- ducing conditions (data not shown). The weak band visible in Fig. 2, right side, lanes 1, 2, and 4, at about 32 kDa most probably represents a nonspecific cross-reaction of the serum. This band also appears in E. coli cell extracts lacking the expression plasmids pAW380 and pAW387 with the same intensity as seen in Fig. 2. In those extracts, however, no full- length transposase encoded by chromosomal copies of IS30 is detectable (data not shown). It is therefore very unlikely that the 32-kDa protein represents a degradation product of the IS30 transposase.

In electron micrographs, a large number of inclusion bodies are observed in IPTG-induced cells carrying the expression plasmid pAW380, whereas no inclusion bodies can be seen if induction is omitted. After lysis of the induced cells, the transposase is found in the low speed pellet (5000 X g)

1 2 3

-.. .

SM 4 5 SM

together with cell debris. The protein is insoluble under nondenaturing conditions. Similar observations have been made of a number of other different proteins overexpressed in E. coli cells (23). Aggregation of transposase and loss of activity after high level expression (more than 1% of total cellular protein) were also observed for IS10 (24), as well as the precipitation of Tn3 transposase in low ionic strength buffers (4).

Attempts to renature the IS30 transposase into an active form failed and resulted in precipitation of the protein.

Expression and Purification of the 17-kDa N-terminal Frag- ment-It was shown for bacteriophages Mu (25) and D108 (26) that the DNA-binding domain of the transposase is located on the N-terminal part of the protein. Therefore, we decided to express only the N-terminal part of the protein. Deletion of the 0.8-kilobase pair Hind111 fragment of PAW380 (Fig. 1C) led to the plasmid pAW387. This plasmid encodes the N-terminal part of the IS30 transposase up to the unique Hind111 site at position 461 in the nucleotide sequence (8). The cloning procedure resulted in the fusion of this partial reading frame for the IS30 transposase with a short stretch of 14 codons located adjacent to the Hind111 site of pAW387. E. coli cells carrying pAW387 together with the repressor plasmid pDMI,l produce high levels of a 17-kDa protein after induction with IPTG (1 mM final concentration) (Fig. 2, lane 2). The molecular weight of this protein corresponds to the expected size of the IS30 transposase N-terminal fragment encoded on pAW387. The polyclonal antibodies also react with this N-terminal part (Fig. 2, right side, lanes 2 and 3). In contrast to the full-length protein, the 17-kDa truncated form of the IS30 transposase is soluble in buffer A containing 900 mM KCl. Upon lowering the salt concentration to 300 mM KCl, the 17-kDa protein precipitates. This property of the 17-kDa protein was used for the isolation of fractions in which the N-terminal transposase fragment represented over 90% of the total protein content (Fig. 2, lane 3).

1

* 94 - - 67 -

- 43 -

- 30 *

1 20 -

- 14 -

2 3 45

FIG. 2. Overexpression and identification of the wild-type and of the 17-kDa N-terminal fragment of the IS30 transposase. The E. coli strains harboring the different expression plasmids were grown in 2 X YT containing ampicillin (200 fig/ml) and kanamycin (25 pg/ml) medium to OD,,,, = 0.5 and induced with IPTG (1 mM final concentration) for 2 h where indicated. 300 ~1 of the cells was then centrifuged, and the pellets were resuspended in 30 ~1 of H,O with loading buffer. They were lysed by sonication, boiled for 2 min, and loaded on a 15% polyacrylamide gel. SDS-polyacrylamide gel electrophoresis of the samples was done according to (40). Left side: lane I. JM109 (pDMI,l: pAW387); lane 2, JM109 (pDMI,l; pAW387) induced with IPTG (1 mM final concentration) for 2 h; lane 3, the partially purified 17-kDa N-terminal fragment of the IS30 transposase. The isolation of the nrotein is described under “Materials and Methods.” Lane 4, JMlOl (pDMI.1: pAW380); lane 5, JMlOl (pDMI,l,pAW380) induced with IPTG (1 mM final concentration) for 2 h. On the right&e, an immunoblot of the gel is shown. The positions of the 17-kDa N-terminal transposase fragment (lanes 2 and 3) and of the wild- type transposase (lane 5) are indicated by arrows. The numbers between the SDS gel and the immunoblot indicate the positions of the molecular mass standards (SM) in kDa.

by guest on April 4, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3760 N Terminus of IS30 Transposase Has DNA-binding Activity

Specific Interaction of the 17-kDa Protein with the Ends of ZS30-Band shift experiments show that the 17-kDa protein is able to interact specifically with DNA fragments containing either the right or the left end of IS30. The binding of the transposase to the linearized DNA fragments is not dependent on the presence of ATP. These results are in agreement with similar observations for the transposases of bacteriophage Mu (3) and Tn3 (4).

DNase I protection experiments show that the 17-kDa protein binds specifically to DNA sequences in the terminal inverted repeats of the IS30 element. The protected region in the left end spans 26 nucleotides on the upper strand (Fig. 3A, LZI, lane 4 and Fig. 3B) and 19 nucleotides on the lower strand (Fig. 3A, LZ, lane 2 and Fig. 3B). Similarly, 26 nucle- otides on the lower strand of the right end (Fig. 3A, RII, lane 8 and Fig. 3B) and 19 nucleotides of the upper strand (Fig.

3A, RI, lane 6 and Fig. 3B) are protected from nuclease digestion. The protected regions in the upper strand of the left end and in the lower strand of the right end extend over the length of the terminal inverted repeats of 26 nucleotides. It is known for other IS elements such as ISI (27), IS10 (28), or IS50 (29) that sequences required for a functional end are larger than only the inverted repeats. No indication was found that other proteins from the host are necessary for the inter- action of the l7-kDa IS30 transposase fragment with the ends of the element. No full-length transposase could be detected with the antibodies in cell extracts from E. coli not carrying the expression plasmid pAW380, despite of the presence of chromosomal copies of IS30. This result makes it very un- likely that the specific DNA-protein interactions described above are due to trace amounts of complete IS30 transposase present in the cell extracts.

The binding site of the 17-kDa transposase fragment in the left end of the element overlaps with the promoter region P30A. Transposase bound to the left end could probably repress transcription in a autoregulative manner. This kind of regulation could play an important role under native con- ditions.

Sequence Comparison between IS30 and Other Transposable Elements-The overall comparison of prokaryotic transpo- sases reveals a rather poor homology on the nucleotide level between the different transposases encoded by bacterial IS elements (1). However, nucleotide sequences homologous to the ends of IS30 are found in the ends of bacteriophage Mu with its highest homology to the outermost left end (Ll) (8) and in IS4351 (30) (Fig. 4). 65% of the first 28 nucleotides of Mu Ll and 57% of the first 27 nucleotides of the left end of IS4351 are identical to the left end of IS30. The comparison of the right end of IS4351 with the right end of IS30 shows 69% homology of the last 26 nucleotides of the two elements. The two regions of the strong homology between the IS30 left end and Mu Ll contain the recognition sequence for the IS30 and the Mu transposase, and they are separated by one helical turn. For IS4351, no footprint data are available at the mo- ment.

On the protein level, homologous stretches of amino acid sequences can be found at least for some transposases. Inter- estingly, significant homology is observed between the IS30 transposase and the Mu repressor (31), which binds like the Mu transposase to the ends of the mobile genetic element. To a much greater extent, homology exists between the putative transposase of IS4351 and the IS30 transposase (1). The two proteins share more than a third of identical amino acids. The less pronounced homology on the nucleotide level be- tween these two transposase genes indicates a conservation of a similar function and probably a possible common evolu- tionary origin of these different mobile genetic elements.

Secondary Structure Predictions-It is shown for the Xcro and other proteins that helix-turn-helix motifs are secondary

Left end Mu (Li) 5’ TGTATTGATTCACTTGAAGTACGAAAAA 3 Left end IS4351 5’ CTTGCAGTTCAACTTATAAATGCAACT 3 Left end IS30 5’ TGTAGATTCAATTGGTCAACGCAACA 3

. 0 00....0cJ.0 0 0.0.0..00

Right end IS30 5’ TGTAGATTCAATCTGTCAATGCAACA 3’ Right end 184351 5’ GCTGAATTCAACTT$CAAATGCAACA 3’

. . . . . . . . . . . . . . .

FIG. 4. Comparison of the ends of IS30 with those of IS4351 and the Mu Ll sequence. The homologies between the left end of IS30 and either Mu Ll or IS4351 are indicated by 0, identical nucleotides in all three transposable elements are indicated by 0. Identical nucleotides in the right ends of IS30 and IS4351 are indi- cated by 0.

A L’ LI RI RI’

56 76

jl

_ .-i .* a. -a

-e .(l --

B I 10 . , LEFT END IS30 5~bGTAGATT&TTGGTCAA~GCAA&GTT~TGTGAAMtiT 3’

3’ACATCTAAGTTAACCAGTTGCGTTGTCAATACAGTTTTGTA 5’ , . 1220 1210 1200 llP0

. I

RIGHT E N D 1.530 ~'TCTAGATTCAA~CTGTCAATG~~~~~~T~TCAATTAT~ 3' 3'ACATCTAAGTTAGACAGTTACGTTGTGGGGAAAGTTlUiTAG 5'

, .

FIG. 3. DNaseI footprint analysis. A: lanes I and 2, the 368-bp FnuDII-PuuII fragment of pAW305 containing the left end of IS30 labeled at the FnuDII site (LZ). Lanes 3 and 4, the 368-bp FnuDII- PuuII fragment of pAW305 labeled at the PuuII site (LII). Lanes 5 and 6, the 303-bp B&II-PuuII fragment of pAW305 containing the right end of IS30 labeled at the BglII site (RI). Lanes 7 and 8, the same BglII-PuuII fragment as in lanes 5 and 6 but labeled at the PuuII site (RII). In lanes 2, 4, 6, and 8, the 17-kDa N-terminal transposase fragment was added to the reaction. In lanes l-8, DNaseI was added to the DNA fragments. The protected DNA regions are indicated by the brackets to the right of these lanes. The guanidine residues (lanes G) and the purine residues (lanes G/A) in the four DNA fragments were determined according to the method of Maxam and Gilbert (41). The numbers to the right of the G/A reactions indicate the coordinates on the IS30 sequence (8). B: the nucleotides between the arrows were protected by the 17-kDa protein against DNaseI digestion. The asterisk (*) indicates the last nucleotide of the 26-bp-long terminal inverted sequence at the ends of the element. The numbers above the nucleotide sequences refer to the coordinates of the IS30 sequence (8).

by guest on April 4, 2018

http://ww

w.jbc.org/

Dow

nloaded from

N Terminus of IS30 Transposase Has DNA-binding Activity 3761

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1R 19 20

Lsmbdarep 33 Gl*-Gl"-S~r-"al-All-Asp-Lys-Met-Gly-Het-GLy-Gln-Ser-Gly-"~l-Gly-Ala-Le"-Phe-Asn 52 Lambdacro 16 Gl*-Tht-Ly~-Thr-Al~-Ly~-Asp-Leu-Gly-Val-Tyr-Gln-Ser-Ala-Ile-A~n-Ly~-Ala-Ile-Bis 35 434rep n Gln-Ale-Gl"-Le"-*la-Gln-lys-Val-Gly-~h~-~h~-Gl~-Gl"-a~~-~l~-Gl"-Gl"-L~"-Gl"-A~* 36 434cro 19 Gln-~hr-Gl"-Leu-Ala-Thr-lys-Ala-Gly-"~l-Ly~-Gl~-Gl"-s~~-~l~-Gl~-L~"-~l~-Gl~-*l~ 38 IS3OTnp 12 Ser-Val-Phe-Glu-Leu-Trp-Lys-Asn-Gly-Thr-Gly-Phe-Ser-Gl"-Il~-Thr-Asn-Ile-Leu-Gly 31

I HELIX 2 TUKN

I HELIX 3

I

FIG. 5. Secondary structure prediction. The secondary structure analysis of the IS30 transposase was done according to the methods of Chou and Fasman (33) and Garnier et al. (34). The amino acid sequences were aligned with the n2-a3 sequences of Xcro and X-repressor, as well as with 434 cro and 434 repressor (434 rep). The numbers to the right and left of the protein sequences refer to the positions of the first and last amino acids shown, respectively. The numbers on top of the sequences indicate the positions of individual amino acids in the motif. The sequence information for the alignment was taken from Pabo and Sauer (32).

structures frequently involved in promoting DNA-protein in- teractions (32). Examination of the amino acid sequence of the IS30 transposase according to the methods of Chou and Fasman (33) and Garnier et al. (34) revealed one possible LY- helix-turn-a-helix motif in the N-terminal part of the protein. Other DNA-binding motifs such as zinc fingers (35) or leucine zippers (36) could not be found in the sequence of the IS30 transposase.

Comparison of the possible helix-turn-helix motif with a master set of reference sequences reveals a score of 0.82 if calculated according to the method of Brennan and Matthews (37). Protein sequences with scores below 0.80 are the most probable candidates to contain a helix-turn-helix motif, whereas those with scores close to the upper limit of 1.0 have a small likelihood for this kind of secondary structure. The score for the IS30 transposase does not indicate a very strong probability for a helix-turn-helix motif; however, there is a number of proteins with predicted helix-turn-helix motifs which agree poorly with the reference sequences. Examples are proteins containing the homeo box, resolvases, and inver- sion proteins (37). Fig. 5 shows a comparison of the relevant IS30 transposase sequence with four well characterized DNA- binding proteins. The most highly conserved positions in the helix-turn-helix motif in the reference sequences are 5, 9, and 15. Rules are proposed in which residue 5 should not be a /3- branched amino acid; residue 9 should be a glycine, and at positions 4 and 15, no charged amino acid should be located (32, 37). In addition, there should be no proline in the two helices.

The predicted helix-turn-helix motif of the IS30 transpos- ase agrees with these rules with respect to the positions 9 and 15 and the lack of proline, whereas a charged residue (glutamic acid) is found at position 4, and a branched amino acid leucine) is at position 5 in the first helix.

Our in vitro studies located the DNA-binding activity to the 17-kDa N-terminal end of the IS30 transposase. However, no strong homology to a known secondary structure motif responsible for DNA binding could be found. Future experi- ments have to show whether the possible helix-turn-helix motif of the transposase is involved in the specific DNA- protein interaction.

Modular Organization of the IS30 Transposase-Our results show that (i) the DNA-binding property of the transposase is present in the N-terminal part of the protein, and (ii) a functional DNA-binding domain could be formed in the ab- sence of the C terminus of the protein. A similar result was obtained with N-terminal fragments of the bacteriophage D108 transposase (26) and of the transposase of phage Mu (25). Specific DNA binding of a small C-terminal fragment of the yd-resolvase could be demonstrated, thereby suggesting a modular construction of the resolvase protein (38). Results obtained with the bacteriophage Mu transposase indicate that

this protein consists of three distinct domains in which the N-terminal domain provides the site-specific interaction with the ends of the transposable element. It is proposed that the core domain is the catalytically active part of the protein, whereas the C terminus mediates protein-protein interactions (39). We favor the hypothesis that also the IS30 transposase is built up of functionally separated domains. Evidence from our genetic experiments indicates a similar organization of the IS30 transposase as it is proposed for the Mu transposase.’

Acknowledgments-We would like to thank Angelo Guidolin, Phi- 1iDD Hiibner. and Heini Sandmeier for stimulating discussions; Die- t&h Stiiber’ from Hoffmann-La Roche AG for the kind gift of the plasmids pDMI,l and pDS78; and Renate Gyalog for her expert help in the electron microscopical investigations. Special thanks go to Johannes Hegemann for his help in the oligonucleotide-directed mutagenesis.

1.

2.

3.

4.

5.

6.

7.

8.

9. 10. 11. 12.

13.

14.

15. 16.

17.

18.

19.

REFERENCES

Syvanen, M. (1988) in Genetic Recombinntion (Kucherlapati, R., and Smith, G. R.. eds) vv. 331-356, American Society of Mi- crobiology,‘Wash.; D. C: _

Hartl, D. L., and Sawyer, S. A. (1988) in Transposition (Kings- man, A. J., Chater, K. F., and Kingsman, S. M., eds) pp. 91- 106, Cambridge University Press, Cambridge, United Kingdom

Craigie, R., Mizuuchi, M., and Mizuuchi, K. (1984) CeU 39,387- 394

Ichikawa, H., Ikeda, K., Wishart, W. L., and Ohtsubo, E. (1987) Proc. Natl. Acad. Sci. U. S. A. 84. 8220-8224

Mizuuchi, K., and Craigie, R. (1986j Annu. Reu. Genet. 20, 385- 429

Grindley, N. D. F., and Reed, R. R. (1985) Annu. Rev. Biochem. 54,863-896

Caspers, P., Dalrymple, B., Iida, S., and Arber, W. (1984) Mol. Gem Genet. 196,68-73

Dalrymple, B., Caspers, P., and Arber, W. (1984) EMBO J. 3, 2145-2149

Dalrymple, B., and Arber, W. (1985) EMBO J. 4, 2687-2693 Dalrymple, B., and Arber, W. (1986) Gene (Am&.) 44, l-10 Stalder, R., and Arber, W. (1989) Gene (Am&.) 76, 187-193 McKown, R. L., Orle, K. A., Chen, T., and Craig, N. L. (1988) J.

Bacterial. 170, 352-358 Messing, J., Crea, R., and Seeburg, P. H. (1981) Nucleic Acids

Res. 9,309-321 Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Geruz

(Am&) 33, 103-l 19 Minton, N. P. (1984) Gene (Am&.) 31, 269-273 Certa. U.. Bannwarth. W. Stiiber. D.. Gentz. R.. Lanzer. M..

Ledrice, S., Guillot, b., Wendler,’ I., Husmann, d., Bujarh, H.; and Mous, J. (1986) EMBO J. 5,3051-3056

Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Miller, J. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Stormo, G. D., Schneider, T. D., and Gold, L. (1982) Nucleic Acids Res. 10,2971-2996

’ F. Olasz, manuscript in preparation.

by guest on April 4, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3762 N Terminus of IS30 Transposase Has DNA-binding Activity

20.

21.

22.

23.

24. 25.

26. 27.

28.

29.

30.

Kramer, W., Drutsa, V., Jansen, H. W., Kramer, B., Pflugfelder, M., and Fritz, H. J. (1984) Nucleic Acids Res. 12, 9441-9454

Hochuli, E., Debeli, H., and Schacher, A. (1987) J. Chromatogr. 411, 177-184

deBoer, H. A., Comstock, L. J., and Vasser, M. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 21-25

Kane, J. F., and Hartley, D. L. (1988) Trends Biotechnol. 6, 95- 101

Morisato, D., and Kleckner, N. (1987) Cell 51, 101-111 Betermier, M., Alazard, R., Ragueh, F., Roulet, E., Toussaint, A.,

and Chandler, M. (1987) Mol. Gen. Genet. 210, 77-85 Tolias, P. P., and Dubow, M. S. (1987) Virology 157, 117-126 Prentki, P., Gamas, P., Galas, D., and Chandler, M. (1987) in

DNA Replication and Recombination (McMacken, R., and Kelly, T. J., eds) pp. 719-734, Alan R. Liss, Inc., New York

Way, J., and Kleckner, N. (1984) Proc. Natl. Acad. Sci. U. S. A. 81,3452-3456

Johnson, R. C., and Reznikoff, W. S. (1983) Nature 304, 280- 282

Rasmussen, J. L., Odelson, D. A., and Macrina, F. L. (1987) J. Bacterial. 169, 3573-3580

31. 32.

33.

34.

35.

36.

37.

38.

39.

40. 41.

Dalrymple, B. (1986) FEBS Lett. 208, 7-10 Pabo, C. O., and Sauer, R. T. (1984) Annu. Reu. Biochem. 53,

293-321 Chou, P. Y., and Fasman, G. D. (1978) Adu. Enzymol. 47, 54-

148 Garnier, J., Osguthorpe, D. J., and Robson, B. (1978) J. Mol.

Biol. 120,97-120 Miller, J., McLachlan, A. D., and Klug, A. (1985) EMBO J. 4,

1609-1614 Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1988)

Science 240, 1759-1764 Brennan, R. G., and Matthews, B. W. (1989) J. Biol. Chem. 264,

1903-1906 Abdel-Meguid, S. S., Grindley, N. D. F., Smith Templeton, N.,

and Steitz, T. A. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 2001-2005

Nakayama, C., Teplow, D. B., and Harshey, R. M. (1987) Proc. Natl. Acod. Sci. U. S. A. 84, 1809-1813

Laemmli, U. K. (1970) Nature 227,680-685 Maxam, A. M., and Gilbert, W. (1977) Proc. Natl. Acad. Sci. U.

S. A. 74,560-564

by guest on April 4, 2018

http://ww

w.jbc.org/

Dow

nloaded from

R Stalder, P Caspers, F Olasz and W Arberspecifically with the terminal inverted repeats of the element.

The N-terminal domain of the insertion sequence 30 transposase interacts

1990, 265:3757-3762.J. Biol. Chem. 

  http://www.jbc.org/content/265/7/3757Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/265/7/3757.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on April 4, 2018

http://ww

w.jbc.org/

Dow

nloaded from