principlesofpcr · principlesofpcr • principles* • designofprimers • pcrforcloning ......

24

Principles of PCR • Principles • Design of primers • PCR for cloning • Real 3me PCR • Error frequency • Tips and tricks

Upload: others

Post on 14-Oct-2020

9 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Page 1: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Principles of PCR

•  Principles •  Design of primers •  PCR for cloning •  Real 3me PCR •  Error frequency •  Tips and tricks

Page 2: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.1 p 148

Page 3: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.2 p 149

Page 4: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.3, 9.4 p 149

Page 5: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.5 p 150

Page 6: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.6 p 150

Page 7: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.7 p 152

Page 8: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Page 9: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Page 10: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.8 p 153

Page 11: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Page 12: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.9 p 154

Page 13: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.10 p 155

Page 14: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.11 p 155

Page 15: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.12, 9.13 p 156

Page 16: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.14 p 157

Page 17: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.15 p 157

Page 18: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.16 p 158

Page 19: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Page 20: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.18, p 160

Page 21: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.19 p 160

Page 22: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Fig 9.20 p 161

Page 23: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Page 24: Principles*of*PCR · Principles*of*PCR • Principles* • Designofprimers • PCRfor*cloning* ... give amplification products (b) PCR of human DNA with 17-mer primers Only the desired

Tips and tricks

•  Make a master mix solu3on (i.e. mix buffers, water, dNTP:s) enough for all samples plus one

•  Use the protocol recommended by the manufacturer

•  Use fresh solu3ons •  Avoid contamina3on •  Are there any possible inhibitors in your sample? Increase volume of added polymerase

PCR with arbitrary primers - Gene bank · uses a short primer ... Copyright: IPGRI and Cornell Univ ersity, 2003 PCR with arbitrary primers 15! Dominant!

Supplemental table 1 : List of primers used for Me-DIP coupled Q-PCR

Lab safety Documentation, GLP Practical tips; primers and PCR

Appendix 1 List of primers and PCR conditions - CORE · Appendix 1 List of primers and PCR conditions CRB1gene Primer Sequence Product (kb) PCR Mix PCR Conditions exon11_1F ACCAATGTATTCAACAGGGACC

Primers - needhammicrobialecology.files.wordpress.com€¦ · Web viewAppendix 4: PCR clean-up notes17. Appendix 5: Sequencing Submission18. References:19. Primers. 1,2, 5’->3’,

PCR - edisciplinas.usp.br · Primers X Anticorpos. 10. Alinhamento gene codificador proteína capsídeo Isolados de Calicivírus felino Região de alta variabilidade. Primers/Bases

Polymerase Chain Reaction (PCR) · in PCR is Dependent on the Primers • The PCR reaction will amplify the DNA section between the two primers. • If the DNA sequence is known,

Reação Polimerásica em Cadeia (PCR) - dbbm.fiocruz.br · (PCR) PCR - consiste em fazer cópias de DNA “in vitro”, ... 2. Anneal: 37 ° C - 65 ° C Primers bind to specific

Molecular systematics of the barklouse family Psocidae ... · Primers and PCR pro- ... TYG GNC AYC CHG AAG T) + H7005 for second PCR of weak initial PCR products

Evaluation and optimization of PCR primers for …...METHODS AND PROTOCOLS Evaluation and optimization of PCR primers for selective and quantitative detection of marine ANME subclusters

Nested PCR,Fusion primers, Integrated PCR

Supplementary table 1: Primers used for PCR amplification

Zip Nucleic Acids: new high affinity oligonucleotides as potent primers for PCR and reverse transcription

Analytes and Related PCR Primers Used for GMO Detection ...publications.jrc.ec.europa.eu/repository/bitstream... · Analytes and Related PCR Primers Used for GMO Detection and Quantification

Phylogenetic placement of Cryptophiale Cryptophialoidea ...mycosphere.org/pdf/MYCOSPHERE_9_6_5.pdf · 1134 of PCR products were carried out using the above-mentioned PCR primers at

TABLE S1 – Primers Used for Cloning, Quantitative PCR/RT … · Quantitative RT-PCR primers Gene Genebank Forward Primer Reverse Primer ... E p C A s e r a ( A - 2 0 OD490nm

Basic Principles and Components of PCR

Principles*of*PCR - ifm.liu.se€¦ · PCR primers are generally 15-30 nucleotides long. Optimal GC content of the primer is 40-60%. Ideally, C and G nucleotides should be distributed

two primers are used in pcr

Zero Blunt PCR Cloning Kit - Thermo Fisher Scientifictools.thermofisher.com/content/sfs/manuals/zeroblunt_man.pdf · Introduction ... Sequence of primers ... The Zero Blunt® PCR

Laboratorio PCR y diseno primers (1).pdf

Finding the Right Primers: Using NCBI for RT-PCR Primer Design

Specificity, Efficiency, and Fidelity of PCR...PCR generated a number of unspecific bands or if a different set of primers (i.e., internal primers) is to be utilized for the subsequent

Design and standardization of PCR primers and protocols for …€¦ · · 2015-03-10LEADING ARTICLE Design and standardization of PCR primers and protocols for detection of clonal

Fingerprinting Genomes Using PCR With Arbitrary Primers

Polymerase Chain Reaction (PCR). Tópicos 1. DNA 2. PCR –Alvos –Denaturação –Primers –Anelamento –Ciclos –Requerimentos

An introduction to PCR primer design, the features …PCR primer design is a critical step in all types of PCR methods The design of polymerase chain reaction (PCR) primers, like the

PCR en Tiempo Real. ADN molde Primers Taq polimerasa dNTPs MgCl 2 Buffer Fluorocromo

Nonaplex PCR using Cliffhanger primers to identify

DynamicsofMyosinHeavyChainGeneRegulationinSlow … · The MHC mRNA isoform distribution was evaluated by RT with random primers followed by PCR with primers targeting the embryonic,

The first PCR cycle: The sequence between the two primers will be amplified

Basic Principles of Real-Time PCR

Principles of PCR Small

sem4-cdna sythesis,pcr,designing primers for pcr, synthesis of genes, shotgun experiment and gene library

Synthetic Biology for - 2015.igem.org2015.igem.org/.../c/cb/IGEM5_OurProject_InversePCR.pdf · 2015-09-19 · Our Primers in Inverse PCR In PCR, the primers are part of the newly