Bulletin of Insectology 68 (1): 65-72, 2015 ISSN 1721-8861

Presence of kdr and s-kdr resistance in Musca domestica populations collected in Piacenza province (Northern Italy)

Emanuele MAZZONI1, Olga CHIESA

1, Vincenzo PUGGIONI

1, Michela PANINI

1, Gian Carlo MANICARDI

2,

Davide BIZZARO3

1Dipartimento di Scienze delle Produzioni Vegetali Sostenibili - Area Protezione sostenibile delle piante e degli ali-

menti, Università Cattolica del Sacro Cuore, Piacenza, Italy 2Dipartimento di Scienze della Vita, Università di Modena e Reggio Emilia, Reggio Emilia, Italy

3Istituto di Biologia e Genetica, Università Politecnica delle Marche, Ancona, Italy

Abstract

Pyrethroid insecticides combine a high efficacy against insects with a low toxicity towards warm-blooded vertebrates. For this

reason they are largely used to control housefly infestations. The efficacy of these products is affected by insecticide resistance

mechanisms. In particular, some mutations in the sodium channel coding sequence are responsible for target-site resistance to

pyrethroid insecticides. This work presents a new molecular approach based on allele-specific PCRs to point out and to

characterise this resistance mechanism in two M. domestica populations (PNT and TRV) collected near Piacenza (Northern Italy).

The presence of different kdr and s-kdr genotypes was assessed for population PNT whilst kdr only was detected in population

TRV. Dose-response bioassays evidenced quite high resistance factors, expecially for population PNT. This is in line with the kdr

and s-kdr frequencies observed in the assayed populations.

Key words: housefly, insecticide resistance, sodium channel, PASA, haplotypes, Italy.

Introduction

The common housefly Musca domestica L. (Diptera

Muscidae) is a well known pest for health threat as it is

capable to transmit and to distribute many human and

animal pathogens in the environment (Graczyk et al.,

2001; Forster et al., 2007). This insect usually finds in

farms, dairies and also urban dumps suitable environ-

ments for the development and rapid growth of its popu-

lations (Raspi and Belcari, 1989; Trentini et al., 1999;

Cao et al., 2006). For this reason, nuisance to livestocks

and people living in the surroundings cannot be ne-

glected (Howard, 2001; Winpisinger et al., 2005).

Insecticide applications are commonly used to control

housefly populations. In the past, organochloride insec-

ticides like DDT (IRAC MOA 3B, www.irac-online.org)

have been widely and intensively used to limit the

spread of this species. Today, pyrethroid insecticides

(IRAC MOA 3A) represent an important part of the

chemicals adopted for housefly control, as they combine

high efficacy against this pest with a quite low toxicity

towards warm-blooded vertebrates. In addition, this

class of products avoid the long term environmental pol-

lution caused by organochlorine insecticides.

Di-phenyl ethane (like DDT) and pyrethroid insecti-

cides act as modulators of the voltage-gated sodium

channels, membrane proteins that are responsible for the

transmission of nerve impulses. Their interaction with

the channel protein result in electrical signalling altera-

tion that culminates with the paralysis and the conse-

quent dead of the insect.

Unfortunately, insecticide treatments cannot be so ef-

ficacious because of unsatisfactory environment man-

agement strategies that do not consider the high growth

rate of this pest and also because insecticide resistance

mechanisms have been developed and selected in

housefly populations. During the years, the insecticide

abuse have exerted high selection pressure on the popu-

lations selecting different resistant mechanisms, due to

an increased production of detoxifying enzymes or to

structural changes in the pesticide target proteins (Liu

and Pridgeon, 2002). The most important mechanism of

resistance to pyrethroids is target-site insensitivity con-

ferred by mutations which occur in the sodium channel

coding sequence. They cause a reduction of the insecti-

cide binding affinity, compromising the effectiveness of

the insecticide applications and seriously affecting the

integrated management strategies.

Several point mutations have been described in this

target, in M. domestica as well as in many others insect

species (Davies et al., 2007; Soderlund, 2012; Rinke-

vich et al., 2013; Dong et al., 2014). The two most im-

portant non-synonymous mutations found to confer py-

rethroid resistance were first described in housefly and

are known as “knock-down resistance” (kdr) and “su-

per-kdr” (s-kdr) (Williamson et al., 1996). They are re-

sponsible for amino acid substitutions located in the

same functional domain: L1014F for the former and

M918T for the latter (Soderlund and Knipple, 2003).

In houseflies there is an additional mutation located in

the kdr locus and involved in pyrethroid resistance. It is

referred as “kdr-his” and causes a different amino acid

replacement, from Leu to His (L1014H) (Liu and Prid-

geon, 2002; Rinkevich et al., 2012).

Insecticide bioassays do not provide enough informa-

tion about the presence of these mutations and their alle-

lic variants, while a rapid identification is possible by

using a biomolecular approach. Different methods have

been developed in order to detect kdr mutations: PCR-

RFLP, allele-specific PCRs or direct sequencing (Huang

et al., 2004; Rinkevich et al., 2006; Qiu et al., 2012).

On the contrary, till now s-kdr has been detected only

66

by direct sequencing (Rinkevich et al., 2006). In M.

domestica, the analysis of mutation frequencies in volt-

age gated sodium channel can give important informa-

tion about the resistance levels of the analysed popula-

tions and it could be an interesting tool to evaluate the

efficacy of control strategies based on pyrethroid appli-

cations. Recent insecticide bioassays carried on an Ital-

ian population of M. domestica collected from a poultry

farm showed the presence of high resistance levels to-

wards several active ingredients but no evidences about

the resistance mechanisms involved were provided

(Pezzi et al., 2011).

Our study aims to point out the presence and involve-

ment of target-site resistance to pyrethroid insecticides

in two populations of M. domestica collected near

Piacenza (Northern Italy, Po valley), analysed with a

new molecular approach which allows the detection of

the three known amino acidic substitutions in the volt-

age gated sodium channel.

Materials and methods

Insects: origin and rearing Adult houseflies were collected in 2010 in two live-

stock farms located in Piacenza province. The first one, a

modern stable which uses regular insecticide applications

in order to control the housefly populations, was near a

small town named Pontenure (PNT). The second one, a

small traditional stable not applying any control strate-

gies against flies, was near Trevozzo village (TRV).

For each sampling area, a population was originated

from the collected insects and maintained in rearing

cages under controlled conditions (21 °C ± 0.5 °C), with

water and dry mixture of sucrose and milk powder (1:1)

always available. A mixture of bran and milk powder

(4:1) moistened with tap water was used as oviposition

substrate. Eggs were collected every 2 days and trans-

ferred into a rearing substrate (bran: 25% w/w; milk

powder: 5% w/w; water: 70% w/w). Puparia were col-

lected regularly and transferred to another cage for the

next generations.

A susceptible population (S-WHO), used as reference,

was kindly provided by Ralf Nauen (Bayer Crop Sci-

ence, Monheim, Germany) and was maintained in the

same conditions.

Genomic extraction Genomic DNA was extracted from the heads of indi-

vidual adult, following a „salting-out‟ protocol already

described (Panini et al., 2014). Heads were homoge-

nized using a QIAGEN TissueLyser LT for 30 s at 50

Hz in a 2 mL tube containing one stainless steel bead

and 300 μL TNES buffer pH 7.5 (50 mM Tris, 400 mM

NaCl, 20 mM EDTA, 0.5% SDS) with proteinase K

(100 μg mL−1

). Homogenate was heated at 55 °C for 1 h

and then proteins were precipitated with 85 μL NaCl 5

M and pelleted at 16 000 × g for 5 min. DNA was iso-

lated from the supernatant by ethanol precipitation and

resuspended in 50 μL sterile water. The DNA concen-

tration was assessed using a Qubit Fluorimeter 2.0 in-

strument (Quant-iT ds DNA HS Assay kit; Invitrogen,

Carlsbad, CA, USA). The amount of genomic DNA ob-

tained was in the range 2–50 ng µL−1

.

PASA-PCR The presence of kdr (L1014F and L1014H) and s-kdr

(M918T) single point mutations was assessed with al-

lele specific polymerase chain reaction amplification

(PASA-PCR). A set of primers was designed (table 1)

using a cDNA M. domestica sodium channel gene cod-

ing sequence (Gene Bank accession number:

NM_001286885.1) and primer sequences from Huang

et al. (2004). A schematic representation of the primer

positions is reported in figure 1. The gene structure was

analysed by using Spidey (Wheelan et al., 2001), which

provide tools for the alignment between mRNA and ge-

nomic DNA sequences.

PASA-PCR mixtures contained 0.4 μM of each

primer, 1 μL of genomic DNA and 12.5 μL Dream Taq

Green PCR Master Mix (Thermo Scientific, Milan, It-

aly) in a total reaction volume of 25 μL. For both targets

amplification started with 2 min at 94 °C, followed by

30 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for

30 s, with a final elongation at 72 °C for 10 min.

Results of PASA-PCRs were validated by sequencing

the control fragments directly amplified with the exter-

nal primers, encompassing the mutations under investi-

gation, obtained from some samples randomly selected.

The obtained sequences were then aligned with the ge-

nomic reference sequence (Gene Bank accession num-

bers: NW_004774263.1 and NW_004765908.1) using

ClustalW (Thomson et al., 1994).

Table 1. Primers (5‟-3‟) used for kdr and s-kdr characterisation. Nucleotides reported in bold uppercase indicate their

specificity for the susceptible or the resistant alleles. The position of the primers is reported as the nucleotide num-

ber of the cDNA sequence (Gene Bank accession number: X96668).

Target Primer Direction Sequence 5'-3' Position References

kdr K1 FW tcgcttcaaggaccatgaat 2881-2901

kdr K2 RE ttacgtttcacccagttctta 3178-3199

kdr K3 FW acggtcgtgatcggcaatC 3035-3054 Huang et al., 2004

kdr K4 FW acggtcgtgatcggcaatT 3035-3054 Huang et al., 2004

kdr HF_KsH_F FW cggtcgtgatcggcaatcT 3036-3055

kdr HF_KrH_F FW cggtcgtgatcggcaatcA 3036-3055

s-kdr SK1 FW ttcgtgtattcaaattggcaaa 2709-2731

s-kdr SK2 RE cgaaaagttgcattcccatc 2836-2856

s-kdr SK3 RE acccattgtccggcccA 2767-2783

s-kdr SK4 RE acccattgtccggcccG 2767-2783

67

Figure 1. Scheme of M. domestica sodium channel gene, which focuses on the portion encompassing the mutations

of interest. A) Three exons are shown as grey boxes. The first one includes the s-kdr locus (triangle); the second

one includes the kdr locus (circle). B) SK1 and SK2 are the common external primers used to amplify the s-kdr re-

gion (145 bp); SK3 and SK4 are the internal specific primers used to amplify respectively the susceptible or the re-

sistant alleles (72 bp). K1 and K2 are the common external primers used to amplify the kdr region (448 bp); K3 and

K4 are the internal specific primers used to discriminate the polimorphisms of the first position of the codon

(295 bp), whilst HF_KsH_F and HF_KrH_F are the internal specific primers used to discriminate the polimor-

phisms of the second position of the codon (295 bp).

Characterisation of kdr mutations The presence of kdr mutations was assessed by com-

bining results from different specific PCR reactions.

The common external primers K1 and K2 amplify a

control band of 448 bp, while amplicons originated

from the common primer K2 and the allele specific

primers (K3, K4, HF_KsH_F and HF_KrH_F) produce

a fragment of 295 bp.

Specifically, PCRs were organised in two separate

groups in order to detect the nucleotide substitutions in

the first and second position of the kdr codon, respec-

tively.

The first PCR group combines the reverse common

primer K2 and the forward primers K3 (PCR-S1) or K4

(PCR-R1), specifically designed to detect nucleotide C

or T in the first position of the codon. It allows the de-

termination of the Phe substitution (TTT) but it is not

able to discriminate between wild-type susceptible Leu

(CTT) and resistant His (CAT).

The second PCR group combines the reverse common

primer K2 and the forward primers HF_KsH_F (PCR-

S2) or HF_KrH_F (PCR-R2), specifically designed to

detect nucleotide T or A in the second position of the

codon. It allows the determination of the His substitution

(CAT) but it is not able to discriminate between wild-

type susceptible Leu (CTT) and resistant Phe (TTT).

Results derived from the cross-check of the two PCR

groups allow the correct genotyping of the kdr locus. A

schematic overview is presented in figure 2.

Amplicons were visualised on 2% agarose gel stained

with Midori Green (NIPPON Genetics EUROPE

GmbH) (figure 3).

68

Figure 2. Schematic representation of the amplification

obtained with the PCRs used in this study. Black

boxes indicate positive amplification for the corre-

sponding genotype. PCRs S1 and R1 are used to dis-

criminate nucleotide C/T in the first position of the

codon; PCRs S2 and R2 are used to discriminate nu-

cleotide T/A in the second position of the codon.

Characterisation of s-kdr mutations The presence of the s-kdr mutation was assessed by

using 3 different PCR reactions. The combination of the

common external primers SK1 and SK2 amplifies a 145

bp control band . The combination of SK1 with SK3 or

SK4 amplifies respectively the susceptible or the resis-

tant allele, both producing 72 bp bands. Amplicons were

visualised on 3.5% agarose gel stained with Midori

Green (figure 4).

Insecticides bioassays Susceptibility toward technical grade methoxychlor

(Sigma-Aldrich) was investigated by using topical ap-

plication bioassays, according to Huang et al. (2004).

Insecticide solution in acetone (1 µL) was applied on

the notum of three days old females with an Hamilton

micro-syringe. For each experiment, 5-6 different con-

centrations of insecticide were prepared and used to

treat pools of 20 houseflies; a control group treated with

acetone only was included in each replicates. Each

group was maintained inside a vented plastic cylinder,

with water and food (dry milk and sucrose, 1:1 ratio)

supplied ad libitum and mortalities were assessed 24

hours after the treatment.

The experiment was replicated at least 4 different

times for each population (PNT, TRV and S-WHO).

Data obtained from the bioassays were pooled together,

corrected for control mortality by using Abbott‟s for-

mula (Abbott, 1925) and concentration-mortality rela-

tionships were estimated by probit analysis using

POLO-Plus software (LeOra Software, Berkeley, CA)

(Finney, 1971).

Results and discussion

Genotyping of kdr and s-kdr mutations Three different alleles for the kdr locus are known in

M. domestica: the wild-type codon „CTT‟ (Leu) and two

different resistant codons „TTT‟ (Phe) and „CAT‟ (His)

(Rinkevich et al., 2006).

In the TRV population (n = 30 specimens) only two

kdr alleles were found: 40% of the analysed individuals

carried the susceptible allele L1014, whilst 60% of them

showed the presence of the resistant allele F1014. In

particular, the majority of the flies was heterozygous

resistant (53%) and a small percentage carried the ho-

mozygous resistant genotype (7%) (table 2).

On the contrary, all the three possible kdr alleles were

detected in the PNT population (n = 40 specimens), with

different genotype combinations. The most diffuse

genotypes were L1014 + F1014 (35%) and F1014 +

H1014 (32.5%). In addition, homozygous resistant flies

for both amino acidic substitutions were found: 17.5%

for the F1014 allele and 7% for the H1014 allele (table

2).

The same flies were analysed for the presence of the

s-kdr mutation (M918T). It was found only in the PNT

population: 50% of the individuals showed a heterozy-

gous genotype and 2.5% a homozygous resistant geno-

type (table 3).

In addition, the mutation was found only in the pres-

ence of kdr F1014. No specimens bearing s-kdr muta-

tion without kdr (F1014) have been found. This is in

Table 2. Percentage of specimens with different kdr

genotype combinations in the two analysed popula-

tions, TRV (n = 30) and PNT (n = 40).

kdr genotype flies (%)

TRV PNT

L/L 40 2.5

L/F 53.3 35

L/H 0 5

F/F 6.7 17.5

F/H 0 32.5

H/H 0 7.5

Table 3. Percentage of specimens with different s-kdr

genotype combinations in the two analysed popula-

tions, TRV (n = 30) and PNT (n = 40).

s-kdr genotype flies (%)

TRV PNT

M/M 100 47.5

M/T 0 50

T/T 0 2.5

69

Figure 3. Amplification profile of different kdr genotypes: S1, R1, S2 and R2 are the allele-specific PCR reactions

(295 bp); C is the control band (448 bp). DNA ladder 100 bp (Thermo Scientific) is used as marker (M).

Figure 4. Amplification profile of different s-kdr genotypes: 1) Met/Met: homozygous susceptible (S: 72 bp); 2)

Met/Thr: heterozygous (S and R: 72 bp); 3) Thr/Thr: homozygous resistant (R: 72 bp); 4) negative control of each

PCR reaction. For each genotype a control band (C: 172 bp) is shown. DNA ladder 100 bp (Thermo Scientific) is

used as marker (M).

70

agreement with literature data and support the hypothe-

sis of the secondary origin of s-kdr mutation in respect

with kdr mutation and also that the presence of kdr is

compulsory to fix s-kdr mutation in the same allele (Lee

et al., 1999).

Haplotypes Some of the results obtained with allele-specific PCRs

were confirmed by direct sequencing of the control band

amplified with the external primers. Primers K1 and K2,

encompassing the kdr locus, amplify a region of 448 bp

and it is comprehensive of an intron of about 131 bp (in-

tron B) (figure 1) that has been described in the litera-

ture as a very high variable region. More than 120 hap-

lotypes, in several cases showing also insertions as well

as delections, have been reported till now (Rinkevich et

al., 2012).

Sequences derived from Italian samples carrying dif-

ferent kdr genotypes were aligned with all the housefly

sequences now available in GeneBank. The alignment

of intronic region B showed that the Italian specimens

with the susceptible homozigous genotype (Leu/Leu,

e.g. TRV 8) present the same intronic region of a Turk-

ish sample with same genotype (v11, accession number:

AY850269.2). Furthemore, the Italian samples with the

resistant homozigous (Phe/Phe, e.g. PNT 5) and het-

erozygous genotype (Phe/His, e.g. PNT 9) shoved the

same intronic region of samples derived from Turkey,

China and USA (kdr2, accession number: AY850261.2)

(Rinkevich et al., 2012) (figure 5).

Samples carrying genotypes Leu/Leu, Phe/Phe and

Phe/His showed chromatograms with single peaks; on

the contrary, other samples with different genotypes

(Leu/Phe and His/His) showed the presence of double

peaks which suggest the presence of two different in-

tronic region in the same specimen (data not shown).

Figure 5. Alignment of intronic region B of all the sequences available in GeneBank. Intronic region variations are

in grey boxes. The symbols identify two different haplotypes: samples PNT 5 (Phe/Phe) and PNT 9 (Phe/His) have

the same intronic sequence of AY805261.2 (kdr2, triangle) whilst TRV 8 (Leu/Leu) has 100% identity with

AY850269.2 (v11, circle).

71

Table 4. Log-dose probit-mortality data derived from methoxychlor topical application bioassays against adult flies.

LC50: lethal concentration that is expected to cause 50% of mortality; CI 95%: confidence interval limits at 95%;

R.F.: resistance factor calculated as the ratio between LC50 of resistant strain and LC50 of susceptible strain S-WHO.

Population LC50 (g L-1

) CI 95% Slope d.f. χ2 R.F.

S-WHO 0.43 0.30 - 0.61 1.36 ± 0.15 21 14.1 =

TRV 86.4 39.3 - 286 0.71 ± 0.12 14 18.6 201

PNT 1240 346 - 50600 0.67 ± 0.16 14 14.2 2876

This data suggest that at least two different alleles as-

sociated with mutation L1014H are present in population

PNT. Possibly, one of the allele is the same found in the

intronic region of kdr2 (see above), which correspond to

the Italian specimens with Phe/His genotype.

These results are in agreement with already published

data: the intronic sequence of kdr2 haplotype was

found to be the same for different kdr alleles (Leu, Phe,

His), whilst the intronic region of v11 haplotype was

found to be associated only with Leu (Rinkevich et al.,

2012).

Bioassays Preliminary bioassays were performed to estimate a

valid insecticide dose range. In the case of the suscepti-

ble population (S-WHO) the optimal range of technical

active ingredient was from 0.001 g L-1

to 10 g L-1,

while

for populations PNT and TRV the optimal range was

from 1 g L-1

to 200 g L-1

. Parameters of the estimated

“log-probit” mortality curves are reported in table 4.

The LC50 of population TRV, for which no control

strategies have been adopted, was lower than the LC50

of population PNT, derived from a farm that regularly

uses insecticide applications. Both of them were signifi-

cantly higher than the LC50 of the susceptible strain S-

WHO. Estimated resistance factors (RFs) were about

200 for population TRV and more than 2800 for popula-

tion PNT (table 4).

Conclusions

Pyrethroids are commonly used insecticides to control

houseflies. Target-site mutations responsible for pyre-

throid resistance have been documented in samples col-

lected in different locations worldwide (Ahmed and

Wilkins, 2002; Shono et al., 2002; Rinkevich et al.,

2007; 2012) but just a few information are available re-

garding the Italian situation (Pezzi, 2011) and no data

confirm the presence of the most common mutations

which are known to confer pyrethroid insensitivity.

This work evaluated the presence of kdr, kdr-his and

s-kdr mutations in Italian samples collected in livestock

farms of the Po valley. Even if only two populations

have been considered, the presence of target-site muta-

tions was reported, demonstrating for the first time their

involvement in pyrethroid resistance also in Italy. Inter-

estingly, one of those population was collected in a farm

where no insecticide treatments have been used, sug-

gesting the spread of target-site resistance around the

territory.

The molecular approach here reported represents a

possible alternative to the classic technologies till now

adopted to investigate the above reported mutations. In

fact, the allele-specific PCRs allow the rapid genotyping

of the kdr and s-kdr alleles with the reduction of the

costs required for the direct sequencing or for a PCR-

RFLP analysis. Moreover, our set of primers can detect

not only the classic kdr mutation (L1014F) but also the

other described amino acid replacement (L1014H) in

the same locus, thus avoiding the overestimation of the

susceptible allele and overcoming PCR-RFLP limitation

(Rinkevich et al., 2006).

The allele frequencies of kdr and s-kdr reported in

these two populations support the level of resistance that

have been found in dose-response insecticide bioassays

with methoxychlor, a chlorinated insecticide affecting

the same target of pyrethroids.

Significant resistant factors were estimated for both

the assayed populations but the highest resistance factor

was detected in population PNT, collected from a farm

which usually uses insecticide to control housefly popu-

lations. These results are in agreement with the calcu-

lated kdr and s-kdr frequencies: in population TRV only

kdr mutation was detected, and the resistant allele was

present in 60% of the analysed specimens, whilst popu-

lation PNT showed a consistent presence of kdr and s-

kdr mutations, with more than 90% of the individuals

carrying different kdr resistant genotypes and more than

50% the s-kdr mutation.

The study demonstrated the association of the resis-

tance-attributable mutations in the sodium channel gene

with insensitivity to methoxychlor insecticide. As it

shares the same mode of action of pyrethroids (IRAC 3

- sodium channel modulators), our results suggest the

possible involvement of the same mutations also in py-

rethroid resistance. We cannot exclude the involvement

of different resistance mechanisms like detoxification

systems based on P450 enzymes. Further investigations

with different insecticide products would be necessary,

including pre-treatment with PBO in order to better ex-

plore the influence of metabolic resistance.

Even if this study is based on a little number of popula-

tions, it confirms the presence of different genotype

combinations of target-site mutations that can influence

the efficacy of pyrethroids applications. Furthermore, the

intronic analysis of the region closed to the kdr locus

confirms that the haplotype variability, already detected

worldwide, is also present in our samples. Those results

support the multiple origin of target-site resistance al-

ready discussed by other authors (Rinkevich et al.,

2012). Moreover, the s-kdr mutation was not found to be

associated with a specific intronic region, supporting the

theory that it evolved from different kdr alleles.

72

The establishment of different combinations of resis-

tant alleles could be due to crosses among housefly

populations that are capable to spread around different

geographical areas and it is enhanced by their high re-

productive potential.

Additional analysis of a higher number of housefly

populations collected around Italy are then required to

better explain these aspects, to provide more details

about the current insecticide resistance situation in this

pest and to adopt and implement more efficacious insec-

ticide resistance management strategies.

Acknowledgements

The authors are grateful to Ralf Nauen (Bayer CropS-

cience AG, Global Biology Insecticides, Monheim,

Germany) for providing susceptible population S-WHO.

References ABBOTT W. S., 1925.- A method of computing the effectiveness of

an insecticide.- Journal of Economic Entomology, 18: 265-267.

AHMED S., WILKINS R., 2002.- Studies on some enzymes in-

volved in insecticide resistance in fenitrothion-resistant and -

susceptible strains of Musca domestica L. (Dipt, Muscidae).-

Journal of Applied Entomology, 126: 510-516.

CAO X. M., SONG F. L, ZHAO T. Y., DONG Y. D., SUN CH. X., LU

B. L., 2006.- Survey of deltamethrin resistance in house flies

(Musca domestica) from urban garbage dumps in Northern Chi-

na.- Environmental Entomology, 35: 1-9.

DAVIES T. G. E., FIELD L. M., USHERWOOD P. N. R., WILLIAM-

SON M. S., 2007.- DDT, pyrethrins, pyrethroids and insect so-

dium channels.- IUBMB Life, 59: 151-162.

DONG K., DU Y., RINKEVICH F., NOMURA Y., XU P., WANG L.,

SILVER K., ZHOROV B. S., 2014.- Molecular biology of insect

sodium channels and pyrethroid resistance.- Insect Biochemistry

and Molecular Biology, 50: 1-17.

FINNEY D. J., 1971.- Probit analysis.- Cambridge University

Press, Cambridge, UK.

FORSTER M., KLIMPEL S., MEHLHORN H., SIEVERT K., MESSLER

S., PFEFFER K., 2007.- Pilot studies on synantropic flies (e.g.

Musca, Sarcophaga, Calliphora, Fania, Lucilia, Stomoxys) as

vectors of pathogenic microorganisms.- Parasitology Research,

101: 243-246.

GRACZYK T. K., KNIGHT R., GILMAN R. H., CRANFIELD M. R.,

2001.- The role of non-biting flies in the epidemiology of hu-

man infectious diseases.- Microbes and Infection, 3: 231-235.

HOWARD J., 2001.- Nuisance flies around a landfill: patterns of

abundance and distribution.- Waste Management and Research,

19: 308-313.

HUANG J., KRISTENSEN M., QIAO C. L., JESPERSEN J. B., 2004.-

Frequency of kdr gene in house fly field populations: correla-

tion of pyrethroid resistance and kdr frequency.- Journal of

Economic Entomology, 97: 1036-1041.

LEE S. H., SMITH T. J., KNIPPLE D. C., SODERLUND D. M., 1999.-

Mutations in the house fly Vssc1 sodium channel gene associated

with super-kdr resistance abolish the pyrethroid sensitivity of

Vssc1/tipE sodium channels expressed in Xenopus oocytes.- In-

sect Biochemistry and Molecular Biology, 29: 185-194.

LIU N., PRIDGEON J. W., 2002.- Metabolic detoxication and the

kdr mutation in pyrethroid resistant house flies, Musca domes-

tica (L.).- Pesticide Biochemistry and Physiology, 73: 157-163.

PANINI M., DRADI D., MARANI G., BUTTURINI A., MAZZONI E.,

2014.- Detecting the presence of target site resistance to neoni-

cotinoids and pyrethroids in Italian populations of Myzus persi-

cae.- Pest Management Science, 70: 931-938.

PEZZI M., LANFREDI M., CHICCA M., TEDESCHI P., BRANDOLINI

V., LEIS M., 2011.- Preliminary evaluation of insecticide resis-

tance in a strain of Musca domestica (Diptera: Muscidae) from

an intensive chicken farm of Northern Italy.- Journal of Envi-

ronmental Science and Health B, 46: 480-485.

QIU X., PAN J., LI M., LI Y, 2012.- PCR-RFLP methods for detec-

tion of insecticide resistance-associated mutations in the house

fly (Musca domestica).- Pesticide Biochemistry and Physiology,

104: 201-205.

RASPI A., BELCARI A., 1989.- Alcune osservazioni sulla composi-

zione quali-quantativa della ditterofauna presente in stalle di bo-

vini per la produzione del latte.- Frustula Entomologica, 12: 1-13.

RINKEVICH F. D., ZHANG L., HAMM R. L., BRADY S. G., LAZZARO

B. P., SCOTT J. G., 2006.- Frequencies of the pyrethroid resistance

alleles of Vssc1 and CYP6D1 in house flies from the eastern

United States.- Insect Molecular Biology, 15 (2): 157-167.

RINKEVICH F. D., HAMM R. L., GEDEN C. J., SCOTT J. G., 2007.-

Dynamics of insecticide resistance alleles in house fly popula-

tions from New York and Florida.- Insect Biochemistry and Mo-

lecular Biology, 37: 550-558.

RINKEVICH F. D., HEDTKE S. M., LEICHTER C. A., HARRIS S. A.,

SU C., BRADY S. G, TASKIN V., QIU X., SCOTT J. G., 2012.-

Multiple origins of kdr-type resistance in the house fly, Musca

domestica.- PLoS ONE, 7: e52761.

RINKEVICH F. D., DU Y., DONG K., 2013.- Diversity and conver-

gence of sodium channel mutations involved in resistance to py-

rethroids.- Pesticide Biochemistry and Physiology, 106: 93-100.

SHONO T., KASAI S., KAMIYA E., KONO Y., SCOTT J. G., 2002.-

Genetics and mechanisms of permethrin resistance in the YPER

strain of house fly.- Pesticide Biochemistry and Phisiology, 73:

27-36.

SODERLUND D. M., 2012.- Molecular mechanisms of pyrethroid

insecticide neurotoxicity: recent advances.- Archives of Toxi-

cology, 86: 165-181.

SODERLUND D. M., KNIPPLE D. C., 2003.- The molecular biology

of knockdown resistance to pyrethroid insecticides.- Insect Bio-

chemistry and Molecular Biology, 33: 563-577.

THOMPSON J. D., HIGGINS D. G., GIBSON T. J., 1994.- CLUSTAL

W: improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, position‐specific gap

penalties and weight matrix choice.- Nucleic Acids Research,

22: 4673‐4680.

TRENTINI M., GOVERNATORI M., POCATERRA C., RUGGERI L.,

1999.- Monitoraggio delle mosche in tre caseifici della provin-

cia di Bologna.- Industrie alimentari, 38: 261-282.

WHEELAN S. J., CHURCH D. M., OSTELL J. M., 2001.- Spidey: a

tool for mRNA-to-genomic alignments.- Genome Research, 11:

1952-1957.

WILLIAMSON M. S., MARTINEZTORRES D., HICK C. A., DEVON-

SHIRE A. L., 1996.- Identification of mutations in the housefly

para-type sodium channel gene associated with knockdown re-

sistance (kdr) to pyrethroid insecticides.- Molecular and Gener-

al Genetics, 252: 51-60.

WINPISINGER K. A., FERKETICH A. K., BERRY R. L., MOESCH-

BERGER M. L., 2005.- Spread of Musca domestica (Diptera: Mus-

cidae), from two caged layer facilities to neighboring residences

in rural Ohio.- Journal of Medical Entomology, 42: 732-738.

Authors’ addresses: Emanuele MAZZONI (corresponding

author: emanuele.mazzoni@unicatt.it), Olga CHIESA, Vincenzo

PUGGIONI, Michela PANINI, Dipartimento di Scienze delle

Produzioni Vegetali Sostenibili - Area Protezione sostenibile

delle piante e degli alimenti, Università Cattolica del Sacro

Cuore, via Emilia parmense 84, 29122 Piacenza, Italy; Gian

Carlo MANICARDI, Dipartimento di Scienze della Vita, Uni-

versità di Modena e Reggio Emilia, Reggio Emilia, Italy;

Davide BIZZARO, Istituto di Biologia e Genetica, Università

Politecnica delle Marche, Ancona, Italy.

Received July 18, 2013. Accepted March 13, 2015.