posaconazole, a second-generation triazole antifungal drug ......posaconazole inhibits the hedgehog...

Small Molecule Therapeutics

Posaconazole, a Second-Generation TriazoleAntifungal Drug, Inhibits the Hedgehog SignalingPathway and Progression of Basal Cell CarcinomaBaozhi Chen1, Vinh Trang2, Alex Lee3, Noelle S.Williams4, Alexandra N.Wilson1,Ervin H. Epstein Jr3, Jean Y. Tang3,5, and James Kim1,2

Abstract

Deregulation of Hedgehog (Hh) pathway signaling has beenassociated with the pathogenesis of various malignancies, includ-ing basal cell carcinomas (BCC). Inhibitors of the Hh pathwaycurrently available or under clinical investigation all bind andantagonize Smoothened (SMO), inducing amarked but transientclinical response. Tumor regrowth and therapy failure were attrib-uted to mutations in the binding site of these small-moleculeSMO antagonists. The antifungal itraconazole was demonstratedto be a potent SMO antagonist with a distinct mechanism ofaction from that of current SMO inhibitors. However, itracona-zole represents a suboptimal therapeutic option due to its numer-ous drug–drug interactions. Here, we show that posaconazole,

a second-generation triazole antifungal with minimal drug–drug interactions and a favorable side-effect profile, is also apotent inhibitor of the Hh pathway that functions at the level ofSMO. We demonstrate that posaconazole inhibits the Hhpathway by a mechanism distinct from that of cyclopamineand other cyclopamine-competitive SMO antagonists but, sim-ilar to itraconazole, has robust activity against drug-resistantSMO mutants and inhibits the growth of Hh-dependent BCCin vivo. Our results suggest that posaconazole, alone or incombination with other Hh pathway antagonists, may bereadily tested in clinical studies for the treatment of Hh-depen-dent cancers. Mol Cancer Ther; 15(5); 866–76. �2016 AACR.

IntroductionInappropriate modulation of the Hedgehog (Hh) signaling

pathway—a highly conserved, fundamental developmental path-way (1)—leads to disorders of development and cancers (1). Thefirst cancers ascribed to defects in Hh pathway signaling werethose associatedwithBasal cell nevus syndrome (BCNS)orGorlinsyndrome (2), an autosomal dominant disorder associatedwith agermline loss of one copy of the PTCH1 gene (3). Basal cellcarcinoma (BCC) and medulloblastoma are the most commontumors in these patients (2).

Under normal homeostatic conditions, the binding of a Hhligand (SHH, IHH, or DHH in mammals; ref. 4) to Patched(PTCH), a 12-pass transmembrane protein, relieves its inhibition

of Smoothened (SMO), a 7-pass transmembrane protein. SMOaccumulates within the primary cilium followed by accumulationof GLI2 in the primary cilium. Once activated, GLI2 translocatesinto the nucleus to initiate the transcription of Hh target genes,including PTCH1 and GLI1 (4).

BCC is the most common cancer in the United States (3). ForBCNS patients, BCCs arise when the second copy of PTCH is lostdue to UV radiation (3). Sporadic BCC is also associated withinappropriate Hh pathway activity with �90% and �10% con-taining mutations in PTCH and SMO (3), respectively. Thus,nearly all BCC are driven by aberrant Hh pathway activation.

The strong degree of association between inappropriate Hhpathway activation and cancer suggested that abrogation of thepathway may be a viable therapeutic strategy. Cyclopamine, thefirst identified small-molecule Hh pathway antagonist (5), bindsto the SMO transmembrane domain to inhibit its activity (6).Major developmental efforts have produced numerous small-molecule pathway antagonists; of which most bind SMO nearthe cyclopamine-binding site despite the diversity of chemicalscaffolds (7). Currently, vismodegib (GDC-0449; Genentech/Roche), sonidegib (NVP-LDE225; Novartis), BMS-833923(XL139; Bristol-Myers Squibb), LY2940680 (Lilly), and PF-04449913 (Pfizer) are being evaluated in clinical trials. However,drug resistance has emerged due to the dearth of mechanisticdiversity. Resistance mechanisms include point mutations inSMO (8–13), pathway activation downstream of SMO(10,11,14), and induction of alternative pathways (11).

We have previously identified itraconazole, a widely used FDA-approved systemic antifungal drug, as a potent inhibitor of theHhpathway (15). Itraconazole inhibited SMO activity at a sitedistinct from cyclopamine and other clinically available SMOinhibitors and inhibited its accumulation in theprimary cilia.Due

1Hamon Center for Therapeutic Oncology Research, University ofTexas Southwestern, Dallas, Texas. 2Department of Internal Medicine,University of Texas Southwestern, Dallas, Texas. 3Children's HospitalOakland Research Institute, Oakland, California. 4Department of Bio-chemistry, University of Texas Southwestern, Dallas, Texas. 5Depart-ment of Dermatology, Stanford University, Stanford, California.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

B. Chen and V. Trang contributed equally to this article.

Current address for A. Lee: Department ofMolecular andMedical Pharmacology,University of California Los Angeles, Los Angeles, California.

Corresponding Author: James Kim, Department of Internal Medicine, HamonCenter for Therapeutic Oncology Research, University of Texas Southwestern,5323 Harry Hines Boulevard, Dallas, TX 75390-8593. Phone: 214-648-1456; Fax:214-648-4940; E-mail: [email protected]

doi: 10.1158/1535-7163.MCT-15-0729-T

�2016 American Association for Cancer Research.

MolecularCancerTherapeutics

Mol Cancer Ther; 15(5) May 2016866

on September 10, 2021. © 2016 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst January 28, 2016; DOI: 10.1158/1535-7163.MCT-15-0729-T

http://mct.aacrjournals.org/

to its distinct site of SMO antagonism, itraconazole also inhibitedthe activity of vismodegib- and sonidegib-resistant SMOmutantsin vitro and in vivo subcutaneous and orthotopicmodels ofmurinevismodegib-resistant SMOD477G medulloblastoma (16).

Itraconazole has now been tested in several small phase IIclinical trials for lung (17), prostate (18), andBCC(19) cancers. Inone clinical trial, BCCs treated with a short 1-month course ofitraconazole showed a significant reduction of tumor size andtumor cell proliferation that corresponded with suppression ofHh pathway activity (19).

However, itraconazole presents several challenges that limit itsclinical utility. Numerous drug–drug interactions complicate itsuse, particularly in elderly cancer patients who often requiremultiple medications. Furthermore, dose adjustments are neces-sary for renal and hepatic insufficiencies (20).

Posaconazole, a new generation FDA-approved triazole anti-fungal and a structural analogue of itraconazole (SupplementaryFig. S1), has an excellent long-term use safety profile with mildside effects. Posaconazole has fewer drug–drug interactions thanitraconazole (21) anddoes not require dose adjustmentwithmildto moderate renal or hepatic insufficiency (22).

Given the structural similarity to itraconazole and the demon-strated advantages in minimizing drug–drug interactions, wesought to investigate the ability of posaconazole to inhibit theHh pathway, and its efficacy against Hh pathway dependent BCC.

Materials and MethodsReagents

Posaconazole (Selleck Chemicals; S1257), voriconazole (Sell-eck Chemicals; S1442), vismodegib (GDC-0449; LC Laborato-ries), sonidegib (NVP-LDE225; LC Laboratories), and KAAD-cyclopamine (Calbiochem; 239804), SAG (Cayman Chemical;11914) were dissolved in DMSO. Arsenic trioxide (Sigma) wasformulated as previously described (16). 20(S)-hydroxycholes-terol (Steraloids Inc; C6480-000), lathosterol (Sigma), desmos-terol (Sigma), and cholesterol (Sigma) were prepared in ethanol.

For in vivo experiments, posaconazole oral suspension (Noxafil,Merck) was obtained from the pharmacies of the University ofTexas Southwestern (UTSW), Stanford Comprehensive CancerCenter or TheChildren'sHospital andResearchCenter atOaklandand diluted as necessary with sterile water.

Reporter-based assaysThe generation and maintenance of Shh-Light2, SmoA1-

Light, Ptch�/� MEFs (23) and Smo�/�fibroblast cell lines

(24) have been described previously. No authentication ofthese cell lines was performed. Plasmid constructs for SmoWT

or drug-resistant Smo mutants (25), GFP, Gli-dependent fireflyluciferase reporter, and TK-Renilla luciferase reporter (23) havebeen described previously. SHHN conditioned medium (CM)and HEK-293 CM (control) were collected as previouslydescribed (15) and were diluted 20-fold with the appropriatemedia for Hh pathway signaling assays. All reporter assays,including transient transfections, for Hh pathway activationwere performed in 24-well tissue culture plates as describedpreviously (15,16). Luciferase units were measured on a Fluos-tar Optima (BMG Labtech) with Dual Luciferase Assay ReporterSystem (Promega). GraphPad Prism software was used togenerate dose–response curves and IC50 values with fourparameter logarithmic nonlinear regression fitting.

Fluorescent BOPDIPY-cyclopamine competition assaysTheHEK-293 cell line stably expressing a tetracycline-inducible

Smo gene has been described previously (15,26). BODIPY-cyclo-pamine fluorescence was monitored using a FACScan (BectonDickinson) in the Moody Foundation Flow Cytometry Facility ofthe Children's Research Institute (UTSW). FACS data were ana-lyzed with FlowJo software.

Immunofluorescence imagingNIH-3T3 cells were cultured, treated, and stained with rabbit

polyclonal anti-SMO (1:750 dilution; ref. 25), mouse monoclo-nal antiacetylated tubulin (1:1,000 dilution; Sigma), goat anti-rabbit AlexaFluor 488 (1:667 dilution; Life Technologies) andgoat anti-mouse AlexaFluor 594 (1:667 dilution; Life Technolo-gies), as previously described (15). Microscopy images wereobtained by a Zeiss LSM 510 META confocal microscope in theLive Cell Imaging Core Facility (UTSW) as previously described(15).

In vivo studiesPharmacokinetic study. Please see Supplementary Informationfor full methods of the pharmacokinetic study. All studies wereapproved by and conformed to the policies and regulations ofthe Institutional Animal Care and Use Committees (IACUC) atUTSW. Mice were maintained in a standard facility and con-ditions of a 12-hour light/dark cycle, temperature, and humid-ity at UTSW. Mice were administered 1 dose of posaconazole(Noxafil, Merck) 30 mg/kg or 60 mg/kg by oral gavage andsacrificed at various time points. Drinking water was acidified(pH 2.5). Plasma was isolated from whole blood by centrifu-gation, treated with methanol containing formic acid andtolbutamide internal standard, and subsequent supernatantused for posaconazole measurement. An AB Sciex 3200 Qtrapmass spectrometer coupled to a Shimadzu Prominence LC withan Agilent XDB C18 chromatography column was used todetect posaconazole levels. Pharmacokinetic parameters werecalculated using the noncompartmental analysis tool in Phoe-nix WinNonlin (Certara Corp).

Drug treatment study. Mice were kept at standard conditions of a12-hour light/dark cycle, temperature, and humidity at the Chil-dren's Hospital Oakland Research Institute (CHORI). All of thestudies were approved by and conformed to the policies andregulations of the IACUC at CHORI. Autochthonous BCC tumorsfrom Ptch1þ/�;K14CreER2/þ;Trp53fl/fl mice (27) were obtained asdescribed previously (16) and digested to a single cell suspensionwith 0.5% Collagenase 1 (Life Technologies) in HBSS solution.The suspension was mixed 1:1 with Matrigel (Fisher Scientific)and injected subcutaneously into two distinct dorsal sites ofNOD/SCID mice (Jackson Laboratories). When BCCs werebetween 5 and 10mm in diameter, mice were treated with vehiclecontrol or posaconazole 30or 60mg/kg via oral gavage twice dailyon weekdays and once daily on weekends. At the end of theexperiment, mice were euthanized and tumor samples werecollected.

Necrosis scoring of BCC tumors. Scoring of hematoxylin andeosin (H&E) sections of BCC tumors after the drug treatmentstudy has been described previously (15). Necrosis was scoredas follows: 0, no evidence of necrosis with large basaloid cells;

Posaconazole Inhibits the Hedgehog Signaling Pathway

www.aacrjournals.org Mol Cancer Ther; 15(5) May 2016 867




1, mild necrosis with nuclear pyknosis; 2, moderate necrosiswith <25% necrosis; 3, severe necrosis with >25% necrosis.Comparison between cyclodextrin control and posaconazole-treated tumors was made using a two-sided unpaired t test withGraphPad Prism software.

Quantitative PCR of GLI1 transcript in BCC cells and allografts.Generation and maintenance of BCC cell lines ASZ and BSZ havebeen previously described (28). No authentication of these celllines was performed. After confluence, BCC cells were treatedwithdrugs for 2 days in growth medium except with 0.5% chelexedFBS. For BCC allograft tumors, tissue was collected 4 hours afterthe last dose of drug and flash frozen in liquid nitrogen. Tumorsweremechanically homogenized with aMinibeadbeater (BiospecProduct). Preparation of total RNA and cDNA have beendescribed previously (15). Gli1 mRNA was quantified usingBio-Rad CFX real-time cycler with SYBR (Bio-Rad) as previouslydescribed (16). Data are presented as fold induction relative tocontrol samples using the DDCt (2�DDCt)methodwithHprt1 as aninternal control gene.

Primers:

Gli1: forward: 50 AAGGAATTCGTGTGCCATTGGG, reverse: 50

ACATGTAAGGCTTCTCACCCGT.

Hprt1: forward: 50 CGTGATTAGCGATGATGAACCAGG, reverse:50 CATCTCGAGCAAGTCTTTCAGTCC.

ResultsPosaconazole's effect on Hh pathway activity was tested using

SHH-Light2 cells, a clonal NIH-3T3 cell line stably expressing an8x-Gli binding site-luciferase reporter (23). Posaconazole potent-ly inhibited SHHN CM (29) induced Hh pathway activation in adose-dependent manner with an IC50 of 880 nmol/L (Fig. 1A). Incontrast, voriconazole, another triazole antifungal drug (Supple-mentary Fig. S1) with a contrasting chemical backbone, didnot demonstrate any detectable inhibition of the Hh pathwayup to 40 mmol/L.

Posaconazole inhibits antifungal growth by its potent antag-onism of 14-a-lanosterol demethylase (14LDM), an enzyme

Figure 1.Posaconazole inhibits the hedgehog pathway. 8x-Gli–binding site luciferase reporter SHH-Light2 cells stimulated with SHHN CM were used. A, posaconazoleinhibited Hh pathway activation whereas voriconazole, another triazole antifungal drug, did not. B, inhibition of Hh pathway activation cannot be reversed withthe addition of cholesterol, lathosterol, and desmosterol—components of cholesterol biosynthesis downstream of 14a-lanosterol demethylase, the target ofposaconazole's antifungal activity. C, addition of cholesterol, lathosterol, and desmosterol in the absence of SHHNCMdid not induceHhpathway activity. Data,meanof triplicates � SD.

Chen et al.

Mol Cancer Ther; 15(5) May 2016 Molecular Cancer Therapeutics868




required for ergosterol biosynthesis in fungi and cholesterolbiosynthesis in mammals (30). HMG-CoA reductase antago-nists that inhibit cholesterol biosynthesis upstream of 14LDMhave been shown to inhibit Hh reception between PTCH andSMO in cells treated with cyclodextrin to deplete cellularsterols (31). We tested whether posaconazole's inhibition of14LDM in cholesterol biosynthesis may account for its abilityto inhibit Hh pathway activation. The addition of 25 mmol/Leach of cholesterol, lathosterol, and desmosterol—compo-nents of cholesterol biosynthesis downstream of 14LDM—toposaconazole and SHHN was unable to reverse the inhibitoryeffect of posaconazole (Fig. 1B). Cholesterol, lathosterol,and desmosterol alone were insufficient to induce Hhpathway activation in Shh-Light2 cells (Fig. 1C). These resultssuggest that posaconazole inhibits the Hh pathway by amechanism distinct from its antifungal inhibitory activity of14LDM.

Next, we mapped posaconazole's inhibitory effect on thepathway. Constitutively active Ptch�/� murine embryonic fibro-blast cells (23) were transiently transfected with an 8x-Gli lucif-erase reporter and treated with increasing concentrations of posa-conazole. Posaconazole inhibited theHh pathwaywith an IC50 of986 nmol/L (Fig. 2A), similar to SHH-Light2 cells (Fig. 1A). Incontrast, posaconazole had no inhibitory effect on Shh-Light2SmoA1 cells that stably expressed the constitutively active SMOA1(SMOW539L) mutant (ref. 23; Fig. 2B).

Results presented thus far suggested that posaconazole acteddownstream of PTCH and at or upstream of SMO in thepathway. To determine if posaconazole binds directly to SMO,we tested whether it could compete with cyclopamine, analkaloid that binds to the transmembrane domain of SMOand inhibits its activity (6). Tetracycline inducible, SMO-expressing HEK-293 cells (26) were treated with a fluorescentlylabeled BODIPY-cyclopamine (6) and varying concentrationsof KAAD-cyclopamine or posaconazole (Fig. 2C and D). BOD-IPY fluorescence was measured by flow cytometry. SMO-induced cells treated with BODIPY-cyclopamine (BD) 5nmol/L showed �10-fold increase in fluorescence over unin-duced cells (no tetracycline treatment; Fig. 2C). The increase influorescence of uninduced cells with BD from uninduced cellswith no BD was most likely due to nonspecific binding of BD(Fig. 2C). The addition of KAAD-cyclopamine 200 nmol/L and400 nmol/L (�10� and 20� IC50, respectively), a more potentderivative of cyclopamine (23), to BD-treated SMO-overexpres-sing cells reduced the fluorescence of BD bound to SMO tobaseline levels (Fig. 2D), reflecting the competition of KAAD-cyclopamine and BD for binding to SMO (Fig. 2D). However,the addition of increasing concentrations of posaconazole, upto 10 mmol/L (�11 � IC50), did not significantly decrease thefluorescence of BODIPY-cyclopamine bound to SMO (Fig. 2E).These results suggest that posaconazole does not bind to SMOat the same site as cyclopamine.

To further verify that posaconazole did not bind to SMO inthe same binding region as cyclopamine, Hh pathway activitywas induced with SAG, a small-molecule SMO agonist thatcompetes with cyclopamine for binding (32), and competedwith KAAD-cyclopamine or posaconazole (Fig. 3A and B).Titration of SAG with increasing concentrations of KAAD-cyclopamine from 0 to 100 nmol/L (5 � IC50) shifted theEC50 of SAG more than 7-fold from 34 nmol/L to 244 nmol/L(Fig. 3A) while maintaining similar levels of maximal path-

way activation. These results suggested that KAAD-cyclopa-mine and SAG compete with each other for SMO binding. Incontrast, increasing concentrations of posaconazole from 0 to7.5 mmol/L (8.5 � IC50) did not significantly alter the EC50 ofSAG but rather significantly decreased the maximal inductionof pathway activation (Fig. 3B). These results suggested thatposaconazole does not compete with SAG for SMO bindingand acts as a noncompetitive inhibitor of SAG.

20(S)-hydroxycholesterol has been shown to activate the Hhsignaling pathway (26,33) by binding to the N-terminal extra-cellular cysteine-rich domain (CRD) of SMO (34–36) and actnoncompetitively with itraconazole (37). Titration of 20(S)-hydroxycholesterol with increasing concentrations of posacona-zole did not significantly alter the EC50 of the oxysterol (Fig. 3C),similar to SAG (Fig. 3B). Conversely, titration of posaconazolewith increasing concentrations of 20(S)-hydroxycholesterol didnot significantly alter the IC50 of posaconazole (Fig. 3D). Similarto itraconazole (15), posaconazole inhibited pathway activationby 20(S)-hydroxycholesterol (164 nmol/L; Fig. 3C) with muchgreater potency than SHHN (880 nmol/L; Fig. 1A). These resultssuggested that posaconazole is a noncompetitive inhibitor of 20(S)-hydroxycholesterol and binds to a target distinct from theCRD of SMO.

As posaconazole did not appear to bind to SMOat the same siteas KAAD-cyclopamine, we tested whether the combination ofposaconazole and cyclopamine may act synergistically. Indeed,titration of posaconazole with increasing concentrations ofKAAD-cyclopamine diminished the IC50 of posaconazole �2.5fold (Fig. 3E), suggesting that posaconazole and KAAD-cyclopa-mine act synergistically to inhibit the Hh pathway. Treatment ofSHH-Light2 cells activated by SHHN CM with subtherapeuticdoses of posaconazole 1 mmol/L (�1.1 � IC50), KAAD-cyclopa-mine 10 nmol/L (�0.5 � IC50) or vismodegib (GDC-0449) 20nmol/L (�1� IC50), a cyclopamine-competitive SMOantagonist,partially inhibited the Hh pathway (Fig. 3F). However, the com-bination of posaconazole with either KAAD-cyclopamine orvismodegib at the same subtherapeutic doses completely inhib-ited Hh pathway activation (Fig. 3F). We also tested subthera-peutic doses of posaconazole in combination with KAAD-cyclo-pamine or vismodegib (Fig. 3G) on constitutively active ASZ andBSZ BCC cells (28) that were derived from Ptchþ/�and Ptchþ/�;K14CreER/þ;Trp53fl/fl murine BCC, respectively. Similar to theresults in SHH-Light2 cells (Fig. 3F), combination of drugsinhibited pathway activation more completely than single drugsalone. These results confirmed the cooperativity of posaconazoleand cyclopamine-competitive SMO antagonists and that, indeed,posaconazole acted upon SMO at a distinct site from the cyclo-pamine-binding site.

As posaconazole did not compete with SMO agonists andantagonists that are known to bind SMO, we wondered ifposaconazole may act on SMO by disruption of its localizationin the primary cilium. Localization and accumulation of SMOin the primary cilia have been observed upon pathway activa-tion whether by Hh ligands, SMO agonists, or constitutivelyactive mutant SMO (25,38,39). With the addition of posaco-nazole to SHHN induced NIH-3T3 cells, a marked decrease inthe ciliary accumulation of SMO was seen (Fig. 4) from �87%of cilia in SHHN and vehicle control-treated cells to �16% ofprimary cilia in SHHN and posaconazole-treated cells (P <0.0001). Control cells treated with vehicle control alone (with-out SHHN) showed �8% of primary cilia with SMO (Fig. 4B).






These results correlated well with the degree of pathway inhi-bition by posaconazole, suggesting that posaconazole acts onthe pathway by a net decrease in the accumulation of SMO inprimary cilia to activate the pathway.

Single, weight-based oral administration of posaconazole30 mg/kg or 60 mg/kg resulted in pharmacokinetic profiles(Fig. 5A; Supplementary Table S1), similar to those reportedpreviously in mice (40). Doubling the posaconazole dose from

Figure 2.Posaconazole inhibits the Hh pathway downstream of PTCH. A, in constitutively active Ptch�/� murine fibroblasts transfected with an 8x-Gli luciferase reporter,posaconazole inhibited Hh pathway activity. B, posaconazole was unable to inhibit the pathway activity of SHH-Light SMOA1 cells stably expressingconstitutively active mutant SMOA1. C–E, histograms of BODIPY-cyclopamine (BD) fluorescence (x-axis), as measured by FACS, using tetracycline-inducibleSMO-expressing HEK-293 cells. Graphs are from the same experiment separated for clarity. When used, BODIPY-cyclopamine is 5 nmol/L in all panels. C, blacktracing represents uninduced cells (no SMO)with no BODIPY-cyclopamine. Blue trace represents uninduced cellswith BODIPY-cyclopamine. Green trace representsmaximal fluorescence in cells with induced SMO-overexpression and BODIPY-cyclopamine. D, addition of KAAD-cyclopamine 200 nmol/L (orange-filledtrace; 10 � IC50) and 400 nmol/L (red-filled trace; 20 � IC50) reduced fluorescence back to baseline levels. E, treatment with increasing concentrations ofposaconazole up to 10 mmol/L (�11 � IC50) did not significantly decrease fluorescence of BODIPY-cyclopamine bound to SMO.

Chen et al.





Figure 3.Posaconazole inhibits the Hh pathwayat distinct sites from other SMOmodulators. A–F, signaling assaysusing SHH-Light2 cells stimulatedwithSAG, a small-molecule SMOagonist, orSHHN CM. A, addition of KAAD-cyclopamine 20 nmol/L (1 � IC50) and100 nmol/L (5 � IC50) increased theEC50 of SAG �3.5- and �7-fold,respectively, while maintainingmaximal pathway activation. B,treatment with posaconazole 1 mmol/L(�1.1 � IC50) and 7.5 mmol/L(�5.5 � IC50) decreased the maximalactivity of SAG but did notsignificantly affect its EC50. C,increasing concentrations ofposaconazole while titrating 20(S)-hydroxycholesterol, an agonist thatbinds SMO at a distinct site fromSAG, decreased maximalpathway activation of 20(S)-hydroxycholesterol but did not alter itsEC50. D, increasing concentrations of20S-hydroxycholesterol, up to 10mmol/L, did not significantly alter theIC50 of posaconazole. E, the additionof posaconazole caused a reduction inthe IC50 of KAAD-cyclopamine. F,treatment with posaconazole 1 mmol/L(�1.1 � IC50), KAAD-cyclopamine 10nmol/L (�0.5 � IC50), and GDC-044920 nmol/L (�1.5 � IC50) partiallyinhibited Hh pathway activation bySHHN CM. Combination of eitherKAAD-cyclopamine or GDC-0449with posaconazole at the same dosesfurther suppressed pathwayactivation. G, treatment of ASZ andBSZ, constitutively active murine BCCcells, with posaconazole 1 mmol/L(�1.1 � IC50), KAAD-cyclopamine40 nmol/L (�2.0 � IC50) and GDC-0449 40 nmol/L (�3.1 � IC50)significantly inhibited the pathway asmeasured by Gli1mRNA. Combinationof posaconazole with either KAAD-cyclopamineorGDC-0449completelyinhibited pathway activity. For panelsA–E, respective IC50 or EC50 of thetitrated compound under varyingconditions are listed in thefigure. Data,mean of triplicates � SD.






30mg/kg to 60mg/kg did not substantially increase the maximalplasma concentration (Cmax) from 16.1 mg/mL to 15.9 mg/mL,respectively, or the AUC0–24h from 244.65 mg�h/mL to 288.46mg�h/mL, respectively (Fig. 5A; Supplementary Table S1). Thus,analogous tohuman studies (41), the absorptionof posaconazolefrom the murine intestine is limited beyond 30 mg/kg.

To evaluate the therapeutic efficacy of posaconazole to treatHh-dependent tumors, we treated nude mice bearing subcutane-ous allografts of murine Ptchþ/�;Trp53�/� BCC (42) with posa-conazole 30 mg/kg or 60 m/kg twice daily. Posaconazole treat-ment significantly suppressed tumor growth (Fig. 5B) comparedwith vehicle control–treated tumors (P < 0.005). In a separateexperiment, allografted BCC tumors treated with posaconazoleshowed significant inhibition of the Hh pathway as measured byGli1 mRNA (Fig. 5C). The similar degrees of tumor growthsuppression and Hh pathway inhibition between posaconazole30 mg/kg and 60 m/kg were consistent with the results of ourpharmacokinetic study that showed the 60 mg/kg dose did notsubstantially increase plasma posaconazole levels. Microscopicexamination of tumor samples treated with posaconazoleshowed significant levels of necrosis that were not present intumors treated with vehicle control (Fig. 5D and E), as evi-denced by the architectural destruction of tumor cell nests andsurrounding stroma (Fig. 5E).

Recently, several mechanisms of resistance (8–13) to cyclopa-mine-competitive antagonists, vismodegib (GDC-0445) andsonidegib (NVP-LDE225; refs. 43,44), have emerged. As our datasuggested that posaconazole does not bind to the cyclopamine-binding region of SMO, we examined the ability of posaconazolewith or without arsenic trioxide (ATO), an inhibitor of GLIproteins (25), to inhibit the Hh pathway in SMO mutants withdemonstrated resistance to the vismodegib (D477G, E522K) andsonidegib (G457S, S392N, D388N, N223D, L225R). Smo�/�

murine fibroblasts were transiently transfected with wild-type(WT) or drug-resistant Smo mutants and stimulated with SHHNCM. Vismodegib- and sonidegib-resistant SMO mutants wereresistant to vismodegib 0.5 mmol/L (�40 � IC50) and sonidegib0.5 mmol/L (�80� IC50) treatment, respectively (SupplementaryFig. S2). SMO-G457S was inhibited by sonidegib 0.5 mmol/L butwas resistant at lower dose of 0.05 mmol/L, consistent withprevious reports (10). Posaconazole showed inhibitory activityagainst all of the tested drug-resistant SMO mutants (Fig. 6). The

combination of posaconazole and ATO further inhibited theactivity of drug-resistant SMO mutants (Fig. 6).

DiscussionSimilar to itraconazole (15,16), posaconazole inhibited theHh

pathway downstream of PTCH and at or upstream of SMO, didnot compete with cyclopamine, SAG, or 20(S)-hydroxycholes-terol for SMO binding, inhibited SMO accumulation in theprimary cilia, had inhibitory activity against drug-resistant SMOmutants, and inhibited the growth of Hh-dependent BCC.

Our results from thedrug competition experiments (Fig. 3A–D)suggest that posaconazole interacts with SMO in a region distinctfrom the N-terminal CRD (where oxysterols bind; refs. 34–36),and the cyclopamine-binding regions of the transmembranedomain, where all of the current clinically tested SMO inhibitorsbind (7). Alternatively, as posaconazole is a highly hydrophobicmolecule, it may interact with the SMO transmembrane domainsto disrupt the multimerization of SMO (45,46), an event thatoccurs when Hh binds to PTCH (45) and may be required forSMO function. A third possibility may be that posaconazole doesnot bind SMO directly but rather binds to an upstream target thatmediates SMO action, particularly its localization to the primarycilia.

Itraconazole has shown activity in human clinical trials againstseveral tumor types, including Hh-dependent BCC (19). Howev-er, itraconazole and its primarymetabolite, hydroxy-itraconazole,are both strong inhibitors and substrates of the major drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 (47,48), andweaker inhibitors of CYP2C9 and CYP2C19 (49). Thus, itraco-nazole has numerous drug–drug interactions that lead to toxi-cities resulting in frequent dose adjustments or discontinuation.Also, itraconazole requires dose adjustments in the setting of renaland hepatic insufficiencies (21). Posaconazole, in contrast, ismetabolized by uridine diphosphateglucuronosyltransferaseenzyme pathways (50). Posaconazole inhibits CYP3A4 but doesnot inhibit other drug-metabolizing isoenzymes CYP 1A2, 2C8,2C9, 2D6, or 2E1 (51). Thus, posaconazole has a decreasedpotential for drug–drug interactions compared with itraconazole.Posaconazole also does not require dose adjustments for renaland hepatic insufficiencies (22). Posaconazole treatments lastingup to 2 years without significant adverse events have been

Figure 4.Posaconazole inhibits SMO accumulation in primary cilia. A, representative immunofluorescent images of NIH-3T3 cells. Stimulation of the Hh pathway withSHHN led to accumulation of SMO in primary cilia. Treatment of posaconazole 7.5 mmol/L with SHHN inhibited SMO accumulation in primary cilia. Insetsshow enlarged views of boxed primary cilia with acetylated tubulin (red) and SMO (green) channels offset for clarity. B, tabulation of SMO accumulation inprimary cilia. Data, mean of at least 7 fields � SD. Scale bar, 10 mm.

Chen et al.





Figure 5.In vivo treatment with posaconazole. A, plasma pharmacokinetics of posaconazole. Balb-c mice were treated with one dose of posaconazole, and plasmalevels of posaconazole were measured at various time points after treatment. Each data point represents mean of 3 mice � S.D. B, posaconazoletreatment of nude mice bearing subcutaneous allografts of murine Ptchþ/�;Trp53 �/� BCCs suppressed tumor growth compared with vehicle control.�� , P < 0.005. C, posaconazole treatment decreased Hh pathway activation in allografted BCCs compared with vehicle control–treated tumors, asmeasured by Gli1 mRNA levels. Gli1 mRNA levels of posaconazole-treated tumors were normalized to the mean of vehicle-treated tumors.Treatments were given twice per day by oral gavage for 5 days. Line represents mean of data sets.� , P ¼ 0.0224; �� , P ¼ 0.0033 (D and E) BCCtumors treated with posaconazole showed increased tumor necrosis compared with control vehicle. D, tabulation of necrosis scores of tumors (seeMaterials and Methods). Line represents mean of data set. �� , P ¼ 0.0028. E, representative images of BCC treated with vehicle control andposaconazole 30 mg/kg. Vehicle control–treated tumors showed structured and ordered nests of tumor cells surrounded by stroma (black arrowhead).In contrast, posaconazole-treated tumors showed destruction of organized tumor epithelial architecture (arrow) with increased stroma (whitearrowhead). Scale bar, 200 mm.






reported (22,52), an important consideration as continuous,prolonged courses of therapywillmost likely be needed for cancertreatment.

Plasma Cmax and AUC0–24h at 30 mg/kg in our murinepharmacokinetic study are �12� and �5� higher, respectively,than those reported for 800-mg single dose in humans (41)while half-life was shorter by �7 hours. However, the patientsin the human study (41) did not take posaconazole with anacidic drink as in our murine study. Acidification of the stom-ach may double the plasma Cmax and AUC0–24h (53) and thusbring human posaconazole levels closer in range to those seenin our murine study.

Response of human BCC to posaconazole may require lessdrug than the doses administered here. Our preclinical itraco-nazole study (15) suggested that at least 800 mg/day of itra-conazole may be required for tumor responses in patients.However, in our phase II clinical trial, human BCC respondedwith itraconazole 400 mg/day (19), half the dose of ourpreclinical studies. Analogously, human BCCmay show similarresponses with lower doses of posaconazole than thosereported here.

Recently, we and others (12,13) have shown that the major-ity of human vismodegib-resistant BCCs are due to two classesof SMO mutations in the transmembrane domain: (i) thosewithin or adjacent to the vismodegib binding pocket thatrequire upstream inactivation of PTCH (either by mutation orHh ligand) for activation and (ii) mutations far from thebinding site that confer constitutive SMO activity. Given ourresults in the present study (Figs. 2B and 6), we predict thatposaconazole will have activity against the first class of SMOmutants but not against the second class of mutants that conferconstitutive SMO activity. However, we have shown that acombination of posaconazole and cyclopamine-competitiveantagonists acts synergistically to suppress SMO activation (Fig.3E–G). Initial use of posaconazole with a cyclopamine-com-

petitive antagonist may provide a more potent, durableresponse with suppression or delay of resistant tumors thanwith a cyclopamine-competitive antagonist alone. Alternative-ly, combination of posaconazole and arsenic trioxide (Fig. 6)may provide durable responses without the appearance ofdrug-resistant SMO mutants due to inhibition of downstreamGLI transcription factors by ATO.

The limited mechanistic diversity of current cyclopamine-competitive SMO antagonists has led to the emergence of drug-resistant SMO mutants (8–13). Posaconazole has been studiedfor nearly 20 years, has been FDA-approved since 2006 withwell-known toxicities, has a favorable drug–drug interactionprofile, and inhibits SMO with a distinct mechanism fromcurrent SMO antagonists that are under clinical investigation.Thus, posaconazole, either alone or in combination with otherHh antagonists, offers readily available therapeutic strategiesthat can be tested immediately in human trials against Hh-dependent cancers.

Disclosure of Potential Conflicts of InterestE.H. Epstein Jr. is a founder and member of the board of directors for

PellePharm Inc. No potential conflicts of interest were disclosed by the otherauthors.

Authors' ContributionsConception and design: J. KimDevelopment of methodology: B. Chen, J. KimAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): B. Chen, V. Trang, A. Lee, N.S. Williams, E.H. EpsteinJr, J.Y. Tang, J. KimAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): B. Chen, V. Trang, N.S. Williams, J.Y. Tang, J. KimWriting, review, and/or revision of the manuscript: V. Trang, J. KimAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): B. Chen, A.N. WilsonStudy supervision: J. Kim

Figure 6.Posaconazole and ATO inhibit the activity of drug-resistant SMO mutants. Signaling assays of Smo�/�

fibroblasts transfected with 8x-Gli luciferase reporterand either wild-type or mutant Smo constructs resistant to vismodegib (GDC-0449) or sonidegib (LDE225) and stimulated with SHHN CM. Posaconazole,ATO, or combination inhibited the drug-resistant mutant SMO activity. SMO D477G and E522K are vismodegib resistant. All other SMO mutants areresistant to sonidegib. WT, wild-type. Data, mean of triplicates � SD.

Chen et al.





AcknowledgmentsThe authors thank Dr. Lawrence Lum for his helpful comments and discus-

sions of the manuscript.

Grant SupportThis research was supported in part by grants to N.S. Williams and the

Preclinical Pharmacology Core from Cancer Prevention Research Institute ofTexas (RP11078-C3) and the UTSW Institute for Innovations in MedicalTechnology (IIMT), to J.Y. Tang from the Damon Runyon Cancer ResearchFoundation (Clinical Investigator Award), to E.H. Epstein Jr from NIH

(5R01CA163611), and to J. Kim from Free to Breathe (Young InvestigatorResearch Grant), Bonnie J. Addario Lung Cancer Foundation (Young Investi-gator Award), UT Southwestern–American Cancer Society InstitutionalResearch Grant and UT Southwestern institutional funds.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received September 1, 2015; revisedDecember 23, 2015; acceptedDecember30, 2015; published OnlineFirst January 28, 2016.

References1. Barakat MT, Humke EW, Scott MP. Learning from Jekyll to control Hyde:

Hedgehog signaling in development and cancer. Trends Mol Med 2010;16:337–48.

2. Gorlin RJ. Nevoid basal-cell carcinoma syndrome. Medicine (Baltimore)1987;66:98–113.

3. Epstein EH. Basal cell carcinomas: attack of the hedgehog. Nat Rev Cancer2008;8:743–54.

4. Sasai N, Briscoe J. Primary cilia and graded Sonic Hedgehog signaling.Wiley Interdiscip Rev Dev Biol 2012;1:753–72.

5. Cooper MK, Porter JA, Young KE, Beachy PA. Teratogen-mediated inhibi-tion of target tissue response to Shh signaling. Science 1998;280:1603–7.

6. Chen JK, Taipale J, Cooper MK, Beachy PA. Inhibition of Hedgehogsignaling by direct binding of cyclopamine to Smoothened. Genes Dev2002;16:2743–8.

7. Sharpe HJ, Wang W, Hannoush RN, de Sauvage FJ. Regulation of theoncoprotein Smoothened by small molecules. Nat Chem Biol 2015;11:246–55.

8. RudinCM,HannCL, Laterra J, YauchRL,CallahanCA, Fu L, et al. Treatmentof medulloblastoma with hedgehog pathway inhibitor GDC-0449. NewEngl J Med 2009;361:1173–8.

9. Yauch RL, Dijkgraaf GJ, Alicke B, Januario T, Ahn CP, Holcomb T, et al.Smoothenedmutation confers resistance to aHedgehog pathway inhibitorin medulloblastoma. Science 2009;326:572–4.

10. Buonamici S, Williams J, Morrissey M, Wang A, Guo R, Vattay A, et al.Interfering with resistance to smoothened antagonists by inhibitionof the PI3K pathway in medulloblastoma. Sci Transl Med 2010;2:51ra70.

11. Dijkgraaf GJ, Alicke B, Weinmann L, Januario T, West K, Modrusan Z, et al.Small molecule inhibition of GDC-0449 refractory smoothened mutantsand downstream mechanisms of drug resistance. Cancer Res 2011;71:435–44.

12. Sharpe HJ, Pau G, Dijkgraaf GJ, Basset-Seguin N, Modrusan Z, Januario T,et al. Genomic analysis of smoothened inhibitor resistance in Basal cellcarcinoma. Cancer Cell 2015;27:327–41.

13. Atwood SX, Sarin KY, Whitson RJ, Li JR, Kim G, Rezaee M, et al. Smooth-ened variants explain the majority of drug resistance in Basal cell carcino-ma. Cancer Cell 2015;27:342–53.

14. Atwood SX, Li M, Lee A, Tang JY, Oro AE. GLI activation by atypical proteinkinase C iota/lambda regulates the growth of basal cell carcinomas. Nature2013;494:484–8.

15. Kim J, Tang JY, Gong R, Kim J, Lee JJ, Clemons KV, et al. Itraconazole, acommonly used antifungal that inhibits Hedgehog pathway activity andcancer growth. Cancer Cell 2010;17:388–99.

16. Kim J, Aftab BT, Tang JY, Kim D, Lee AH, Rezaee M, et al. Itraconazole andarsenic trioxide inhibit Hedgehog pathway activation and tumor growthassociated with acquired resistance to smoothened antagonists. CancerCell 2013;23:23–34.

17. Rudin CM, Brahmer JR, Juergens RA, Hann CL, Ettinger DS, Sebree R, et al.Phase 2 study of pemetrexed and itraconazole as second-line therapy formetastatic nonsquamous non-small-cell lung cancer. J ThoracOncol 2013;8:619–23.

18. Antonarakis ES, Heath EI, Smith DC, Rathkopf D, Blackford AL, DanilaDC, et al. Repurposing itraconazole as a treatment for advanced prostatecancer: a noncomparative randomized phase II trial in men withmetastatic castration-resistant prostate cancer. Oncologist 2013;18:163–73.

19. Kim DJ, Kim J, Spaunhurst K, Montoya J, Khodosh R, Chandra K, et al.Open-label, exploratory phase II trial of oral itraconazole for the treatmentof basal cell carcinoma. J Clin Oncol 2014 Feb 3; doi: 10.1200/JCO.2013.49.9525.

20. Lass-Florl C. Triazole antifungal agents in invasive fungal infections: acomparative review. Drugs 2011;71:2405–19.

21. Katragkou A, Tsikopoulou F, Roilides E, Zaoutis TE. Posaconazole: whenand how? The clinician's view. Mycoses 2012;55:110–22.

22. Raad II, Graybill JR, Bustamante AB, Cornely OA, Gaona-Flores V, AfifC, et al. Safety of long-term oral posaconazole use in the treatment ofrefractory invasive fungal infections. Clin Infect Dis 2006;42:1726–34.

23. Taipale J, Chen JK, Cooper MK, Wang B, Mann RK, Milenkovic L, et al.Effects of oncogenic mutations in Smoothened and Patched can bereversed by cyclopamine. Nature 2000;406:1005–9.

24. Varjosalo M, Li SP, Taipale J. Divergence of hedgehog signal transductionmechanism between Drosophila and mammals. Dev Cell 2006;10:177–86.

25. Kim J, Lee JJ, Kim J, Gardner D, Beachy PA. Arsenic antagonizes theHedgehog pathway by preventing ciliary accumulation and reducingstability of the Gli2 transcriptional effector. Proc Natl Acad Sci U S A 2010;107:13432–7.

26. Dwyer JR, SeverN, CarlsonM,Nelson SF, Beachy PA, Parhami F.Oxysterolsare novel activators of the hedgehog signaling pathway in pluripotentmesenchymal cells. J Biol Chem 2007;282:8959–68.

27. Tang JY, Xiao TZ, Oda Y, Chang KS, Shpall E, Wu A, et al. Vitamin D3inhibits hedgehog signaling and proliferation in murine Basal cell carci-nomas. Cancer Prev Res 2011;4:744–51.

28. So PL, Langston AW, Daniallinia N, Hebert JL, Fujimoto MA, Khaimskiy Y,et al. Long-term establishment, characterization and manipulation of celllines from mouse basal cell carcinoma tumors. Exp Dermatol 2006;15:742–50.

29. Maity T, Fuse N, Beachy PA. Molecular mechanisms of Sonic hedgehogmutant effects in holoprosencephaly. Proc Natl Acad Sci U S A 2005;102:17026–31.

30. Lepesheva GI, Waterman MR. Sterol 14alpha-demethylase cytochromeP450 (CYP51), a P450 in all biological kingdoms. Biochim Biophys Acta2007;1770:467–77.

31. Cooper MK, Wassif CA, Krakowiak PA, Taipale J, Gong R, Kelley RI, et al. Adefective response to Hedgehog signaling in disorders of cholesterolbiosynthesis. Nat Genet 2003;33:508–13.

32. Chen JK, Taipale J, Young KE, Maiti T, Beachy PA. Small moleculemodulation of Smoothened activity. Proc Natl Acad Sci U S A 2002;99:14071–6.

33. Corcoran RB, Scott MP. Oxysterols stimulate Sonic hedgehog signal trans-duction and proliferation ofmedulloblastoma cells. Proc Natl Acad Sci U SA 2006;103:8408–13.

34. Nedelcu D, Liu J, Xu Y, Jao C, Salic A. Oxysterol binding to the extracellulardomain of Smoothened in Hedgehog signaling. Nat Chem Biol 2013;9:557–64.

35. Myers BR, Sever N, Chong YC, Kim J, Belani JD, Rychnovsky S, et al.Hedgehog pathway modulation by multiple lipid binding sites on thesmoothened effector of signal response. Dev Cell 2013;26:346–57.

36. Nachtergaele S, Whalen DM,Mydock LK, Zhao Z, Malinauskas T, KrishnanK, et al. Structure and function of the Smoothened extracellular domain invertebrate Hedgehog signaling. eLife 2013;2:e01340.






37. Nachtergaele S, Mydock LK, Krishnan K, Rammohan J, Schlesinger PH,Covey DF, et al. Oxysterols are allosteric activators of the oncoproteinSmoothened. Nat Chem Biol 2012;8:211–20.

38. Corbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, Reiter JF.Vertebrate Smoothened functions at the primary cilium. Nature 2005;437:1018–21.

39. Rohatgi R, Milenkovic L, Scott MP. Patched1 regulates hedgehog signalingat the primary cilium. Science 2007;317:372–6.

40. Nomeir AA, Kumari P, Hilbert MJ, Gupta S, Loebenberg D, Cacciapuoti A,et al. Pharmacokinetics of SCH 56592, a new azole broad-spectrumantifungal agent, in mice, rats, rabbits, dogs, and cynomolgus monkeys.Antimicrob Agents Chemother 2000;44:727–31.

41. Courtney R, Pai S, LaughlinM, Lim J, Batra V. Pharmacokinetics, safety, andtolerability of oral posaconazole administered in single andmultiple dosesin healthy adults. Antimicrob Agents Chemother 2003;47:2788–95.

42. XiaoTZ, Tang JY,WuA, Shpall E, Khaimsky I, SoP, et al.Hedgehog signalingof BCC is inhibited by Vitamin D: implication for a chemopreventive agentagainst BCC carcinogenesis. J Invest Dermatol 2009;129:S32.

43. Robarge KD, Brunton SA, Castanedo GM, Cui Y, Dina MS, Goldsmith R,et al. GDC-0449-a potent inhibitor of the hedgehog pathway. Bioorg MedChem Lett 2009;19:5576–81.

44. Pan S, Wu X, Jiang J, Gao W, Wan Y, Cheng D, et al. Discovery of NVP-LDE225, a potent and selective smoothened antagonist. ACS Med ChemLett 2010;1:130–4.

45. Zhao Y, Tong C, Jiang J. Hedgehog regulates smoothened activity byinducing a conformational switch. Nature 2007;450:252–8.

46. Wang C,WuH, Katritch V, HanGW,Huang XP, LiuW, et al.Structure of thehuman smoothened receptor bound to an antitumour agent. Nature 2013;497:338–43.

47. Isoherranen N, Kunze KL, Allen KE, Nelson WL, Thummel KE. Role ofitraconazole metabolites in CYP3A4 inhibition. Drug Metab Dispos 2004;32:1121–31.

48. Templeton IE, Thummel KE, Kharasch ED, Kunze KL,Hoffer C,NelsonWL,et al. Contribution of itraconazole metabolites to inhibition of CYP3A4 invivo. Clin Pharmacol Ther 2008;83:77–85.

49. Niwa T, Shiraga T, Takagi A. Effect of antifungal drugs on cytochrome P450(CYP) 2C9, CYP2C19, and CYP3A4 activities in human liver microsomes.Biol Pharm Bull 2005;28:1805–8.

50. Ghosal A, Hapangama N, Yuan Y, Achanfuo-Yeboah J, Iannucci R,Chowdhury S, et al. Identification of human UDP-glucuronosyltransferaseenzyme(s) responsible for the glucuronidation of posaconazole (Noxafil).Drug Metab Dispos 2004;32:267–71.

51. Wexler D, Courtney R, Richards W, Banfield C, Lim J, Laughlin M. Effect ofposaconazole on cytochrome P450 enzymes: a randomized, open-label,two-way crossover study. Eur J Pharm Sci 2004;21:645–53.

52. Anstead GM, Corcoran G, Lewis J, Berg D, Graybill JR. Refractorycoccidioidomycosis treated with posaconazole. Clin Infect Dis 2005;40:1770–6.

53. Krishna G,Moton A, Ma L, Medlock MM,McLeod J. Pharmacokinetics andabsorption of posaconazole oral suspension under various gastric condi-tions in healthy volunteers. Antimicrob Agents Chemother 2009;53:958–66.


Chen et al.




2016;15:866-876. Published OnlineFirst January 28, 2016.Mol Cancer Ther Baozhi Chen, Vinh Trang, Alex Lee, et al. Cell CarcinomaInhibits the Hedgehog Signaling Pathway and Progression of Basal Posaconazole, a Second-Generation Triazole Antifungal Drug,

Updated version

10.1158/1535-7163.MCT-15-0729-Tdoi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2016/01/28/1535-7163.MCT-15-0729-T.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/15/5/866.full#ref-list-1

This article cites 52 articles, 18 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/15/5/866.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/15/5/866To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-15-0729-T

http://mct.aacrjournals.org/content/suppl/2016/01/28/1535-7163.MCT-15-0729-T.DC1

http://mct.aacrjournals.org/content/15/5/866.full#ref-list-1

http://mct.aacrjournals.org/content/15/5/866.full#related-urls

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/15/5/866


posaconazole, a second-generation triazole antifungal drug ......posaconazole inhibits the hedgehog...

Documents