Plants and the EnvironmentYang Zhong & Yufang Zheng

(School of Life Sciences, Fudan University)

yangzhong@fudan.edu.cn, zhengyf@fudan.edu.cn

About the Course

• BIOL 107 Plants and the environment• Undergraduates from Pepperdine University• Shanghai, September 20 – December 6, 2010• Professors Yang Zhong and Yufang Zheng• TA: Dr Nian Liu• Textbook: Graham et al. 2006, Plant Biology (2nd

edition)• Class time: Monday 13:15-15:00; 15:30-17:00

September 20: Introduction

• About the course• About the teachers• What are plants (types, ranks, names …)• Uses of plants (food, medicine, furniture …)• Cells & Molecules of life• Botany vs. Plant Biology (pure and applied botany)• Key points for the courses (biodiversity, evolution,

visit to botanical garden, DIY for specimen and DNA…)

September 27: Plant Structure and Function

• Cells and cell division

• Plant structure, growth, and development

• Stems and materials transport

• Roots and plant nutrition

• Leaves and their functions

• Plant behavior

October 11: Plant Reproduction and Genetics

• Plant reproduction

• Genetics and model plants

• Genetic engineering (plant breeding, GMO…)

October 25: Diversity of Plants& Mid-term exam

• Various plants in the world

• Biodiversity and endangered plants

• Classification and nomenclature of plants

•Understanding alive plants

•Take pictures and collect samples (for specimen and DNA) !

November 1: Visit to Shanghai Botanical Garden

November 8: Biological Evolution

• Variations in plants (morphological and molecular levels)

• Phylogenetic tree and “Tree of Life”

November 15: Plant-animal Co-evolution

• What is Co-evolution?

• Case studies (e.g., butterflies and plants)

November 29: Plant Ecology

• Ecology and the biosphere

• Ecosystems

• Case studies (Arid, aquatic…)

December 6: Exam

• Submission of report

• Final exam

“Lab work”

1. Make specimens

2. Extract plant DNAs

Requirements and Grading

• 1 report (2-3 pages) 20 pts• 1 photo show (plants in botanical garden) 10 pts• lab work 10 pts• Mid-term exam 25 pts• Final exam 35 pts

Total: 100 pts

Requirements and Grading

• 1 report (2-3 pages) 20 pts• 1 photo show (plants in botanical garden) 10 pts• lab work 10 pts• Mid-term exam 25 pts• Final exam 35 pts

Total: 100 pts

About the Teachers

Yang Zhong ( 钟 扬 )

B. E., Electronic Engineering (The Gifted Young Class), University of Science and Technology of China

Ph. D., Biology, The Graduate University for Advanced Studies, Japan

Professor, School of Life Sciences, Fudan University, Shanghai

Director, Institute of Biodiversity Science and Geobiology, Tibet University, Lhasa

Research Professor, Wuhan Institute of Botany, Academia Sinica

Visiting Scholar, University of California-Berkeley and Michigan State University

Research interests: Mangrove ecosystem (aquatic plants), Tibetan plants, Molecular evolution, Bioinformatics

About the Teachers

Yufang Zheng ( 郑煜芳 )

• B. S. & M.S., Biophysics, Tsinghua University, Beijing, China

• Ph. D., Physiology & Biophysics, Graduate School of Weill Medical College of Cornell University, NY, USA

• Associate Professor, School of Life Sciences, Fudan University, Shanghai

• Research interests: Brain development

Mangroves: important ecological plants

“A Forest in the Sea”

Total 24 families, 30 genera, and about 74 species, distributed from tropical to subtropical coastal regions worldwide

China: Guangdong, Hainan, Taiwan, Hong Kong, Fujian …

USA: Florida

Significant adaptive characters of mangroves

The highly adapted plants growing in coastal ecosystems

vivipary

salinityroot system

Hainan Island

Field-investigation

Okinawa, Japan

Tibet

A way for studying science

Lotus ( 莲）(Nelumbo nucifera)

Waterlily （睡莲）(Nymphaea tetragona)

Stick out of water Floating leaves

Names of Plants

Magnolia denudata

白玉兰

Shanghai City Flower / Tree

California State Flower

The California redwood (Seq

uoia sempervirens, Sequoia g

igantea) is the official state tr

ee

California State Tree

Binomial nomenclature

Karl von Linne or Carl von Linné or Carolus Linnaeus (1707–1778), a Swedish botanist, invented the modern system of binomial nomenclature.

Taxonomy: Hierarchy

• Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; Proteales; Nelumbonaceae; Nelumbo

• Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; basal Magnoliophyta; Nymphaeales; Nymphaeaceae; Nymphaea

Zhong et al., 1996, Taxon (following International Code of Plant Nomenclature)

Tree of Life

Three domains of “Tree of Life”The Three-Domain Hypothesis is the idea that life can be divided into three distinct (monophyletic) domains: archaebacteria, bacteria, and eukaryotes. An important part of the hypothesis is that eukaryotes are descended from ancient archaebacteria.

Doolittle's Scientific American article "Uprooting the Tree of Life" (February 2000).

© Scientific American

Placental mammals

Pegasoferae, an unexpected mammalian clade revealed by tracking ancient retroposon insertions

from Proceedings of National Academy of Sciences of the United States, 2006

Understanding plants

• Structure and function:• Molecules --- Molecular biology• Cell --- Cell biology (cytobiology)• Photosynthesis/growth… --- Plant physiology• Reproduction --- Genetics/Developmental biology• Variation/plant-animal relation --- Evolutionary biology• Name and classification --- Taxonomy • Plant-environment relation --- Ecology• Others, e.g., endangered species --- Conservation biology• e.g., diseases --- Pathology

Cells

• All life-forms are composed of cells

• The eukaryotic cells of algae, protozoa, fungi, plants, and animals are more structurally complex than prokaryotic cells

A Plant Cell

mtDNA

Prokaryotic & Eukaryotic cells

Prokaryotes Eukaryotes

Typical organisms bacteria, archaea protists, fungi, plants, animals

Typical size ~ 1-10 µm ~ 10-100 µm (sperm cells, apart from the tail, are smaller)

Type of nucleusnucleoid region; no real

nucleusreal nucleus with double membrane

DNA circular (usually) linear molecules (chromosomes) with histone proteins

RNA-/protein-synthesis

coupled in cytoplasmRNA-synthesis inside the nucleus

protein synthesis in cytoplasm

Ribosomes 50S+30S 60S+40S

Cytoplasmatic structure

very few structures highly structured by endomembranes and a cytoskeleton

Cell movement flagella made of flagellinflagella and cilia containing microtubules; lamellipodia and filopodi

a containing actin

Mitochondria none one to several thousand (though some lack mitochondria)

Chloroplasts none in algae and plants

Organization usually single cellssingle cells, colonies, higher multicellular organisms with specialize

d cells

Cell divisionBinary fission (simple

division)Mitosis (fission or budding)Meiosis

Cell Division

• All organisms are composed of one or more cells; all cells pass through the cell cycle

• Cell cycle and cell division are defining attributes of life

• Prokaryotic organisms and cell organelles reproduce by binary fission

• Eukaryotic organisms have separate processes of nuclear division and cytoplasmic division

Fluorescent microscope

Electron MicroscopesTransmission Electron Microscope (TEM): 0.5 nm

Scanning Electron Microscope (SEM): less than 1 nm ~ 20 nm

Scanning Transmission Electron Microscope (STEM)

A scanning transmission electron microscope (STEM) is a type of transmission electron microscope. With it, the electrons pass through the specimen, but, as in scanning electron microscopy, the electron optics focus the beam into a narrow spot which is scanned over the sample in a raster. The STEM rasters a focused incident probe across a specimen that (as with the TEM) has been thinned to facilitate detection of electrons scattered through the specimen. The high resolution of the TEM is thus possible in STEM. The focusing action (and aberrations) occur before the electrons hit the specimen in the STEM, but afterward in the TEM. The STEM's use of SEM-like beam rastering simplifies annular dark-field imaging, and other analytical techniques, but also means that image data is acquired in serial rather than in parallel fashion.

Scanning Electron Microscope (1 - 20 nm)

pollen grains from Helianthus annuus

Transmission Electron Microscope (0.5 nm)

transverse section through a diatom, Phaeodactylum tricornutum. (a silicon algae )

Usage of Plants

• Food, energy, construction, decoration, etc

• Sources of starch

• Sources of sugar

• Sources of oils

• Sources of oxygen

• Photosynthesis provides the food and fuel

that power life on Earth

• The interaction between light and pigments

is crucial to the capture of solar energy

Path of energy flow

Photosynthesis and respiration• Life on Earth is solar powered• Photosynthesis is the process by which cells trap t

he energy in sunlight as chemical bonds in simple sugars

• Plant cells and those of other photosynetic organisms construct the complex carbohydrates, lipids, nucleic acids, and proteins of life from simple sugars

• Respiration is a series of chemical reactions that release energy from chemical bonds in the organic molecules which were produced by photosynthesis

Flaming Mountain at Turfan (Turpan) , Xin Jiang

(>47.8 °C, Gound surface >70 °C)

Grape valley

A sunny day in Tibet

Plants in Tibet

Flowers in Tibet

Lhasa, the city of sunshine (over 3000 hours per year)

Silicon boards for solar energy (Lhasa)

Chloroplast

Photosynthesis

Cooperation between two photosystems

Calvin cycle: The C3

pathway

Photorespiration

The C4 pathway

Examples of CAM plants (a) Snake plant (Sansevieria) and (b) Crassula rupestris, a stonecrop

Respiration and fermentation

release energy for cellular metabolism

Beers in Shanghai

Brewing Beers

• Malt

• Hops

• Yeast

• Water

Barley

Yunnan Yuanyang Rice Terraces

The Botany of Beer

• Malt provided by barley, rice, …

• (Starch -> sugar -> alcohol …)

Hops: flowers from Humulus species (Cannabaceae family, hemp family)

HopsHumulus lupulus

Sources of starchMajor: rice, wheat, zea, potato, barley, oat, rye, sorghum

Additional: Jerusalem artichoke, taro, sweet potato, water chestnut, lily, kudzu

Sources of sugar

• Major: sugarcane, sugar beet

Additional: Luo-han-guo

Distributed in Guangxi

themogrosides are about 300 times sweeter than sugar

Sources of oils

• Major: oil rape, peanut, sunflower, soybean

• Additional: olive oil, camellia (tea) oil, cotton seed oil

Bio-energyCorn

Bio-energySugarcane (Rum)

Gardens in Suzhou

Decoration: Primula

Herbal remedy

St John's wort, is the plant species Hypericum perforatum, and is widely known as an herbal treatment for depression.

Have a rest

Molecules of Life

Molecules of Life• Chemical elements

– 1) All physical matter is composed of chemical elements;

– 2) An element is a substance composed of only one kind of atom;

– 3) Over 90 elements occur in nature (from hydrogen, the lightest to uranium, the heaviest)

• Macronutrients– Nine elements account for 99.95% of the dry weight of

plants • Micronutrients

– trace elements (required in very small amount)

Essential Elements

Organic fertilizers

• N: fabaceous herbs and muck;

• P: phosphate rock;• K: plant ash;• Ca: limestone.

Left: Soybean (Glycine max), one of major nitrogen-fixing plants;

Right: Rhizobia (Rhizobium leguminosarum)

Sea Buckthorn (Hippophae rhamnoides),

one of non-legume nitrogen fixing plants

Frankia is a genus of nitrogen fixing filam

entous bacteria that live in symbiosis with

actinorhizal plants, similar to Rhizobia. Ba

cteria of this genus form root nodules

Nauru

Between Hawaii and Australia

22 km2

Population size about 12,000

“Country of phosphate” (38, 000, 000 tons)

From rich to poor

Karst (limestone)

Stone Forest Yangshuo

Mining area

Organic molecules: presence of the element carbon

• Carbohydrates (Sugars, starches, cellulose…)• Lipids (fats, oils, waxes…)• Proteins (large molecules compounds of amino

acids)• Nucleic acids (DNA, RNA…)

Four types of primary compounds

Molecules produced by plants, algae, or fungi that are not found in all species

• Terpenes (e.g., rose extracts)

• Phenolics (e.g., vanilla extracts)

• Flavonoids (pigments)

• Alkaloids (e.g., nicotine from tabacco)

Secondary compounds

Damascan rose (Rosa damascene)

Camphor tree (Cinnamomum camphora)

It was first introduced to Britain from Yichang County, Hubei Province, China in 1880 and rapidly became established as a popular ornamental plant throughout Europe and the United States as well as other countries allergic contact dermatitis

An example: Primula

Detection of the chemical compounds

A significant cause of allergic contact dermatitis ?

In a number of sensitization experiments, 2-methoxy-6-alkyl-1,4-b

enzoquinones with branch side chain length C1-C15, including primin,

have showed an increase of the sensitizing capacity with increasing le

ngth of the alkyl side chain from C-1 to C-13 ( reaching maximum acti

vity at an alkyl chain of 10 to 11 carbons), but the sensitizing potency

decreased beyond 13 carbons and the sensitization hardly occurred at

C-1 to C-3.

DNA ： Genetic material

Watson and Crick

(1953)

Chromosome

DNA Sequence

Arabidopsis thaliana APP mRNA, complete cds aaagctttca agggaagcca tcgatgaaga agaaaacgaa gaagaagact cttcaaatgc tcgcgcgaac tcacttctga cgaaa

accat acttcctcag tctcattccc tttccgacga actattctcc tgaagaagaa gacgaaaatg gcgaacaagc tcaaagtcga cgaactccgt ttaaaactcg ccgagcgtgg actcagtact actggagtca aagccgttct ggtggagagg cttgaagagg ctatcgcaga agacactaag aaggaagaat caaagagcaa gaggaaaaga aattcttcta atgatactta tgaatcgaac aaattgattg caattggcga atttcgtggg atgattgtga aggaattgcg tgaggaagct attaagagag gcttagatac aacaggaacc aaaaaggatc ttcttgagag gctttgcaat gatgctaata acgtttccaa tgcaccagtc aaatccagta atgggacaga tgaagctgaa gatgacaaca atggctttga agaagaaaag aaagaagaga aaatcgtaac cgcgacaaag aagggtgcag cggtgttaga tcagtggatt cctgatgaga taaagagtca gtaccatgtt ctacaaaggg gtgatgatgt ttatgatgct atcttaaatc agacaaatgt cagggataat aataacaagt tctttgtcct acaagtccta gagtcggata gtaaaaagac atacatggtt tacaccagat ggggaagagt tggtgtgaaa ggacaaagta agctagatgg gccttatgac tcatgggatc gtgcgataga gatatttacc aataagttca atgacaagac aaagaattat tggtctgaca gaaaggagtt tatcccacat cccaagtcct atacatggct cgaaatggat tacggaaaag aggaaaatga ttcaccggtc aataatgata ttccgagttc atcttccgaa gttaaacctg aacaatcaaa actagatact cgggttgcca agttcatctc tcttatatgt aatgtcagca tgatggcaca gcatatgatg gaaataggat ataacgctaa caaattgcca ctcggcaaga taagcaagtc cacaatttca aagggttatg aagtgctgaa gagaatatcg gaggtgattg atcggtatga tagaacgagg cttgaggaac tgagtggaga gttctacaca gtgatacctc atgattttgg ttttaagaaa atgagccagt ttgttataga cactcctcaa aagttgaaac agaaaattga aatggttgaa gcattaggtg agattgaact cgcaacaaag ttgttgtccg tcgacccggg attgcaggat gatcctttat attatcacta ccagcaactt aattgtggtt tgacgccagt aggaaatgat tcagaggagt tctctatggt tgctaattac atggagaaca ctcatgcaaa gacgcattcg ggatatacgg ttgagattgc tcaactattt agagcttcga gagctgttga agctgatcga ttccaacagt tttcaagttc gaagaacagg atgctactct ggcacggttc acgtctcact aactgggctg gtattttatc tcaaggtctg cgaatagctc ctcctgaagc gcctgtaact ggttacatgt ttggaaaagg ggtttacttt gcggatatgt tctccaagag tgcgaactat tgctatgcca acactggcgc taatgatggc gttctgctcc tctgcgaggt tgctttggga gacatgaatg aacttctgta ttcagattat aacgcggata atctaccccc gggaaagcta agcacaaaag gtgtggggaa aacagcacca aacccatcag aggctcaaac actagaagac ggtgttgttg ttccacttgg caaaccagtg gaacgttcat gctccaaggg gatgttgttg tacaacgaat atatagtcta caatgtggaa caaatcaaga tgcgttatgt gatccaagtc aaattcaact acaagcacta aaacttatgt atattagctt ttgaacatca actaattatc caaaaatcag cgttttattg tatttctttc aaactccttc atctctgatt ttgcacggtt cactcg

Arabidopsis is native to Europe, Asia, and northwestern Africa. It is an annual (rarely biennial) plant usually growing to 20–25 cm tall. The flowers are 3 mm in diameter. The fruit is a siliqua 5–20 mm long, containing 20–30 seeds.

Brassicacaea family

Use as a model organism

• Arabidopsis is widely used as one of the model organisms for studying plant sciences, including genetics and plant development. It plays the role for agricultural sciences that mice and fruit flies (Drosophila) play in animal biology. Although Arabidopsis thaliana has little direct significance for agriculture, it has several traits that make it a useful model for understanding the genetic, cellular, and molecular biology of flowering plants.

• The small size of its genome make Arabidopsis thaliana useful for genetic mapping and sequencing — with about 157 million base pairs and five chromosomes, Arabidopsis has one of the smallest genomes among plants. It was the first plant genome to be sequenced, completed in 2000 by the Arabidopsis Genome Initiative. Much work has been done to assign functions to its 27,000 genes and the 35,000 proteins they encode.

• The plant's small size and rapid life cycle are also advantageous for research. Having specialized as a spring ephemeral, it has been used to found several laboratory strains that take about six weeks from germination to mature seed. The small size of the plant is convenient for cultivation in a small space and it produces many seeds. Further, the selfing nature of this plant assists genetic experiments. Also, as an individual plant can produce several thousand seeds, each of the above criteria leads to Arabidopsis thaliana being valued as a genetic model organism.

• Plant transformation in Arabidopsis is routine, using Agrobacterium tumefaciens to transfer DNA to the plant genome. The current protocol, termed "floral-dip", involves simply dipping a flower into a solution containing Agrobacterium, the DNA of interest, and a detergent. This method avoids the need for tissue culture or plant regeneration.

• Genetic Information is expressed through Nucleic Acids chains called RiboNucleic Acids.

• Three types of RNAs differing in size, function and localization:

• Messenger RNA (mRNA) is a carrier of genetic information, a copy of a gene sequence acting as a template for protein construction.

• Ribosomal RNA (rRNA) and Transfer RNA (tRNA) (also sometimes referred to as insoluble and soluble RNAs) are structural ribonucleic acids which support the expression of mRNA into protein.

RNA: Genetic material transformation

Crick’s central dogma

Genetic code

• In 1968, Nirenberg & Khorana jointly were awarded the Nobel Prize for the elucidation of the Genetic Code.

• Most codons for a given amino acid differ only in the third base of the triplet (exceptions: Leu, Arg, Ser)

• One codon (AUG or Met) also signals the START of a polypeptide chain. • Three codons (UAA, UAG and UGA) are used to signal the END of a polypeptide chain (STOP

codons)

DNA fingerprinting

• The chemical structure of everyone's DNA is the same. The only difference between people (or any animal/plant) is the order of the base pairs. There are so many millions of base pairs in each person's DNA that every person has a different sequence.

• Using these sequences, every person could be identified solely by the sequence of their base pairs. However, because there are so many millions of base pairs, the task would be very time-consuming. Instead, scientists are able to use a shorter method, because of repeating patterns in DNA.

• These patterns do not, however, give an individual "fingerprint," but they are able to determine whether two DNA samples are from the same person, related people, or non-related people. Scientists use a small number of sequences of DNA that are known to vary among individuals a great deal, and analyze those to get a certain probability of a match.

Variable Number Tandem Repeats (VNTRs)

Gel electrophoresis

An example of DNA fingerprinting

Practical Applications of DNA Fingerprinting

1. Paternity and Maternity: Because a person inherits his or her VNTRs from his or her parents, VNTR patterns can be used to establish paternity and maternity. The patterns are so specific that a parental VNTR pattern can be reconstructed even if only the children's VNTR patterns are known (the more children produced, the more reliable the reconstruction). Parent-child VNTR pattern analysis has been used to solve standard father-identification cases as well as more complicated cases of confirming legal nationality and, in instances of adoption, biological parenthood.

2. Criminal Identification and Forensics: DNA isolated from blood, hair, skin cells, or other genetic evidence left at the scene of a crime can be compared, through VNTR patterns, with the DNA of a criminal suspect to determine guilt or innocence. VNTR patterns are also useful in establishing the identity of a homicide victim, either from DNA found as evidence or from the body itself.

3. Personal Identification : The notion of using DNA fingerprints as a sort of genetic bar code to identify individuals has been discussed, but this is not likely to happen anytime in the foreseeable future. The technology required to isolate, keep on file, and then analyze millions of very specified VNTR patterns is both expensive and impractical. Social security numbers, picture ID, and other more mundane methods are much more likely to remain the prevalent ways to establish personal identification.

Problems with DNA Fingerprinting

Like nearly everything else in the scientific world, nothing about DNA fingerprinting is 100% assured. The term DNA fingerprint is, in one sense, a misnomer: it implies that, like a fingerprint, the VNTR pattern for a given person is utterly and completely unique to that person. Actually, all that a VNTR pattern can do is present a probability that the person in question is indeed the person to whom the VNTR pattern (of the child, the criminal evidence, or whatever else) belongs. Given, that probability might be 1 in 20 billion, which would indicate that the person can be reasonably matched with the DNA fingerprint; then again, that probability might only be 1 in 20, leaving a large amount of doubt regarding the specific identity of the VNTR pattern's owner.

• 1. Generating a High Probability

The probability of a DNA fingerprint belonging to a specific person needs to be reasonably high--especially in criminal cases, where the association helps establish a suspect's guilt or innocence.

2. Problems with Determining Probability A. Population Genetics

VNTRs, because they are results of genetic inheritance, are not distributed evenly across all of human population. A given VNTR cannot, therefore, have a stable probability of occurrence; it will vary depending on an individual's genetic background. The difference in probabilities is particularly visible across racial lines. Some VNTRs that occur very frequently among Hispanics will occur very rarely among Caucasians or African-Americans. Currently, not enough is known about the VNTR frequency distributions among ethnic groups to determine accurate probabilities for individuals within those groups; the heterogeneous genetic composition of interracial individuals, who are growing in number, presents an entirely new set of questions. Further experimentation in this area, known as population genetics, has been surrounded with and hindered by controversy, because the idea of identifying people through genetic anomalies along racial lines comes alarmingly close to the eugenics and ethnic purification movements of the recent past, and, some argue, could provide a scientific basis for racial discrimination.

B. Technical Difficulties Errors in the hybridization and probing process must also be figured into the probability, and often the idea of error is simply not acceptable. Most people will agree that an innocent person should not be sent to jail, a guilty person allowed to walk free, or a biological mother denied her legal right to custody of her children, simply because a lab technician did not conduct an experiment accurately. When the DNA sample available is minuscule, this is an important consideration, because there is not much room for error, especially if the analysis of the DNA sample involves amplification of the sample (creating a much larger sample of genetically identical DNA from what little material is available), because if the wrong DNA is amplified (i.e. a skin cell from the lab technician) the consequences can be profoundly detrimental. Until recently, the standards for determining DNA fingerprinting matches, and for laboratory security and accuracy which would minimize error, were neither stringent nor universally codified, causing a great deal of public outcry.

DNA sequence changes

Ancient gene

X Y

t＋ 1

t

time

X’ Y’

DNA sequence changes

AAGACTT

TGGACTTAAGGCCT

-3 mil yrs

-2 mil yrs

-1 mil yrs

today

AGGGCAT TAGCCCT AGCACTT

AAGGCCT TGGACTT

TAGCCCA TAGACTT AGCGCTTAGCACAAAGGGCAT

AGGGCAT TAGCCCT AGCACTT

AAGACTT

TGGACTTAAGGCCT

AGGGCAT TAGCCCT AGCACTT

AAGGCCT TGGACTT

AGCGCTTAGCACAATAGACTTTAGCCCAAGGGCAT

Splits tree analysis of 44 manuscripts of “The Wife of Bath’s Prologue” from Chaucer’s The Canterbury Tales. The two- or three-character codes indicate individual manuscripts, whereas the large capitals indicate groups of manuscripts, which are colored the same.

NCBI

National Center for Biotechnology Information

– http://www.ncbi.nlm.nih.gov/

The largest DNA sequence database and bioinformatic

s center

NCBI homepage

Fossil specimens (>10 mya)(a)Magnolia latahensis(b) Persea pseudocarolinensisThe fossil DNA sequencing was publi

shed in Nature (1990)

Ancient DNA (from herbarium/museum or fossil samples)

Mam-moth (Mammuthus primigenius) body from Siberian, Russia (9,000 yr)

The whole mt genome of Neanderthals has been reconstructed in 2007

Neanderthals (200,000 yr ago in Europe)

Two major challenges for ancient DNA sequencing:

• DNA quality (can be sequenced after 100,000 yrs or longer, such as 10 million years) (maintenance in natural conditions)?

• Pollution (by bacteria, fungi, …)