phosphorylation of phospholamban in aortic smooth muscle cells and heart by...

Cellular Signding Vol. 6, No.6, 617-630, 1994. pp. Copyright 0 1994 Ekvier Science Ltd

tinted in Great Britain. All rights reserved 0898-5568194 $7.00 + 0.00

0898-6568(94)00012-L

PHOSPHORYLATION OF PHOSPHOLAMBAN IN AORTIC SMOOTH MUSCLE CELLS AND HEART BY CALCIUMKALMODULIN-DEPENDENT PROTEIN

KINASE II

WEN CHEN, MARIA LAH,* PHILLIP J. ROBINSON? AND BRUCE E. KEMP?

St Vincent’s Institute of Medical Research, 41 Victoria Parade, Fitzroy, Vie. 3065 Australia; * CSIRO, Division of Biomolecular Engineering, 343 Royal Parade, Parkville, Australia and t Endocrinology Unit, John Hunter Hospital,

Newcastle, Australia

(Received 14 March 1994; and accepted 13 April 1994)

Abstract-Phospholamban is a negative regulator of the sarcoplasmic reticulum Ca*+-pumping ATPase. Phosphorylation of phospholamban activates the ATPase and decreases the level of cytosolic calcium. Phospholamban is phosphorylated in heart by CAMP-dependent protein kinase, cGMP-dependent protein kinase and calcium/calmodulin-dependent protein kinase 11 (CM-kinase-11) and in smooth muscle cells by cGMP-dependent protein kinase. In contrast to heart muscle, phospholamban is poorly phosphorylated by CM-kinase-11 in extracts of rat aortic smooth muscle cells. Rat aorta phospholamban amino acid sequence was identical to dog heart. The peptide substrate specificity of CM-kinase-II from rat aorta was the same as that from rat heart. The lack of phosphorylation of rat aorta phospholamban by the CM-kinase-11 appears to result from the relatively low abundance of phospholamban in smooth muscle.

Key words: Phospholamban, calcium/calmodulin-dependent protein kinase 11, smooth muscle, aorta, phosphorylation, phosphatase.

INTRODUCTION

Phospholamban is a 52 residue protein in the sarcoplasmic (endoplasmic) reticulum of slow oxida- tive muscles [9,37]. It consists of a hydrophobic

a-helix that anchors the protein in the membrane and a hydrophilic (x-helix that is cytoplasmically oriented and contains the phosphorylation sites

Ser-16 and Thr- 17 [29]. The hydrophilic domain of phospholamban interacts with the Ca*+-pumping ATPase in the sarcoplasmic reticulum mem-

t Author to whom correspondence should be addressed. Abbreviations: CM - calmodulin; CM-kinase-II -

calmodulin-dependent protein kinase-II; PL - phospholamban; SMC - smooth muscle cells; cGMP&nase - cGMP- dependent protein kinase; EDTA - ethylenediaminetetra- acetic acid; EGTA - ethylene glycol-bis(P-aminoethyl ether)- N,N,N’,N’-tetraacetic acid; SDS - sodium dodecyl sulphate; PMSF - phenylmethyl-sulphonylfluoride.

brane and inhibits its activity. When phosphory-

lated, phospholamban dissociates from the

ATPase, resulting in activation of the enzyme [10,16,18,31,33]. In this way phospholamban reg-

ulates the Ca*+-pumping ATPase of the sarcoplasmic reticulum and modulates the level of cytosolic free calcium. PhosphoIylation by CAMP- or cGMP-dependent protein kinases on Ser-16 and by Ca2+/calcium/calmodulin-dependent protein kinase II on Thr-17 is additive and is correlated with stimulation of Ca2+ pump ATPase activity of the sarcoplasmic reticulum and increased calcium transport into the sarcoplasmic reticulum [ 18,2 1,32-351. Phosphorylation of phospholamban has been demonstrated in intact heart by CAMP-dependent protein kinase, CM-PK-11[40] and in intact SMC by cGMP-dependent protein kinase [4]. The action of CAMP and cGMP in

617

618 W. Chen et al.

lowering [Ca?+] and subsequently promoting relaxation may, at least in part, be mediated by

phosphorylation of phospholamban. Calcium/calmodulin-dependent protein kinase

II (CM-kinase-II) is a member of a family of calcium/calmodulin regulated protein kinases which includes CM-kinase I and III, myosin light chain

kinase and phosphorylase kinase [22,23]. It is most highly concentrated in neural tissue [6] but also present in most mammalian tissues. CM- kinase-II is a heteropolymer comprised of sub- units in the range 50-62,000 M,. The amino acid sequences surrounding phosphorylation sites of substrates for CM-kinase-II typically but not exclusively occur in the [Arg-X-X-Ser (Thr)] recognition motif [24,26].

We observed that Ca*+/calmodulin-dependent phosphorylation of phospholamban in smooth

muscle extracts was poor compared to heart muscle. This raised the possibility that smooth muscle may differ from heart muscle in the phos-

pholamban structure or the specificity of respec- tive Ca*+/calmodulin-dependent protein kinases.

MATERIALS AND METHODS

Materials

ATP, leupeptin, phenylmethylsulphonylfluoride (PMSF), 3’5’-adenosine cyclic monophosphate (CAMP), leupeptin, trypsin inhibitor, and phosphoamino acids were from Sigma; Acrylamide, bis-acrylamide, glycine, SDS and AGlX8 were from Bio-Rad; [rJ2P] ATP (3000 Ci/mmol) was from New England Nuclear; protein molecular weight standards were from Pharmacia; CPG columns and oligonucleotide purification cartridges were from Applied Biosystems Incorporated; deoxynucleoside triphosphates and murine leukemia virus reverse transcriptase were from Bethesda Research Laboratories; Thermus aquaticus (Taq) polymerase was from Amersham; restriction endonucleases were from Toyobo; Ml 3 phage vectors were from Boehringer Mannheim; sequenase and universal Ml3 promers were from United States Biochemical Corporation; calmodulin was prepared from sheep testes as described previously [5,39]; cGMP-dependent protein kinase was purified from bovine lung according to the method of Lincoln [38]; P-81 paper was from Whatman. Synthetic peptide analogs of glycogen synthase (GS) and phospholamban peptide PL( l-3 1) were synthesised as described by Pearson 1251.

Smooth muscle cell culture

Cells were isolated from the aorta of Sprague-Dawley rats as described by Sarcevic [28] and used only in passages l-4.

Preparation of smooth muscle cell and heart membrane fractions

Smooth muscle cell membrane fraction was prepared as described previously [28, 381. Heart membrane fraction was prepared from rat heart by the same tech- nique, except for homogenization with an Ultraturrax. Protein concentrations were measured using the Bradford method [2] with bovine serum albumin as the standard.

Protein phosphorylation

Phosphorylation experiments were conducted on freshly prepared membrane fractions. The standard phosphorylation reaction mixture contained 50 mM Tris-HCl, pH 7.4, 15 mM MgCl,, 1 mM EGTA, 40 @I[T-~~P] ATP (10 Ci/mmol) and 30-60 pg protein in a final volume of 60 pl and incubated at 37°C for 1 min unless otherwise stated. For the assay of CM-kinase-II, calcium was added to a final concentration of 200 pM and calmodulin was added to a final concentration of 25 ug/ml. For the assay of cyclic nucleotide-dependent protein kinases, CAMP or cGMP was added to a final concentration of 10 pM. Variations in the standard reaction conditions are indicated in the appropriate figure legends. The reactions were initiated by the additional of membrane protein and terminated by adding 30 1.11 of SDS stop solution (0.2M Tris-HCl, pH 6.8, 6% (w/v) SDS, 30% (v/v) glycerol, 6 mM EGTA, 15% (v/v) p- mercaptoethanol, 0.1% (w/v) bromophenal blue) and freezing in dry ice. The samples were then boiled for 3 min unless otherwise stated and subjected to SDS- PAGE.

Polyacrylamide gel electrophoresis and autoradiogra-

phy

The samples were subjected to SDS-PAGE according to the method of Laemmli [ 171 using a linear 7-17% acrylamide gradient (120 V at 10°C). Following electrophoresis the proteins were fixed with 20% (w/v) trichloroacetic acid, stained with Coomassie Brilliant Blue, dried under vacuum, and exposed to Kodak X-AR film.

Partial puri’cation of CM-kinase-II

The kinase was partially purified by the procedure of McGuinness [20]. Three rat hearts or aortic SMC from four confluent 150 cm2 tissue culture flasks were

Phosphorylation of phospholamban 619

homogenized in 10 volumes of buffer A (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM EGTA, 0.5 mM DTT, 0.1 mM PMSF, 10 ug/ml leupeptin and 50 mg/l trypsin inhibitor) with an Ultraturrax and cen- trifuged at 150,000 g for 45 min. The pellet was resuspended in buffer B (1 mM piperazine, 0.5 mM EDTA, 0.5 mM EGTA, 0.5 mM DTT, 0.1 mM PMSF, 10 mg/l leupeptin and 50 mg/l trypsin inhibitor) and stirred for 1 h before recentrifuging. The supernatant and the origi- nal supematant were combined and applied to a Q- sepharose (10 x 1.6 cm) in buffer C (25 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM EGTA, 0.5 mM DTI’). The kinase activity was eluted with a linear gradient of 0 to 0.3 M NaCl at 1 ml/min over 30 min and brought to 10% (v/v) glycerol and 0.1% (v/v) Tween 80 and frozen at -20°C for up to two weeks without significant loss of activity.

Assay of CM-kinase-II

CM-kinase-II was assayed in a 40 ul reaction containing finally 30 mM Tris-HCl, pH 7.4, 1 mM EGTA, 10 mM MgCl,, 0.2 mM free CaCl,, 0.1 mg/ml peptide substrate, 20 pM [Y-~~P] ATP (3500 cpm/pmol) and 8 ul of each column fraction. CM-kinase-II activity was determined by the difference between activity in the presence or absence of calmodulin (12.5 ug/ml). Incubations (in triplicate) proceeded for 5 min at 3O”C, were terminated by acidification to 75 mM phosphoric acid, and unreacted [Y-~~P] ATP was separated from labelled peptides by binding the peptides to P-81 paper for subsequent scintillation counting [27]. Kinetic parameters K,,, and apparent V,,,,, were determined with Enzfitter program (by Robin Leatherbarrow, Elsevier- BIOSOFT, Cambridge, U.K.).

Phospharases

Commercially available potato acid phosphatase was obtained from Calbiochem. In the purification of heart CM-kinase-II described above there was also a phosphatase activity detected in fractions prior to peak II, which dephosphorylated PL(l-31). These fractions were pooled and used as a source of crude cardiac phospholamban phosphatase. As a substrate for phosphatases, PL( l-3 1) (0.1 mg/ml) was phosphorylated with CM-kinase-II (peak II) from aortic SMC or with bovine lung cGMP-dependent protein kinase for 2 h at 30°C to achieve stoichiometric peptide phosphorylation. The peptide was purified by passage over a 2 ml AGIX8 anion exchange column, eluted with 30% (v/v) acetic acid, dried in a Savant centrifugation con- centrator, and resuspended in 0.005% (v/v) Triton X- 100 in 30 mM Tris-HCl, pH 7.4 to 0.1 mg/ml. Phosphorylated peptide was utilized as a phosphatase substrate in an assay containing the same buffers as the membrane phosphorylation assay described above

except for the absence of ATP (a phosphatase inhibitor).

Phosphoamino acid analysis by thin layer electrophoresis (TM)

Stoichiometrically phosphotylated PL( l-3 1) was precipitated by 6% trichloroacetic acid and the dried pellet was partially hydrolysed by 5.8 M HCl at 110°C for 2 h. The sample was dried in a Savant vacuum cen- trifuge prior to the addition of 15 ul of standard mixture containing 1 mg/ml each of P-Ser, P-Thr and P-Tyr and spotted onto a glass-backed TLE plate (10 x 20 cm, 100 pM cellulose, from EM Science). Following high volt- age electrophoresis at pH 3.5 (1000 V at 10°C for 65 min), the plate was dried and stained with ninhydrin to detect the unlabelled standards, and the labelled residue was located by autoradiography.

Nucleotide sequencing

Oligodeoxyribonucleotides (oligonucleotides) were synthesised on an Applied Biosystems 380A DNA syn- thesiser using the 0.2 pm01 scale P-cyanoethylphospho- ramidate method [30] and based on sequence informa- tion from canine cardiac phospholamban [7]. After deprotection the oligonucleotides were eluted from a CPG column and purified using an oligonucleotide purification cartridge. The nucleotide sequences to which they were synthesised are presented in Table 1. Total cytoplasmic RNA was extracted from two flasks of rat aortic smooth muscle cells (2 x 10’ cells) or one rat heart, and 5 ug was used in a 20 pl cDNA synthesis reaction buffer containing deoxynucleoside triphosphates (dNTPS), oligo (dT) primer and 200 units of murine leukemia virus reverse transcriptase. Incubations were at 37°C for 1 h and terminated by addition of 8Oul distilled H,O. For PCR amplification 3 ul of the RNA-cDNA hybrid was included in 50 u1 reactions containing 100 pIv4 of each dNTP, 30 ng of each oligonucleotide primer, 10 mM Tris-HCI, pH 8.3, 50 mM KC1 1.5 mM MgCl,, 0.1% (w/w) gelatin, 12.5 &ml calf thymus DNA and 5 units of Thermus aquaticus (Taq) polymerase and overlaid with 100 ul of par- rafin oil. Thirty-five PCR cycles were run using the Hybrid Intelligent programmable heating block and the following conditions: 1 min at 92°C to denature double stranded templates, 90 s at 55°C to foster primer anneal- ing and 2 min extension times at 72°C. After the final cycle the temperature was held at 72°C for 10 min to allow complete extension of PCR products. Amplification products were analysed on a 2% (w/v) agarose gel in 89 mM Tris, 89 mM boric acid, and 2 mM EDTA. PCR-derived fragments encoding rat aortic smooth muscle cell phospholamban containing Eco RI and Hind III restriction endonuclease sites were digested according to the manufacturers instructions and subcloned into similar digested Ml 3 mp18 and

620 W. Chen et al.

Table 1. Nucleotide sequence of oligonucleotide primers used in PCR analysis of rat phospholamban

Name of Relative nucleotide Nucleiotide sequence* 5’3’ oligonucleotide position to pBLB 1

5’UT - 161 - 161 - 137 CAGGGATCCCACCGATAAGAC-ITCATACAACTA

5’CR + 1 +1 + 21 CAGAAGC-ITATGGATAAAAGTCCAATACCTC

3’CR + 1.56 + 135 + 156 CAGGAATTCGAGAAGCATCACAATAGATGCAG

3’UT + 260 + 135 + 156 CAGCTGCAGAAGTGGTCTGI-IATATAGTA’I-I

3’UT + 537 + 236 + 537 CAGCTGCAGTGAAGCTAATGCTITATAT

* Oligonucleotides also contained additional nucleotides incorporated into their 5’ termini encoding a restriction endonuclease site (either BarnHI, EcoRI, or PsrI underlined). UT, untranslated; CR, coding region.

mp19 phage vectors. Nucleotide sequence analysis by the dideoxy chain termination method was performed using sequenase reagents and universal Ml3 primers.

RESULTS

Phosphorylation of phospholamban in rat aortic

SMC and heart membranes

Membrane fractions from aortic SMC and heart were phosphorylated with [Y-~*P] ATP and the activators of various endogenous protein kinases. Phospholamban was detected by its char- acteristic mobility shift from a 28,000 M, pen-

tamer to a 6000 M, monomer after boiling in the presence of SDS [28] (Fig. 1). When heart mem-

branes were stimulated with cGMP or calcium/calmodulin, phospholamban and a num- ber of other proteins were phosphorylated. However, in aortic SMC membranes phospholamban phosphorylation was stimulated only by cGMP-dependent protein kinase. Little or no phosphorylation by endogenous CM-kinase-II was detected, despite a high activity of this kinase towards many other endogenous substrates in the

membranes (Fig. 2).

Nucleotide sequence of rat aortic SMC phospho-

lamban

We investigated whether the apparent lack of phospholamban phosphorylation in SMC by CM- kinase-II was due to sequence differences in SMC phospholamban compared to the heart.

Phospholamban mRNA was sequenced using a PCR approach. Thirty M 13-phospholamban clones were sequenced from which a consensus sequence was derived. The nucleotide sequence of

rat aortic SMC phospholamban shows no sequence divergence from phospholamban isolated from other muscle types.

Partical purification of CM-kinase-II from rat

aortic SMC and heart

Since phospholamban sequence is identical between heart and aortic SMC, it was determined whether the substrate specificity of the endogenous CM-kinase-II in each tissue might be differ-

ent. CM-kinase-II was partially purified from rat heart and aortic SMC by chromatography on Q- sepharose (Fig. 3). Two peaks of activity were obtained in each tissue. Although the major peak in heart was peak II, variable levels of peak I were obtained in different preparations. Both peaks were usually present in SMC at similar levels.

Comparison of the substrate spec$city of CM-

kinase-ll in the two tissues

The peptide substrate specificity of peak II CM-kinase-II was determined for three known substrates of CM-kinase-II (Table 2). The K, and apparent V_ for three analogues of a glycogen synthase (GS) peptide were not significantly different between heart and SMC. The K,,, values were very similar to those previously reported for

621

SMC Heart Boil + + - + + - +-+ - +-+-

kDa

PL-

Ct cGMP Ca CafCM m--v

ct CGMP Ca CaiCM

Fig. 1. Autoradiograph showing phospholamban phosphorylation by endogenous protein kinases in aortic SMC or heart membranes. Membranes were prepared as described under Materials and Methods. Membrane proteins were phosphorylated for 1 min at 37°C under standard reaction conditions (see Materials and Methods), in the presence of EGTA (Ct); cGMP (10 t&l); calcium (200 pM) and calcium (200 pM) plus calmodulin (25 pg/mI). Prior to electrophoresis the samples were either warmed at 37°C or boiled at lOtj”C for 3 min. The mobility shift of phospholamban from 28,000 M, to 6000 M, are indicated with arrows. The positions of standard molecular weight marker proteins are shown on the right in M,. Results are representative of three independent experiments.

622

WC 123456

71 kDa

87

Heart 7 8 9 IO

kDa

- 200

- 118

- 97

- 67

- 43

- 30

- 20

- 14

Ct.cAMP cGMP Ca C&/CM Ct. cGMP Ca CWCM

Fig. 2. Protein phosphorylation by endogenous kinases in aortic SMC or heart membranes. Membranes were incubated with [T-~~P] ATP at 37’C for 1 min in the presence of EGTA (Ct, lanes 1 and 7), calcium (200 uM) (lanes 5 and 9) or the activators of different classes of protein kinases: CAMP (10 pM) (lane 2); cGMP (10 pM) (lanes 3, 4 and 9); calcium (200 uM) plus calmodulin (25 ug/ml) (lanes 6 and 10). The samples were boiled and resolved by 7.517% SDS-PAGE and subjected to autoradiography. This experiment is representative of three separate experiments with the same pattern of protein phosphorylation.


Ptnification of CM-kinase II from aortic SMC

4oooo

0 0 100 25l 300

NaCl (mh4)

Puritication of CM-kinase II fromheart

0 100 200 300

NaCl (n&l)

Fig. 3. Partial purification of CM-kinase-II by chromatography on Q-sepharose. Two peaks of activity (I and II) were obtained from each tissue that phosphorylated a synthetic peptide substrate GS(l-10)R3. Phosphorylation was in the presence (filled symbols) or absence (open symbols) of calmodulin.

these peptides [26]. A synthetic peptide corre- sponding to the cytoplasmic domain of phospho-

lamban [PL(l-31)]: MDKVQYLTRSAIR-

RASTIEMPQQARQNLQNL, was synthesised and tested as a possible substrate (Table 3). PL(l- 31) was an excellent substrate for CM-kinase-II. Both peaks I and II from SMC phosphorylated the

peptide with kinetics that were indistinguishable from those of GS( 1- 10)R3, one of the best reported synthetic peptide substrates of CM-kinase-II. In

each case the phophorylated amino acids of PL( l- 31) were both serine and threonine in approxi- mately equal ratios (55% serine and 45% threonine by SMC CM-kinase-II; 60% serine and 40% threonine by heart CM-kinase-II) (Fig.4).

The possibility that subcellular location of CM-

kinase-II in SMC resulting in reduced access to phospholamban was examined by adding exogenous CM-kinase-II from SMC to the membranes.

However, phosphorylation of phospholamban was not stimulated (Fig.5). Next, we examined

whether a phospholamban phosphatase could account for the apparent lack of phospholamban phosphorylation by CM-kinase-II in SMC. The PL( 1-31) peptide phosphorylated with either SMC CM-kinase-II or with cGMP-dependent protein kinase was an excellent substrate for acid phosphatase. The peptide was also dephosphorylated

by a cardiac phosphatase obtained by Q-sepharose chromatography. However, no significant dephos- phorylation of this peptide was detected in SMC membranes after 5 min at 37”C, indicating that

there was not an unusually high level of phospholamban-phosphatase activity in the SMC membrane (results not shown).

Table 2. Comparison of kinetic parameters for the phosphotylation of synthetic peptides by CM-kinase-II (peak II) from rat aortic SMC and heart

Peptide SMC Km (PM

Heart V,,, (nmol/mg/min)

SMC Heart

GS( l- 10)R3A9J0 6.9 zt .4 3.1 i 0.6 20.3 i 0.3 31.5 + 1.5

GS(l-10)R5A9.” lll.Oi4.5 40.4 f 6.6 28.0 f 6.8 35.1 f 2.5

GS(l-12)A9J0K”J2 16.2 f 1.7 9.6 i 1.4 15.5 f 0.5 25.8 + 1.1

Peptide phosphorylation was determined as described under Materials and Methods. Kinetic constants (+ S.E.) were estimated by fitting the data to the Michaelis-Menten equation using the method of least squares.

624 W. Chen et al.

Table 3. Comparison of the kinetic parameters for phosphorylation of PL( l-3 1) or GS( 1 - 10)R3 by CM-kinase-II peaks I and II from rat aortic SMC or heart

Peptide SMC K&W

Heart V,,,(nmol/mg/min)

SMC Heart

Peak 1 PL(l-31) 9.0 t 1.2 20.5 zt 1.2 -

GS(I-10)R3A’Jo 8.6* 1.3 - 17.4 * 0.9

Peak II

PL(l-31) 14.5 f 3.0 24.2 f 1.2 23.5 ? 2.5 9.4i2.1

GS(l-10)R’A9J0 6.9 + 0.4 3.1 *0.6 20.3 i 0.3 31.5 * 1.5

Peptide phosphorylation was determined as described under Materials and Methods. Kinetic constants (* SE.) were estimated by fitting the data to the Michaelis-Menten equation using the method of least squares.

We examined whether phospholamban in SMC was already substantially phosphorylated in the

membrane preparation. SMC membranes were pretreated with acid phosphatase or with a partially purified heart phosphatase that can rapidly dephos- phorylate PL( l-3 1) after being phosphorylated with either CM-kinase-II or cGMP-dependent protein kinase. None of these pre-treatments resulted in subsequent phosphorylation of SMC phospholamban by endogenous CM-kinase-II (Fig. 6).

DISCUSSION

Phospholamban from rat aortic smooth muscle

cells is an excellent substrate for cGMP-dependent protein kinase, as is its counterpart in heart.

However, smooth muscle phospholamban is poorly phosphorylated by endogenous CM-kinase II, in contrast to phospolamban in the heart. We found that phospholamban’s amino acid sequence is the same in the two tissues and the substrate specificity of the CM-kinase-II form that is present in each tissue is indistinguishable. Moreover SMC membranes do not contain phospholamban in a phosphorylated form nor do they contain high levels of a phospholamban phosphatase.

A simple explanation for lack of phosphorylation by CM-kinase-II in smooth muscle cells was a possible amino acid substitution in phospholamban’s sequence that removed Thr-17 or modified one of the basic amino acids amino-terminal to Thr-17 (particularly Arg-9), thus leading to loss of CM-kinase-II phosphorylation, but not cGMP-

dependent protein kinase phosphorylation [ 81. However, the nucleotide sequence of rat SMC phospholamban does not show any amino acid substitution compared with other muscle types.

It is known that there are at least five isoen-

zymes of CM-kinase-II: a [12], p [1]$‘[3], y and 6[36], with distinct tissue distribution. Studies on tissue-specific expression of these isoenzyme mRNAs have shown that a and p/p’ mRNAs are primarily, if not exclusively, expressed in various tissues, with y being predominant in the aorta and

6 being considerably expressed in heart. Therefore it is a possibility that the tissue-specific expression of distinct CM-kinase-II isoforms might underlie the poor phosphorylation of phospholamban in SMC versus heart. However, after partially purifying CM-kinase-II from each tissue we failed to detect any significant substrate specificity differences between them. This is consistent with the report of Gupta and Iwasa [ 11,141, who purified the CM-kinase-II from canine heart cytosol and showed that its substrate specificity was similar to the enzyme from other tissues. However, CM- kinase-II has not been previously purified from rat aorta. We found that a synthetic peptide corre- sponding to the cytoplasmic domain of phospholamban [PL(l-31)] was an excellent substrate for CM-kinase-II from either heart or SMC. The kinetics of phosphorylation were comparable to those of the best synthetic peptide substrates of this kinase [26] and were similar to those previously described for PL( l-25) phosphorylated by CM-kinase-II in heart [ 111.

625

- P-Ser.

- P-Thr.

- P-Tyr.

cGMP-kinase CM-kinase II CM-kinase II

ww (Heart)

Fig. 4. Phosphoamino acid analysis of PL( l-3 1). PL( l-3 1) was phosphorylated by purified CM-kinase-II from SMC or heart and by cGMP-dependent protein kinase, and was partially hydrolysed with 5.8 M HCI at 110°C for 2 h. Phosphoamino acids were separated by thin layer electrophoresis (TLE) at pH 3.5 (see Materials and Methods) and autoradiographed. The positions of phospho-amino acid standards are indicated.

626

A. Membrane alone B. Membrane +

CM-Kinase (Peak I)

kDa

- 97

- 67

- 45

- 30

- 20

- 14

PL-

Ct Ca CalCM Ct Ca Ca/CM

Fig. 5. Phosphorylation of phospholamban in aortic SMC membranes in the presence of exogenous CM-kinase-II (peak I) from aortic SMC. Membranes were phosphorylated for 1 min at 37°C under standard reaction conditions, in the presence of EGTA (Ct, lane 1); calcium (200 pM) (lanes 2); calcium (200 pM) plus calmodulin (25 pg/ml) (lanes 3). Panel A, in the absence of exogenous CM-kinase-II (peak I). Panel B, in the presence of exogenous CM- kinase-II (peak I). Proteins were separated by SDS-PAGE and autoradiographed. Phospholamban migration is indicated with arrows.

621

kDa

- 30

ct cGMP Ca/CM ct cGMP CdCM

Fig. 6. Phosphoxylation of phosphatase pretreated SMC membranes. SMC membranes were preincubated with potato acid phosphatase (80 pg) (panel A) or a partially purified heart phosphatase (panel B) for 30 min at 20°C and then put on ice for 10 min to diminish phosphatase activity, followed by phosphorylation in the presence of EGTA (Ct, lane 1); cGMP (10 pM) (lane 2); calcium (200 pM) plus calmodulin (25 t&ml) (lane 3) for 1 min at 0°C. Proteins were separated by SDS-PAGE and autoradiographed.


Cornwell and Lincoln [4,19] have indicated

that compartmentalization of protein kinases with substrates in the intact cell is an important factor involved in protein phosphorylation. They have found that phospholamban is phosphorylated by CAMP-dependent protein kinase only in heart and by cGMP-dependent protein kinase only in aortic

SMC. Using confocal laser scanning microscopy they have shown that cGMP-dependent protein kinase and phospholamban co-localize to the same cellular regions. The subcellular distribution of CM-kinase-II has been shown to be divergent

in different tissues [ 131. For example, most of the kinase activity is cytoplasmic in rat kidney (lOO%), liver (94%) and heart (82%) whereas in cerebrum and testis most kinase is particulate (88% and 84%, respectively). However, phospholamban phosphorylation was still not detectable even after adding exogenous CM-kinase-II from

SMC. Phospholamban is associated with (in decreas-

ing order) phosphatidylserine, phosphatidyl-

choline, sphingomyelin, phosphatidylinositol,

phosphatidylethanolamine, and polyphosphatidyli- nositols [15]. Results of the study by Suzuki [32] suggest that phospholamban in the sarcoplasmic reticulum is embedded in a phosphatidylinositol- rich microenvironment and the phospholipid envi- ronment surrounding phospholamban has pro- found effects on the ability of the protein to serve as a substrate of CAMP-dependent protein kinase. We cannot exclude the possibility that the phospholipid microenvironment of phospholamban modulates its ability to serve as the substrate of CM-kinase-II in aortic SMC compared to heart muscle. However it seems more reasonable that the low abundance of phospholamban in smooth muscle is probably the reason for the lack of Ca*+/calmodulin-dependent phosphorylation.

Acknowledgements - We are grateful to COLIN HOUSE for critical reading of the manuscript, and to KEN MITCHELHILL for making synthetic peptides. This work was supported by a grant from the National Heart Foundation. BEK is an NHMRC Research Fellow.

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17. 18.

19.

20.

21.

22.

23.

24.

25.

REFERENCES

Bennett M. K. and Kennedy M. B. (1987) Proc. natn. Acad. Sci. U.S.A. 84, 1794-1798. Bradford M. M. (1976) Analyt. Biochem. 72, 248-254. Bulleit R. F., Bennett M. K., Molloy S. S., Hurley J. B. and Kennedy M. B. (1988) Neuron 1, 63-72. Comwell T. L., Pryzwansky K. B., Wyatt T. A. and Lincoln T. M. (1991) Molec. Pharmac. 40,923-93 1 (Abstract). Dedman J. R. and Kaetzel M. A. (1983) Meth. Enzymol. 102, l-8. Erondu N. E. and Kennedy M. B. (1985) J. Neurosci. 5, 3270-3277. Fujii J., Kadoma M., Tada M., Toda H. and Sakiyama F. (1986) Biochem. biophys. Res. Commun. 138, 1044-1050. Fujii J., Maruyama K., Tada M. and MacLennan D.H. (1989) J. biol. Chem. 264, 12,95@12,955. Fujii J., Ueno A., Kitano K., Tanaka S., Kadoma M. and Tada M. (1987) J. c/in. Invest. 79, 301-304. Go M., Yokoyama M., Akita H. and Fukuzaki H. (1988) Biochem. biophys. Res. Commun. 153, 51-58. Gupta R. C. and Kranias E. G. (1989) Biochemistry 28,5909-5916. Hanley R. M., Means A. R., Ono T., Kemp B. E., Burgin K. E., Waxham N. and Kelly P. T. (1987) Science 237,293-297. Hashimoto Y. and Soderling T. R. (1987) Arch. Biochem. Biophys. 252,4 18425. Iwasa T., Inoue N. and Miyamoto E. (1985) J. Biochem. (Tokyo) 98,577-580. Jakab G. and Kranias E. G. (1988) Biochemistry 27,3799-3806. James P., Inui M., Tada M., Chiesi M. and Carafoli E. (1989) Nature 342,90-92. Laemmli U. K. (1970) Nature 227,680-685. Le Peuch C. J., Haiech J. and Demaille J. G. (1979) Biochemistry l&5150-5157. Lincoln T. M. and Comwell T. L. (199 I) Blood Vessels 28, 129- 137. McGuinness T. L., Lai Y. and Greengard P. (1985) J. biol. Chem. 260, 16961704. Mosesian M. A., Nishikawa M. and Adelstein R. S. (1984) J. biol. Chem. 259, 8029-8032. Naim A. C., Bhagat B. and Greengard P. (1985) Proc. natn. Acad. Sci. U.S.A. 82, 7939-7943. Naim A. C., Hemmings H. C. and Greengard P. (1985) A. Rev. Biochem. 54,93 l-976. Payne M. E., Schworer C. M. and Soderling T. R. (1983) J. biol. Chem. 258,23762382. Pearson R. B., Mitchelhill K. I. and Kemp B. E. (1993) in Protein Phosphotylution (Hardie D. G.,

630 W. Chen et al.

Ed.), pp. 265-291. Oxford University Press, Oxford.

26. Pearson R. B., Woodgett J. R., Cohen P. and Kemp B. E. (1985) .I. biul. Chem. 260, 14,471-14,476.

27. Roskoski R. Jr. (1983) Meth. Enzymol. 99,3-6. 28. Sarcevic B., Brookes V., Martin T. J., Kemp B. E.

and Robinson P. J. (1989) J. biol. Chem. 264 20,648-20,654.

29. Simmerman H. K. B., Lovelace D. E. and Jones L. R. (1989) Biochim. biophys. Actu 997,322-329.

30. Sinha N. D., Biemat J., McNanus J. and Koster H. (1990) Nucl. Acids Res. 12,23-30.

31. Suzuki T. and Wang J. H. (1986) J. biol. Chem. 261,7018-7023.

32. Suzuki T. and Wang J. H. (1987) J. biol. Chem. 262,3880-3885.

33. Tada M. and Katz A. M. (1982) A. Rev. Physiol. 44,401-423.

34. Tada M., Kirchberger M. A. and Katz A. M. (1975) J. biol. Chem. 250,2640-2647.

35. Tada M., Ohmori F., Kinoshita N. and Abe H. (1978) Adv. Cyclic. Nucleotide. Res. 9,355-369.

36. Tobimatsu T. and Fujisawa H. (1989) J. biol. Chem. 264,17,907-17,912.

37. Uyeda A., Kitano K., Fujii J., Kadoma M., Tada M. and Tanaka S. (1987) Nut. Acids Res. 15,6738.

38. Waldman S. A., Rapoport R. M., Fiscus R. R., Leitman D.C., Chang L. Y., and Murad F. (1989) Biochim. biophys. Actu 999, 157-162.

39. Walsh M. P., Hit&ins S., Dabrowska R. and Hartshome D. J. (1983) Meth. Enzymol. 99, 279-288.

40. Wegener A. D., Simmerman H. K. B., Lindemann J. P. and Jones L. R. (1989) J. biol. Chem. 264, 11,468-l 1,474.

phosphorylation of phospholamban in aortic smooth muscle cells and heart by...

Documents