pGLO lab

The importance of DNA

The DNA double helix is the code of life

• DNA is the code to make proteins

• The blueprint for all structures in your body which are made of protein

• DNA is comprised of nucleotides

Nulceotides are the monomers of nucleic acid polymers

• Consist of a sugar, a phosphate, and a nitrogen-containing base

• Sugar can be deoxygenated

• Bases contain the genetic information

There are 4 kinds of DNA bases

Adenine always matches with

Thymine, Cytosine always

matches with Guanine-

Hydrogen bonds hold bases together

Living things are extremely complex• Cellular machinery is

sophisticated and required for life

• Cellular machinery is made largely of proteins

• Blueprints for all cellular machinery are contained in genes

• Genes are inherited from parents

• Humans have ~30,000 genes

Proteins give living things the variety of their structures

Protein variety is generated by 1o structure- the sequence of amino acids

which make the protein

Figure 2.12

Amino Acids

• Proteins consist of subunits called amino acids

How DNA works

• Replication• Transcription• Translation

The sequence of DNA bases is the code for the primary structure of

proteins

All cells require a copy of the genome

• Genome- all the genes of the cell • Human genome is made of DNA• DNA is similar in all cells• Gene- 1 DNA Molecule (+

proteins the genetic information to produce a single product (protein)

• DNA replication copies all cellular DNA

Replication of DNA

Figure 21.2

The DNA code

Computers use binary digital code

• 01100001 = A• 01100010 =B• 01000011 =c• 00100111 = apostrophe• Etc.

• http://www.geek-notes.com/tools/17/text-to-binary-translator/

01000011 01101000 01100101 01100101 01110011 01100101 01100010 01110101 01110010 01100111 01100101 01110010 00100000 01000100 01100101 01101100 01110101 01111000 01100101 = cheeseburger deluxe

How does the DNA code work?

• atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttc=GFP

The DNA code is (nearly)

universalIt uses groups of 3 bases (codon)

3 bases = 1 codon = 1 amino acid

The Central Dogma of Molecular Biology

• DNA RNA Protein • DNARNA :

Transcription• RNA Protein:

Translation

DNA RNA Protein Trait

The Universality of the DNA code makes

this possible

Firefly gene (Luciferase) in a tobacco plant

tRNA’s carry an amino acid at one end, and have an anticodon at the other

Figure 21.6

Amino acid(phenylalanine)

mRNA

Anticodon

Amino acidattachment site:Binds to a specific amino acid.

Anticodon:Binds to codon on mRNA, following complementary base-pairing rules.

The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in

sequence

In this way, the proteins in nature are virtually limitless

Proteins are incredibly diverse at the molecular level

Insulin

ATP synthase

Rubisco

NitrogenaseFibrin

A few examples

Protein function depends greatly on shape

Because the DNA code is universal, genes can be moved from one living thing to another

Figure 21.14 (1 of 2)

Step 1: Isolate DNA fromtwo sources.

Step 2: Cut both DNAswith the same restriction enzyme.

Step 3: When mixed, the DNAs recombine by base pairing.

Bacterium

Plasmid

Cell with gene of interest

Source (donor) DNA

Fragments of source DNA

When one DNA molecule is copied to make two DNA molecules, the new DNA contains

1. A) 25% of the parent DNA. 2. B) 50% of the parent DNA. 3. C) 75% of the parent DNA. 4. D) 100% of the parent DNA. 5. E) none of the parent DNA.

DNA in action

• HIV and AIDS• Genetic engineering• pGLO

Genetic Engineering allows DNA

to be moved from one

organism to another

Figure 21.14

Green Fluorescent Protein• discovered in 1960s by Dr. Frank Johnson

and colleagues

• closely related to jellyfish aequorin

• absorption max = 470nm

• emission max = 508nm

• 238 amino acids, 27kDa

• “beta can” conformation: 11 antiparallel beta sheets, 4 alpha helices, and a centered chromophore

• amino acid substitutions result in several variants, including YFP, BFP, and CFP

40 Å

30 Å

The pGLO plasmid has genes which can be turned on and off

• ori- origin of replication• GFP- green fluorescent

protein• bla- Beta-lactamase• araC- Arabinose • What are all the other

marks? Why are they there?

2008 Nobel Prize- GFP

• GFP mice

Gene Regulation

RNA Polymerase

araC

ara GFP Operon

GFP Gene

araC GFP Gene

araC GFP Gene

Effector (Arabinose)

B A DaraC

B A DaraC

RNA Polymerase

Effector (Arabinose)

araC B A D

ara Operon

On pGLO, the regulatory regions of the Arabinose operon have been glued to the structural sequences for GFP

What will happen on the Ara (+) plates?What will happen on the Ara (-) plates?

04/19/23 34

Grow? Glow?

Follow protocol On which plates will

colonies grow? Which colonies will

glow?

Which colonies will glow?