The DNA double helix is the code of life
• DNA is the code to make proteins
• The blueprint for all structures in your body which are made of protein
• DNA is comprised of nucleotides
Nulceotides are the monomers of nucleic acid polymers
• Consist of a sugar, a phosphate, and a nitrogen-containing base
• Sugar can be deoxygenated
• Bases contain the genetic information
Adenine always matches with
Thymine, Cytosine always
matches with Guanine-
Hydrogen bonds hold bases together
Living things are extremely complex• Cellular machinery is
sophisticated and required for life
• Cellular machinery is made largely of proteins
• Blueprints for all cellular machinery are contained in genes
• Genes are inherited from parents
• Humans have ~30,000 genes
All cells require a copy of the genome
• Genome- all the genes of the cell • Human genome is made of DNA• DNA is similar in all cells• Gene- 1 DNA Molecule (+
proteins the genetic information to produce a single product (protein)
• DNA replication copies all cellular DNA
Computers use binary digital code
• 01100001 = A• 01100010 =B• 01000011 =c• 00100111 = apostrophe• Etc.
• http://www.geek-notes.com/tools/17/text-to-binary-translator/
01000011 01101000 01100101 01100101 01110011 01100101 01100010 01110101 01110010 01100111 01100101 01110010 00100000 01000100 01100101 01101100 01110101 01111000 01100101 = cheeseburger deluxe
How does the DNA code work?
• atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttc=GFP
The DNA code is (nearly)
universalIt uses groups of 3 bases (codon)
3 bases = 1 codon = 1 amino acid
The Central Dogma of Molecular Biology
• DNA RNA Protein • DNARNA :
Transcription• RNA Protein:
Translation
tRNA’s carry an amino acid at one end, and have an anticodon at the other
Figure 21.6
Amino acid(phenylalanine)
mRNA
Anticodon
Amino acidattachment site:Binds to a specific amino acid.
Anticodon:Binds to codon on mRNA, following complementary base-pairing rules.
Proteins are incredibly diverse at the molecular level
Insulin
ATP synthase
Rubisco
NitrogenaseFibrin
A few examples
Protein function depends greatly on shape
Because the DNA code is universal, genes can be moved from one living thing to another
Figure 21.14 (1 of 2)
Step 1: Isolate DNA fromtwo sources.
Step 2: Cut both DNAswith the same restriction enzyme.
Step 3: When mixed, the DNAs recombine by base pairing.
Bacterium
Plasmid
Cell with gene of interest
Source (donor) DNA
Fragments of source DNA
When one DNA molecule is copied to make two DNA molecules, the new DNA contains
1. A) 25% of the parent DNA. 2. B) 50% of the parent DNA. 3. C) 75% of the parent DNA. 4. D) 100% of the parent DNA. 5. E) none of the parent DNA.
Green Fluorescent Protein• discovered in 1960s by Dr. Frank Johnson
and colleagues
• closely related to jellyfish aequorin
• absorption max = 470nm
• emission max = 508nm
• 238 amino acids, 27kDa
• “beta can” conformation: 11 antiparallel beta sheets, 4 alpha helices, and a centered chromophore
• amino acid substitutions result in several variants, including YFP, BFP, and CFP
40 Å
30 Å
The pGLO plasmid has genes which can be turned on and off
• ori- origin of replication• GFP- green fluorescent
protein• bla- Beta-lactamase• araC- Arabinose • What are all the other
marks? Why are they there?
Gene Regulation
RNA Polymerase
araC
ara GFP Operon
GFP Gene
araC GFP Gene
araC GFP Gene
Effector (Arabinose)
B A DaraC
B A DaraC
RNA Polymerase
Effector (Arabinose)
araC B A D
ara Operon
On pGLO, the regulatory regions of the Arabinose operon have been glued to the structural sequences for GFP
What will happen on the Ara (+) plates?What will happen on the Ara (-) plates?