Pendimethalin Nitroreductase Is Responsible for the InitialPendimethalin Degradation Step in Bacillus subtilis Y3

Hai-yan Ni,a Fei Wang,b Na Li,a Li Yao,a,d Chen Dai,c Qin He,a Jian He,a,c Qing Honga

Key Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing, Jiangsu, People’sRepublic of Chinaa; Jiangxi Engineering Laboratory for the Development and Utilization of Agricultural Microbial Resources, College of Bioscience and Bioengineering,Jiangxi Agricultural University, Nanchang, Jiangxi, People’s Republic of Chinab; Laboratory Center of Life Sciences, College of Life Sciences, Nanjing Agricultural University,Nanjing, Jiangsu, People’s Republic of Chinac; Department of Biological Sciences, College of Ocean and Biology Engineering, Yancheng Teachers University, Yancheng,Jiangsu, People’s Republic of Chinad

ABSTRACT

Pendimethalin [N-(1-ethylpropyl)-2,6-dinitro-3,4-xylidine] is a selective preemergence dinitroaniline herbicide. Several fungiand bacteria have been reported to degrade pendimethalin, but the enzymes or genes involved in this process have not beencharacterized. Nitroreduction is the initial degradation and detoxification step for pendimethalin. In this study, a pendimethalinnitroreductase (PNR), responsible for the nitroreduction of pendimethalin, was purified from the pendimethalin-degradingstrain Bacillus subtilis Y3. Based on a comparison of its mass fingerprints with all of the deduced proteins from the draft genomeof strain Y3, a protein annotated as a nitroreductase was identified, and its corresponding encoding gene was termed pnr. PNRwas a functional homodimer with a subunit molecular mass of approximately 23 kDa. PNR reduced the C-6 nitro group of thearomatic ring of pendimethalin, yielding 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine. PNR could also catalyze the nitrore-duction of three other major varieties of dinitroaniline herbicides, including butralin, oryzalin, and trifluralin. However, thenumber of reduced nitro groups was two instead of one, which differed from the nitroreduction of pendimethalin by PNR andwhich may be due to the symmetry in the chemical structures of the two nitro groups. A detoxification assay revealed that 2-ni-tro-6-amino-N-(1-ethylpropyl)-3,4-xylidine (PNR-reduced pendimethalin) showed no inhibitory effect on the growth of Saccha-romyces cerevisiae BY4741, whereas pendimethalin showed an obvious inhibitory effect on its growth, indicating the detoxifica-tion effect of pendimethalin by PNR. Therefore, PNR has potential in pendimethalin detoxification applications. This reportdescribes an enzyme (and corresponding gene) involved in the biodegradation of pendimethalin and dinitroaniline herbicides.

IMPORTANCE

Pendimethalin [N-(1-ethylpropyl)-2,6-dinitro-3,4-xylidine] is a widely used selective preemergence dinitroaniline herbicide, andits residue has been frequently detected in the environment. The U.S. Environmental Protection Agency (EPA) has classifiedpendimethalin as a persistent bioaccumulative toxin. To date, no enzymes or genes involved in pendimethalin biodegradationhave been reported. In the present study, the gene pnr, which encodes the nitroreductase PNR, responsible for the nitroreduc-tion of pendimethalin, was cloned from the pendimethalin-degrading strain Bacillus subtilis Y3. PNR could also catalyze thenitroreduction of three other major varieties of dinitroaniline herbicides, including butralin, oryzalin, and trifluralin. The re-duction of pendimethalin by PNR might eliminate its toxicity against Saccharomyces cerevisiae BY4741, indicating the applica-tion potential of PNR in the detoxification of pendimethalin.

Pendimethalin [N-(1-ethylpropyl)-2,6-dinitro-3,4-xylidine], aselective preemergence dinitroaniline herbicide, is widely used to

control annual grasses and certain broadleaf weeds in the planting ofdryland crops. It is the third most frequently used herbicide behindglyphosate and parquet and the most frequently used selective herbi-cide in the world. Pendimethalin’s herbicidal action lies in its inhibi-tion of cell elongation and cell division. Compared to other dinitroa-nilines, pendimethalin has a relatively low volatility, so it is lost lessrapidly from the surface soil by volatilization (1, 2). Pendimethalin ismoderately persistent in soil, with a half-life of approximately 69 daysin tropical fields, and its residue has been frequently detected in soil,ground water, and surface water (3). The U.S. Environmental Protec-tion Agency (EPA) has classified pendimethalin as a persistent bioac-cumulative toxic agent (4). Although it has low acute toxicity, it is apossible human carcinogen and is also toxic to terrestrial and aquaticinvertebrates (5, 6). Therefore, great concern and interest have beenraised regarding the environmental behavior and degradation mech-anisms of pendimethalin.

To date, several microorganisms capable of degrading pendi-methalin have been isolated and characterized, including Azoto-bacter chroococcum, Fusarium oxysporum, Pyricularia oryzae Cav.,Lecanicillium saksenae, Bacillus circulans, and Bacillus subtilis Y3(7–10). The degradation pathway of pendimethalin has been pro-

Received 11 June 2016 Accepted 22 September 2016

Accepted manuscript posted online 30 September 2016

Citation Ni H, Wang F, Li N, Yao L, Dai C, He Q, He J, Hong Q. 2016. Pendimethalinnitroreductase is responsible for the initial pendimethalin degradation step in Bacillussubtilis Y3. Appl Environ Microbiol 82:7052–7062. doi:10.1128/AEM.01771-16.

Editor: H. Nojiri, The University of Tokyo

Address correspondence to Qing Hong, hongqing@njau.edu.cn.

H.N. and F.W. contributed equally to this article.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01771-16.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

7052 aem.asm.org December 2016 Volume 82 Number 24Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

posed and summarized based on the structural identification ofintermediate metabolites that appear during its degradation bydifferent strains (Fig. 1). In the degradation process, nitroreduc-tion is the key step.

Because no genes or enzymes involved in the biodegradation ofpendimethalin have been described thus far and because the ni-troreduction process is a general strategy for the detoxification ofnitroaromatic compounds (7, 11, 12), in this study, we focused onthe cloning of a gene encoding the nitroreductase responsible forthe conversion of pendimethalin to 2-nitro-6-amino-N-(1-ethyl-propyl)-3,4-xylidine in B. subtilis Y3, which was previously iso-lated by our group (10).

MATERIALS AND METHODSChemicals and media. Pendimethalin (97%) was a generous gift fromRosi Chemical Co. Ltd., Zhejiang Province, China. Butralin (99%), ory-

zalin (99%), and trifluralin (99%) were purchased from Sigma-Aldrich,France. All other chemical reagents were of the highest analytical purity.

Mineral salts medium (MSM) consisted of 1.0 g/liter NH4NO3, 0.5g/liter NaCl, 1.5 g/liter K2HPO4, 0.5 g/liter KH2PO4, and 0.2 g/literMgSO4·7H2O; the carbon source was added as needed. Luria-Bertani (LB)broth contained 10.0 g/liter tryptone, 5.0 g/liter yeast extract, and 10.0g/liter NaCl. Yeast extract peptone dextrose (YPD) medium contained20.0 g/liter tryptone, 10.0 g/liter yeast extract, and 20.0 g/liter glucose. Forsolid medium, 15.0 g agar was added per liter.

Strains, plasmids, and culture conditions. The strains and plasmidsused in the study are presented in Table 1. Strain Y3 (deposit numberCanadian Clinical Trials Coordinating Centre [CCTCC] AB 2015029)was grown in LB broth or MSM supplemented with 0.36 mM pendime-thalin at 30°C aerobically unless otherwise stated. Escherichia coliBL21(DE3) and Staphylococcus aureus ATCC 25923 were incubated aero-bically at 37°C in LB broth. Saccharomyces cerevisiae BY4741 was grown onYPD medium at 30°C.

FIG 1 Proposed degradation pathways of pendimethalin by the reported strains.

Pendimethalin Nitroreductase PNR

December 2016 Volume 82 Number 24 aem.asm.org 7053Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Sequencing, assembly, and annotation. DNA extraction was per-formed according to the method described by Sambrook and Russell (13).The sequencing of the strain Y3 draft genome was performed by ShanghaiMajorbio Bio-pharm Technology Co. Ltd. (Shanghai, China) using theIllumina HiSeq 2000 sequencing system (14–16). Shotgun libraries con-sisting of 500-bp paired-read fragments were sequenced and assembledusing SOAPdenovo software (version 2; http://soapdenovo2.sourceforge.net/). Gene prediction and functional annotation were performed usingGlimmer 3.02 (17), tRNAscan-SE version 1.3.1 (18), and Barrnap 0.4.2(19).

Purification of pendimethalin nitroreductase. Strain Y3 cells weregrown in LB broth, harvested by centrifugation at 8,000 � g for 10 min at4°C, washed twice with 20 mM Tris-HCl buffer (pH 7.5), and lysed bysonication (Auto Science, UH-650B ultrasonic processor, 40% intensity)for 15 min. After centrifugation at 12,000 � g for 30 min at 4°C to removeunbroken cells, the supernatant obtained, referred to as the cell extract,was precipitated with ammonium sulfate. The 45 to 70% fraction wasdissolved in 20 ml of 20 mM Tris-HCl buffer (pH 7.5) and desalted over-night in a Slide-A-Lyzer dialysis membrane (10 kDa) (Pierce, USA)against 20 mM Tris-HCl buffer (pH 7.5) at 4°C. After dialysis, the result-ing mixture was subjected to DEAE-Sepharose chromatography, and pro-teins were eluted with a 0 to 1 M linear gradient of NaCl in 20 mMTris-HCl buffer (pH 7.5). Active fractions were combined, dialyzed, andsubjected to ammonium sulfate precipitation to a final ammonium sulfateconcentration of 45%. The fraction was collected by centrifugation at12,000 � g for 30 min at 4°C, dissolved in 20 mM Tris-HCl buffer (pH7.5), subjected to a hydrophobic interaction chromatography column,and eluted with a 45% to 0% ammonium sulfate gradient in 20 mMTris-HCl buffer (pH 7.5). Pooled active fractions were collected, concen-trated using Microcon centrifugal filters (10-kDa cutoff), subjected toSephadex G-75 Gel filtration, and eluted with 20 mM Tris-HCl buffer (pH7.5). All purification steps were performed at 4°C. Sodium dodecyl sul-fate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed todetermine the molecular weight of the denatured protein (20), and theBradford method (21) was used to quantify the protein concentration.

Pendimethalin is orange-yellow in color; the fading or disappearanceof this specific color could be used as a method to determine its degrada-tion (see Fig. S1 in the supplemental material). Native polyacrylamide gelelectrophoresis (native PAGE) was performed according to the descrip-tion of Wittig et al. (22) with some modifications. Pendimethalin (0.18mM) was added to the gel as an indicator. The purified proteins of strainY3 in the native PAGE were assayed for nitroreductase activity againstpendimethalin after electrophoresis, which would result in a transparentzone in the native PAGE gel if the protein mixture exhibited nitroreduc-tase activity.

Protein assay, sequencing, mass spectroscopy analysis, and genomecomparison. The transparent zone on the native PAGE gel was cut outand sent to Bo-Yuan Biological Technology Co. Ltd. (Shanghai, China)for peptide mass fingerprint analysis. The resulting peptide fragmentswere compared with the amino acid sequences of the annotated open

reading frames (ORFs) from the draft genome of strain Y3 to identify thesequences with high similarity.

For the phylogenetic analysis of pendimethalin nitroreductase (PNR),all protein sequences were aligned in Clustal X (version 2.1) (23) and thenimported into MEGA software (version 5.0) (24) for phylogenetic treeconstruction using the neighbor-joining method (25). Distances were cal-culated with a Kimura two-parameter distance model (26).

Expression of pnr and purification of recombinant PNR. The pnrgene was amplified from the genome DNA of strain Y3 with primers pnr-F(5=-GGAATTCCATATGATCAAAACAAACGATTTTATGG-3=) (theNdeI digestion site is underlined) and pnr-R (5=-CCGCTCGAGTTTCCATTCTGCAATTGTATCAATC-3=) (the XhoI digestion site is underlined).The products were then digested with NdeI and XhoI and introduced intothe corresponding sites of pET29a(�), yielding pET29a-pnr, which wastransformed into E. coli BL21(DE3) and sequenced for validating the cor-rect amplification and insertion into pET29a(�). E. coli BL21(DE3) cellsharboring pET29a-pnr were incubated in 100 ml of LB broth at 37°C to anoptical density at 600 nm (OD600) of 0.6 to 0.8, after which 0.3 mMisopropyl-�-D-thiogalactopyranoside (IPTG) was added. After anotherincubation at 16°C for 16 h, cells were harvested by centrifugation andsubjected to ultrasonic disruption as described above. Nickel-nitrilotri-acetic acid (Ni2�-NTA) resin was used for the purification of the recom-binant PNR (27). A series concentration of imidazole in 20 mM Tris-HClbuffer (pH 7.5) was used to elute the recombinant PNR. Sephadex G-75gel filtration was used to determine the molecular weight of the nativeprotein.

Enzyme activity assay. The enzyme reaction was performed at 35°Cfor 10 min in 3 ml of 20 mM Tris-HCl buffer (pH 7.5) containing 0.36 mMpendimethalin, a suitable amount of enzyme (cell extract or recombinantPNR), 0.8 mM NADH, and 1 mM Mg2�. One unit of enzyme activity wasdefined as the amount of enzyme required to catalyze the consumption of1 nmol pendimethalin per min.

Different concentrations of pendimethalin (0.09 to 0.72 mM) or NADH(0.2 to 1 mM) were added into the enzyme reaction mixture, which was thenincubated at 35°C for 10 min. The kinetic parameters Km and Vmax of PNRwere calculated using the Lineweaver-Burk plot method (28).

Preparation of the reduced product of pendimethalin by PNR. En-zyme assay samples were extracted with equal volumes of dichlorometh-ane. The organic phase was dehydrated with anhydrous sodium sulfate,and 3 ml of the dehydrated organic phase was drawn, evaporated to dry-ness with nitrogen gas, and concentrated to 0.5 ml with a mixture ofchloroform and acetonitrile (1:1 [vol/vol]). The concentrated sampleswere further purified by thin-layer chromatography (TLC). The develop-ing solvent for TLC was a mixture of petroleum ether, chloroform, andacetonitrile in proportions of 25:1:1 (vol/vol/vol), and the flow rate was 2ml/min. Eluted fractions were collected every 10 ml and subjected to high-performance liquid chromatography (HPLC) analysis to identify the frac-tions containing the reduced product of pendimethalin. These fractionswere then pooled and dried with nitrogen gas to prepare them for thefollowing analysis.

TABLE 1 Strains and plasmids used in this study

Strain or plasmid Description Source or reference

StrainsBacillus subtilis Y3 Degrades pendimethalin 10Escherichia coli BL21(DE3) F� ompT hsdS(rB

� mB�) gal dcm lacY1 (DE3) Invitrogen

E. coli BL21(DE3)-pnr E. coli BL21(DE3) harboring the plasmid pET29a-pnr This studySaccharomyces cerevisiae BY4741 MAT� his3�1 leu2� met15� ura3� This labStaphylococcus aureus ATCC 25923 Standard strain of Gram-positive bacteria This lab

PlasmidspET29a(�) Expression vector, Kmra

NovagenpET29a-pnr pET29a(�) derivative carrying pnr, Kmr This study

a Kmr, kanamycin resistant.

Ni et al.

7054 aem.asm.org December 2016 Volume 82 Number 24Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Identification of PNR-reduced pendimethalin by UHPLC-MS/MSand NMR. For ultrahigh-performance liquid chromatography-tandemmass spectroscopy (UHPLC-MS/MS) analysis, the dried fraction was dis-solved in methanol and then filtered through a 0.22-�m Millipore mem-brane filter before use. The UHPLC column utilized was a Hypersil GoldC18 column (100 mm by 2.10 mm, 3-�m particle sizes; Thermo FisherScientific). The mobile phase consisted of 0.02% formic acid in water(solvent A) and 100% acetonitrile (solvent B), with a flow rate of 0.2ml/min. The injection volume was 5 �l. For mass spectrometry analysis,an LTQ Orbitrap XL mass spectrometer (Thermo Fisher Scientific)equipped with an electrospray ionization (ESI) probe was used. Data anal-ysis was under the positive mode (29).

To confirm which nitro group of pendimethalin was reduced, thedried fraction was dissolved in dimethyl sulfoxide (DSMO) and subjectedto 1H nuclear magnetic resonance (NMR) analysis using a Bruker Avance500-MHz spectrometer (Bruker Biospin, France). The probe was a 5-mmPABBO BB-1H, the pulse program was zgpr, and the sweep width was10,000,000 Hz.

RNA isolation and quantitative real-time PCR. An aliquot of the cellsof strain Y3 was inoculated at the level of 2% (vol/vol) into 20 ml of MSMsupplemented with 0.36 mM pendimethalin or 0.56 mM glucose, respec-tively. The cultures were incubated at 30°C for 12 h (about 50% of pendi-methalin was transformed), and the cells were harvested by centrifugation(3,770 � g, 10 min at 4°C). Total RNA was extracted using a MiniBESTuniversal RNA extraction kit (TaKaRa, China) and treated with genomicDNA (gDNA) eraser (TaKaRa), according to the manufacturer’s instruc-tions. A reverse transcription (RT) reaction was performed using a Pri-meScript RT reagent kit (TaKaRa). Expression of pnr in strain Y3 wasanalyzed by quantitative real-time PCR in an Applied Biosystems 7300real-time PCR system (Applied Biosystems, USA) using an SYBR PremixEx Taq RT-PCR kit (TaKaRa). The 16S rRNA gene was used as the internalcontrol gene since it was transcribed both in the presence and absence ofpendimethalin as demonstrated in reverse transcription-PCR (data notshown). Gene-specific primers RT-16SF/16SR and RT-PF/PR used forquantitative real-time PCR are listed in Table 2. Relative changes in pnrexpression were calculated using the 2���CT threshold cycle number (CT)method (30).

Biochemical properties of the recombinant PNR. The effects of pHand temperature on the activity and stability of PNR were determined.

Three different buffers (20 mM citrate buffer [pH 3.0 to 6.0], 20 mMphosphate-buffered saline [PBS] [pH 6.0 to 7.5], and 20 mM Tris-HCl[pH 7.0 to 8.8]) were used to assess the optimal reaction pH. To de-termine the optimal reaction temperature, a range of 4°C to 65°C wasinvestigated. The PNR activity observed at Tris-HCl (pH 7.0) and 35°Cwas defined as 100%, and the relative activities of each reaction werecalculated. To determine pH stability, PNR in different pH buffers wasincubated at 4°C for 12 h, and the residual activity was measured. Toevaluate thermal stability, the enzyme assay was performed every 2 h atdifferent temperatures.

The effects of potential activators or inhibitors on PNR activity weredetermined by the addition of 1 mM different metal cations (Mg2�, Ca2�,Fe2�, Fe3�, Cd2�, Hg2�, Li�, K�, Cu2�, Co2�, Mn2�, Zn2�, Ni2�, Ag�),100 mM metal-chelating agent EDTA, and 100 mM chemical agents di-thiothreitol (DTT) and SDS into the PNR reaction mixture. PNR activitywith no additive was referred to as the blank control and was defined as100%, and the relative activity of PNR with different treatments was cal-culated. Potential enhancers and inhibitors of PNR activity were distin-guished by the threshold value 100% 10%. Butralin, oryzalin, and tri-fluralin were used to determine the substrate spectrum of PNR.

Detoxification assay. The effects of pendimethalin and its PNR-cata-lyzed product 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine on thegrowth of strains BY4741, BL21(DE3), and ATCC 25923 were investi-gated. Pendimethalin was dissolved in methanol. 2-Nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine was produced from the transformation ofpendimethalin by PNR and was redissolved in methanol.

All of the strains were grown to the exponential phase, after which theywere washed three times and used as inoculants. Strain BY4714 was theninoculated in 5-fold-diluted YPD medium. Strain BL21(DE3) was inocu-lated in MSM supplemented with 0.56 mM glucose. Strain ATCC 25923was cultured in 10-fold-diluted LB. Pendimethalin or 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine was added into the medium at a final con-centration of 0.36 mM or 0.4 mM, respectively. The strain growth wasmeasured every 4 h by the spreading plate method and by counting theCFU per milliliter.

Accession number(s). The GenBank accession numbers for the draftgenome of strain Y3 and the nucleotide sequence of pnr are LRFK00000000and KU565870, respectively.

TABLE 2 Primers used in this study

Primer DNA sequence (5= to 3=)a Description

pnr-F GGAATTCCATATGATCAAAACAAACGATTTTATGG Forward primer to amplify pnr with a NdeI sitepnr-R CCGCTCGAGTTTCCATTCTGCAATTGTATCAATC Reverse primer to amplify pnr with a XhoI siteRT-16SF CCAGCATTCAGTTGGGCACTCTAAG Forward primer of quantitative real-time PCR to amplify a 173-bp

fragment of 16S rRNA sequenceRT-16SR ACTGAGAACAGATTTGTGGGATTGG Reverse primer of quantitative real-time PCR to amplify a 173-bp

fragment of 16S rRNA sequenceRT-PF GCCGCCGTTCTATTCGCAACTATG Forward primer of quantitative real-time PCR to amplify a 113-bp

fragment of pnr sequenceRT-PR CCATGGCTGCGCGTTAACAGAAGAT Reverse primer of quantitative real-time PCR to amplify a 113-bp

fragment of pnr sequencea Underlined sequences refer to the restriction sites.

TABLE 3 Purification of PNR from B. subtilis Y3

Purification step Total protein (mg) Total activity (U) Specific activity (U/mg protein) Purification (fold) Yield (%)

Cell extract 231.62 609.53 0.38 100Ammonium sulfate precipitation 121.82 348.41 2.86 7.53 56.56DEAE-Sepharose chromatography 37.29 241.27 6.47 17.03 39.58Hydrophobic interaction chromatography 5.46 58.91 10.79 28.39 9.67Sephadex G-75 gel filtration 0.12 2.22 18.5 48.68 0.36

Pendimethalin Nitroreductase PNR

December 2016 Volume 82 Number 24 aem.asm.org 7055Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

RESULTS AND DISCUSSIONPurification of PNR from strain Y3. PNR was purified from thestrain Y3 cell extract to obtain the protein sequence and subse-quently identify the corresponding gene. The PNR purificationprocess was summarized in Table 3. The PNR activity of the cellextract of strain Y3 was only 0.38 U/mg protein. However, afterfour steps of purification, the specific activity of the purified en-zyme had increased to 18.5 U/mg protein, with a purification fac-tor of 48.7-fold. The purified protein yielded a band of approxi-mately 23 kDa on an SDS-PAGE gel (Fig. 2A). The purifiedprotein was also run on a native PAGE gel supplemented with 0.18mM pendimethalin, after which the gel was placed into 20 mMTris-HCl buffer (pH 7.5) with the addition of 0.5 mM NADH and

1 mM Mg2� for 10 min to test the pendimethalin nitroreductaseactivity. The purified protein yielded an obvious transparentzone on the native PAGE gel (Fig. 2B), suggesting that thepurified protein from strain Y3 displayed nitroreductase activ-ity against pendimethalin. The gel’s transparent zone was thenexcised for matrix-assisted laser desorption ionization�timeof flight (MALDI-TOF) mass spectrometry analysis.

Sequences of several peptide fragments were obtained andcompared to those of all of the annotated proteins from the draftgenome of strain Y3, and they matched a nitroreductase encodedby open reading frame orf03879 (630 bp in length) (see Fig. S2 inthe supplemental material). orf03879 was subsequently desig-nated pnr and chosen for the following study.

Sequence analysis of PNR. Sequence analysis indicated thatPNR consisted of 209 amino acids. The result of a BLASTP searchin the NCBI protein databases (the UniProt Knowledge Base/Swiss-Prot databases) revealed that PNR showed 100% identity tothe uncharacterized NAD(P)H nitroreductase YdgI from Bacillussubtilis subsp. subtilis strain 168 (GenBank accession number NP388447). Among the characterized nitroreductases, PNR showedthe highest identity (35%) to nitrobenzoate nitroreductase PnbAof Lactobacillus plantarum WCFS1; it also shared 31%, 29%, and28% amino acid sequence identities with the quinone reductaseDrgA of Synechocystis sp., the NAD(P)H-flavin oxidoreductaseFRase I of Vibrio fischeri, and the NAD(P)H-dependent oxi-doreductase PnrB of Pseudomonas putida, respectively (Fig. 3).Bacterial nitroreductases can be divided into two types accordingto the one- or two-electron mechanism of nitroreduction ofpolynitroaromatic compounds. Type I nitroreductases are oxy-gen-insensitive and require NAD(P)H as electron donors in anobligatory two-electron transfer. Type II nitroreductases are oxy-gen-sensitive and catalyze the nitro group through a single-elec-tron reduction, bearing a nitro anion radical, which can be reoxi-dized to the parent structure in aerobic conditions. Therefore, asthe reduction of nitro groups by type II nitroreductases results in

FIG 2 Purification of pendimethalin nitroreductase from B. subtilis Y3. (A)SDS-PAGE spectrum of PNR purified from cell extract of strain Y3. Lane 1,protein marker (kilodaltons); lane 2, purified protein after four steps of puri-fication. (B) Native PAGE analysis of PNR purified from strain Y3; the arrowpoints to the transparent zone.

FIG 3 Neighbor-joining phylogenetic tree constructed based on the alignment of PNR with related type I nitroreductases. Confidence values for branches weredetermined using bootstrap analyses based on 1,000 resamplings. The subgroups (A, B1, and B2) of type I nitroreductases are marked on the right.

Ni et al.

7056 aem.asm.org December 2016 Volume 82 Number 24Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

a futile cycle, studies on type II nitroreductases have been verylimited. Type I nitroreductases catalyze the sequential reductionof the nitro groups to generate nitroso, hydroxyamino, and aminoderivatives (31, 32). Type I nitroreductases can be further divided

into two main groups, which are represented by the E. coli nitrore-ductases NfsA (group A in Fig. 3) and NfsB (group B in Fig. 3),respectively. Sequence alignment revealed that PNR was assignedto the NfsB-like nitroreductase, which is classified as type I group

FIG 4 Identification of pendimethalin-reduced product by PNR. (A) UHPLC-MS/MS analysis of the pendimethalin-reduced product by PNR, whose retention time(RT) was 16.16 min. Data analysis of the product’s MS/MS spectrum was under the positive mode. (B) 1H NMR analysis of pendimethalin-reduced product by PNR.

Pendimethalin Nitroreductase PNR

December 2016 Volume 82 Number 24 aem.asm.org 7057Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

B. Group B nitroreductases are divided into two subfamilies. Sub-family B1 includes the minor nitroreductase NfsB of E. coli (33),the retro-nitroreductase (RNR) of Enterobacter cloacae (34), thenitroreductase PnrB of P. putida JLR11 (35), the NAD(P)H-flavinoxidoreductase FRase I of V. fischeri (36), the quinone reductaseDrgA of Synechocystis sp. (37), the nitrobenzoate nitroreductasePnbA of L. plantarum WCFS1 (38), and others. Subfamily B2 con-tains the YdjA of E. coli and Salmonella enterica and the nitroben-zene nitroreductase CnbA encoded by the cnbA gene located onplasmid pCNB1 of Comamonas testosteroni CNB-1 (39). A phylo-

genetic analysis revealed that PNR was a member of the B1 sub-family and clustered into a single branch on the phylogenetic tree(Fig. 3).

Heterogeneous gene expression of pnr. To further identifywhether PNR was responsible for the nitroreduction of pendime-thalin, the pnr gene was amplified using a specific primer pairpnr-F/R and introduced into pET29a(�) to produce pET29a-pnr.A whole-cell transformation assay revealed that E. coli BL21(DE3)-pnr gained the capacity to transform pendimethalin (data notshown). Recombinant PNR was purified using Ni2�-NTA resin,

FIG 5 Nitroreduction of pendimethalin, trifluralin, butralin, and oryzalin by PNR.

Ni et al.

7058 aem.asm.org December 2016 Volume 82 Number 24Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

and SDS-PAGE analysis showed that the recombinant PNR pos-sessed a monomer size of approximately 23 kDa (see Fig. S3 in thesupplemental material), which was in agreement with its theoret-ical molecular mass. The PNR activity was as high as 25.1 U/mgprotein. Sephadex G-75 gel filtration analysis of native PNR indi-cated a molecular mass of approximately 48 kDa, indicating thatthe protein acted functionally as a homodimer.

Transcriptional level of pnr of strain Y3 under the inductionof pendimethalin. The relative changes in the transcription of pnrof strain Y3 under pendimethalin-induced and uninduced condi-tions were investigated by quantitative real-time PCR. The datashowed that there was no significant difference between the cellsgrown under induced and uninduced conditions (see Fig. S4 inthe supplemental material), indicating that the expression of pnrin strain Y3 was conservative. This also explained the purificationof PNR from the cell extract of strain Y3 cultured in LB brothwithout the addition of pendimethalin.

Identification of the pendimethalin-nitroreduced productby PNR. The nitroreduction product of pendimethalin by PNRwas first identified by UHPLC-MS/MS (Fig. 4A), which was con-sistent with a previously reported result (10). Because the previousreport focused on the structural identification of metabolites andthe proposed degradation pathway of pendimethalin, there wasno strong evidence identifying which nitro group of pendimetha-lin was reduced (7–10). For further confirmation, the nitroreduc-tion product of pendimethalin was subjected to 1H NMR analysis(Fig. 4B). The 1H NMR spectrum displayed an aromatic ring pro-ton (C-5 proton) at 6.6 ppm, two aromatic methyl groups at 1.9 ppm and 2.1 ppm, and an amino proton at 4.9 ppm. Theproton signals for the N-(1-ethylpropyl) group were present at 3.5 ppm, 2.75 ppm, 1.3 ppm, and 0.8 ppm. The discrepancybetween 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine and2-amino-6-nitro-N-(1-ethylpropyl)-3,4-xylidine in the 1H NMRspectrum was the chemical shift of the C-5 proton, which wasobserved at 6.6 ppm in 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine and at 8.0 ppm in 2-amino-6-nitro-N-(1-ethylpropyl)-3,4-xylidine (7). The reduction of the C-6 nitro group to an aminogroup might result in the upfield shift of the C-5 proton signal in2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine. Therefore, PNRreduced the C-6 nitro group of the aromatic ring of pendimethalin,resulting in the production of 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine (Fig. 5).

Characterization of PNR. The highest PNR activity was ob-served at pH 7.0 and 35°C (see Fig. S5A and C in the supplementalmaterial). PNR retained greater than 80% activity after incubationat pH values ranging from 6.0 to 8.0 at 4°C for 12 h (see Fig. S5B)and might also retain greater than 80% activity for 6 h in temper-atures ranging from 4 to 35°C (see Fig. S5D); however, in high-

temperature conditions (50 to 60°C), the residual activity of PNRfell below 10% in 2.5 h.

PNR activity was enhanced by Mg2�, Fe2�, and Fe3�, while itwas inhibited by Cd2�, Hg2�, Cu2�, Ag�, and Zn2� (see Table S1in the supplemental material). Additionally, Li�, K�, Ca2�, Co2�,Mn2�, and Ni2� had no obvious effects on PNR activity. EDTAalso had no clear effect on PNR activity, whereas SDS inhibited it.Surprisingly, DTT strongly enhanced PNR activity by 1.3-fold.

Butralin, oryzalin, and trifluralin are three prominent mem-bers of the selective preemergence dinitroaniline herbicides.These compounds have many physical and chemical properties incommon with pendimethalin, but they have two symmetrical ni-tro groups, in contrast to pendimethalin (Fig. 5). They show rel-atively high toxicity toward aquatic organisms and rats (40–43); inaddition, trifluralin is suspected to be an endocrine disruptor (44)and has been classified as a group C possible human carcinogen(45). Until now, there has been no report on the genes or enzymesthat are responsible for the degradation of butralin, oryzalin, andtrifluralin. Thus, a comparison of the transformations of the threedinitroanilines with pendimethalin by PNR was conducted. PNRdisplayed nitroreduction activity against butralin, oryzalin, andtrifluralin. Moreover, UHPLC-MS analysis of their PNR-reducedmetabolites revealed that both nitro groups on the aromatic ringcould be reduced by PNR (see Fig. S6 to S8 in the supplementalmaterial). Although PNR reduced both nitro groups of butralin,oryzalin, and trifluralin, it only reduced the C-6 nitro group of thearomatic ring of pendimethalin (Fig. 5), which may have been dueto structural differences in these compounds. For butralin, oryza-lin, and trifluralin, the two nitro groups are symmetrical, whereaspendimethalin contains a substituent methyl group at C-3 of thearomatic ring, distinct from the structures of butralin, oryzalin,and trifluralin. This substituent group may make it difficult forPNR to catalyze the second nitroreduction reaction.

The kinetic constants for PNR against the four dinitroanilineherbicides are shown in Table 4. The Kcat/Km values of PNRagainst pendimethalin, butralin, and oryzalin showed no signifi-cant differences, indicating that the catalytic efficiency of PNRtoward pendimethalin, butralin, and oryzalin was almost at thesame level, while it was 10.89 �M�1 · s�1 against trifluralin and alittle bit lower. The Kcat/Km value of NADH was observed at 10.68�M�1 · s�1 with pendimethalin as the electron acceptor.

Detoxification assay. Studies were performed to measure thetoxic effects of pendimethalin and its nitroreduced metabolite2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine on the growthof strains BY4741, BL21(DE3), and ATCC 25923. Cell growth inthe presence of different treatments was evaluated, and the resultsare presented in Fig. 6. Compared with the control settings (blankcontrol and solvent treatment), strain BY4741 treated with 0.4

TABLE 4 Kinetic constants for PNRa

Drug Specific activity (U/mg protein) Vmax (nmol/min/mg protein) Km (�M) Kcat (s�1) Kcat/Km (�M�1 · s�1)

NADH 49.98 1.06 � 103 35.13 375.22 10.68Pendimethalin 25.11 4.39 � 102 13.05 155.40 11.91Butralin 23.71 3.87 � 102 11.54 136.99 11.61Oryzalin 20.22 3.76 � 102 11.19 133.10 11.89Trifluralin 17.85 56.60 1.82 20.04 10.89a PNR constants for pendimethalin, butralin, oryzalin, and trifluralin calculated with NADH served as electron donors. NADH constants were determined with pendimethalin asthe electron acceptor.

Pendimethalin Nitroreductase PNR

December 2016 Volume 82 Number 24 aem.asm.org 7059Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

mM PNR-reduced product 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine showed no obvious differences in growth, whereasstrain BY4741 treated with 0.36 mM pendimethalin for 8 h dis-played a lower cell concentration. Furthermore, an obvious inhib-itory effect on its cell growth was observed after 12 h of treatment,indicating that pendimethalin had a toxic effect on the cell growthof strain BY4741. However, the cell growth of strains BL21(DE3)and ATCC 25923 treated with pendimethalin or 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine showed no significant differencecompared to the control conditions after 12 h of treatment, sug-gesting that neither pendimethalin or 2-nitro-6-amino-N-(1-eth-ylpropyl)-3,4-xylidine had no effects on the cell growth of strainsBL21(DE3) and ATCC 25923.

The herbicidal mechanism of pendimethalin involves inhibit-ing chromosome separation and cell wall formation during celldivision, causing weed death (46). Strain BY4741 is a eukaryoticorganism; therefore, its manner of cell division is similar to that ofplant cells. Thus, pendimethalin was capable of inhibiting its celldivision and cell growth. In contrast, strains BL21(DE3) andATCC 25923 are prokaryotic organisms; therefore, pendimethalincould not inhibit their cell division and cell growth. The nitrore-duction of pendimethalin may eliminate its toxicity and inhibi-tory effect on eukaryotic and plant cells, suggesting that nitrore-duction is the critical detoxification step for pendimethalin. Thesefindings imply that PNR has potential in the elimination of toxic-ity caused by pendimethalin.

In summary, the present work reports a nitroreductase PNRwith its encoding gene pnr, which was responsible for the initialdegradation step of pendimethalin in strain Y3. PNR catalyzed the

C-6 nitro group reduction of pendimethalin. Additionally, PNRcould also functionally reduce three other major varieties of dini-troaniline herbicides, including butralin, oryzalin, and trifluralin,in which both aromatic nitro groups were reduced. The reductionof pendimethalin by PNR could eliminate its toxicity against Sac-charomyces cerevisiae BY4741, indicating the application potentialof PNR in the detoxification of pendimethalin.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundationof China (31570105, 31560031, 31370155), the Program for New Cen-tury Excellent Talents in University (NCET-13-0861), the Project ofUniversity-Industry Collaboration of Guangdong Province-Ministry(2013B090500017), and the Jiangsu Agriculture Science and Technol-ogy Innovation Fund CX (15)1004.

FUNDING INFORMATIONThis work, including the efforts of Jian He, was funded by Project ofUniversity-industry Collaboration of Guangdong Province-ministry(2013B090500017). This work, including the efforts of Fei Wang, wasfunded by National Natural Science Foundation of China (NSFC)(31560031). This work, including the efforts of Qing Hong, was funded byNational Natural Science Foundation of China (NSFC) (31370155). Thiswork, including the efforts of Jian He, was funded by National NaturalScience Foundation of China (NSFC) (31570105). This work, includingthe efforts of Qing Hong, was funded by Jiangsu Agricultural Science andTechnology Innovation Fund (JASTIF) (CX(15)1004).

REFERENCES1. Tomlin C. 1994. The pesticide manual. British Crop Protection Council,

Surrey, United Kingdom.

FIG 6 Effects of pendimethalin and 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine on the growth of S. cerevisiae BY4741 (A), E. coli BL21(DE3) (B), and S.aureus ATCC 25923 (C). Strain growth was determined at 4 h, 8 h, and 12 h based on the CFU per milliliter. Blank control, inoculation alone; solvent treatment,methanol; pendimethalin with solvent, pendimethalin and methanol; 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine with solvent, 2-nitro-6-amino-N-(1-ethylpropyl)-3,4-xylidine and methanol.

Ni et al.

7060 aem.asm.org December 2016 Volume 82 Number 24Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

2. Walker A, Bond W. 1977. Persistence of the herbicide AC 92,553, N-(1-ethylpropyl)-2,6-dinitro-3,4-xylidine, in soils. Pesticide Sci 8:359 –365.http://dx.doi.org/10.1002/ps.2780080409.

3. Pinto AP, Serrano C, Pires T, Mestrinho E, Dias L, Teixeira DM,Caldeira AT. 2012. Degradation of terbuthylazine, difenoconazole andpendimethalin pesticides by selected fungi cultures. Sci Total Environ435– 436:402– 410. http://dx.doi.org/10.1016/j.scitotenv.2012.07.027.

4. Roca E, D’Errico E, Izzo A, Strumia S, Esposito A, Fiorentino A. 2009.In vitro saprotrophic basidiomycetes tolerance to pendimethalin. Int Bio-deterior Biodegrad 63:182–186. http://dx.doi.org/10.1016/j.ibiod.2008.08.004.

5. Das N, Ray S, Jena S, Mohanty P. 1998. Effect of certain herbicides onweeds and population of root-knot nematode (Meloidogyne incognita) inmustard. Crop Res (Hisar) 16:156 –158.

6. Fliedner A. 1997. Ecotoxicity of poorly water-soluble substances. Chem-osphere 35:295–305. http://dx.doi.org/10.1016/S0045-6535(97)00156-2.

7. Kole RK, Saha J, Pal S, Chaudhuri S, Chowdhury A. 1994. Bacterialdegradation of the herbicide pendimethalin and activity evaluation of itsmetabolites. Bull Environ Contam Toxicol 52:779 –786.

8. Kulshrestha G, Singh SB, Lal SP, Yaduraju NT. 2000. Effect oflong-term field application of pendimethalin: enhanced degradationin soil. Pest Manag Sci 56:202–206. http://dx.doi.org/10.1002/(SICI)1526-4998(200002)56:2<202::AID-PS97>3.0.CO;2-C.

9. Megadi VB, Tallur PN, Hoskeri RS, Mulla SI, Ninnekar HZ. 2010.Biodegradation of pendimethalin by Bacillus circulans. Indian J Biotech-nol 9:173–177.

10. Ni H, Yao L, Li N, Cao Q, Dai C, Zhang J, He Q, He J. 2016.Biodegradation of pendimethalin by Bacillus subtilis Y3. J Environ Sci(China) 41:121–127. http://dx.doi.org/10.1016/j.jes.2015.04.035.

11. Kulkarni M, Chaudhari A. 2007. Microbial remediation of nitro-aromatic compounds: an overview. J Environ Manage 85:496 –512. http://dx.doi.org/10.1016/j.jenvman.2007.06.009.

12. Zayed SM, Mostafa IY, Farghaly MM, Attaby HS, Adam YM, MahdyFM. 1983. Microbial degradation of trifluralin by Aspergillus carneus, Fus-arium oxysporum and Trichoderma viride. J Environ Sci Health 18:253–267. http://dx.doi.org/10.1080/03601238309372367.

13. Sambrook J, Russell DW. 1989. Molecular cloning: a laboratory manual,vol 3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

14. Chin CS, Alexander DH, Marks P, Klammer AA, Drake J, Heiner C,Clum A, Copeland A, Huddleston J, Eichler EE, Turner SW, Korlach J.2013. Nonhybrid, finished microbial genome assemblies from long-readSMRT sequencing data. Nat Methods 10:563–569. http://dx.doi.org/10.1038/nmeth.2474.

15. Koren S, Schatz MC, Walenz BP, Martin J, Howard JT, GanapathyG, Wang Z, Rasko DA, McCombie WR, Jarvis ED, Phillippy AM.2012. Hybrid error correction and de novo assembly of single-moleculesequencing reads. Nat Biotechnol 30:693–700. http://dx.doi.org/10.1038/nbt.2280.

16. Luo R, Liu B, Xie Y, Li Z, Huang W, Yuan J, He G, Chen Y, Pan Q, LiuY, Tang J, Wu G, Zhang H, Shi Y, Liu Y, Yu C, Wang B, Lu Y, Han C,Cheung DW. 2012. SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler. GigaScience 1:18. http://dx.doi.org/10.1186/2047-217X-1-18.

17. Delcher AL, Bratke KA, Powers EC, Salzberg SL. 2007. Identifyingbacterial genes and endosymbiont DNA with glimmer. BioInformatics23:673– 679. http://dx.doi.org/10.1093/bioinformatics/btm009.

18. Lowe TM, Eddy SR. 1997. tRNAscan-SE: a program for improved detec-tion of transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955–964. http://dx.doi.org/10.1093/nar/25.5.0955.

19. Lagesen K, Hallin P, Rødland EA, Staerfeldt HH, Rognes T, UsseryDW. 2007. RNAmmer: consistent and rapid annotation of ribosomalRNA genes. Nucleic Acids Res 35:3100 –3108. http://dx.doi.org/10.1093/nar/gkm160.

20. Laemmli UK. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680 – 685. http://dx.doi.org/10.1038/227680a0.

21. Bradford MM. 1976. A rapid and sensitive method for the quantitationof microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248 –254. http://dx.doi.org/10.1016/0003-2697(76)90527-3.

22. Wittig I, Braun HP, Schägger H. 2006. Blue native PAGE. Nat Protoc1:418 – 428. http://dx.doi.org/10.1038/nprot.2006.62.

23. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, ThompsonJD, Gibson TJ, Higgins DG. 2007. Clustal W and Clustal X version 2.0.BioInformatics 23:2947–2948. http://dx.doi.org/10.1093/bioinformatics/btm404.

24. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S.2011. MEGA5: molecular evolutionary genetics analysis using maxi-mum likelihood, evolutionary distance, and maximum parsimonymethods. Mol Biol Evol 28:2731–2739. http://dx.doi.org/10.1093/molbev/msr121.

25. Saitou N, Nei M. 1987. The neighbor-joining method: a new method forreconstructing phylogenetic trees. Mol Biol Evol 4:406 – 425.

26. Kimura M. 1980. A simple method for estimating evolutionary rates ofbase substitutions through comparative studies of nucleotide sequences. JMol Evol 16:111–120. http://dx.doi.org/10.1007/BF01731581.

27. Janknecht R, de Martynoff G, Lou J, Hipskind RA, Nordheim A,Stunnenberg HG. 1991. Rapid and efficient purification of native his-tidine-tagged protein expressed by recombinant vaccinia virus. ProcNatl Acad Sci U S A 88:8972– 8976. http://dx.doi.org/10.1073/pnas.88.20.8972.

28. Dowd JE, Riggs DS. 1965. A comparison of estimates of Michaelis-Menten kinetic constants from various linear transformations. J BiolChem 240:863– 869.

29. Ramakrishna M, Venkata Mohan S, Shailaja S, Narashima R, SarmaPN. 2008. Identification of metabolites during biodegradation of pendi-methalin in bioslurry reactor. J Hazard Mater 151:658 – 661. http://dx.doi.org/10.1016/j.jhazmat.2007.06.039.

30. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2���CT method. Methods 25:402– 408. http://dx.doi.org/10.1006/meth.2001.1262.

31. Bryant DW, McCalla DR, Leeksma M, Laneuville P. 1981. Type Initroreductases of Escherichia coli. Can J Microbiol 27:81– 86. http://dx.doi.org/10.1139/m81-013.

32. Peterson FJ, Mason RP, Hovsepian J, Holtzman JL. 1979. Oxygen-sensitive and -insensitive nitroreduction by Escherichia coli and rat hepaticmicrosomes. J Biol Chem 254:4009 – 4014.

33. Zenno S, Koike H, Tanokura M, Saigo K. 1996. Gene cloning, purifica-tion, and characterization of NfsB, a minor oxygen-insensitive nitrore-ductase from Escherichia coli, similar in biochemical properties to FRase I,the major flavin reductase in Vibrio fischeri. J Biochem 120:736 –744. http://dx.doi.org/10.1093/oxfordjournals.jbchem.a021473.

34. Koder RL, Oyedele O, Miller AF. 2001. Retro-nitroreductase, a pu-tative evolutionary precursor to Enterobacter cloacae strain 96-3 nitrore-ductase. Antioxid Redox Signal 3:747–755. http://dx.doi.org/10.1089/15230860152664957.

35. Caballero A, Lázaro JJ, Ramos JL, Esteve-Núñez A. 2005. PnrA, a newnitroreductase-family enzyme in the TNT-degrading strain Pseudomonasputida JLR11. Environ Microbiol 7:1211–1219. http://dx.doi.org/10.1111/j.1462-2920.2005.00801.x.

36. Zenno S, Saigo K, Kanoh H, Inouye S. 1994. Identification of the geneencoding the major NAD(P)H-flavin oxidoreductase of the biolumines-cent bacterium Vibrio fischeri ATCC 7744. J Bacteriol 176:3536 –3543.

37. Takeda K, Iizuka M, Watanabe T, Nakagawa J, Kawasaki S, Niimura Y.2007. Synechocystis DrgA protein functioning as nitroreductase and ferricreductase is capable of catalyzing the Fenton reaction. FEBS J 274:1318 –1327. http://dx.doi.org/10.1111/j.1742-4658.2007.05680.x.

38. Guillén H, Curiel JA, Landete JM, Guillén H, Curiel JA, Landete JM,Muñoz R, Herraiz T. 2009. Characterization of a nitroreductase withselective nitroreduction properties in the food and intestinal lactic acidbacterium Lactobacillus plantarum WCFS1. J Agric Food Chem 57:10457–10465. http://dx.doi.org/10.1021/jf9024135.

39. Wu JF, Jiang CY, Wang BJ, Ma YF, Liu ZP, Liu SJ. 2006. Novel partialreductive pathway for 4-chloronitrobenzene and nitrobenzene degrada-tion in Comamonas sp. strain CNB-1. Appl Environ Microbiol 72:1759 –1765. http://dx.doi.org/10.1128/AEM.72.3.1759-1765.2006.

40. Emmerson J, Pierce E, McGrath J. 1980. The chronic toxicity of com-pound 36352 (trifluralin) given as a component of the diet to Fischer 344rats for two years. Studies R-87 and R-97. Elanco Products Co., Eli Lillyand Co., Indianapolis, IN.

41. Helling CS. 1976. Dinitroaniline herbicides in soils. J Environ Qual 5:1–15. http://dx.doi.org/10.2134/jeq1976.0511.

42. Könen S, Çavas¸ T. 2008. Genotoxicity testing of the herbicide trifluralinand its commercial formulation Treflan using the piscine micronucleus

Pendimethalin Nitroreductase PNR

December 2016 Volume 82 Number 24 aem.asm.org 7061Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

test. Environ Mol Mutagen 49:434 – 438. http://dx.doi.org/10.1002/em.20401.

43. Naqvi SM, Leung TS. 1983. Trifluralin and oryzalin herbicides toxicitiesto juvenile crawfish (Procambarus clarkii) and mosquitofish (Gambusiaaffinis). Bull Environ Contam Toxicol 31:304 –308. http://dx.doi.org/10.1007/BF01608703.

44. US Environmental Protection Agency. 1998. Registration eligibility

decision (RED): bromoxynil-738-R-98-013. US Environmental Protec-tion Agency, Washington, DC.

45. Greene SA, Pohanish RP. 2005. Sittig’s handbook of pesticides and agri-cultural chemicals. William Andrew Publishing, New York, NY.

46. Strandberg M, Scott-Fordsmand JJ. 2004. Effects of pendimethalin atlower trophic levels—a review. Ecotoxicol Environ Saf 57:190 –201. http://dx.doi.org/10.1016/j.ecoenv.2003.07.010.

Ni et al.

7062 aem.asm.org December 2016 Volume 82 Number 24Applied and Environmental Microbiology

on Decem

ber 9, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from