pellegrinelli v1,2,3#, rouault c1,2, 3, rodriguez-cuenca s ......2015/02/16 · 1 human adipocytes...

1

Human adipocytes induce inflammation and atrophy in muscle cells during obesity

Pellegrinelli V1,2,3#

, Rouault C1,2, 3

, Rodriguez-Cuenca S4, Albert V

1,2,3, Edom-Vovard

F5,6,7,8

,Vidal-Puig A4, Clément K

1, 2, 3*, Butler-Browne GS

5,6,7,8* and Lacasa D

1,2, 3*

1 - INSERM, U1166 Nutriomique, Paris, F-75006 France;

2 - Sorbonne Universités, University Pierre et Marie-Curie-Paris 6, UMR S 1166, Paris, F-

75006 France;

3- Institut Cardiométabolisme et Nutrition, ICAN, Pitié Salpétrière Hospital, Paris, F-75013

France;

4- Metabolic Research Laboratories, Wellcome Trust-MRC Institute of Metabolic Science,

University of Cambridge, Cambridge, United Kingdom;

5- Sorbonne Universités, University Pierre et Marie-Curie-Paris6, Centre de recherches en

Myologie UMR 974, F-75005, Paris, France;

6- INSERM, U974, 75013, Paris, France;

7- CNRS FRE 3617, 75013, Paris, France;

8- Institut de Myologie, 75013, Paris, France.

Key Words: muscle cells atrophy, visceral adipocytes, human obesity.

Running title: obese human adipocytes induce muscle cells atrophy

* These authors share senior co-authorship

# Corresponding author: Current address: Wellcome Trust-MRC Institute of Metabolic

Science, Metabolic Research Laboratories,University of Cambridge

e-mail address: [email protected]

Phone+44 (0)1223 336786

Fax: +44 1223 330598

Word count of body: 4568

Word count of abstract: 206

Number of figures/Tables: 7

Supplementary data

Page 2 of 58Diabetes

Diabetes Publish Ahead of Print, published online February 18, 2015

2

ABSTRACT

Inflammation and lipid accumulation are hallmarks of muscular pathologies resulting from

metabolic diseases such as obesity and type II diabetes. During obesity, the hypertrophy of

visceral adipose tissue (VAT) contributes to muscle dysfunctions particularly through

dysregulated production of adipokines.

We have investigated the crosstalk between human adipocytes and skeletal muscle cells to

identify mechanisms linking adiposity and muscular dysfunctions.

First, we demonstrated that the secretome of obese adipocytes decreased the expression of

contractile proteins in myotubes consequently inducing atrophy. Using a three-dimensional co-

culture of human myotubes and VAT adipocytes we showed the decreased expression of genes

corresponding to skeletal muscle contractility complex and myogenesis. We demonstrated an

increased secretion by co-cultured cells of cytokines and chemokines with IL-6 and IL-1β as key

contributors. Moreover, we gathered evidence showing that obese subcutaneous adipocytes were

less potent than VAT adipocytes in inducing these myotubes dysfunctions. Interestingly, the

atrophy induced by visceral adipocytes was corrected by IGF-II/IGFBP-5. Finally, we observed

that skeletal muscle of obese mice displayed decreased expression of muscular markers in

correlation with VAT hypertrophy and abnormal distribution of the muscle fiber size.

In summary, we show the negative impact of obese adipocytes on the muscle phenotype that

could contribute to muscle wasting associated with metabolic disorders.

Page 3 of 58 Diabetes

3

INTRODUCTION

During obesity, hypertrophy of white adipose tissue (WAT) is associated with fibro-inflammation

and cell dysfunctions. However, visceral depot (VAT) differs from subcutaneous (SAT) by its

inflammatory status due to its high infiltration with immune cells such as macrophages, T

lymphocytes and mast cells (1,2). Hence, VAT hypertrophy is considered an important

contributor to obesity related metabolic and cardiovascular diseases (3). In obese subjects,

hypertrophied adipocytes display abnormal secretion of leptin and adiponectin, an increased

production of numerous inflammatory cytokines and chemokines, leading to a disrupted inter-

organ communication between VAT and important metabolic peripheral tissues such as liver and

skeletal muscle (4). These organs are particularly exposed to free fatty acids and cytokines,

mostly IL-6, increasingly released by visceral fat of obese subjects (5,6). Skeletal muscles are one

of the major metabolic tissues of the body, playing a pivotal role in glucose and lipid metabolism.

There is growing body of evidence showing the contribution of obesity on skeletal muscle

dysfunctions, such as the development of insulin resistance, as attested by numerous studies

performed in rodent models of obesity (7,8). Thus, it has been shown that obese rats display

impaired activation of skeletal muscle protein synthesis in response to chronic lipid infiltration

(9). Ectopic lipid storage in muscle (e.i. within muscle cells and/or in adipocytes located between

muscle fibers) represents a negative risk factor for development of type 2 diabetes related to

muscle insulin resistance (10–13). Moreover, skeletal muscle of obese subjects also displays an

impairment in oxidative capacity (14) and abnormal muscle fiber organization (15,16). Increased

amount of VAT in obesity has been proposed to link obesity and muscle metabolic alterations,

such as insulin resistance. Surgical removal of VAT in rats leads to reduction of systemic

concentrations of cytokines (e.g. IL-6, Fractalkine resistin) and improvement of skeletal muscle


4

insulin sensitivity (17). Particularly, adipocytes have been identified as potential effectors of

muscle cells dysfunctions. Co-culture system previously showed impact of adipocytes on muscle

cells insulin resistance and oxidative capacity (18–20). However, the impact of VAT adipocytes

on muscle structural organization and the molecular factors involved remains elusive.

Inflammatory mediators act synergistically to negatively impact regeneration capacity and insulin

sensitivity in muscle (7). For example, IL-6 is overproduced by hypertrophied adipocytes and its

systemic concentration is increased in obesity. Increased IL6 is associated with altered insulin

signalling in myotubes and impaired myoblast differentiation/proliferation capacity leading to

muscle atrophy (7,8). At the molecular level, IL-6 with IL-1β down-regulate IGFs/Akt signalling

decreasing muscle protein synthesis (21). Excessive production of various mediators by obese

VAT adipocytes could trigger a cross-talk with muscle cells, altering the production of myokines

(22) which could affect in turn VAT endocrine functions. This cross-talk associated with an

inflammatory microenvironment could be deleterious in perpetuating a vicious cycle leading to

muscle loss and wasting. To address this question, the secretome of obese adipocytes was tested

on human primary muscle cells and direct co-cultures were performed.

The main aim of our study was to identify the major contributors of VAT adipocytes/skeletal

muscle crosstalk and their role in inducing muscle atrophy and inflammation, common disorders

associated with metabolic pathologies such as obesity and type 2 diabetes (4).

Research Design and Methods

The antibodies and recombinant proteins used in the study are listed in Table S1.

Mice studies


5

C57BL/6N male mice were purchased from Charles River. Standard chow or 58 kcal% fat

w/sucrose Surwit Diet (HFD, D12331, Research Diets) was given ad libitum to animals. Dietary

intervention started at 8 weeks of age and continued for 12 or 16 weeks (n=8-9 per experimental

group). The detailed procedures of the mice studies are provided in (23). Adipose tissues and

skeletal muscles from 12 weeks chow/HFD mice (RNA extraction) and Gastrocnemius muscle of

16 weeks chow/HFD mice (histological analysis) were prepared as described in (23,24). Muscle

fiber cross-section size (up to 201 muscle fibers/section) was automatically evaluated by

determination of the Feret’s diameter (Image J software) in 3 independent fields in each section.

The variance coefficient of the Feret’s diameter was defined to evaluate the muscle fiber size

variability between the experimental groups of mice and avoid experimental errors such as the

orientation of the sectioning angle (25). Number of intermuscular adipocyte spots was assessed

visually in the total longitudinal section biopsy.

Human studies

Subcutaneous (SAT) and VAT biopsies were obtained from morbid obese subjects (body mass

index, BMI>40 kg/m2) (clinical parameters in Table S2) and SAT biopsies from lean female

subjects (BMI<25 kg/m2) undergoing elective surgery. None of the lean subjects had diabetes or

metabolic disorders, and none were taking medication. All clinical investigations were performed

according to the Declaration of Helsinki and approved by the Ethical Committee of Hôtel-Dieu

Hospital (Paris, France).

Isolation of mature adipocytes from human WAT and preparation of the 3D adipocyte

cultures


6

Tridimensional gels were prepared with mature adipocytes isolated from WAT of lean (SAT) or

obese (SAT and VAT) subjects as described in (26,27). Adipocytes were embedded in the

hydrogel (Puramatrix, BD Biosciences, Bedford, MA, USA). Hydrogel was diluted in 20%

sucrose solution at a concentration of 1x 105cells per 1mL of gel preparation into 24-well plates

containing 1.5ml of DMEM/F12 (1% bovine albumin, 1% antibiotics). Culture medium was

changed after 1h with fresh medium containing human insulin (50 nM). Adipocytes from SAT or

VAT were incubated for 48h before collecting the conditioned media referred as lean SAT CM

(lean SAT adipocyte conditioned media) and obese SAT/VAT CM (obese SAT/VAT adipocyte

conditioned media), respectively. Samples were kept at -80°C prior experimental measurements.

Myoblast cultures, differentiation to myotubes and treatment with adipocyte conditioned

media

We used the human primary satellite cells (CHQ5B) originally isolated from the quadriceps of a

newborn child without indication of neuromuscular disease as previously described (28). The

cells were cultivated in a growth medium consisting of 4V DMEM, 1V M199 supplemented with

50 µg/ml of gentamycin and 20% FBS. Cells were plated in 24 well-plates at a density of 1500

cells per cm2. Differentiation was induced at sub-confluence by replacing the growth medium

with differentiation medium (DMEM supplemented with 50 µg/ml of gentamycin and 10 µg/ml

human insulin) (29). After 5 days of differentiation, the medium was replaced for 48h with

control DMEM/F12 culture medium or conditioned media from either adipocytes from lean SAT

(lean SAT CM ) or adipocytes from obese SAT/VAT (obese SAT/VAT CM). Then, the medium

was exchanged for fresh medium, for 24 h before being collected and stored at -80 C.

Quantification of the fusion index and measurement of myotube thickness


7

Muscle cells were allowed to differentiate in serum-free medium for 6 days in the presence of

lean SAT CM or obese SAT/VAT CM. After fixation with 4 % paraformaldehyde, the cells were

incubated with an antibody specific for desmin. Specific antibody binding was revealed using an

Alexa-488 coupled goat anti mouse secondary antibody. Nuclei were visualized with Hoechst

staining.

The efficiency of the fusion was assessed by counting the number of nuclei in myotubes (>2

myonuclei) as a percentage of the total number of nuclei (mononucleated and plurinucleated).

This percentage was determined by counting 1000 nuclei per dish on three independent cultures.

Myotubes thickness was quantified with Image J software measuring intensity of the desmin

staining in ten random fields (X10) from three independent cultures.

The counting was performed with blind lectures by two different investigators (VA and FEV).

Direct co-cultures of primary adipocytes and differentiated myoblasts in 3D hydrogels

Muscle cells were embedded in hydrogel prepared as below, at a concentration of 200.000 cells

per 100µl of gel preparation containing 0.5 mg/ml collagen type 1 (BD Biosciences). The gel

preparation was put into 96-well plates containing 150 µl of growth medium. After 2 days in

culture, this medium was replaced by differentiating medium for 3 days. We then added to this

preparation a second hydrogel containing mature adipocytes isolated from VAT or SAT from

obese subjects (10.000 cells per 100 µl of gel preparation). Adipocytes and differentiated

myoblasts were then co-cultured for 24h or 3 days in DMEM/F12 (1% antibiotics and 50 nM

insulin).

Secretory function analysis and serum biochemistry


8

Adipokine secretions were evaluated by ELISA assay, using secretory medium from 24h-cultures

of 3D adipocytes (leptin, adiponectin) (Duoset, R&D Systems). Concentrations of human

cytokines were determined in either conditioned media from adipocytes, myotubes or co-cultures

using human cytokine/chemokine Panel I 41plex from Millipore (Billirica, MA, USA) as

previously described in (30). IGF-II levels were measured by ELISA assay in CM from myotubes

co-cultured or not with 3D adipocytes during 48h incubation. Serum levels of the murine

cytokines IL-6, IL-1 β, IL-10 and TNFα were analyzed using the MSD 7-plex mouse

proinflammatory cytokine high sensitivity kit (product code K15012C-2, MesoScale Discovery

(Gaithersburg, MD, USA) on the MesoScale Discovery Sector 6000 analyzer. Results were

calculated using the MSD Workbench software package. Lower limit of detection were the

following: CXCL1/2/3 (3.3 pg/ml), IL-10 (5.0 pg/ml), IL-1β (2.3 pg/ml), IL-6 (16.8 pg/ml) and

TNFα (0.9 pg/ml).

Neutralizing experiments and treatment by recombinant proteins

Myotubes alone or co-cultured cells were treated with IgG1 (3µg/mL) (MYO IgG, and

MYO+AD IgG) or with IL-6 (2.5µg/mL) and IL-1β (0.5µg/mL) neutralizing antibodies (MYO

abIL-6/IL-1β, MYO+AD abIL-6/IL-1β) during 3 days with renewal every day. Human

recombinant IL-6 (10 ng/ml) and IL-1β (1ng/ml) were added to myotubes cultured in the

hydrogel for 3 days with renewal every day. In another set of experiments, myotubes and co-

cultured cells were treated with IGF-II (50 ng/ml) and IGFBP-5 (200 ng/ml), when indicated, for

3 days with every day change. After this period, cells and media were collected for

immunofluorescence and multiplex analysis, respectively.

Immunofluorescence analysis and confocal microscopy


9

After fixation in 4 % paraformaldehyde, cells were processed for immunofluorescence analysis.

These samples were incubated with the appropriate primary antibody (overnight et 4°C), and then

the corresponding Alexa488-conjugated anti-mouse IgG or Alexa546-conjugated anti-rabbit IgG

interspaced by multiple washes in PBS, and followed by mounting coverslips. Sample

examinations were performed at the imaging platform (CICC, Centre de Recherches des

Cordeliers, Paris, France) using a Zeiss 710 confocal laser scanning microscope (Carl Zeiss, Inc.,

Thornwood, NY, USA) fitted with a LD LCI Plan-Apochromat oil-immersion objective 25x or

63X. Images were captured and analyzed with ZEN 2009 imaging software (Carl Zeiss, Inc.).

Western blot analysis:

Total cell extracts were prepared in a buffer containing a cocktail of protease and phosphatase

inhibitors (Roche Diagnostics, Mannheim, Germany) and were analyzed as previously described

(26). Apparent molecular sizes were estimated by using the SeeBlue® Plus2 Pre-Stained Protein

Standard (Life Technologies, Foster City, CA, USA) as indicated on immunoblots.

RNA preparation and PCR array

Muscle cells and adipocytes co-cultured in the 3D scaffolds were processed for RNA extraction

using the RNeasy RNA mini kit (Qiagen, Courtaboeuf, France). After reverse transcription of the

total RNAs (1 µg), samples were analyzed by i) real time PCR and ii) PCR array using the “

Human myogenesis and myopathy PCR array” according to manufacturer’s instructions

(Qiagen). Table S3 presents the list of the primers used. Data were normalized according to the

RPLPO gene expression. Supplementary list presents the functional classification of the genes in

the “Human myogenesis and myopathy PCR array”.


10

Statistical analysis

The experiments were performed at least three times, using adipocytes from different human

subjects. Statistical analyses were performed with GraphPad Software (San Diego, CA, USA).

Values are expressed as means ± SEM of (n) independent experiments performed with different

adipocyte preparations. Comparisons between the two conditions in the in vitro experiments

(adipocytes and adipocytes/myotubes cultures) and in vivo studies (chow and HFD mice) were

analyzed using the Wilcoxon non parametric paired test. Comparisons between more than two

groups were carried out using one way analysis of variance (ANOVA) followed by post-hoc

tests. Spearman coefficients were calculated to examine correlations. Differences were

considered significant when p<0.05.

RESULTS

Adipocyte secretions from obese VAT provoke muscle cells dysfunctions

Obesity and associated metabolic disorders such as type 2 diabetes are associated with muscle

dysfunctions characterized by inflammation and fat deposition (7). The muscle alterations are

associated with insulin resistance in link with an increase of visceral fat mass (10,20,31). We

sought to establish whether SAT/VAT from obese subjects could directly contribute to the

harmful phenotype observed in the muscle of these patients. Here, we take advantage of a well

characterized cohort of severe obese subjects showing chronic inflammation and marked insulin

resistance (1,32), as shown in Table S2.

Initially, we characterized the secretome of conditioned media from SAT and VAT adipocytes

(obese SAT CM and obese VAT CM, respectively) obtained from obese subjects and the media


11

obtained from the adipocytes isolated from SAT of healthy lean subjects as control (lean SAT

CM). As expected, low adiponectin secretion was observed in obese SAT and VAT adipocytes

compared to lean SAT ones (Figure S1A). We observed that the secretome of VAT adipocytes

exhibited a pro-inflammatory profile with high levels of several cytokines (IL-6 and G-CSF),

chemokines (IL-8, CCL2, CCL5 and CXCL1/2/3) as well as the growth factor FGF-2, compared

to SAT adipocytes from either lean or obese subjects (Figure S1A-B). Adipocytes from obese

SAT presented an intermediary inflammatory profile between lean SAT and obese VAT.

For this reason, we focused on obese VAT adipocytes and explored the impact of conditioned

media (VAT CM) on myotubes morphology and contractile protein expression, in comparison to

conditioned media from lean SAT adipocytes (lean SAT CM). We observed that myotubes were

thinner in the presence of obese VAT CM than control and lean SAT CM conditions as estimated

after immunofluorescence staining with desmin (a major component of muscle cell architecture

and contractility), which was also significantly lower in myotubes treated with obese VAT CM

than with lean SAT CM (-20%, p<0.01) (Figure 1A-B). The number of nuclei in the

differentiated cultures was not modified by the two conditioned media (Figure 1C). Western blot

analysis showed that the myosin heavy chain (MF20) and troponin, two major components of the

contractile apparatus in skeletal muscle, were also significantly decreased for both proteins in the

presence of obese VAT CM compared to control and lean SAT CM conditions (Figure 1D). If

lean SAT seems to impact myotube thickness and protein content, this was not statistically

significant and remains much lower than the effect of obese VAT CM. These data suggest that

the secretome of obese VAT adipocyte decrease myogenic capacity of the skeletal myoblasts.

VAT adipocytes directly induce muscle cells atrophy in a 3D scaffold


12

We then examined the effect of obese SAT and VAT adipocytes on skeletal muscle cells by using

3D co-cultures. Mature adipocytes and muscle cells were then embedded in separate hydrogels

(Figure S2A-B), previously characterized by the ability to maintain altered functions of obese

adipocytes (26). Direct co-cultures of human cells in a 3D setting are of great value because they

allow the study of a complex set from adipocyte-derived signals that regulate skeletal muscle

functions without confounding effects of other organ systems, while maintaining signals

including labile diffusible factors. The human myoblast differentiation and fusion processes were

not modified by cultivation in this 3D scaffold compared to 2D cultures (see MF20 and DAPI

staining, Figure S2C).

We used a skeletal muscle specific PCR array to determine the effects of the obese VAT

adipocytes on the expression of the muscle-specific genes. Among the set of 86 genes screened

on the array, we detected significant under-expression of 10 genes in the muscle cells exposed to

obese VAT adipocytes. Especially, we found decreased level of myogenic transcription factors,

MyoD1 and Myogenin (MYOG), the growth factor IGF-II and its binding partner IGFBP-5, the

sarcomeric protein titin (TTN), a member of the dystrophin complex, α sarcoglycan (SGCA), the

muscle-specific protein of caveolae, caveolin-3 (CAV-3) and an important component of the

neuro-muscular junction, the muscle-specific kinase (MuSK) (Figure 2A). It should be noted

that ER stress and cytolysis pathways were not detected in the co-cultured cells as assessed from

expression of ER stress markers (ATF4, HSPA5 and C/EBPζ) and lactate dehydrogenase

activity, respectively (Figures S3 and S4A).

By confocal analysis, we confirmed decreased expression of titin at protein level in myotubes

induced by VAT adipocytes (Figure 2B). Moreover, myotubes exposed to VAT adipocytes


13

showed a reduced striated staining for titin suggesting a disturbed internal sarcomeric structure

(Figure 2C).

Importantly, when compared to obese VAT adipocytes, obese SAT adipocytes appeared less

potent in inducing muscle cell atrophy as seen from myotube thickness and staining of troponin

and titin (Figure 2D-F).

Next, we quantified the levels of inflammation-related proteins using a multiplex “human

cytokines/chemokines” approach. Among the 41 screened proteins, 12 were significantly

detected in VAT adipocytes and myocytes (level >15 pg/ml). CCL2, IL-8, CXCLs, G-CSF, IL-6

and VEGF were highly secreted by the co-cultured cells compared to VAT adipocytes grown

alone in hydrogel (Figure S4B). For most of these inflammatory proteins, secretion was increased

in an additive manner in the presence of myotubes and adipocytes. Moreover, a synergistic affect

was observed for G-CSF (75-fold, p<0.05), IL-6 (25-fold, p<0.05) and CCL7 (10-fold, p<0.01)

(Figure 3A). As observed above for muscle cell atrophy, adipocytes from obese SAT provoked a

lower inflammatory status than those from obese VAT in the co-cultured cells (Figure 3B-C).

Considering the marked inflammatory profile of VAT adipocytes from obese subjects and their

potent impact on muscle cell phenotype compared to lean and obese SAT ones, we then focus on

the cross talk between muscle cells and obese VAT adipocytes.

IL-6 and IL-1ββββ have relevant role in inflammation of myotubes/adipocytes

We tested the role of two pro-inflammatory cytokines IL-6 and IL-1β, as drivers of myotubes

inflammation observed in co-cultures based on previous reports (26,33,34). After 3 days of

culture, in the presence of the neutralizing IL-6/IL-1β antibodies, the inflammatory response of


14

co-cultured cells was reduced with decreased levels of G-CSF (-71.4%), Fractalkine (-58%), IL-7

(-56%) and the chemokines CXCL1/2/3 (-53%), CCL7 (-42%), IL-8 (-43.5%), IP-10 (-36%) and

CCL5 (-38%,) (Figure 3D). To further confirm the role of IL-6/IL-1β, we treated myotubes with

human recombinant IL-6 and IL-1β which showed marked increased secretion of inflammatory

molecules such as G-CSF (~6000-fold), CXCL1/2/3 (~100-fold) and IL-8 (~100-fold) (p<0.001)

(Figure 3E). These results indicate the key role played by the cytokines IL-6 and IL-1β in the

inflammatory environment of the co-cultured cells. Strikingly, the combination of recombinant

IL-6/IL-1β or antibody neutralization of endogenous IL-6/IL-1β failed to influence myotube

thickness and titin staining (figure S5) suggesting an independent relationship between

inflammation and the atrophic phenotype observed in our experimental conditions.

IGF-II and IGFBP-5 correct the myotubes atrophy induced by obese VAT adipocytes

As shown in Figure 2A, myotubes co-cultured with obese VAT adipocytes displayed a decreased

expression of IGF-II and its binding partner IGFBP-5 known to synergically promotes myogenic

action (35). In 3D cultures of myocytes, 3 days treatment with human recombinant IGF-II (50

ng/ml) and IGFBP-5 (200 ng/ml) impacts muscle cells by increasing titin content (Figure S6). We

then tested the potential correction of the atrophic phenotype of myotubes co-cultured with VAT

adipocytes. Interestingly, chronic treatment with IGF-II and IGFBP-5 corrected the atrophic

aspect of the co-cultured myotubes through increased thickness (Figure 4A) and production of

both titin and myosin heavy chain (Figure 4B-D).

However, chronic treatment with IGF-II/IGFBP-5 failed to decrease the inflammatory secretome

of the co-cultured cells (Figure S7). Conversely, co-cultured cells treated by neutralizing


15

antibodies for IL-6 and IL-1β or treatment of myotubes by recombinant IL-6 and IL-1β did not

influence the production of IGF-II (Figure S5A).

Down-regulation of the signaling pathways controlling protein synthesis in myotubes

exposed to VAT adipocytes.

Skeletal muscle mass is determined by the balance between protein synthesis and degradation.

The rate of protein synthesis is, at least in part, finely controlled by the PI3K/Akt/mTOR

signaling pathway, activated by IGFs and amino acids (36). Here, we assessed the IGF-II/IGFBP-

5 activation of this pathway in co-cultured atrophic myotubes by measuring the phosphorylation

status of direct targets, Akt, p70S6K and 4E-BP1. We showed a reduction of basal

phosphorylation of Akt, S6K and 4E-BP1 in co-cultured myotubes compared to control ones as

well as reduced AKT phosphorylation in response to IGF-II/IGFBP-5 (Figure 4E-F), suggesting

that signalling pathways (Akt/S6K/4E-BP1) controlling protein synthesis are down regulated in

co-cultured muscle cells. Conversely, the gene expression of two atrophy-related ubiquitin

ligases, atrogin-1 and murf-1, remained unchanged in muscle cells exposed to VAT adipocytes

and not influenced by IGF-II/IGFBP-5 (Figure S8). Overall, our data suggest that the atrophy

phenotype is likely related to decreased synthesis of muscle proteins.

Diet-induced obesity induces muscle atrophy in association with epididymal WAT hypertrophy

and accumulation of intermuscular adipocytes in mice models.

In order to validate in vivo the relevance of the molecular candidates identified from our 3D co-

cultures, we used a diet-induced obese mouse model and screened expression of

inflammatory/muscle markers in their skeletal muscles. After 12 weeks of HFD, mice displayed

WAT and systemic inflammation with a global decrease in gene expression of muscular markers

such as MyoD (-76%), IGF-II (-58%), β-actin (-43%) and PGC-1β (-30%) in the Gastrocnemius


16

muscle (Figure 5A-B, Figure S9A). Conversely, expression of the inflammatory markers IL-1β

and CCL2 was significantly increased: 1.7 fold (p=0.0415) and 1.5 fold (p=0.0361), respectively.

In addition, the expression of skeletal muscle markers such as MyoD and IGF-II was negatively

correlated with increased fat mass (% fat mass and leptin expression) and inflammation in

epididymal WAT (IL-6 expression) (Table 1 and Table S4). However, we did not find any

correlations between IL-6 expression in inguinal WAT and skeletal muscle markers, highlighting

the specificity of the crosstalk between muscle and the VAT depots (Table S5). Finally,

histological analysis of the Gastrocnemius of obese mice revealed pathological changes generally

observed in muscle of dystrophic mice (25) with abnormal distribution of the muscle fiber size in

cross-section samples (increased co-variance coefficient of Feret’s diameter) and adipocytes

accumulation (Figure 5C-E, Figure S9B). Accordingly, we observed in obese mice muscle an

increased expression of adipocyte markers (i.e. leptin and FABP-4) in muscle reflecting increased

fat infiltration (Figure S9C). Interestingly, the expression of MyoD, IGF-II and β-actin in skeletal

muscle was negatively correlated with leptin expression in epididymal WAT and skeletal muscle

(Table 1). These results suggest a potential relationship between adipocyte accumulations and

muscle structure and dysfunction.

Discussion

We studied the adipocyte/muscle cell cross-talk participating in the complex inter-tissular

network of hypertrophied WAT with skeletal muscle. Here, using a 3D co-culture system, we

provide evidence in vitro that adipocytes from obese VAT induce muscle cells inflammation and

atrophy by decreasing the expression of contractile proteins such as troponin, titin and myosin

heavy chain. Importantly, we showed that in obese states, VAT adipocytes are more potent than

their SAT counterparts in provoking deleterious effects in muscle cells such as atrophy and


17

inflammation. These observations are probably linked to differences in the lineage specificity

and tissular environment characterizing these two depots (1,2,37,38).

Co-culture systems have been developed during the last decade to study the cross-talk between

adipose tissue and muscle, particularly focusing on the impact of adipocytes on muscle insulin

resistance and glucose uptake. Co-cultures of human in vitro differentiated preadipocytes with

skeletal muscle cells induce the insulin resistance of the latters (19) with impact on oxidative

metabolism (20). Here we have used mature (i.e. unilocular) adipocytes isolated from human

subjects. These cells display high metabolic (lipolytic activity) and secretory (production of leptin

and adiponectin) functions when compared to in vitro differentiated preadipocytes. We believe

that the results obtained using this 3D setting with mature adipocytes may be more patho-

physiologically relevant than previous studies using 2D co-culture with primary human

myoblasts (18–20,39). In addition this system allowed a long-term survey of muscle cells

functions addressing the original question of the impact of obese VAT adipocytes on

inflammation and myotubes structural organization.

Our results reveal that co-cultures of obese VAT adipocytes with muscle cells enhanced the pro-

inflammatory environment with increased production of several cytokines (IL-6 and G-CSF) and

chemokines (CCL2, IL-8, CXCL1/2/3, CCL7 and Fractalkine). More importantly, we have clearly

identified IL-6 and IL-1β playing key roles in this inflammatory loop. These cytokines which act

in concert in various inflammatory processes are over-produced by adipose tissue during obesity

and type 2 diabetes (40,41).

Muscles cells are characterized by their contractile capacity, a phenomenon depending of tissue

physical properties. The hydrogel used in the present study is soft (~300 Pa, compared to skeletal


18

muscle or culture well plates (~12kPa and ~100 kPa respectively, (42)), limiting the analysis of

myotubes contractility in our 3D co-cultures. However, in this 3 D model maintaining adipocyte

viability, we were able to demonstrate a major role of obese VAT adipocytes on inducing muscle

cell atrophy phenotype. The myogenic program is controlled by transcription factors such as

MyoD and myogenin. Binding of these factors to specific sequences in the promoter of muscle-

specific genes increases the expression of contractile proteins such as myosin heavy chain,

tropomyosin, troponin (43,44) and titin, which maintains sarcomere integrity (45). At the

molecular level, we observed the down-regulation of MyoD, myogenin, and

contractile/sarcomeric proteins (titin) and the dystrophin complex in myotubes co-cultured with

the obese VAT adipocytes. These data provide new insights about which proteins are

preferentially targeted and participate to the atrophic phenotype of the muscle cells when co-

cultured in this 3D setting.

In addition to the decreased gene expression of muscle specific structural proteins, we also

observed a decreased expression of the growth/myogenic factor IGF-II and its binding partner

IGFBP-5 (35). IGF-II shares with IGF-I the same receptor and protein signaling pathway

(Akt/mTOR/p70S6) which mediates hypertrophy in skeletal muscle (21). Importantly, the acute

activation by IGF-II/IGFBP-5 of this pathway, in particular Akt phosphorylation, was altered in

myotubes exposed to obese VAT adipocytes, which could be responsible for the observed muscle

cell atrophy phenotype. This is supported by the observations that chronic treatment by IGF-II

and IGFBP-5 were able to correct the muscle atrophy phenotype and restore titin and myosin

heavy chain production in the co-cultured myotubes while having a minor influence on myotube

phenotype alone in control conditions.


19

Finally, the patho-physiological relevance of our results was further supported in a rodent model

of nutritionally induced obesity. Obese mice displayed abnormal distribution of cross-section

muscle fiber size, adipocyte accumulation and decreased muscle markers expression.

Interestingly, expression of the muscle markers (i.e. MyoD, β-Actin, Titin, IGF-II and IGFBP-5)

were negatively correlated with inflammation and epididymal fat expansion. We cannot exclude

in our in vivo model, an additional role of the liver in promoting muscle dysfunctions. According

to the “portal hypothesis”, the liver is directly exposed to VAT-derived factor which may induce

inflammation, causing then skeletal muscle defects such as insulin resistance (46). Moreover,

correlative observations made in skeletal muscle need further studies to firmly establish a

potential role of intermuscular adipocytes in muscle dysfunctions.. Several clinical studies

suggest that muscle-derived adipocytes through secretion of bio-active factors could play a role in

muscle deteriorations by inducing insulin-resistance and negatively affecting myogenesis and

muscle performance (13,31,47). Moreover, a recent report showed a potential link between

obesity-induced lipotoxicity and muscle insulin resistance through disruption of 4E-BP1

phosphorylation and protein synthesis (48). Consequently, future goal will be to compare both

VAT and intermuscular adipocytes phenotypes; the latter still remains unknown.

To conclude, we provide evidence for a cross-talk between human obese adipocytes and muscle

cells leading to muscle atrophy (Figure 6). The subset of under-expressed muscle-specific genes

could constitute a molecular signature of muscle damage induced by hypertrophy of obese WAT.

The identification of negative (IL-6/IL-1β) and beneficial (IGF-II/IGFBP-5) molecular actors

involved in these dysfunctions open new avenues for therapeutic strategies of myopathies

associated with metabolic disorders.


20

Author contributions

VP, SRC and DL conceived and performed the experiments and analyzed the data.

CR performed and analyzed multiplex and PCR array experiments.

FEV and VA performed muscle cell culture.

KC contributed to clinical investigation and patients recruitment.

VP, KC, SRC, AVP, GBB and DL wrote the manuscript with the input of all the co-authors.

GBB and DL are the guarantors of this work, such as, had the full access to all data in the study

and take the responsibility for the integrity of the data and the accuracy of the data analysis.

Acknowledgments

The authors are very grateful to Dr Peter Van Der Ven (Institut for Cell Biology, Bonn,

Germany) for providing us the anti-human titin monoclonal antibody. We acknowledge patients,

the physician Dr Christine Poitou of the Nutrition Department of Pitié Salpétrière (Paris, France)

for patients’ recruitment. We also thank Christophe Klein from imaging facilities of Centre de

Recherches des Cordeliers. For cellular studies, ethical authorization was obtained from CPP

Pitié Salpêtrière. Human adipose tissues pieces were obtained thanks to Clinical Research

Contract (Assistance Publique/Direction de la Recherche Clinique AOR 02076).

Fundings

This work was supported by a grant from the European Community seventh framework program,

Adipokines as Drug to combat Adverse Effects of Excess Adipose tissue project (contract

number HEALTH-FP2-2008-201100), APHP Clinical Research Contract, Emergence program,

University Pierre et Marie Curie (to VP), Région Ile de France (FUI-OSEO Sarcob), the


21

Fondation pour la Recherche Médicale, grant number “DEQ20120323701” (to KC) as well as

French National Agency of Research (French government grant, Investments for the Future”;

grant no. ANR-10-IAHU, ANR AdipoFib). This work was also financed by the EU FP7

Programme project MYOAGE (contract HEALTH-F2-2009-223576), the ANR Genopath-

INAFIB, the AFLD, the CNRS and the AFM (Association Française contre les Myopathies).

SRC and AVP are supported by MRC and BHF programme grants.

Disclosure statement:

No conflicts of interest to this article are reported.


22

REFERENCES

1. Cancello R, Tordjman J, Poitou C, Guilhem G, Bouillot JL, Hugol D, et al. Increased

infiltration of macrophages in omental adipose tissue is associated with marked hepatic lesions in

morbid human obesity. Diabetes. 2006 Jun;55(6):1554–61.

2. Villaret A, Galitzky J, Decaunes P, Estève D, Marques M-A, Sengenès C, et al. Adipose

tissue endothelial cells from obese human subjects: differences among depots in angiogenic,

metabolic, and inflammatory gene expression and cellular senescence. Diabetes. 2010

Nov;59(11):2755–63.

3. Jensen MD. Role of body fat distribution and the metabolic complications of obesity. J

Clin Endocrinol Metab. 2008 Nov;93(11 Suppl 1):S57–63.

4. Harwood HJ Jr. The adipocyte as an endocrine organ in the regulation of metabolic

homeostasis. Neuropharmacology. 2012 Jul;63(1):57-75.

5. Rytka JM, Wueest S, Schoenle EJ, Konrad D. The portal theory supported by venous

drainage-selective fat transplantation. Diabetes. 2011 Jan;60(1):56–63.

6. Fontana L, Eagon JC, Trujillo ME, Scherer PE, Klein S. Visceral fat adipokine secretion

is associated with systemic inflammation in obese humans. Diabetes. 2007 Apr;56(4):1010–3.

7. Kewalramani G, Bilan PJ, Klip A. Muscle insulin resistance: assault by lipids, cytokines

and local macrophages. Curr Opin Clin Nutr Metab Care. 2010 Jul;13(4):382–90.

8. Akhmedov D, Berdeaux R. The effects of obesity on skeletal muscle regeneration. Front

Physiol. 2013;4:371.

9. Masgrau A, Mishellany-Dutour A, Murakami H, Beaufrère A-M, Walrand S, Giraudet C,

et al. Time-course changes of muscle protein synthesis associated with obesity-induced

lipotoxicity. J Physiol (Lond). 2012 Oct 15;590(Pt 20):5199–210.

10. Boettcher M, Machann J, Stefan N, Thamer C, Häring H-U, Claussen CD, et al.

Intermuscular adipose tissue (IMAT): association with other adipose tissue compartments and

insulin sensitivity. J Magn Reson Imaging. 2009 Jun;29(6):1340–5.

11. Thomas EL, Saeed N, Hajnal JV, Brynes A, Goldstone AP, Frost G, et al. Magnetic

resonance imaging of total body fat. J Appl Physiol. 1998 Nov;85(5):1778–85.

12. Gallagher D, Kelley DE, Yim J-E, Spence N, Albu J, Boxt L, et al. Adipose tissue

distribution is different in type 2 diabetes. Am J Clin Nutr. 2009 Mar;89(3):807–14.

13. Goodpaster BH, Krishnaswami S, Harris TB, Katsiaras A, Kritchevsky SB, Simonsick

EM, et al. Obesity, regional body fat distribution, and the metabolic syndrome in older men and

women. Arch Intern Med. 2005 Apr 11;165(7):777–83.

14. Coen PM, Hames KC, Leachman EM, DeLany JP, Ritov VB, Menshikova EV, et al.

Reduced skeletal muscle oxidative capacity and elevated ceramide but not diacylglycerol content

in severe obesity. Obesity (Silver Spring). 2013 Nov;21(11):2362–71.

15. Kemp JG, Blazev R, Stephenson DG, Stephenson GMM. Morphological and biochemical

alterations of skeletal muscles from the genetically obese (ob/ob) mouse. Int J Obes (Lond). 2009

Aug;33(8):831–41.


23

16. Denies MS, Johnson J, Maliphol AB, Bruno M, Kim A, Rizvi A, et al. Diet-induced

obesity alters skeletal muscle fiber types of male but not female mice. Physiol Rep. 2014 Jan

1;2(1):e00204.

17. Borst SE, Conover CF, Bagby GJ. Association of resistin with visceral fat and muscle

insulin resistance. Cytokine. 2005 Oct 7;32(1):39–44.

18. Vu V, Kim W, Fang X, Liu Y-T, Xu A, Sweeney G. Coculture with primary visceral rat

adipocytes from control but not streptozotocin-induced diabetic animals increases glucose uptake

in rat skeletal muscle cells: role of adiponectin. Endocrinology. 2007 Sep;148(9):4411–9.

19. Dietze D, Koenen M, Röhrig K, Horikoshi H, Hauner H, Eckel J. Impairment of insulin

signaling in human skeletal muscle cells by co-culture with human adipocytes. Diabetes. 2002

Aug;51(8):2369–76.

20. Kovalik J-P, Slentz D, Stevens RD, Kraus WE, Houmard JA, Nicoll JB, et al. Metabolic

remodeling of human skeletal myocytes by cocultured adipocytes depends on the lipolytic state

of the system. Diabetes. 2011 Jul;60(7):1882–93.

21. Glass DJ. PI3 kinase regulation of skeletal muscle hypertrophy and atrophy. Curr Top

Microbiol Immunol. 2010;346:267–78.

22. Pedersen BK, Febbraio MA. Muscles, exercise and obesity: skeletal muscle as a secretory

organ. Nat Rev Endocrinol. 2012 Aug;8(8):457–65.

23. Whittle AJ, Carobbio S, Martins L, Slawik M, Hondares E, Vázquez MJ, et al. BMP8B

increases brown adipose tissue thermogenesis through both central and peripheral actions. Cell.

2012 May 11;149(4):871–85.

24. Riehle C, Wende AR, Zaha VG, Pires KM, Wayment B, Olsen C, et al. PGC-1β

deficiency accelerates the transition to heart failure in pressure overload hypertrophy. Circ Res.

2011 Sep 16;109(7):783–93.

25. Briguet A, Courdier-Fruh I, Foster M, Meier T, Magyar JP. Histological parameters for

the quantitative assessment of muscular dystrophy in the mdx-mouse. Neuromuscul Disord. 2004

Oct;14(10):675–82.

26. Pellegrinelli V, Rouault C, Veyrie N, Clément K, Lacasa D. Endothelial Cells From

Visceral Adipose Tissue Disrupt Adipocyte Functions In A 3D Setting: Partial Rescue By

Angiopoietin-1. Diabetes. 2014 Feb;63(2):535-49.

27. Pellegrinelli V, Heuvingh J, du Roure O, Rouault C, Devulder A, Klein C, et al. Human

adipocyte function is impacted by mechanical cues. J Pathol. 2014 Jun;233(2):183-95.

28. Decary S, Mouly V, Hamida CB, Sautet A, Barbet JP, Butler-Browne GS. Replicative

potential and telomere length in human skeletal muscle: implications for satellite cell-mediated

gene therapy. Hum Gene Ther. 1997 Aug 10;8(12):1429–38.

29. Delaporte C, Dautreaux B, Fardeau M. Human myotube differentiation in vitro in

different culture conditions. Biol Cell. 1986;57(1):17–22.

30. Rouault C, Pellegrinelli V, Schilch R, Cotillard A, Poitou C, Tordjman J, et al. Roles of

chemokine ligand-2 (CXCL2) and neutrophils in influencing endothelial cell function and

inflammation of human adipose tissue. Endocrinology. 2013 Mar;154(3):1069–79.


24

31. Hilton TN, Tuttle LJ, Bohnert KL, Mueller MJ, Sinacore DR. Excessive adipose tissue

infiltration in skeletal muscle in individuals with obesity, diabetes mellitus, and peripheral

neuropathy: association with performance and function. Phys Ther. 2008 Nov;88(11):1336–44.

32. Dalmas E, Rouault C, Abdennour M, Rovere C, Rizkalla S, Bar-Hen A, et al. Variations

in circulating inflammatory factors are related to changes in calorie and carbohydrate intakes

early in the course of surgery-induced weight reduction. Am J Clin Nutr. 2011 Aug;94(2):450–8.

33. Spranger J, Kroke A, Möhlig M, Hoffmann K, Bergmann MM, Ristow M, et al.

Inflammatory cytokines and the risk to develop type 2 diabetes: results of the prospective

population-based European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam

Study. Diabetes. 2003 Mar;52(3):812–7.

34. Stapp JM, Sjoelund V, Lassiter HA, Feldhoff RC, Feldhoff PW. Recombinant rat IL-

1beta and IL-6 synergistically enhance C3 mRNA levels and complement component C3

secretion by H-35 rat hepatoma cells. Cytokine. 2005 Apr 21;30(2):78–85.

35. Ren H, Yin P, Duan C. IGFBP-5 regulates muscle cell differentiation by binding to IGF-II

and switching on the IGF-II auto-regulation loop. J Cell Biol. 2008 Sep 8;182(5):979–91.

36. Glass DJ. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem

Cell Biol. 2005 Oct;37(10):1974–84.

37. Chau Y-Y, Bandiera R, Serrels A, Martínez-Estrada OM, Qing W, Lee M, et al. Visceral

and subcutaneous fat have different origins and evidence supports a mesothelial source. Nat Cell

Biol. 2014 Apr;16(4):367–75.

38. Macotela Y, Emanuelli B, Mori MA, Gesta S, Schulz TJ, Tseng Y-H, et al. Intrinsic

differences in adipocyte precursor cells from different white fat depots. Diabetes. 2012

Jul;61(7):1691–9.

39. Yu J, Shi L, Wang H, Bilan PJ, Yao Z, Samaan MC, et al. Conditioned medium from

hypoxia-treated adipocytes renders muscle cells insulin resistant. Eur J Cell Biol. 2011

Dec;90(12):1000-15.

40. Kern PA, Ranganathan S, Li C, Wood L, Ranganathan G. Adipose tissue tumor necrosis

factor and interleukin-6 expression in human obesity and insulin resistance. Am J Physiol

Endocrinol Metab. 2001 May;280(5):E745–51.

41. Moschen AR, Molnar C, Enrich B, Geiger S, Ebenbichler CF, Tilg H. Adipose and liver

expression of interleukin (IL)-1 family members in morbid obesity and effects of weight loss.

Mol Med. 2011;17(7-8):840–5.

42. Buxboim A, Ivanovska IL, Discher DE. Matrix elasticity, cytoskeletal forces and physics

of the nucleus: how deeply do cells “feel” outside and in? J Cell Sci. 2010 Feb 1;123(Pt 3):297–

308.

43. Berkes CA, Tapscott SJ. MyoD and the transcriptional control of myogenesis. Semin Cell

Dev Biol. 2005 Oct;16(4-5):585–95.

44. Le Grand F, Rudnicki MA. Skeletal muscle satellite cells and adult myogenesis. Curr

Opin Cell Biol. 2007 Dec;19(6):628–33.


25

45. Gautel M. Cytoskeletal protein kinases: titin and its relations in mechanosensing. Pflugers

Arch. 2011 Jul;462(1):119–34.

46. Cai D, Yuan M, Frantz DF, Melendez PA, Hansen L, Lee J, et al. Local and systemic

insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat Med. 2005

Feb;11(2):183–90.

47. Takegahara Y, Yamanouchi K, Nakamura K, Nakano S-I, Nishihara M. Myotube

formation is affected by adipogenic lineage cells in a cell-to-cell contact-independent manner.

Exp Cell Res. 2014 May 15;324(1):105–14.

48. Stephens FB, Chee C, Wall BT, Murton AJ, Shannon CE, van Loon LJC, et al. Lipid

induced insulin resistance is associated with an impaired skeletal muscle protein synthetic

response to amino acid ingestion in healthy young men. Diabetes. 2014 Dec 18;

LEGENDS TO FIGURES


26

Figure 1: Human adipocyte secretions and myotube phenotype

A. Human differentiated muscle cells were cultured in the presence of lean SAT CM or obese

VAT CM for 5 days. Cells were incubated with an antibody specific for desmin, revealed using

an Alexa-488 coupled goat anti mouse secondary antibody (green). Nuclei were visualized with

Hoechst staining (blue). A representative photomicrograph is presented. Scale bar=200 µm.

B. Myotube thickness was quantified using Image J software measuring intensity of the desmin

staining in ten random fields (X20) in three independent cultures.

C. Fusion index: the number of nuclei in differentiated myotubes (>2 myonuclei) were calculated

as a percentage of the total number of nuclei (mononucleated and plurinucleated). 1000 nuclei per

dish were counted in three independent cultures.

The counting was performed with blind lectures by different investigators (VA and FEV).

D. Cell lysates were immunoblotted to detect the heavy chain of myosin II (MF20, 200kDa),

troponin (24 kDa) and emerin (37 kDa, used as normalization control). Graphs represent the

quantification of the immunoblots.

Data are mean ± SEM of 5 independent experiments.

*p<0.05, **p<0.01, control vs. lean SAT CM or obese VAT CM.

Figure 2: Gene expression profile of myocytes co-cultured with human adipocytes

Muscle cells were differentiated in the 3D hydrogel for 3 days and then VAT adipocytes in the

3D hydrogel were added for an additional period of 1 day. Cells were then collected for RNA

extraction to obtain after reverse transcription cDNAs.


27

A. cDNAs were analyzed using “Human myogenesis and myopathy PCR array”.

Graph represents the percentage of decreased gene expression in myocytes co-cultured with

adipocytes (MYO+AD) compared to myocytes alone (control, MYO).

Data are presented as means ± SEM of 5 independent experiments.

**p<0.01, ***p<0.001 MYO+AD vs MYO

B-C Cells were also fixed and stained using antibody directed against titin (green, Alexa488-

conjugated anti-mouse IgG) and phalloidin (red, Alexa-546 phalloidin). A representative

photomicrograph from confocal microscopy is presented. (Figure 2C, scale bar = 20 µm and D,

scale bar = 10 µm).

D-F. Muscle cells were differentiated for 3 days and then 3D adipocytes from SAT or VAT from

paired biopsies of obese subjects were added for an additional period of 3 days. Cells were fixed

and stained using antibody directed against desmin, troponin or titin (green, Alexa488-conjugated

anti-mouse IgG). Graphs represent quantifications of myotube thickness (D), troponin staining

(E) and titin staining (F).

Data are the means ± SEM of 6-8 independent experiments.

*p<0.05 MYO+VAT AD vs MYO

Figure 3: Inflammatory profile of co-cultured human adipocytes and myocytes: IL-6 and

IL-1ββββ as key factors.

Muscle cells were differentiated in the 3D hydrogel for 3 days and then SAT or VAT adipocytes

from obese subjects, cultured in the 3D hydrogel were added for an additional period of 3 days.


28

Media were then collected for the measurement of cytokine and chemokine secretion by a

multiplex assay.

A-Significant changes in the secretory profile in the 3D cultures of muscle cells and obese VAT

adipocytes (AD+MYO) compared to AD as control and MYO are presented in the graph. Data

are expressed as fold variations between AD (white bars), AD+MYO (black bars) and MYO

(grey bars) to take into account human inter-individual variations.


*p<0.05, **p< 0.01 AD+MYO vs AD.

B- Significant changes in the secretory profile in the 3D cultures of muscle cells and obese SAT

(MYO+ SAT AD) or obese VAT adipocytes (MYO+ VAT AD) are presented in the graph. Data

are expressed as fold variations between MYO (control) and MYO+ SAT AD (white bars) or

MYO+ VAT AD (black bars).


C. Gene expression of IL-6, IL-8 and IL-1β in muscle cells cultured alone (control, MYO, white

bars) or exposed to adipocytes from paired biopsies of obese SAT (MYO+ SAT AD, grey bars)

or VAT adipocytes (MYO+ VAT AD, black bars), estimated by real time PCR. Data (fold over

control, MYO) are presented as means ± SEM of 6 independent experiments performed with

different adipocytes preparations.

*p<0.05, **p<0.01 MYO+ VAT AD vs MYO.

#p<0.05 MYO+ SAT AD vs. MYO+ VAT AD


29

D. 3D VAT adipocytes were added for an additional period of 3 days treated with neutralizing

antibodies of IL-6 (2.5 µg/ml) and IL-1β (0.5 µg/ml) (MYO+AD+ abIL-6/IL-1β) IgG1 (control

MYO+AD IgG) in the 3D setting. Media were then collected for multiplex assay. Black bars

represent the percentage decrease in secretions in MYO+AD+ abIL-6/IL-1β co-cultures

compared to control MYO+AD IgG co-cultures.


* P<0.05, **p<0.01, ***p<0.001, ns non-significant MYO+AD IgG vs. MYO+AD+ abIL-6/IL-

1β

E. Multiplex assay of the inflammatory secretome of myocytes treated (MYO IL-6/IL-1β, black

bars) or not (MYO, white bars) with recombinant IL-6 (10 ng/ml) and IL-1β (1 ng/ml) during 3

days.


* P<0.05, **p<0.01, ***p<0.001 MYO IL-6/IL-1β vs. MYO

Figure 4: IGF-II and IGFBP-5 rescue the atrophy of myotubes induced by adipocytes

A-D. Muscle cells were differentiated in the 3D hydrogel for 3 days without (MYO) or with 3D

VAT adipocytes (from obese subjects) (MYO+AD) were added for an additional period of 3 days

in the presence or not of IGF-II (50ng/ml) and IGFBP-5 (200ng/ml) (MYO+AD+IGF-II/IGFBP-

5. Cells were fixed and stained with the corresponding antibodies.

A. Myotube thickness was quantified using Image J software measuring intensity of the desmin

staining in ten random fields (X20) in 6 independent cultures.


30

B-D. Quantification of immunofluorescence was performed using Image J software measuring

intensity of the MF20 (B) and titin (C) staining in five random fields (X20).

D. Immunostaining of titin (green, Alexa488-conjugated anti-mouse IgG) and nuclei (blue,

DAPI). A representative photomicrograph of titin staining is presented (scale bar = 50 µm).


** p<0.01, MYO+AD vs MYO or MYO+AD+IGF-II/IGFBP-5.

E-F. Differentiated muscle cells exposed or not to obese VAT adipocytes were stimulated with

IGF-II (50 ng/ml) and IGFBP-5 (200 ng/ml) for 10 min at 37°C. Serine 473 phosphorylation of

Akt (pS 473 Akt, 56kDa), Serine 65 of 4E-BP1 (pS65 4E-BP1, 21 kDa) and Serine 240 and 244

phosphorylation of S6 ribosomal protein (pS 240/244 S6 ribosomal protein, 32 kDa) were

detected using the corresponding antibodies. A representative Western blot is presented among

the five different experiments (E). The graph represents quantifications of the immunoblots in

IGF-II/IGFBP-5-stimulated conditions normalized to total proteins (F).

Data are presented as means ± SEM of 5-7 independent experiments.

* p<0.05, **p<0.01, MYO+AD vs. MYO

#p<0.05, ##p<0.01, - vs. + IGF-II/IGFBP5 treatment.

Figure 5: Skeletal muscle characteristics of HFD-induced obese mice

A-B. Serum cytokine level (A) and Gastrocnemius gene expression (B) evaluated in 20-week-old

mice after 12 weeks of standard diet (chow, white bars) or High Fat Diet (HFD, black bars).

n=8 mice per experimental group


31

C-E. Histological analysis of the Gastrocnemius muscle obtained from 24-week-old mice (n=9

mice per experimental group) after 16 weeks of standard diet (chow) or High Fat Diet (HFD).

C. Representative microphotographs of cross-section (right panel) and longitudinal section (left

panel). Scale bar=100µm.

D. Measurement of variance coefficients of the fiber size in the cross-section samples of Chow

and HFD mice using Feret’s diameter as geometrical parameter. n=61 (minimum)–201

(maximum) fibers were analyzed for each sample (3 random fields/mouse, X10).

E. Quantification of adipocyte spots in the longitudinal section samples of chow and HFD mice

(total biopsy).

*p<0.05, ***p<0.001, ns, non-significant, chow vs. HFD mice.

Figure 6: Scheme representing the proposed cross-talk between obese adipocytes and

muscle cells which could trigger inflammation and muscle dysfunctions.


32

Table 1. Spearman correlations between the gene expression of muscle markers in the

skeletal muscle (Gastrocnemius) and the expression of leptin/IL-6 in both epididymal AT

and skeletal muscle.

20-week-old mice (n=16).

Significant correlations are indicated in bold

Epididymal Adipose Tissue Gastrocnemius

Gastrocnemius

Fat mass % Leptin IL-6 Leptin IL-6

R p R p R p R p R p

MyoD -0.729 0.001 -0.747 0.001 -0.708 0.001 -0.618 0.006 0.427 0.051

MyoG -0.279 0.147 -0.053 0.424 -0.030 0.454 -0.053 0.424 0.009 0.489

β-Actin -0.415 0.056 -0.788 0.000 -0.720 0.001 -0.435 0.047 0.271 0.155

Titin -0.5357 0.0396 -0.4107 0.1283 -0.6452 0.0094 -0.3429 0.2109 0.1679 0.5499

IGF-II -0.577 0.011 -0.744 0.001 -0.664 0.003 -0.588 0.009 0.453 0.040

IGFBP-5 -0.6264 0.0165 -0.6791 0.0076 -0.6865 0.0067 -0.5121 0.0612 0.4549 0.1022

PGC-1α 0.068 0.410 0.152 0.303 0.213 0.230 0.020 0.476 0.160 0.292

PGC-1β -0.350 0.101 -0.646 0.006 -0.459 0.042 -0.332 0.113 0.418 0.061


Figure 1

A

control Lean SAT CM

B *

*

200µm

C

** *

*

Troponin

Emerin

MF20

38 kDa

18 kDa

188 kDa

D

Obese VAT CM

Control Lean SAT CM Obese VAT CM Control Lean SAT CM Obese VAT CM

Control Lean SAT CM Obese VAT CM

Control Lean SAT CM Obese VAT CM Control Lean SAT CM Obese VAT CM

Myo

tub

e t

hic

kne

ss

(fo

ld o

ver

con

tro

l)


Figure 2

A

-100

-80

-60

-40

-20

0

mR

NA

rel

ativ

e ex

pre

ssio

n in

M

YO+

AD

(%

co

ntr

ol,

MYO

)

*** ***

**

*** ***

** **

*** ***

**

* *

MYO+ VAT AD MYO+SAT AD MYO

titin

D E *

F

B

MY

O

MY

O+

AD

C Phalloidin Titin Merge

Titin

MY

O

MY

O+

AD

*

* *


Figure 3

D

A

CC

L2

IL-8

G-C

SF

IL-6

VEG

F

CC

L7

MIP

1α

FRK

FGF2

0

10

20

30

40

50

60

7080

780

1480

MYO+ SAT ADMYO+VAT AD

Secr

etio

n (

fold

ove

r co

ntr

ol,

MY

O)

*

* *

*

*

*

*

*

*

*

* * * *

#

#

# #

#

25

75

125AD

AD+MYO

MYO

** *

**

**

**

* *

*

* C

CL2

IL-8

CX

CL 1

/2/3

G-C

SF

IL-6

VEG

F

CC

L7

MIP

1α

FRK

FGF2

Secr

eti

on

(fo

ld o

ver

con

tro

l, A

D)

B

*

**

IL-6 IL-8 IL-1

MYO

MYO+VAT AD MYO+SAT AD

C

-90

-75

-60

-45

-30

-15

0

Secr

etio

n in

AD

+MY

O a

b IL

-6/I

L-1β

(%

co

ntr

ol,

AD

+MY

O Ig

G)

***

** ** * ***

** *

ns

ns

*

ns

G-C

SF

FRK

CX

CL 1

/2/3

CC

L7

IL-7

IL-8

IP-1

0

CC

L2

MIP

1α

CC

L5

VEG

F

0

300

600

Secr

etio

n (

pg/

ml)

1200

7200

13200

19200

***

**

***

**

**

***

***

**

**

**

*

MYO MYO IL-6/IL-1β

E

G-CSF FRK CXCL CCL7 IL-7 IL-8 IP-10 CCL2 MIP-1α CCL5 VEGF 1/2/3

*


** **

Myo

tub

e t

hic

kne

ss

(fo

ld o

ver

con

tro

l, M

YO

)

MYO MYO+AD MYO+AD +IGF-II/IGFBP-5

B

** ** ** **


Titin, nuclei

50µm

MYO MYO+AD MYO+AD+IGF-II/IGFBP-5


A C

D

Figure 4

pS473 AKT

Total AKT

pS65 4E-BP1

pS240/244 S6

Total 4E-BP1

Total S6

IGF-II/IGFBP-5 - + - +

MYO MYO+AD

** ##

# **

**

**

**

* *

MYO

MYO+AD

- + - + IGF-II/IGFBP-5



E F

49 kDa

49 kDa

17 kDa

17 kDa

28 kDa

28 kDa


Figure 5

02468

101214161820

MyoD MyoG IGF-II β-Actin PGC1α PGC1β Titin IGFBP-5

mR

NA

rel

ativ

e ex

pre

ssio

n (

A.U

)

ChowHFD

50

100

*** ***

*** *** *

*

*

*

A B

Chow

HFD

Transverse Section

0

10

20

30

40 Chow

HFD***

CV

fer

et d

iam

eter

(%

)

0

2

4

6 Chow

HFD*

Ad

ipo

cyte

sp

ots

C D

Longitudinal Section

*

* * *

*

E

0.0

10.0

20.0

30.0

40.0

IL-6 IL-1β TNFα CXCL IL-10

Seru

m le

vel (

pg/

ml)

60.0

160.0 Chow

HFD

1/2/3


Figure 6

Adipokines secretion

INFLAMMATION

IGF-II/IGFBP-5

ATROPHIC PHENOTYPE (decreased myogenic and

contractile protein expression)

INFLAMMATION

IL-6/IL-1β

Cytokines/chemokines production

Recruitment/activation of immune cells

Adipocyte Muscle cell


1

SUPPLEMENTARY DATA

Human adipocytes induce inflammation and atrophy in muscle cells during obesity

Pellegrinelli V1, 2, 3#

, Rouault C1, 2, 3*

, Rodriguez-Cuenca S4*

, Albert V1, 2, 3

, Edom-

Vovard F5, 6, 7, 8

, Vidal-Puig A4, Clément K

1, 2, 3 **, Butler-Browne GS

5, 6, 7, 8** and

Lacasa D1, 2, 3 **

1 - INSERM, U1166 Nutriomique, Paris, F-75006 France;

2 - Sorbonne Universités, University Pierre et Marie-Curie-Paris 6, UMR S 1166, Paris,

F-75006 France;

3- Institut Cardiométabolisme et Nutrition, ICAN), Pitié Salpétrière Hospital, Paris, F-

75013 France;

4- Metabolic Research Laboratories, Wellcome Trust-MRC Institute of Metabolic

Science, University of Cambridge, Cambridge, United Kingdom;

5- Sorbonne Universités, University Pierre et Marie-Curie-Paris6, Centre de recherches

en Myologie UMR 974, F-75005, Paris, France;

6- INSERM, U974, 75013, Paris, France;

7- CNRS FRE 3617, 75013, Paris, France;

8- Institut de Myologie, 75013, Paris, France.

# Corresponding author: Current address: Wellcome Trust-MRC Institute of Metabolic

Science, Metabolic Research Laboratories,University of Cambridge

This file includes:

9 supplementary figures

5 supplementary tables

1 supplementary list

Supplemental references


2

Figure S1

Secretory profile of human SAT and VAT adipocytes.

A-Secretory profile of 48h-conditioned media prepared from 3D human adipocytes from lean SAT

(lean SAT CM) and obese SAT and VAT (obese SAT CM and obese VAT CM, respectively).

Heatmap represents the secretory profile. Graded shades from green to red represent the secretion

levels (pg/ml). Cytokines and chemokines were classified from high to low secretion.

B-Secretory profile of 48h-conditioned media prepared from human adipocytes from paired samples of obese SAT (obese SAT CM, white bars) and VAT (obese VAT CM, black bars). Results are

expressed as fold variation over control, obese SAT CM.

The amounts of adipokines were determined by ELISA (leptin and adiponectin) and multiplex (cytokines/chemokines) analysis in 10-14 experiments using different adipocyte preparations.

*p<0.05, ** p<0.01 obese VAT CM vs. obese SAT CM (B)


3

Figure S2

Human SAT and VAT

Experimental procedure for 3D co-culture of human adipocytes and myoblasts

A- Muscle cells were embedded in hydrogel at the concentration of 200.000 cells per 100µl of gel

preparation containing 0.5 mg/ml type 1collagen. The gel preparation was put into 96-well plates

containing 150µl of growth medium. After 2 days of culture, this medium was replaced by

differentiating medium for 3 days. A second hydrogel containing mature adipocytes isolated from

SAT or VAT of obese subjects (10.000 cells per 100µl of gel preparation) was then added. Adipocytes

and differentiated myoblasts were then co-cultured for 3 days in DMEM/F12 (1% antibiotics and 50

nM insulin). Culture medium was changed daily.

B- Microphotographs showing the hydrogel containing the mature adipocytes (AD) and/or the

differentiated myoblastes (MYO).


4

C- Immunofluorescence analysis of differentiated myoblastes cultured in 2D or 3D conditions using

antibodies against MF20 (green, Cy2-conjugated anti-mouse IgG), actin (red, Cy3-phalloidin). Nuclei

were stained with DAPI (blue).

Figure S3

ATF4

HSPA5

C/EBPζζζζ

Gene expression of ER stress markers in co-cultured myocytes and VAT adipocytes.

Muscle cells were differentiated in the 3D hydrogel for 3 days and then 3D adipocytes (from VAT of

obese subjects) were added for an additional period of 1 day. Cells were then collected for RNA extraction. After reverse transcription of total RNAs, cDNAs were analyzed for ER stress markers.

Graph represents gene expression in myocytes co-cultured with adipocytes (black bars, AD+MYO)

compared to adipocytes alone (white bars, AD) and myocytes alone (grey bars, MYO).

Data (fold over control, AD) are presented as means ± SEM of 5 independent experiments.


5

Figure S4

A B

Cytotoxicity and inflammation in co-cultures and impact on myotubes thickness.

A-Muscle cells were differentiated in the 3D hydrogel for 3 days and then adipocytes (from VAT of

obese subjects) in another 3D hydrogel were added for an additional period of 1 day. Cytotoxicity was

evaluated by measuring the activity of lactate dehydrogenase (LDH) released from damaged cells. Graph represents LDH activity in differentiated myocytes co-cultured with adipocytes (black bars,

AD+MYO) compared to adipocytes alone (white bars, AD) or differentiated myocytes alone (grey

bars, MYO).

Data (fold over control, AD) are presented as means ± SEM of 5 independent experiments.

B- Muscle cells were differentiated in the 3D hydrogel for 3 days and then inflammatory adipocytes in

the 3D hydrogel were added for an additional period of 3 days. Media were then collected for the measurement of cytokine and chemokine secretion by a multiplex assay. Heatmap represents the

secretory profile. Graded shades from green to red represent the secretion levels (pg/ml). Cytokines

and chemokines were classified from high to low secretion. AD was used as control.



6

Figure S5

A.


7

B.


8

Muscle cells atrophy and inflammatory mediators IL-6/IL-1ββββ.

A- Muscle cells differentiated for 3 days were treated by IL-6 (10 ng/ml) and IL-1β (1 ng/ml) during 3

days. Cells were fixed and stained for desmin (thickness measurement) or titin (green, alexa488-conjugated anti-mouse IgG) and nuclei (blue, DAPI staining). Media were collected for IGF-II ELISA

assay.

Graph represents IGF-II secretion, myotube thickness and titin staining in muscle cells (white bar,

MYO) compared to muscle treated by recombinant IL-6 and IL-1β (black bar, MYO+IL-6/IL-1β).

B- Muscle cells were differentiated for 3 days and then 3D adipocytes (from VAT of obese subjects)

were added for an additional period of 3 days treated with IL-6 and IL-1β neutralizing antibody

(MYO+AD+Neut Ab) compared to co-cultures treated with IgG1 (control MYO+AD) in the 3D setting. Cells were fixed and stained for desmin (thickness measurement) or titin (green, alexa488-

conjugated anti-mouse IgG) and nuclei (blue, DAPI staining). Media were collected and analyzed for

IGF-II ELISA assay.

Graph represents myotube thickness and titin staining in muscle cells (MYO, white bar) or co-cultured

with VAT adipocytes (black bar, MYO+AD) compared to myocytes co-cultured with VAT adipocytes

in the presence of neutralizing antibodies (grey bar, MYO+AD+Neut Ab).

Data are presented as means ± SEM of 4-8 independent experiments.


9

Figure S6

Cell thickness, titin and troponin content in muscle cells treated by IgFII/IGFBP-5

Muscle cells were differentiated in the 3D hydrogel for 3 days before 3 additional days of treatment

with (MYO+IGF-II/IGFBP-5) or without (MYO) IGF-II (50ng/ml) and IGFBP-5 (200ng/ml). Cells

were fixed and stained with the corresponding antibodies. Immunostaining of titin (green, Alexa488-

conjugated anti-mouse IgG), troponin (red, Alexa555-conjugated anti-mouse IgG) and nuclei (blue,

DAPI) were performed. Representative photomicrographs are presented (scale bar = 50 µm). Myotube

thickness was quantified using Image J software in five random fields in 6 independent cultures.

Quantification of immunofluorescence was performed using Image J software measuring intensity of

the titin and troponin staining in five random fields in 6 independent cultures.


* p<0.05, MYO vs MYO+IGF-II/IGFBP-5.


10

Figure S7

G-CSF Fractalkine CXCL CCL7 IL-6 IL-8 CCL2 MIP-1�� VEGF

Inflammatory secretome of co-cultured muscle cells treated by IGF-II/IGFBP5.

Muscle cells were differentiated for 3 days and then 3D adipocytes (from VAT of obese subjects) were

added for an additional period of 3 days treated by IGF-II (50 ng/ml) and IGFBP5 (200 ng/ml) or not .

Media were then collected and analyzed for multiplex assay.

Graph represents the percentage variation in secretions in differentiated myocytes co-cultured with

adipocytes in the presence of IGF-II (50 ng/ml) and IGFBP5 (200 ng/ml) (black bars, % of

MYO+AD) compared to control co-culture of myocytes and adipocytes (MYO+AD).



11

Figure S8

Gene expression of atrophic markers in muscle cells exposed to VAT adipocytes.

Differentiated muscle cells were exposed to 3D adipocytes (from VAT of obese subjects) with or

without IGF-1 (10 ng/ml) or with IGF-II (50 ng/ml) and IGFBP5 (200 ng/ml). Gene expression of

atrogin-1 and murf-1 was estimated by real time PCR and normalized to 18S.

The graph represents gene expression in myocytes co-cultured with adipocytes (black bars,

MYO+AD) compared to myocytes alone (white bars, MYO) with IGF-I (dark grey bars, MYO+AD+IGF-I) or IGF-II/IGFBP-5 (light grey, MYO+AD+IGF-II/IGFBP-5).

Data (fold over control, MYO) are presented as means ± SEM of 6 independent experiments performed with different adipocytes preparations.

Atrogin-1 Murf-1


12

Figure S9

A

B


13

C

Gene expression profile of muscle, adipose and inflammatory markers in skeletal muscle of

obese mice

A-Gene expression profile in subcutaneous (SAT) and epididymal (GnAT) adipose tissue from 20-

week-old mice after 12 weeks of standard diet (chow, white bars) or High Fat Diet (HFD, black bars).


*p<0.05, **p<0.01, ***p<0.001, ns, non-significant, chow vs HFD mice in SAT and GnAT

###p<0.001, SAT vs GnAT during HFD

B-Gene expression in the Gastrocnemius of 24-week-old mice after 16 weeks of standard diet (chow,

white bars) or High Fat Diet (HFD, black bars).


*p<0.05, **p<0.01, ***p<0.001, ns, non-significant, chow vs HFD mice

C-Gene expression of adipose markers in the Gastrocnemius of 20-week-old mice after 12 weeks of

standard diet (chow, white bars) or High Fat Diet (HFD, black bars).



14

Supplementary tables

Table S1. List of the antibodies, recombinant proteins and ELISA kits used in the study

Antibody Reference Provider

anti-human MF-20 antibody MAB4470 Developmental Hybridoma Bank, Iowa City, IW, USA

anti-human emerin antibody NCL-emerin Leica, Newcastle, UK

anti-human desmin monoclonal antibody M076 DAKO, Glostrup, Dk

anti-human troponin monoclonal antibody T6277 Sigma, St Louis, Mo, USA

rabbit anti-human phospho-AKT (Ser473) mAb 4060 Cell Signaling Technology, Denvers, CO, USA

rabbit anti-human total-AKT mAb 9272 Cell Signaling

rabbit anti-human phospho-4E-BP1(Ser65) mAb174A9 Cell Signaling

rabbit anti-human total-4E-BP1 mAb 53H11 Cell Signaling

rabbit anti-human phospho- S6 ribosomal protein

(Ser240/244)

mAb D68F8 Cell Signaling

rabbit anti-human total- S6 ribosomal protein mAb 5G10 Cell Signaling

anti-rabbit IgG HRP-linked antibody P7074 Cell Signaling

mouse anti human IL-6 neutralizing monoclonal

antibody

MAB206 R&D Systems

mouse anti human IL-1β neutralizing monoclonal

antibody

MAB201 R&D Systems

Alexa 488-conjugated anti-mouse antibody A21202 Life Technologies, Foster City, CA, USA

Alexa 546-conjugated anti-rabbit antibody A22283 Life Technologies

phalloidin conjugate alexa®568 A22283 Molecular Probes, Eugene, Or, USA

anti-mouse conjugate alexa®488 A21202 Molecular Probes, Eugene, Or, USA

human recombinant protein IGF-II 292-G2-050 R&D Systems

human recombinant protein IGFBP-5 875-B5-025 R&D Systems

human recombinant protein IL-6 200-06 Peprotech ,Rocky Hill, NJ, USA

human recombinant protein IL-1β 200-01 Peprotech

human Insulin I91077C Sigma

ELISA assay for human IGF-II CSB-

E04583h

CUSABIO , Wuhan, P.R. China


15

Table S2. Clinical parameters of obese subjects

The obese subjects were not on a diet and their weights were stable before surgery. Regarding lean

subjects, none had diabetes and metabolic disorders and none was taking medication. Informed

personal consent was obtained from every participant. In obese subjects, body composition was

estimated by whole-body fan-beam dual energy X-ray absorptiometry scanning (Hologic Discovery

W, software v12.6, 2; Hologic, Bedford, MA) (1). To determine body fat and lean mass repartition, we

used specific measures and analyses as described (2). Blood samples were collected after an overnight

fast of 12 h. Glycaemia was measured enzymatically. Serum insulin concentrations were measured

using a commercial IRMA kit (Bi-insuline IRMA CisBio International, France). Serum leptin and

adiponectin were determined using a radioimmunoassay kit (Linco Research, St. Louis, MO),

according to the manufacturer's recommendations, sensitivity: 0.5 ng/ml and 0.8 ng/ml for leptin and

adiponectin respectively.

Data are presented as means ± SEM (standard error of the mean).

Obese subjects

Number of

subjects

41

Age (years) 41.6 ±1.5

BMI (kg/m2) 47.74 ±1.2***

% of fat mass 43.22 ±5.32

% of lean mass 48.34±1.23

Adipocyte

volume (pL)

800.7 ±94.6

Glycaemia

(mmol/L)

4.66 ±0.57

Insulinemia

(µU/mL)

15.39 ±2.65

HOMA-IR 3.75 ±0.65

Leptin

(ng/ml)

63.17 ±12.56

Adiponectin

( µg/mL)

4.52 ±0.87

IL-6

(pg/ml)

2.93±0.53


16

Table S3

List of primer sequences used for real-time PCR

Gene Forward Reverse

h ATF4 ggtcagtccctccaacaaca ctatacccaacagggcatcc

h C/EBPζ aaggcactgagcgtatcatgt tgaagatacacttccttcttgaaca

h HSPA5 agctgtagcgtatggtgctg aaggggacatacatcaagcagt

h IGF-II gctggcagaggagtgtcc gattcccattggtgtctgga

h IGFBP-5 agagctaccgcgagcaagt gtaggtctcctcggccatct

h irisin tcgtggtcctgttcatgtg ggttcattgtccttgatgatgtc

h PGCα tgagagggccaagcaaag ataaatcacacggcgctctt

h PGC1β ggcaggcctcagatctaaaa tcatgggagccttcttgtct

h RPLPO acagggcgacctggaagt ggatctgctgcatctgctt

h titin tggccacactgatggtctta tcctacagtcaccgtcatcg

m β-actin gctctggctcctagcaccat gccaccgatccacacagagt

m CCL2 ggctcagccagatgcagttaa cctactcattgggatcatcttgct

m IGF-II cgcttcagtttgtctgttcg gcagcactcttccacgatg

mIGFBP-5 aaagcagtgtaagccctccc tccccatccacgtactccat

m IL-6 gtctggaagactcgcctacg aagtgcatcatcgttgttcataca

m IL-1β agttgacggaccccaaaag agctggatgctctcatcagg

m leptin agcatccactgctatggtagc tcttctagtcccaagcattttgg

m myo D agcactacagtggcgactca ggccgctgtaatccatca

m myogenin ccttgctcagctccctca tgggagttgcattcactgg

m PGC1α gaaagggccaaacagagaga gtaaatcacacggcgctctt

m PGC1β ctccagttccggctcctc ccctctgctctcacgtctg

m titin ` gaggtgccgaagaaacttgt ttgggtgcttccggtactt

h, human; m, mice


17

Table S4. Spearman correlations between the gene expression of muscle markers in the

quadriceps muscle and the expression of leptin/IL-6 in both epididymal adipose tissue

and skeletal muscle.



Epididymal Adipose Tissue Quadriceps

Quadriceps

Fat mass % Leptin IL-6 Leptin IL-6

R p R p R p R p R p

MyoD -0.314 0.127 -0.414 0.063 -0.824 0.0001 -0.433 0.053 0.293 0.144

MyoG -0.203 0.225 0.050 0.428 -0.516 0.021 -0.091 0.366 0.462 0.037

β-Actin -0.232 0.193 -0.577 0.011 -0.643 0.004 -0.225 0.198 0.253 0.172

Titin -0.04706 0.8626 0.1059 0.6963 0.1947 0.47 0.4297 0.0967 -0.08824 0.7452

IGF-II -0.482 0.036 -0.489 0.033 -0.577 0.013 -0.320 0.120 0.207 0.229

IGFBP-5 -0.2412 0.3682 -0.2735 0.3053 -0.4248 0.101 -0.4032 0.1214 0.3176 0.2306

PGC-1α 0.041 0.441 0.279 0.147 -0.077 0.385 0.155 0.283 0.391 0.068

PGC-1β -0.124 0.324 -0.006 0.494 -0.086 0.373 -0.019 0.470 0.218 0.208


18

Table S5. Spearman correlations between the gene expression of muscle markers in the

Gastrocnemius muscle and the expression of leptin and IL-6 in inguinal AT.

Gastrocnemius

Inguinal Adipose Tissue

Leptin IL-6

r p r p

MyoD -0.7794 0.0004 -0.01071 0.9698

MyoG -0.2029 0.4510 0.3750 0.1684

β-Actin -0.5000 0.0486 -0.3250 0.2372

Titin -0.5 0.0577 -0.2352 0.4183

IGF-II -0.6588 0.0055 -0.1714 0.5413

IGFBP-5 -0.6747 0.0081 0.1484 0.6286

PGC-1α -0.03736 0.8991 0.5824 0.0367

PGC-1β -0.4250 0.1143 0.08132 0.7823




19

Supplemental list

List of the genes present in the “Human myogenesis and myopathy PCR array”

Skeletal Muscle Contractility: Dystrophin-Glycoprotein Complex: CAMK2G, CAPN3, CAV3, DAG1, DMD (Dystrophin),

DYSF, LMNA, MAPK1, SGCA.

Titin Complex: ACTA1, ACTN3, CAPN3, CRYAB, DES, LMNA, MAPK1, MSTN, MYH1,

MYH2, MYOT, NEB, SGCA, TNNI2, TNNT1, TNNT3, TRIM63 (MuRF1), TTN.

Energy Metabolism: CS, HK2, PDK4, SLC2A4 (GLUT4).

Fast-Twitch Fibers: ATP2A1, MYH1, MYH2, TNNI2, TNNT3.

Slow-Twitch Fibers: MB, MYH1, TNNC1, TNNT1.

Other: DMPK, IKBKB, RPS6KB1.

Skeletal Myogenesis: ACTA1, ADRB2, AGRN, BCL2, BMP4, CAPN2, CAST, CAV1,

CTNNB1, DMD, HDAC5, IGF1, IGFBP3, IGFBP5, MEF2C, MSTN, MUSK, MYF5,

MYF6, MYOD1, MYOG, PAX3, PAX7, PPP3CA (Calcineurin Aa), RHOA, RPS6KB1,

UTRN.

Skeletal Muscle Hypertrophy: ACTA1, ACVR2B, ADRB2, IGF1, IGFBP5, MSTN, MYF6,

MYOD1, RPS6KB1.

Skeletal Muscle Autocrine Signaling: ADIPOQ, FGF2, IGF1, IGF2, IL6, LEP, MSTN,

TGFB1.

Diabetes/Metabolic Syndrome: ADIPOQ, LEP, PPARG, PPARGC1A (PGC-1a),

PPARGC1B (PGC-1β), PRKAA1

(AMPK), PRKAB2, PRKAG1, PRKAG3, SLC2A4 (GLUT4).

Skeletal Muscle Wasting/Atrophy: Autophagy: CAPN2, CASP3, FBXO32 (Atrogin-1), FOXO1, FOXO3, MSTN, NOS2,

PPARGC1A (PGC-1α),

PPARGC1B (PGC-1β), RPS6KB1, TRIM63 (MuRF1).

Dystrophy: AKT1, AKT2, FBXO32 (Atrogin-1), IL1B, MAPK1, MAPK14, MAPK3,

MAPK8, MMP9, NFKB1, TNF,

TRIM63 (MuRF1), UTRN.


20

Supplemental references

1. Perlemuter G, Naveau S, Belle-Croix F, Buffet C, Agostini H, Laromiguière M, et al. Independent

and opposite associations of trunk fat and leg fat with liver enzyme levels. Liver Int. 2008

Dec;28(10):1381–8. 2. Ciangura C, Bouillot J-L, Lloret-Linares C, Poitou C, Veyrie N, Basdevant A, et al. Dynamics of

change in total and regional body composition after gastric bypass in obese patients. Obesity

(Silver Spring). 2010 Apr;18(4):760–5.


pellegrinelli v1,2,3#, rouault c1,2, 3, rodriguez-cuenca s ......2015/02/16 · 1 human adipocytes...

Documents