pellegrinelli v1,2,3#, rouault c1,2, 3, rodriguez-cuenca s ......2015/02/16 · 1 human adipocytes...
TRANSCRIPT
1
Human adipocytes induce inflammation and atrophy in muscle cells during obesity
Pellegrinelli V1,2,3#
, Rouault C1,2, 3
, Rodriguez-Cuenca S4, Albert V
1,2,3, Edom-Vovard
F5,6,7,8
,Vidal-Puig A4, Clément K
1, 2, 3*, Butler-Browne GS
5,6,7,8* and Lacasa D
1,2, 3*
1 - INSERM, U1166 Nutriomique, Paris, F-75006 France;
2 - Sorbonne Universités, University Pierre et Marie-Curie-Paris 6, UMR S 1166, Paris, F-
75006 France;
3- Institut Cardiométabolisme et Nutrition, ICAN, Pitié Salpétrière Hospital, Paris, F-75013
France;
4- Metabolic Research Laboratories, Wellcome Trust-MRC Institute of Metabolic Science,
University of Cambridge, Cambridge, United Kingdom;
5- Sorbonne Universités, University Pierre et Marie-Curie-Paris6, Centre de recherches en
Myologie UMR 974, F-75005, Paris, France;
6- INSERM, U974, 75013, Paris, France;
7- CNRS FRE 3617, 75013, Paris, France;
8- Institut de Myologie, 75013, Paris, France.
Key Words: muscle cells atrophy, visceral adipocytes, human obesity.
Running title: obese human adipocytes induce muscle cells atrophy
* These authors share senior co-authorship
# Corresponding author: Current address: Wellcome Trust-MRC Institute of Metabolic
Science, Metabolic Research Laboratories,University of Cambridge
e-mail address: [email protected]
Phone+44 (0)1223 336786
Fax: +44 1223 330598
Word count of body: 4568
Word count of abstract: 206
Number of figures/Tables: 7
Supplementary data
Page 2 of 58Diabetes
Diabetes Publish Ahead of Print, published online February 18, 2015
2
ABSTRACT
Inflammation and lipid accumulation are hallmarks of muscular pathologies resulting from
metabolic diseases such as obesity and type II diabetes. During obesity, the hypertrophy of
visceral adipose tissue (VAT) contributes to muscle dysfunctions particularly through
dysregulated production of adipokines.
We have investigated the crosstalk between human adipocytes and skeletal muscle cells to
identify mechanisms linking adiposity and muscular dysfunctions.
First, we demonstrated that the secretome of obese adipocytes decreased the expression of
contractile proteins in myotubes consequently inducing atrophy. Using a three-dimensional co-
culture of human myotubes and VAT adipocytes we showed the decreased expression of genes
corresponding to skeletal muscle contractility complex and myogenesis. We demonstrated an
increased secretion by co-cultured cells of cytokines and chemokines with IL-6 and IL-1β as key
contributors. Moreover, we gathered evidence showing that obese subcutaneous adipocytes were
less potent than VAT adipocytes in inducing these myotubes dysfunctions. Interestingly, the
atrophy induced by visceral adipocytes was corrected by IGF-II/IGFBP-5. Finally, we observed
that skeletal muscle of obese mice displayed decreased expression of muscular markers in
correlation with VAT hypertrophy and abnormal distribution of the muscle fiber size.
In summary, we show the negative impact of obese adipocytes on the muscle phenotype that
could contribute to muscle wasting associated with metabolic disorders.
Page 3 of 58 Diabetes
3
INTRODUCTION
During obesity, hypertrophy of white adipose tissue (WAT) is associated with fibro-inflammation
and cell dysfunctions. However, visceral depot (VAT) differs from subcutaneous (SAT) by its
inflammatory status due to its high infiltration with immune cells such as macrophages, T
lymphocytes and mast cells (1,2). Hence, VAT hypertrophy is considered an important
contributor to obesity related metabolic and cardiovascular diseases (3). In obese subjects,
hypertrophied adipocytes display abnormal secretion of leptin and adiponectin, an increased
production of numerous inflammatory cytokines and chemokines, leading to a disrupted inter-
organ communication between VAT and important metabolic peripheral tissues such as liver and
skeletal muscle (4). These organs are particularly exposed to free fatty acids and cytokines,
mostly IL-6, increasingly released by visceral fat of obese subjects (5,6). Skeletal muscles are one
of the major metabolic tissues of the body, playing a pivotal role in glucose and lipid metabolism.
There is growing body of evidence showing the contribution of obesity on skeletal muscle
dysfunctions, such as the development of insulin resistance, as attested by numerous studies
performed in rodent models of obesity (7,8). Thus, it has been shown that obese rats display
impaired activation of skeletal muscle protein synthesis in response to chronic lipid infiltration
(9). Ectopic lipid storage in muscle (e.i. within muscle cells and/or in adipocytes located between
muscle fibers) represents a negative risk factor for development of type 2 diabetes related to
muscle insulin resistance (10–13). Moreover, skeletal muscle of obese subjects also displays an
impairment in oxidative capacity (14) and abnormal muscle fiber organization (15,16). Increased
amount of VAT in obesity has been proposed to link obesity and muscle metabolic alterations,
such as insulin resistance. Surgical removal of VAT in rats leads to reduction of systemic
concentrations of cytokines (e.g. IL-6, Fractalkine resistin) and improvement of skeletal muscle
Page 4 of 58Diabetes
4
insulin sensitivity (17). Particularly, adipocytes have been identified as potential effectors of
muscle cells dysfunctions. Co-culture system previously showed impact of adipocytes on muscle
cells insulin resistance and oxidative capacity (18–20). However, the impact of VAT adipocytes
on muscle structural organization and the molecular factors involved remains elusive.
Inflammatory mediators act synergistically to negatively impact regeneration capacity and insulin
sensitivity in muscle (7). For example, IL-6 is overproduced by hypertrophied adipocytes and its
systemic concentration is increased in obesity. Increased IL6 is associated with altered insulin
signalling in myotubes and impaired myoblast differentiation/proliferation capacity leading to
muscle atrophy (7,8). At the molecular level, IL-6 with IL-1β down-regulate IGFs/Akt signalling
decreasing muscle protein synthesis (21). Excessive production of various mediators by obese
VAT adipocytes could trigger a cross-talk with muscle cells, altering the production of myokines
(22) which could affect in turn VAT endocrine functions. This cross-talk associated with an
inflammatory microenvironment could be deleterious in perpetuating a vicious cycle leading to
muscle loss and wasting. To address this question, the secretome of obese adipocytes was tested
on human primary muscle cells and direct co-cultures were performed.
The main aim of our study was to identify the major contributors of VAT adipocytes/skeletal
muscle crosstalk and their role in inducing muscle atrophy and inflammation, common disorders
associated with metabolic pathologies such as obesity and type 2 diabetes (4).
Research Design and Methods
The antibodies and recombinant proteins used in the study are listed in Table S1.
Mice studies
Page 5 of 58 Diabetes
5
C57BL/6N male mice were purchased from Charles River. Standard chow or 58 kcal% fat
w/sucrose Surwit Diet (HFD, D12331, Research Diets) was given ad libitum to animals. Dietary
intervention started at 8 weeks of age and continued for 12 or 16 weeks (n=8-9 per experimental
group). The detailed procedures of the mice studies are provided in (23). Adipose tissues and
skeletal muscles from 12 weeks chow/HFD mice (RNA extraction) and Gastrocnemius muscle of
16 weeks chow/HFD mice (histological analysis) were prepared as described in (23,24). Muscle
fiber cross-section size (up to 201 muscle fibers/section) was automatically evaluated by
determination of the Feret’s diameter (Image J software) in 3 independent fields in each section.
The variance coefficient of the Feret’s diameter was defined to evaluate the muscle fiber size
variability between the experimental groups of mice and avoid experimental errors such as the
orientation of the sectioning angle (25). Number of intermuscular adipocyte spots was assessed
visually in the total longitudinal section biopsy.
Human studies
Subcutaneous (SAT) and VAT biopsies were obtained from morbid obese subjects (body mass
index, BMI>40 kg/m2) (clinical parameters in Table S2) and SAT biopsies from lean female
subjects (BMI<25 kg/m2) undergoing elective surgery. None of the lean subjects had diabetes or
metabolic disorders, and none were taking medication. All clinical investigations were performed
according to the Declaration of Helsinki and approved by the Ethical Committee of Hôtel-Dieu
Hospital (Paris, France).
Isolation of mature adipocytes from human WAT and preparation of the 3D adipocyte
cultures
Page 6 of 58Diabetes
6
Tridimensional gels were prepared with mature adipocytes isolated from WAT of lean (SAT) or
obese (SAT and VAT) subjects as described in (26,27). Adipocytes were embedded in the
hydrogel (Puramatrix, BD Biosciences, Bedford, MA, USA). Hydrogel was diluted in 20%
sucrose solution at a concentration of 1x 105cells per 1mL of gel preparation into 24-well plates
containing 1.5ml of DMEM/F12 (1% bovine albumin, 1% antibiotics). Culture medium was
changed after 1h with fresh medium containing human insulin (50 nM). Adipocytes from SAT or
VAT were incubated for 48h before collecting the conditioned media referred as lean SAT CM
(lean SAT adipocyte conditioned media) and obese SAT/VAT CM (obese SAT/VAT adipocyte
conditioned media), respectively. Samples were kept at -80°C prior experimental measurements.
Myoblast cultures, differentiation to myotubes and treatment with adipocyte conditioned
media
We used the human primary satellite cells (CHQ5B) originally isolated from the quadriceps of a
newborn child without indication of neuromuscular disease as previously described (28). The
cells were cultivated in a growth medium consisting of 4V DMEM, 1V M199 supplemented with
50 µg/ml of gentamycin and 20% FBS. Cells were plated in 24 well-plates at a density of 1500
cells per cm2. Differentiation was induced at sub-confluence by replacing the growth medium
with differentiation medium (DMEM supplemented with 50 µg/ml of gentamycin and 10 µg/ml
human insulin) (29). After 5 days of differentiation, the medium was replaced for 48h with
control DMEM/F12 culture medium or conditioned media from either adipocytes from lean SAT
(lean SAT CM ) or adipocytes from obese SAT/VAT (obese SAT/VAT CM). Then, the medium
was exchanged for fresh medium, for 24 h before being collected and stored at -80 C.
Quantification of the fusion index and measurement of myotube thickness
Page 7 of 58 Diabetes
7
Muscle cells were allowed to differentiate in serum-free medium for 6 days in the presence of
lean SAT CM or obese SAT/VAT CM. After fixation with 4 % paraformaldehyde, the cells were
incubated with an antibody specific for desmin. Specific antibody binding was revealed using an
Alexa-488 coupled goat anti mouse secondary antibody. Nuclei were visualized with Hoechst
staining.
The efficiency of the fusion was assessed by counting the number of nuclei in myotubes (>2
myonuclei) as a percentage of the total number of nuclei (mononucleated and plurinucleated).
This percentage was determined by counting 1000 nuclei per dish on three independent cultures.
Myotubes thickness was quantified with Image J software measuring intensity of the desmin
staining in ten random fields (X10) from three independent cultures.
The counting was performed with blind lectures by two different investigators (VA and FEV).
Direct co-cultures of primary adipocytes and differentiated myoblasts in 3D hydrogels
Muscle cells were embedded in hydrogel prepared as below, at a concentration of 200.000 cells
per 100µl of gel preparation containing 0.5 mg/ml collagen type 1 (BD Biosciences). The gel
preparation was put into 96-well plates containing 150 µl of growth medium. After 2 days in
culture, this medium was replaced by differentiating medium for 3 days. We then added to this
preparation a second hydrogel containing mature adipocytes isolated from VAT or SAT from
obese subjects (10.000 cells per 100 µl of gel preparation). Adipocytes and differentiated
myoblasts were then co-cultured for 24h or 3 days in DMEM/F12 (1% antibiotics and 50 nM
insulin).
Secretory function analysis and serum biochemistry
Page 8 of 58Diabetes
8
Adipokine secretions were evaluated by ELISA assay, using secretory medium from 24h-cultures
of 3D adipocytes (leptin, adiponectin) (Duoset, R&D Systems). Concentrations of human
cytokines were determined in either conditioned media from adipocytes, myotubes or co-cultures
using human cytokine/chemokine Panel I 41plex from Millipore (Billirica, MA, USA) as
previously described in (30). IGF-II levels were measured by ELISA assay in CM from myotubes
co-cultured or not with 3D adipocytes during 48h incubation. Serum levels of the murine
cytokines IL-6, IL-1 β, IL-10 and TNFα were analyzed using the MSD 7-plex mouse
proinflammatory cytokine high sensitivity kit (product code K15012C-2, MesoScale Discovery
(Gaithersburg, MD, USA) on the MesoScale Discovery Sector 6000 analyzer. Results were
calculated using the MSD Workbench software package. Lower limit of detection were the
following: CXCL1/2/3 (3.3 pg/ml), IL-10 (5.0 pg/ml), IL-1β (2.3 pg/ml), IL-6 (16.8 pg/ml) and
TNFα (0.9 pg/ml).
Neutralizing experiments and treatment by recombinant proteins
Myotubes alone or co-cultured cells were treated with IgG1 (3µg/mL) (MYO IgG, and
MYO+AD IgG) or with IL-6 (2.5µg/mL) and IL-1β (0.5µg/mL) neutralizing antibodies (MYO
abIL-6/IL-1β, MYO+AD abIL-6/IL-1β) during 3 days with renewal every day. Human
recombinant IL-6 (10 ng/ml) and IL-1β (1ng/ml) were added to myotubes cultured in the
hydrogel for 3 days with renewal every day. In another set of experiments, myotubes and co-
cultured cells were treated with IGF-II (50 ng/ml) and IGFBP-5 (200 ng/ml), when indicated, for
3 days with every day change. After this period, cells and media were collected for
immunofluorescence and multiplex analysis, respectively.
Immunofluorescence analysis and confocal microscopy
Page 9 of 58 Diabetes
9
After fixation in 4 % paraformaldehyde, cells were processed for immunofluorescence analysis.
These samples were incubated with the appropriate primary antibody (overnight et 4°C), and then
the corresponding Alexa488-conjugated anti-mouse IgG or Alexa546-conjugated anti-rabbit IgG
interspaced by multiple washes in PBS, and followed by mounting coverslips. Sample
examinations were performed at the imaging platform (CICC, Centre de Recherches des
Cordeliers, Paris, France) using a Zeiss 710 confocal laser scanning microscope (Carl Zeiss, Inc.,
Thornwood, NY, USA) fitted with a LD LCI Plan-Apochromat oil-immersion objective 25x or
63X. Images were captured and analyzed with ZEN 2009 imaging software (Carl Zeiss, Inc.).
Western blot analysis:
Total cell extracts were prepared in a buffer containing a cocktail of protease and phosphatase
inhibitors (Roche Diagnostics, Mannheim, Germany) and were analyzed as previously described
(26). Apparent molecular sizes were estimated by using the SeeBlue® Plus2 Pre-Stained Protein
Standard (Life Technologies, Foster City, CA, USA) as indicated on immunoblots.
RNA preparation and PCR array
Muscle cells and adipocytes co-cultured in the 3D scaffolds were processed for RNA extraction
using the RNeasy RNA mini kit (Qiagen, Courtaboeuf, France). After reverse transcription of the
total RNAs (1 µg), samples were analyzed by i) real time PCR and ii) PCR array using the “
Human myogenesis and myopathy PCR array” according to manufacturer’s instructions
(Qiagen). Table S3 presents the list of the primers used. Data were normalized according to the
RPLPO gene expression. Supplementary list presents the functional classification of the genes in
the “Human myogenesis and myopathy PCR array”.
Page 10 of 58Diabetes
10
Statistical analysis
The experiments were performed at least three times, using adipocytes from different human
subjects. Statistical analyses were performed with GraphPad Software (San Diego, CA, USA).
Values are expressed as means ± SEM of (n) independent experiments performed with different
adipocyte preparations. Comparisons between the two conditions in the in vitro experiments
(adipocytes and adipocytes/myotubes cultures) and in vivo studies (chow and HFD mice) were
analyzed using the Wilcoxon non parametric paired test. Comparisons between more than two
groups were carried out using one way analysis of variance (ANOVA) followed by post-hoc
tests. Spearman coefficients were calculated to examine correlations. Differences were
considered significant when p<0.05.
RESULTS
Adipocyte secretions from obese VAT provoke muscle cells dysfunctions
Obesity and associated metabolic disorders such as type 2 diabetes are associated with muscle
dysfunctions characterized by inflammation and fat deposition (7). The muscle alterations are
associated with insulin resistance in link with an increase of visceral fat mass (10,20,31). We
sought to establish whether SAT/VAT from obese subjects could directly contribute to the
harmful phenotype observed in the muscle of these patients. Here, we take advantage of a well
characterized cohort of severe obese subjects showing chronic inflammation and marked insulin
resistance (1,32), as shown in Table S2.
Initially, we characterized the secretome of conditioned media from SAT and VAT adipocytes
(obese SAT CM and obese VAT CM, respectively) obtained from obese subjects and the media
Page 11 of 58 Diabetes
11
obtained from the adipocytes isolated from SAT of healthy lean subjects as control (lean SAT
CM). As expected, low adiponectin secretion was observed in obese SAT and VAT adipocytes
compared to lean SAT ones (Figure S1A). We observed that the secretome of VAT adipocytes
exhibited a pro-inflammatory profile with high levels of several cytokines (IL-6 and G-CSF),
chemokines (IL-8, CCL2, CCL5 and CXCL1/2/3) as well as the growth factor FGF-2, compared
to SAT adipocytes from either lean or obese subjects (Figure S1A-B). Adipocytes from obese
SAT presented an intermediary inflammatory profile between lean SAT and obese VAT.
For this reason, we focused on obese VAT adipocytes and explored the impact of conditioned
media (VAT CM) on myotubes morphology and contractile protein expression, in comparison to
conditioned media from lean SAT adipocytes (lean SAT CM). We observed that myotubes were
thinner in the presence of obese VAT CM than control and lean SAT CM conditions as estimated
after immunofluorescence staining with desmin (a major component of muscle cell architecture
and contractility), which was also significantly lower in myotubes treated with obese VAT CM
than with lean SAT CM (-20%, p<0.01) (Figure 1A-B). The number of nuclei in the
differentiated cultures was not modified by the two conditioned media (Figure 1C). Western blot
analysis showed that the myosin heavy chain (MF20) and troponin, two major components of the
contractile apparatus in skeletal muscle, were also significantly decreased for both proteins in the
presence of obese VAT CM compared to control and lean SAT CM conditions (Figure 1D). If
lean SAT seems to impact myotube thickness and protein content, this was not statistically
significant and remains much lower than the effect of obese VAT CM. These data suggest that
the secretome of obese VAT adipocyte decrease myogenic capacity of the skeletal myoblasts.
VAT adipocytes directly induce muscle cells atrophy in a 3D scaffold
Page 12 of 58Diabetes
12
We then examined the effect of obese SAT and VAT adipocytes on skeletal muscle cells by using
3D co-cultures. Mature adipocytes and muscle cells were then embedded in separate hydrogels
(Figure S2A-B), previously characterized by the ability to maintain altered functions of obese
adipocytes (26). Direct co-cultures of human cells in a 3D setting are of great value because they
allow the study of a complex set from adipocyte-derived signals that regulate skeletal muscle
functions without confounding effects of other organ systems, while maintaining signals
including labile diffusible factors. The human myoblast differentiation and fusion processes were
not modified by cultivation in this 3D scaffold compared to 2D cultures (see MF20 and DAPI
staining, Figure S2C).
We used a skeletal muscle specific PCR array to determine the effects of the obese VAT
adipocytes on the expression of the muscle-specific genes. Among the set of 86 genes screened
on the array, we detected significant under-expression of 10 genes in the muscle cells exposed to
obese VAT adipocytes. Especially, we found decreased level of myogenic transcription factors,
MyoD1 and Myogenin (MYOG), the growth factor IGF-II and its binding partner IGFBP-5, the
sarcomeric protein titin (TTN), a member of the dystrophin complex, α sarcoglycan (SGCA), the
muscle-specific protein of caveolae, caveolin-3 (CAV-3) and an important component of the
neuro-muscular junction, the muscle-specific kinase (MuSK) (Figure 2A). It should be noted
that ER stress and cytolysis pathways were not detected in the co-cultured cells as assessed from
expression of ER stress markers (ATF4, HSPA5 and C/EBPζ) and lactate dehydrogenase
activity, respectively (Figures S3 and S4A).
By confocal analysis, we confirmed decreased expression of titin at protein level in myotubes
induced by VAT adipocytes (Figure 2B). Moreover, myotubes exposed to VAT adipocytes
Page 13 of 58 Diabetes
13
showed a reduced striated staining for titin suggesting a disturbed internal sarcomeric structure
(Figure 2C).
Importantly, when compared to obese VAT adipocytes, obese SAT adipocytes appeared less
potent in inducing muscle cell atrophy as seen from myotube thickness and staining of troponin
and titin (Figure 2D-F).
Next, we quantified the levels of inflammation-related proteins using a multiplex “human
cytokines/chemokines” approach. Among the 41 screened proteins, 12 were significantly
detected in VAT adipocytes and myocytes (level >15 pg/ml). CCL2, IL-8, CXCLs, G-CSF, IL-6
and VEGF were highly secreted by the co-cultured cells compared to VAT adipocytes grown
alone in hydrogel (Figure S4B). For most of these inflammatory proteins, secretion was increased
in an additive manner in the presence of myotubes and adipocytes. Moreover, a synergistic affect
was observed for G-CSF (75-fold, p<0.05), IL-6 (25-fold, p<0.05) and CCL7 (10-fold, p<0.01)
(Figure 3A). As observed above for muscle cell atrophy, adipocytes from obese SAT provoked a
lower inflammatory status than those from obese VAT in the co-cultured cells (Figure 3B-C).
Considering the marked inflammatory profile of VAT adipocytes from obese subjects and their
potent impact on muscle cell phenotype compared to lean and obese SAT ones, we then focus on
the cross talk between muscle cells and obese VAT adipocytes.
IL-6 and IL-1ββββ have relevant role in inflammation of myotubes/adipocytes
We tested the role of two pro-inflammatory cytokines IL-6 and IL-1β, as drivers of myotubes
inflammation observed in co-cultures based on previous reports (26,33,34). After 3 days of
culture, in the presence of the neutralizing IL-6/IL-1β antibodies, the inflammatory response of
Page 14 of 58Diabetes
14
co-cultured cells was reduced with decreased levels of G-CSF (-71.4%), Fractalkine (-58%), IL-7
(-56%) and the chemokines CXCL1/2/3 (-53%), CCL7 (-42%), IL-8 (-43.5%), IP-10 (-36%) and
CCL5 (-38%,) (Figure 3D). To further confirm the role of IL-6/IL-1β, we treated myotubes with
human recombinant IL-6 and IL-1β which showed marked increased secretion of inflammatory
molecules such as G-CSF (~6000-fold), CXCL1/2/3 (~100-fold) and IL-8 (~100-fold) (p<0.001)
(Figure 3E). These results indicate the key role played by the cytokines IL-6 and IL-1β in the
inflammatory environment of the co-cultured cells. Strikingly, the combination of recombinant
IL-6/IL-1β or antibody neutralization of endogenous IL-6/IL-1β failed to influence myotube
thickness and titin staining (figure S5) suggesting an independent relationship between
inflammation and the atrophic phenotype observed in our experimental conditions.
IGF-II and IGFBP-5 correct the myotubes atrophy induced by obese VAT adipocytes
As shown in Figure 2A, myotubes co-cultured with obese VAT adipocytes displayed a decreased
expression of IGF-II and its binding partner IGFBP-5 known to synergically promotes myogenic
action (35). In 3D cultures of myocytes, 3 days treatment with human recombinant IGF-II (50
ng/ml) and IGFBP-5 (200 ng/ml) impacts muscle cells by increasing titin content (Figure S6). We
then tested the potential correction of the atrophic phenotype of myotubes co-cultured with VAT
adipocytes. Interestingly, chronic treatment with IGF-II and IGFBP-5 corrected the atrophic
aspect of the co-cultured myotubes through increased thickness (Figure 4A) and production of
both titin and myosin heavy chain (Figure 4B-D).
However, chronic treatment with IGF-II/IGFBP-5 failed to decrease the inflammatory secretome
of the co-cultured cells (Figure S7). Conversely, co-cultured cells treated by neutralizing
Page 15 of 58 Diabetes
15
antibodies for IL-6 and IL-1β or treatment of myotubes by recombinant IL-6 and IL-1β did not
influence the production of IGF-II (Figure S5A).
Down-regulation of the signaling pathways controlling protein synthesis in myotubes
exposed to VAT adipocytes.
Skeletal muscle mass is determined by the balance between protein synthesis and degradation.
The rate of protein synthesis is, at least in part, finely controlled by the PI3K/Akt/mTOR
signaling pathway, activated by IGFs and amino acids (36). Here, we assessed the IGF-II/IGFBP-
5 activation of this pathway in co-cultured atrophic myotubes by measuring the phosphorylation
status of direct targets, Akt, p70S6K and 4E-BP1. We showed a reduction of basal
phosphorylation of Akt, S6K and 4E-BP1 in co-cultured myotubes compared to control ones as
well as reduced AKT phosphorylation in response to IGF-II/IGFBP-5 (Figure 4E-F), suggesting
that signalling pathways (Akt/S6K/4E-BP1) controlling protein synthesis are down regulated in
co-cultured muscle cells. Conversely, the gene expression of two atrophy-related ubiquitin
ligases, atrogin-1 and murf-1, remained unchanged in muscle cells exposed to VAT adipocytes
and not influenced by IGF-II/IGFBP-5 (Figure S8). Overall, our data suggest that the atrophy
phenotype is likely related to decreased synthesis of muscle proteins.
Diet-induced obesity induces muscle atrophy in association with epididymal WAT hypertrophy
and accumulation of intermuscular adipocytes in mice models.
In order to validate in vivo the relevance of the molecular candidates identified from our 3D co-
cultures, we used a diet-induced obese mouse model and screened expression of
inflammatory/muscle markers in their skeletal muscles. After 12 weeks of HFD, mice displayed
WAT and systemic inflammation with a global decrease in gene expression of muscular markers
such as MyoD (-76%), IGF-II (-58%), β-actin (-43%) and PGC-1β (-30%) in the Gastrocnemius
Page 16 of 58Diabetes
16
muscle (Figure 5A-B, Figure S9A). Conversely, expression of the inflammatory markers IL-1β
and CCL2 was significantly increased: 1.7 fold (p=0.0415) and 1.5 fold (p=0.0361), respectively.
In addition, the expression of skeletal muscle markers such as MyoD and IGF-II was negatively
correlated with increased fat mass (% fat mass and leptin expression) and inflammation in
epididymal WAT (IL-6 expression) (Table 1 and Table S4). However, we did not find any
correlations between IL-6 expression in inguinal WAT and skeletal muscle markers, highlighting
the specificity of the crosstalk between muscle and the VAT depots (Table S5). Finally,
histological analysis of the Gastrocnemius of obese mice revealed pathological changes generally
observed in muscle of dystrophic mice (25) with abnormal distribution of the muscle fiber size in
cross-section samples (increased co-variance coefficient of Feret’s diameter) and adipocytes
accumulation (Figure 5C-E, Figure S9B). Accordingly, we observed in obese mice muscle an
increased expression of adipocyte markers (i.e. leptin and FABP-4) in muscle reflecting increased
fat infiltration (Figure S9C). Interestingly, the expression of MyoD, IGF-II and β-actin in skeletal
muscle was negatively correlated with leptin expression in epididymal WAT and skeletal muscle
(Table 1). These results suggest a potential relationship between adipocyte accumulations and
muscle structure and dysfunction.
Discussion
We studied the adipocyte/muscle cell cross-talk participating in the complex inter-tissular
network of hypertrophied WAT with skeletal muscle. Here, using a 3D co-culture system, we
provide evidence in vitro that adipocytes from obese VAT induce muscle cells inflammation and
atrophy by decreasing the expression of contractile proteins such as troponin, titin and myosin
heavy chain. Importantly, we showed that in obese states, VAT adipocytes are more potent than
their SAT counterparts in provoking deleterious effects in muscle cells such as atrophy and
Page 17 of 58 Diabetes
17
inflammation. These observations are probably linked to differences in the lineage specificity
and tissular environment characterizing these two depots (1,2,37,38).
Co-culture systems have been developed during the last decade to study the cross-talk between
adipose tissue and muscle, particularly focusing on the impact of adipocytes on muscle insulin
resistance and glucose uptake. Co-cultures of human in vitro differentiated preadipocytes with
skeletal muscle cells induce the insulin resistance of the latters (19) with impact on oxidative
metabolism (20). Here we have used mature (i.e. unilocular) adipocytes isolated from human
subjects. These cells display high metabolic (lipolytic activity) and secretory (production of leptin
and adiponectin) functions when compared to in vitro differentiated preadipocytes. We believe
that the results obtained using this 3D setting with mature adipocytes may be more patho-
physiologically relevant than previous studies using 2D co-culture with primary human
myoblasts (18–20,39). In addition this system allowed a long-term survey of muscle cells
functions addressing the original question of the impact of obese VAT adipocytes on
inflammation and myotubes structural organization.
Our results reveal that co-cultures of obese VAT adipocytes with muscle cells enhanced the pro-
inflammatory environment with increased production of several cytokines (IL-6 and G-CSF) and
chemokines (CCL2, IL-8, CXCL1/2/3, CCL7 and Fractalkine). More importantly, we have clearly
identified IL-6 and IL-1β playing key roles in this inflammatory loop. These cytokines which act
in concert in various inflammatory processes are over-produced by adipose tissue during obesity
and type 2 diabetes (40,41).
Muscles cells are characterized by their contractile capacity, a phenomenon depending of tissue
physical properties. The hydrogel used in the present study is soft (~300 Pa, compared to skeletal
Page 18 of 58Diabetes
18
muscle or culture well plates (~12kPa and ~100 kPa respectively, (42)), limiting the analysis of
myotubes contractility in our 3D co-cultures. However, in this 3 D model maintaining adipocyte
viability, we were able to demonstrate a major role of obese VAT adipocytes on inducing muscle
cell atrophy phenotype. The myogenic program is controlled by transcription factors such as
MyoD and myogenin. Binding of these factors to specific sequences in the promoter of muscle-
specific genes increases the expression of contractile proteins such as myosin heavy chain,
tropomyosin, troponin (43,44) and titin, which maintains sarcomere integrity (45). At the
molecular level, we observed the down-regulation of MyoD, myogenin, and
contractile/sarcomeric proteins (titin) and the dystrophin complex in myotubes co-cultured with
the obese VAT adipocytes. These data provide new insights about which proteins are
preferentially targeted and participate to the atrophic phenotype of the muscle cells when co-
cultured in this 3D setting.
In addition to the decreased gene expression of muscle specific structural proteins, we also
observed a decreased expression of the growth/myogenic factor IGF-II and its binding partner
IGFBP-5 (35). IGF-II shares with IGF-I the same receptor and protein signaling pathway
(Akt/mTOR/p70S6) which mediates hypertrophy in skeletal muscle (21). Importantly, the acute
activation by IGF-II/IGFBP-5 of this pathway, in particular Akt phosphorylation, was altered in
myotubes exposed to obese VAT adipocytes, which could be responsible for the observed muscle
cell atrophy phenotype. This is supported by the observations that chronic treatment by IGF-II
and IGFBP-5 were able to correct the muscle atrophy phenotype and restore titin and myosin
heavy chain production in the co-cultured myotubes while having a minor influence on myotube
phenotype alone in control conditions.
Page 19 of 58 Diabetes
19
Finally, the patho-physiological relevance of our results was further supported in a rodent model
of nutritionally induced obesity. Obese mice displayed abnormal distribution of cross-section
muscle fiber size, adipocyte accumulation and decreased muscle markers expression.
Interestingly, expression of the muscle markers (i.e. MyoD, β-Actin, Titin, IGF-II and IGFBP-5)
were negatively correlated with inflammation and epididymal fat expansion. We cannot exclude
in our in vivo model, an additional role of the liver in promoting muscle dysfunctions. According
to the “portal hypothesis”, the liver is directly exposed to VAT-derived factor which may induce
inflammation, causing then skeletal muscle defects such as insulin resistance (46). Moreover,
correlative observations made in skeletal muscle need further studies to firmly establish a
potential role of intermuscular adipocytes in muscle dysfunctions.. Several clinical studies
suggest that muscle-derived adipocytes through secretion of bio-active factors could play a role in
muscle deteriorations by inducing insulin-resistance and negatively affecting myogenesis and
muscle performance (13,31,47). Moreover, a recent report showed a potential link between
obesity-induced lipotoxicity and muscle insulin resistance through disruption of 4E-BP1
phosphorylation and protein synthesis (48). Consequently, future goal will be to compare both
VAT and intermuscular adipocytes phenotypes; the latter still remains unknown.
To conclude, we provide evidence for a cross-talk between human obese adipocytes and muscle
cells leading to muscle atrophy (Figure 6). The subset of under-expressed muscle-specific genes
could constitute a molecular signature of muscle damage induced by hypertrophy of obese WAT.
The identification of negative (IL-6/IL-1β) and beneficial (IGF-II/IGFBP-5) molecular actors
involved in these dysfunctions open new avenues for therapeutic strategies of myopathies
associated with metabolic disorders.
Page 20 of 58Diabetes
20
Author contributions
VP, SRC and DL conceived and performed the experiments and analyzed the data.
CR performed and analyzed multiplex and PCR array experiments.
FEV and VA performed muscle cell culture.
KC contributed to clinical investigation and patients recruitment.
VP, KC, SRC, AVP, GBB and DL wrote the manuscript with the input of all the co-authors.
GBB and DL are the guarantors of this work, such as, had the full access to all data in the study
and take the responsibility for the integrity of the data and the accuracy of the data analysis.
Acknowledgments
The authors are very grateful to Dr Peter Van Der Ven (Institut for Cell Biology, Bonn,
Germany) for providing us the anti-human titin monoclonal antibody. We acknowledge patients,
the physician Dr Christine Poitou of the Nutrition Department of Pitié Salpétrière (Paris, France)
for patients’ recruitment. We also thank Christophe Klein from imaging facilities of Centre de
Recherches des Cordeliers. For cellular studies, ethical authorization was obtained from CPP
Pitié Salpêtrière. Human adipose tissues pieces were obtained thanks to Clinical Research
Contract (Assistance Publique/Direction de la Recherche Clinique AOR 02076).
Fundings
This work was supported by a grant from the European Community seventh framework program,
Adipokines as Drug to combat Adverse Effects of Excess Adipose tissue project (contract
number HEALTH-FP2-2008-201100), APHP Clinical Research Contract, Emergence program,
University Pierre et Marie Curie (to VP), Région Ile de France (FUI-OSEO Sarcob), the
Page 21 of 58 Diabetes
21
Fondation pour la Recherche Médicale, grant number “DEQ20120323701” (to KC) as well as
French National Agency of Research (French government grant, Investments for the Future”;
grant no. ANR-10-IAHU, ANR AdipoFib). This work was also financed by the EU FP7
Programme project MYOAGE (contract HEALTH-F2-2009-223576), the ANR Genopath-
INAFIB, the AFLD, the CNRS and the AFM (Association Française contre les Myopathies).
SRC and AVP are supported by MRC and BHF programme grants.
Disclosure statement:
No conflicts of interest to this article are reported.
Page 22 of 58Diabetes
22
REFERENCES
1. Cancello R, Tordjman J, Poitou C, Guilhem G, Bouillot JL, Hugol D, et al. Increased
infiltration of macrophages in omental adipose tissue is associated with marked hepatic lesions in
morbid human obesity. Diabetes. 2006 Jun;55(6):1554–61.
2. Villaret A, Galitzky J, Decaunes P, Estève D, Marques M-A, Sengenès C, et al. Adipose
tissue endothelial cells from obese human subjects: differences among depots in angiogenic,
metabolic, and inflammatory gene expression and cellular senescence. Diabetes. 2010
Nov;59(11):2755–63.
3. Jensen MD. Role of body fat distribution and the metabolic complications of obesity. J
Clin Endocrinol Metab. 2008 Nov;93(11 Suppl 1):S57–63.
4. Harwood HJ Jr. The adipocyte as an endocrine organ in the regulation of metabolic
homeostasis. Neuropharmacology. 2012 Jul;63(1):57-75.
5. Rytka JM, Wueest S, Schoenle EJ, Konrad D. The portal theory supported by venous
drainage-selective fat transplantation. Diabetes. 2011 Jan;60(1):56–63.
6. Fontana L, Eagon JC, Trujillo ME, Scherer PE, Klein S. Visceral fat adipokine secretion
is associated with systemic inflammation in obese humans. Diabetes. 2007 Apr;56(4):1010–3.
7. Kewalramani G, Bilan PJ, Klip A. Muscle insulin resistance: assault by lipids, cytokines
and local macrophages. Curr Opin Clin Nutr Metab Care. 2010 Jul;13(4):382–90.
8. Akhmedov D, Berdeaux R. The effects of obesity on skeletal muscle regeneration. Front
Physiol. 2013;4:371.
9. Masgrau A, Mishellany-Dutour A, Murakami H, Beaufrère A-M, Walrand S, Giraudet C,
et al. Time-course changes of muscle protein synthesis associated with obesity-induced
lipotoxicity. J Physiol (Lond). 2012 Oct 15;590(Pt 20):5199–210.
10. Boettcher M, Machann J, Stefan N, Thamer C, Häring H-U, Claussen CD, et al.
Intermuscular adipose tissue (IMAT): association with other adipose tissue compartments and
insulin sensitivity. J Magn Reson Imaging. 2009 Jun;29(6):1340–5.
11. Thomas EL, Saeed N, Hajnal JV, Brynes A, Goldstone AP, Frost G, et al. Magnetic
resonance imaging of total body fat. J Appl Physiol. 1998 Nov;85(5):1778–85.
12. Gallagher D, Kelley DE, Yim J-E, Spence N, Albu J, Boxt L, et al. Adipose tissue
distribution is different in type 2 diabetes. Am J Clin Nutr. 2009 Mar;89(3):807–14.
13. Goodpaster BH, Krishnaswami S, Harris TB, Katsiaras A, Kritchevsky SB, Simonsick
EM, et al. Obesity, regional body fat distribution, and the metabolic syndrome in older men and
women. Arch Intern Med. 2005 Apr 11;165(7):777–83.
14. Coen PM, Hames KC, Leachman EM, DeLany JP, Ritov VB, Menshikova EV, et al.
Reduced skeletal muscle oxidative capacity and elevated ceramide but not diacylglycerol content
in severe obesity. Obesity (Silver Spring). 2013 Nov;21(11):2362–71.
15. Kemp JG, Blazev R, Stephenson DG, Stephenson GMM. Morphological and biochemical
alterations of skeletal muscles from the genetically obese (ob/ob) mouse. Int J Obes (Lond). 2009
Aug;33(8):831–41.
Page 23 of 58 Diabetes
23
16. Denies MS, Johnson J, Maliphol AB, Bruno M, Kim A, Rizvi A, et al. Diet-induced
obesity alters skeletal muscle fiber types of male but not female mice. Physiol Rep. 2014 Jan
1;2(1):e00204.
17. Borst SE, Conover CF, Bagby GJ. Association of resistin with visceral fat and muscle
insulin resistance. Cytokine. 2005 Oct 7;32(1):39–44.
18. Vu V, Kim W, Fang X, Liu Y-T, Xu A, Sweeney G. Coculture with primary visceral rat
adipocytes from control but not streptozotocin-induced diabetic animals increases glucose uptake
in rat skeletal muscle cells: role of adiponectin. Endocrinology. 2007 Sep;148(9):4411–9.
19. Dietze D, Koenen M, Röhrig K, Horikoshi H, Hauner H, Eckel J. Impairment of insulin
signaling in human skeletal muscle cells by co-culture with human adipocytes. Diabetes. 2002
Aug;51(8):2369–76.
20. Kovalik J-P, Slentz D, Stevens RD, Kraus WE, Houmard JA, Nicoll JB, et al. Metabolic
remodeling of human skeletal myocytes by cocultured adipocytes depends on the lipolytic state
of the system. Diabetes. 2011 Jul;60(7):1882–93.
21. Glass DJ. PI3 kinase regulation of skeletal muscle hypertrophy and atrophy. Curr Top
Microbiol Immunol. 2010;346:267–78.
22. Pedersen BK, Febbraio MA. Muscles, exercise and obesity: skeletal muscle as a secretory
organ. Nat Rev Endocrinol. 2012 Aug;8(8):457–65.
23. Whittle AJ, Carobbio S, Martins L, Slawik M, Hondares E, Vázquez MJ, et al. BMP8B
increases brown adipose tissue thermogenesis through both central and peripheral actions. Cell.
2012 May 11;149(4):871–85.
24. Riehle C, Wende AR, Zaha VG, Pires KM, Wayment B, Olsen C, et al. PGC-1β
deficiency accelerates the transition to heart failure in pressure overload hypertrophy. Circ Res.
2011 Sep 16;109(7):783–93.
25. Briguet A, Courdier-Fruh I, Foster M, Meier T, Magyar JP. Histological parameters for
the quantitative assessment of muscular dystrophy in the mdx-mouse. Neuromuscul Disord. 2004
Oct;14(10):675–82.
26. Pellegrinelli V, Rouault C, Veyrie N, Clément K, Lacasa D. Endothelial Cells From
Visceral Adipose Tissue Disrupt Adipocyte Functions In A 3D Setting: Partial Rescue By
Angiopoietin-1. Diabetes. 2014 Feb;63(2):535-49.
27. Pellegrinelli V, Heuvingh J, du Roure O, Rouault C, Devulder A, Klein C, et al. Human
adipocyte function is impacted by mechanical cues. J Pathol. 2014 Jun;233(2):183-95.
28. Decary S, Mouly V, Hamida CB, Sautet A, Barbet JP, Butler-Browne GS. Replicative
potential and telomere length in human skeletal muscle: implications for satellite cell-mediated
gene therapy. Hum Gene Ther. 1997 Aug 10;8(12):1429–38.
29. Delaporte C, Dautreaux B, Fardeau M. Human myotube differentiation in vitro in
different culture conditions. Biol Cell. 1986;57(1):17–22.
30. Rouault C, Pellegrinelli V, Schilch R, Cotillard A, Poitou C, Tordjman J, et al. Roles of
chemokine ligand-2 (CXCL2) and neutrophils in influencing endothelial cell function and
inflammation of human adipose tissue. Endocrinology. 2013 Mar;154(3):1069–79.
Page 24 of 58Diabetes
24
31. Hilton TN, Tuttle LJ, Bohnert KL, Mueller MJ, Sinacore DR. Excessive adipose tissue
infiltration in skeletal muscle in individuals with obesity, diabetes mellitus, and peripheral
neuropathy: association with performance and function. Phys Ther. 2008 Nov;88(11):1336–44.
32. Dalmas E, Rouault C, Abdennour M, Rovere C, Rizkalla S, Bar-Hen A, et al. Variations
in circulating inflammatory factors are related to changes in calorie and carbohydrate intakes
early in the course of surgery-induced weight reduction. Am J Clin Nutr. 2011 Aug;94(2):450–8.
33. Spranger J, Kroke A, Möhlig M, Hoffmann K, Bergmann MM, Ristow M, et al.
Inflammatory cytokines and the risk to develop type 2 diabetes: results of the prospective
population-based European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam
Study. Diabetes. 2003 Mar;52(3):812–7.
34. Stapp JM, Sjoelund V, Lassiter HA, Feldhoff RC, Feldhoff PW. Recombinant rat IL-
1beta and IL-6 synergistically enhance C3 mRNA levels and complement component C3
secretion by H-35 rat hepatoma cells. Cytokine. 2005 Apr 21;30(2):78–85.
35. Ren H, Yin P, Duan C. IGFBP-5 regulates muscle cell differentiation by binding to IGF-II
and switching on the IGF-II auto-regulation loop. J Cell Biol. 2008 Sep 8;182(5):979–91.
36. Glass DJ. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem
Cell Biol. 2005 Oct;37(10):1974–84.
37. Chau Y-Y, Bandiera R, Serrels A, Martínez-Estrada OM, Qing W, Lee M, et al. Visceral
and subcutaneous fat have different origins and evidence supports a mesothelial source. Nat Cell
Biol. 2014 Apr;16(4):367–75.
38. Macotela Y, Emanuelli B, Mori MA, Gesta S, Schulz TJ, Tseng Y-H, et al. Intrinsic
differences in adipocyte precursor cells from different white fat depots. Diabetes. 2012
Jul;61(7):1691–9.
39. Yu J, Shi L, Wang H, Bilan PJ, Yao Z, Samaan MC, et al. Conditioned medium from
hypoxia-treated adipocytes renders muscle cells insulin resistant. Eur J Cell Biol. 2011
Dec;90(12):1000-15.
40. Kern PA, Ranganathan S, Li C, Wood L, Ranganathan G. Adipose tissue tumor necrosis
factor and interleukin-6 expression in human obesity and insulin resistance. Am J Physiol
Endocrinol Metab. 2001 May;280(5):E745–51.
41. Moschen AR, Molnar C, Enrich B, Geiger S, Ebenbichler CF, Tilg H. Adipose and liver
expression of interleukin (IL)-1 family members in morbid obesity and effects of weight loss.
Mol Med. 2011;17(7-8):840–5.
42. Buxboim A, Ivanovska IL, Discher DE. Matrix elasticity, cytoskeletal forces and physics
of the nucleus: how deeply do cells “feel” outside and in? J Cell Sci. 2010 Feb 1;123(Pt 3):297–
308.
43. Berkes CA, Tapscott SJ. MyoD and the transcriptional control of myogenesis. Semin Cell
Dev Biol. 2005 Oct;16(4-5):585–95.
44. Le Grand F, Rudnicki MA. Skeletal muscle satellite cells and adult myogenesis. Curr
Opin Cell Biol. 2007 Dec;19(6):628–33.
Page 25 of 58 Diabetes
25
45. Gautel M. Cytoskeletal protein kinases: titin and its relations in mechanosensing. Pflugers
Arch. 2011 Jul;462(1):119–34.
46. Cai D, Yuan M, Frantz DF, Melendez PA, Hansen L, Lee J, et al. Local and systemic
insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat Med. 2005
Feb;11(2):183–90.
47. Takegahara Y, Yamanouchi K, Nakamura K, Nakano S-I, Nishihara M. Myotube
formation is affected by adipogenic lineage cells in a cell-to-cell contact-independent manner.
Exp Cell Res. 2014 May 15;324(1):105–14.
48. Stephens FB, Chee C, Wall BT, Murton AJ, Shannon CE, van Loon LJC, et al. Lipid
induced insulin resistance is associated with an impaired skeletal muscle protein synthetic
response to amino acid ingestion in healthy young men. Diabetes. 2014 Dec 18;
LEGENDS TO FIGURES
Page 26 of 58Diabetes
26
Figure 1: Human adipocyte secretions and myotube phenotype
A. Human differentiated muscle cells were cultured in the presence of lean SAT CM or obese
VAT CM for 5 days. Cells were incubated with an antibody specific for desmin, revealed using
an Alexa-488 coupled goat anti mouse secondary antibody (green). Nuclei were visualized with
Hoechst staining (blue). A representative photomicrograph is presented. Scale bar=200 µm.
B. Myotube thickness was quantified using Image J software measuring intensity of the desmin
staining in ten random fields (X20) in three independent cultures.
C. Fusion index: the number of nuclei in differentiated myotubes (>2 myonuclei) were calculated
as a percentage of the total number of nuclei (mononucleated and plurinucleated). 1000 nuclei per
dish were counted in three independent cultures.
The counting was performed with blind lectures by different investigators (VA and FEV).
D. Cell lysates were immunoblotted to detect the heavy chain of myosin II (MF20, 200kDa),
troponin (24 kDa) and emerin (37 kDa, used as normalization control). Graphs represent the
quantification of the immunoblots.
Data are mean ± SEM of 5 independent experiments.
*p<0.05, **p<0.01, control vs. lean SAT CM or obese VAT CM.
Figure 2: Gene expression profile of myocytes co-cultured with human adipocytes
Muscle cells were differentiated in the 3D hydrogel for 3 days and then VAT adipocytes in the
3D hydrogel were added for an additional period of 1 day. Cells were then collected for RNA
extraction to obtain after reverse transcription cDNAs.
Page 27 of 58 Diabetes
27
A. cDNAs were analyzed using “Human myogenesis and myopathy PCR array”.
Graph represents the percentage of decreased gene expression in myocytes co-cultured with
adipocytes (MYO+AD) compared to myocytes alone (control, MYO).
Data are presented as means ± SEM of 5 independent experiments.
**p<0.01, ***p<0.001 MYO+AD vs MYO
B-C Cells were also fixed and stained using antibody directed against titin (green, Alexa488-
conjugated anti-mouse IgG) and phalloidin (red, Alexa-546 phalloidin). A representative
photomicrograph from confocal microscopy is presented. (Figure 2C, scale bar = 20 µm and D,
scale bar = 10 µm).
D-F. Muscle cells were differentiated for 3 days and then 3D adipocytes from SAT or VAT from
paired biopsies of obese subjects were added for an additional period of 3 days. Cells were fixed
and stained using antibody directed against desmin, troponin or titin (green, Alexa488-conjugated
anti-mouse IgG). Graphs represent quantifications of myotube thickness (D), troponin staining
(E) and titin staining (F).
Data are the means ± SEM of 6-8 independent experiments.
*p<0.05 MYO+VAT AD vs MYO
Figure 3: Inflammatory profile of co-cultured human adipocytes and myocytes: IL-6 and
IL-1ββββ as key factors.
Muscle cells were differentiated in the 3D hydrogel for 3 days and then SAT or VAT adipocytes
from obese subjects, cultured in the 3D hydrogel were added for an additional period of 3 days.
Page 28 of 58Diabetes
28
Media were then collected for the measurement of cytokine and chemokine secretion by a
multiplex assay.
A-Significant changes in the secretory profile in the 3D cultures of muscle cells and obese VAT
adipocytes (AD+MYO) compared to AD as control and MYO are presented in the graph. Data
are expressed as fold variations between AD (white bars), AD+MYO (black bars) and MYO
(grey bars) to take into account human inter-individual variations.
Data are presented as means ± SEM of 7 independent experiments.
*p<0.05, **p< 0.01 AD+MYO vs AD.
B- Significant changes in the secretory profile in the 3D cultures of muscle cells and obese SAT
(MYO+ SAT AD) or obese VAT adipocytes (MYO+ VAT AD) are presented in the graph. Data
are expressed as fold variations between MYO (control) and MYO+ SAT AD (white bars) or
MYO+ VAT AD (black bars).
Data are presented as means ± SEM of 8 independent experiments.
C. Gene expression of IL-6, IL-8 and IL-1β in muscle cells cultured alone (control, MYO, white
bars) or exposed to adipocytes from paired biopsies of obese SAT (MYO+ SAT AD, grey bars)
or VAT adipocytes (MYO+ VAT AD, black bars), estimated by real time PCR. Data (fold over
control, MYO) are presented as means ± SEM of 6 independent experiments performed with
different adipocytes preparations.
*p<0.05, **p<0.01 MYO+ VAT AD vs MYO.
#p<0.05 MYO+ SAT AD vs. MYO+ VAT AD
Page 29 of 58 Diabetes
29
D. 3D VAT adipocytes were added for an additional period of 3 days treated with neutralizing
antibodies of IL-6 (2.5 µg/ml) and IL-1β (0.5 µg/ml) (MYO+AD+ abIL-6/IL-1β) IgG1 (control
MYO+AD IgG) in the 3D setting. Media were then collected for multiplex assay. Black bars
represent the percentage decrease in secretions in MYO+AD+ abIL-6/IL-1β co-cultures
compared to control MYO+AD IgG co-cultures.
Data are presented as means ± SEM of 5 independent experiments.
* P<0.05, **p<0.01, ***p<0.001, ns non-significant MYO+AD IgG vs. MYO+AD+ abIL-6/IL-
1β
E. Multiplex assay of the inflammatory secretome of myocytes treated (MYO IL-6/IL-1β, black
bars) or not (MYO, white bars) with recombinant IL-6 (10 ng/ml) and IL-1β (1 ng/ml) during 3
days.
Data are presented as means ± SEM of 5 independent experiments.
* P<0.05, **p<0.01, ***p<0.001 MYO IL-6/IL-1β vs. MYO
Figure 4: IGF-II and IGFBP-5 rescue the atrophy of myotubes induced by adipocytes
A-D. Muscle cells were differentiated in the 3D hydrogel for 3 days without (MYO) or with 3D
VAT adipocytes (from obese subjects) (MYO+AD) were added for an additional period of 3 days
in the presence or not of IGF-II (50ng/ml) and IGFBP-5 (200ng/ml) (MYO+AD+IGF-II/IGFBP-
5. Cells were fixed and stained with the corresponding antibodies.
A. Myotube thickness was quantified using Image J software measuring intensity of the desmin
staining in ten random fields (X20) in 6 independent cultures.
Page 30 of 58Diabetes
30
B-D. Quantification of immunofluorescence was performed using Image J software measuring
intensity of the MF20 (B) and titin (C) staining in five random fields (X20).
D. Immunostaining of titin (green, Alexa488-conjugated anti-mouse IgG) and nuclei (blue,
DAPI). A representative photomicrograph of titin staining is presented (scale bar = 50 µm).
Data are presented as means ± SEM of 6 independent experiments.
** p<0.01, MYO+AD vs MYO or MYO+AD+IGF-II/IGFBP-5.
E-F. Differentiated muscle cells exposed or not to obese VAT adipocytes were stimulated with
IGF-II (50 ng/ml) and IGFBP-5 (200 ng/ml) for 10 min at 37°C. Serine 473 phosphorylation of
Akt (pS 473 Akt, 56kDa), Serine 65 of 4E-BP1 (pS65 4E-BP1, 21 kDa) and Serine 240 and 244
phosphorylation of S6 ribosomal protein (pS 240/244 S6 ribosomal protein, 32 kDa) were
detected using the corresponding antibodies. A representative Western blot is presented among
the five different experiments (E). The graph represents quantifications of the immunoblots in
IGF-II/IGFBP-5-stimulated conditions normalized to total proteins (F).
Data are presented as means ± SEM of 5-7 independent experiments.
* p<0.05, **p<0.01, MYO+AD vs. MYO
#p<0.05, ##p<0.01, - vs. + IGF-II/IGFBP5 treatment.
Figure 5: Skeletal muscle characteristics of HFD-induced obese mice
A-B. Serum cytokine level (A) and Gastrocnemius gene expression (B) evaluated in 20-week-old
mice after 12 weeks of standard diet (chow, white bars) or High Fat Diet (HFD, black bars).
n=8 mice per experimental group
Page 31 of 58 Diabetes
31
C-E. Histological analysis of the Gastrocnemius muscle obtained from 24-week-old mice (n=9
mice per experimental group) after 16 weeks of standard diet (chow) or High Fat Diet (HFD).
C. Representative microphotographs of cross-section (right panel) and longitudinal section (left
panel). Scale bar=100µm.
D. Measurement of variance coefficients of the fiber size in the cross-section samples of Chow
and HFD mice using Feret’s diameter as geometrical parameter. n=61 (minimum)–201
(maximum) fibers were analyzed for each sample (3 random fields/mouse, X10).
E. Quantification of adipocyte spots in the longitudinal section samples of chow and HFD mice
(total biopsy).
*p<0.05, ***p<0.001, ns, non-significant, chow vs. HFD mice.
Figure 6: Scheme representing the proposed cross-talk between obese adipocytes and
muscle cells which could trigger inflammation and muscle dysfunctions.
Page 32 of 58Diabetes
32
Table 1. Spearman correlations between the gene expression of muscle markers in the
skeletal muscle (Gastrocnemius) and the expression of leptin/IL-6 in both epididymal AT
and skeletal muscle.
20-week-old mice (n=16).
Significant correlations are indicated in bold
Epididymal Adipose Tissue Gastrocnemius
Gastrocnemius
Fat mass % Leptin IL-6 Leptin IL-6
R p R p R p R p R p
MyoD -0.729 0.001 -0.747 0.001 -0.708 0.001 -0.618 0.006 0.427 0.051
MyoG -0.279 0.147 -0.053 0.424 -0.030 0.454 -0.053 0.424 0.009 0.489
β-Actin -0.415 0.056 -0.788 0.000 -0.720 0.001 -0.435 0.047 0.271 0.155
Titin -0.5357 0.0396 -0.4107 0.1283 -0.6452 0.0094 -0.3429 0.2109 0.1679 0.5499
IGF-II -0.577 0.011 -0.744 0.001 -0.664 0.003 -0.588 0.009 0.453 0.040
IGFBP-5 -0.6264 0.0165 -0.6791 0.0076 -0.6865 0.0067 -0.5121 0.0612 0.4549 0.1022
PGC-1α 0.068 0.410 0.152 0.303 0.213 0.230 0.020 0.476 0.160 0.292
PGC-1β -0.350 0.101 -0.646 0.006 -0.459 0.042 -0.332 0.113 0.418 0.061
Page 33 of 58 Diabetes
Figure 1
A
control Lean SAT CM
B *
*
200µm
C
** *
*
Troponin
Emerin
MF20
38 kDa
18 kDa
188 kDa
D
Obese VAT CM
Control Lean SAT CM Obese VAT CM Control Lean SAT CM Obese VAT CM
Control Lean SAT CM Obese VAT CM
Control Lean SAT CM Obese VAT CM Control Lean SAT CM Obese VAT CM
Myo
tub
e t
hic
kne
ss
(fo
ld o
ver
con
tro
l)
Page 34 of 58Diabetes
Figure 2
A
-100
-80
-60
-40
-20
0
mR
NA
rel
ativ
e ex
pre
ssio
n in
M
YO+
AD
(%
co
ntr
ol,
MYO
)
*** ***
**
*** ***
** **
*** ***
**
* *
MYO+ VAT AD MYO+SAT AD MYO
titin
D E *
F
B
MY
O
MY
O+
AD
C Phalloidin Titin Merge
Titin
MY
O
MY
O+
AD
*
* *
Page 35 of 58 Diabetes
Figure 3
D
A
CC
L2
IL-8
G-C
SF
IL-6
VEG
F
CC
L7
MIP
1α
FRK
FGF2
0
10
20
30
40
50
60
7080
780
1480
MYO+ SAT ADMYO+VAT AD
Secr
etio
n (
fold
ove
r co
ntr
ol,
MY
O)
*
* *
*
*
*
*
*
*
*
* * * *
#
#
# #
#
25
75
125AD
AD+MYO
MYO
** *
**
**
**
* *
*
* C
CL2
IL-8
CX
CL 1
/2/3
G-C
SF
IL-6
VEG
F
CC
L7
MIP
1α
FRK
FGF2
Secr
eti
on
(fo
ld o
ver
con
tro
l, A
D)
B
*
**
IL-6 IL-8 IL-1
MYO
MYO+VAT AD MYO+SAT AD
C
-90
-75
-60
-45
-30
-15
0
Secr
etio
n in
AD
+MY
O a
b IL
-6/I
L-1β
(%
co
ntr
ol,
AD
+MY
O Ig
G)
***
** ** * ***
** *
ns
ns
*
ns
G-C
SF
FRK
CX
CL 1
/2/3
CC
L7
IL-7
IL-8
IP-1
0
CC
L2
MIP
1α
CC
L5
VEG
F
0
300
600
Secr
etio
n (
pg/
ml)
1200
7200
13200
19200
***
**
***
**
**
***
***
**
**
**
*
MYO MYO IL-6/IL-1β
E
G-CSF FRK CXCL CCL7 IL-7 IL-8 IP-10 CCL2 MIP-1α CCL5 VEGF 1/2/3
*
Page 36 of 58Diabetes
** **
Myo
tub
e t
hic
kne
ss
(fo
ld o
ver
con
tro
l, M
YO
)
MYO MYO+AD MYO+AD +IGF-II/IGFBP-5
B
** ** ** **
MYO MYO+AD MYO+AD +IGF-II/IGFBP-5
Titin, nuclei
50µm
MYO MYO+AD MYO+AD+IGF-II/IGFBP-5
MYO MYO+AD MYO+AD +IGF-II/IGFBP-5
A C
D
Figure 4
pS473 AKT
Total AKT
pS65 4E-BP1
pS240/244 S6
Total 4E-BP1
Total S6
IGF-II/IGFBP-5 - + - +
MYO MYO+AD
** ##
# **
**
**
**
* *
MYO
MYO+AD
- + - + IGF-II/IGFBP-5
- + - + IGF-II/IGFBP-5
- + - + IGF-II/IGFBP-5
E F
49 kDa
49 kDa
17 kDa
17 kDa
28 kDa
28 kDa
Page 37 of 58 Diabetes
Figure 5
02468
101214161820
MyoD MyoG IGF-II β-Actin PGC1α PGC1β Titin IGFBP-5
mR
NA
rel
ativ
e ex
pre
ssio
n (
A.U
)
ChowHFD
50
100
*** ***
*** *** *
*
*
*
A B
Chow
HFD
Transverse Section
0
10
20
30
40 Chow
HFD***
CV
fer
et d
iam
eter
(%
)
0
2
4
6 Chow
HFD*
Ad
ipo
cyte
sp
ots
C D
Longitudinal Section
*
* * *
*
E
0.0
10.0
20.0
30.0
40.0
IL-6 IL-1β TNFα CXCL IL-10
Seru
m le
vel (
pg/
ml)
60.0
160.0 Chow
HFD
1/2/3
Page 38 of 58Diabetes
Figure 6
Adipokines secretion
INFLAMMATION
IGF-II/IGFBP-5
ATROPHIC PHENOTYPE (decreased myogenic and
contractile protein expression)
INFLAMMATION
IL-6/IL-1β
Cytokines/chemokines production
Recruitment/activation of immune cells
Adipocyte Muscle cell
Page 39 of 58 Diabetes
1
SUPPLEMENTARY DATA
Human adipocytes induce inflammation and atrophy in muscle cells during obesity
Pellegrinelli V1, 2, 3#
, Rouault C1, 2, 3*
, Rodriguez-Cuenca S4*
, Albert V1, 2, 3
, Edom-
Vovard F5, 6, 7, 8
, Vidal-Puig A4, Clément K
1, 2, 3 **, Butler-Browne GS
5, 6, 7, 8** and
Lacasa D1, 2, 3 **
1 - INSERM, U1166 Nutriomique, Paris, F-75006 France;
2 - Sorbonne Universités, University Pierre et Marie-Curie-Paris 6, UMR S 1166, Paris,
F-75006 France;
3- Institut Cardiométabolisme et Nutrition, ICAN), Pitié Salpétrière Hospital, Paris, F-
75013 France;
4- Metabolic Research Laboratories, Wellcome Trust-MRC Institute of Metabolic
Science, University of Cambridge, Cambridge, United Kingdom;
5- Sorbonne Universités, University Pierre et Marie-Curie-Paris6, Centre de recherches
en Myologie UMR 974, F-75005, Paris, France;
6- INSERM, U974, 75013, Paris, France;
7- CNRS FRE 3617, 75013, Paris, France;
8- Institut de Myologie, 75013, Paris, France.
# Corresponding author: Current address: Wellcome Trust-MRC Institute of Metabolic
Science, Metabolic Research Laboratories,University of Cambridge
This file includes:
9 supplementary figures
5 supplementary tables
1 supplementary list
Supplemental references
Page 40 of 58Diabetes
2
Figure S1
Secretory profile of human SAT and VAT adipocytes.
A-Secretory profile of 48h-conditioned media prepared from 3D human adipocytes from lean SAT
(lean SAT CM) and obese SAT and VAT (obese SAT CM and obese VAT CM, respectively).
Heatmap represents the secretory profile. Graded shades from green to red represent the secretion
levels (pg/ml). Cytokines and chemokines were classified from high to low secretion.
B-Secretory profile of 48h-conditioned media prepared from human adipocytes from paired samples of obese SAT (obese SAT CM, white bars) and VAT (obese VAT CM, black bars). Results are
expressed as fold variation over control, obese SAT CM.
The amounts of adipokines were determined by ELISA (leptin and adiponectin) and multiplex (cytokines/chemokines) analysis in 10-14 experiments using different adipocyte preparations.
*p<0.05, ** p<0.01 obese VAT CM vs. obese SAT CM (B)
Page 41 of 58 Diabetes
3
Figure S2
Human SAT and VAT
Experimental procedure for 3D co-culture of human adipocytes and myoblasts
A- Muscle cells were embedded in hydrogel at the concentration of 200.000 cells per 100µl of gel
preparation containing 0.5 mg/ml type 1collagen. The gel preparation was put into 96-well plates
containing 150µl of growth medium. After 2 days of culture, this medium was replaced by
differentiating medium for 3 days. A second hydrogel containing mature adipocytes isolated from
SAT or VAT of obese subjects (10.000 cells per 100µl of gel preparation) was then added. Adipocytes
and differentiated myoblasts were then co-cultured for 3 days in DMEM/F12 (1% antibiotics and 50
nM insulin). Culture medium was changed daily.
B- Microphotographs showing the hydrogel containing the mature adipocytes (AD) and/or the
differentiated myoblastes (MYO).
Page 42 of 58Diabetes
4
C- Immunofluorescence analysis of differentiated myoblastes cultured in 2D or 3D conditions using
antibodies against MF20 (green, Cy2-conjugated anti-mouse IgG), actin (red, Cy3-phalloidin). Nuclei
were stained with DAPI (blue).
Figure S3
ATF4
HSPA5
C/EBPζζζζ
Gene expression of ER stress markers in co-cultured myocytes and VAT adipocytes.
Muscle cells were differentiated in the 3D hydrogel for 3 days and then 3D adipocytes (from VAT of
obese subjects) were added for an additional period of 1 day. Cells were then collected for RNA extraction. After reverse transcription of total RNAs, cDNAs were analyzed for ER stress markers.
Graph represents gene expression in myocytes co-cultured with adipocytes (black bars, AD+MYO)
compared to adipocytes alone (white bars, AD) and myocytes alone (grey bars, MYO).
Data (fold over control, AD) are presented as means ± SEM of 5 independent experiments.
Page 43 of 58 Diabetes
5
Figure S4
A B
Cytotoxicity and inflammation in co-cultures and impact on myotubes thickness.
A-Muscle cells were differentiated in the 3D hydrogel for 3 days and then adipocytes (from VAT of
obese subjects) in another 3D hydrogel were added for an additional period of 1 day. Cytotoxicity was
evaluated by measuring the activity of lactate dehydrogenase (LDH) released from damaged cells. Graph represents LDH activity in differentiated myocytes co-cultured with adipocytes (black bars,
AD+MYO) compared to adipocytes alone (white bars, AD) or differentiated myocytes alone (grey
bars, MYO).
Data (fold over control, AD) are presented as means ± SEM of 5 independent experiments.
B- Muscle cells were differentiated in the 3D hydrogel for 3 days and then inflammatory adipocytes in
the 3D hydrogel were added for an additional period of 3 days. Media were then collected for the measurement of cytokine and chemokine secretion by a multiplex assay. Heatmap represents the
secretory profile. Graded shades from green to red represent the secretion levels (pg/ml). Cytokines
and chemokines were classified from high to low secretion. AD was used as control.
Data are presented as means ± SEM of 7 independent experiments.
Page 44 of 58Diabetes
6
Figure S5
A.
Page 45 of 58 Diabetes
7
B.
Page 46 of 58Diabetes
8
Muscle cells atrophy and inflammatory mediators IL-6/IL-1ββββ.
A- Muscle cells differentiated for 3 days were treated by IL-6 (10 ng/ml) and IL-1β (1 ng/ml) during 3
days. Cells were fixed and stained for desmin (thickness measurement) or titin (green, alexa488-conjugated anti-mouse IgG) and nuclei (blue, DAPI staining). Media were collected for IGF-II ELISA
assay.
Graph represents IGF-II secretion, myotube thickness and titin staining in muscle cells (white bar,
MYO) compared to muscle treated by recombinant IL-6 and IL-1β (black bar, MYO+IL-6/IL-1β).
B- Muscle cells were differentiated for 3 days and then 3D adipocytes (from VAT of obese subjects)
were added for an additional period of 3 days treated with IL-6 and IL-1β neutralizing antibody
(MYO+AD+Neut Ab) compared to co-cultures treated with IgG1 (control MYO+AD) in the 3D setting. Cells were fixed and stained for desmin (thickness measurement) or titin (green, alexa488-
conjugated anti-mouse IgG) and nuclei (blue, DAPI staining). Media were collected and analyzed for
IGF-II ELISA assay.
Graph represents myotube thickness and titin staining in muscle cells (MYO, white bar) or co-cultured
with VAT adipocytes (black bar, MYO+AD) compared to myocytes co-cultured with VAT adipocytes
in the presence of neutralizing antibodies (grey bar, MYO+AD+Neut Ab).
Data are presented as means ± SEM of 4-8 independent experiments.
Page 47 of 58 Diabetes
9
Figure S6
Cell thickness, titin and troponin content in muscle cells treated by IgFII/IGFBP-5
Muscle cells were differentiated in the 3D hydrogel for 3 days before 3 additional days of treatment
with (MYO+IGF-II/IGFBP-5) or without (MYO) IGF-II (50ng/ml) and IGFBP-5 (200ng/ml). Cells
were fixed and stained with the corresponding antibodies. Immunostaining of titin (green, Alexa488-
conjugated anti-mouse IgG), troponin (red, Alexa555-conjugated anti-mouse IgG) and nuclei (blue,
DAPI) were performed. Representative photomicrographs are presented (scale bar = 50 µm). Myotube
thickness was quantified using Image J software in five random fields in 6 independent cultures.
Quantification of immunofluorescence was performed using Image J software measuring intensity of
the titin and troponin staining in five random fields in 6 independent cultures.
Data are presented as means ± SEM of 6 independent experiments.
* p<0.05, MYO vs MYO+IGF-II/IGFBP-5.
Page 48 of 58Diabetes
10
Figure S7
G-CSF Fractalkine CXCL CCL7 IL-6 IL-8 CCL2 MIP-1���� VEGF
Inflammatory secretome of co-cultured muscle cells treated by IGF-II/IGFBP5.
Muscle cells were differentiated for 3 days and then 3D adipocytes (from VAT of obese subjects) were
added for an additional period of 3 days treated by IGF-II (50 ng/ml) and IGFBP5 (200 ng/ml) or not .
Media were then collected and analyzed for multiplex assay.
Graph represents the percentage variation in secretions in differentiated myocytes co-cultured with
adipocytes in the presence of IGF-II (50 ng/ml) and IGFBP5 (200 ng/ml) (black bars, % of
MYO+AD) compared to control co-culture of myocytes and adipocytes (MYO+AD).
Data are presented as means ± SEM of 6 independent experiments.
Page 49 of 58 Diabetes
11
Figure S8
Gene expression of atrophic markers in muscle cells exposed to VAT adipocytes.
Differentiated muscle cells were exposed to 3D adipocytes (from VAT of obese subjects) with or
without IGF-1 (10 ng/ml) or with IGF-II (50 ng/ml) and IGFBP5 (200 ng/ml). Gene expression of
atrogin-1 and murf-1 was estimated by real time PCR and normalized to 18S.
The graph represents gene expression in myocytes co-cultured with adipocytes (black bars,
MYO+AD) compared to myocytes alone (white bars, MYO) with IGF-I (dark grey bars, MYO+AD+IGF-I) or IGF-II/IGFBP-5 (light grey, MYO+AD+IGF-II/IGFBP-5).
Data (fold over control, MYO) are presented as means ± SEM of 6 independent experiments performed with different adipocytes preparations.
Atrogin-1 Murf-1
Page 50 of 58Diabetes
12
Figure S9
A
B
Page 51 of 58 Diabetes
13
C
Gene expression profile of muscle, adipose and inflammatory markers in skeletal muscle of
obese mice
A-Gene expression profile in subcutaneous (SAT) and epididymal (GnAT) adipose tissue from 20-
week-old mice after 12 weeks of standard diet (chow, white bars) or High Fat Diet (HFD, black bars).
n=8 mice per experimental group
*p<0.05, **p<0.01, ***p<0.001, ns, non-significant, chow vs HFD mice in SAT and GnAT
###p<0.001, SAT vs GnAT during HFD
B-Gene expression in the Gastrocnemius of 24-week-old mice after 16 weeks of standard diet (chow,
white bars) or High Fat Diet (HFD, black bars).
n=9 mice per experimental group
*p<0.05, **p<0.01, ***p<0.001, ns, non-significant, chow vs HFD mice
C-Gene expression of adipose markers in the Gastrocnemius of 20-week-old mice after 12 weeks of
standard diet (chow, white bars) or High Fat Diet (HFD, black bars).
n=8 mice per experimental group
Page 52 of 58Diabetes
14
Supplementary tables
Table S1. List of the antibodies, recombinant proteins and ELISA kits used in the study
Antibody Reference Provider
anti-human MF-20 antibody MAB4470 Developmental Hybridoma Bank, Iowa City, IW, USA
anti-human emerin antibody NCL-emerin Leica, Newcastle, UK
anti-human desmin monoclonal antibody M076 DAKO, Glostrup, Dk
anti-human troponin monoclonal antibody T6277 Sigma, St Louis, Mo, USA
rabbit anti-human phospho-AKT (Ser473) mAb 4060 Cell Signaling Technology, Denvers, CO, USA
rabbit anti-human total-AKT mAb 9272 Cell Signaling
rabbit anti-human phospho-4E-BP1(Ser65) mAb174A9 Cell Signaling
rabbit anti-human total-4E-BP1 mAb 53H11 Cell Signaling
rabbit anti-human phospho- S6 ribosomal protein
(Ser240/244)
mAb D68F8 Cell Signaling
rabbit anti-human total- S6 ribosomal protein mAb 5G10 Cell Signaling
anti-rabbit IgG HRP-linked antibody P7074 Cell Signaling
mouse anti human IL-6 neutralizing monoclonal
antibody
MAB206 R&D Systems
mouse anti human IL-1β neutralizing monoclonal
antibody
MAB201 R&D Systems
Alexa 488-conjugated anti-mouse antibody A21202 Life Technologies, Foster City, CA, USA
Alexa 546-conjugated anti-rabbit antibody A22283 Life Technologies
phalloidin conjugate alexa®568 A22283 Molecular Probes, Eugene, Or, USA
anti-mouse conjugate alexa®488 A21202 Molecular Probes, Eugene, Or, USA
human recombinant protein IGF-II 292-G2-050 R&D Systems
human recombinant protein IGFBP-5 875-B5-025 R&D Systems
human recombinant protein IL-6 200-06 Peprotech ,Rocky Hill, NJ, USA
human recombinant protein IL-1β 200-01 Peprotech
human Insulin I91077C Sigma
ELISA assay for human IGF-II CSB-
E04583h
CUSABIO , Wuhan, P.R. China
Page 53 of 58 Diabetes
15
Table S2. Clinical parameters of obese subjects
The obese subjects were not on a diet and their weights were stable before surgery. Regarding lean
subjects, none had diabetes and metabolic disorders and none was taking medication. Informed
personal consent was obtained from every participant. In obese subjects, body composition was
estimated by whole-body fan-beam dual energy X-ray absorptiometry scanning (Hologic Discovery
W, software v12.6, 2; Hologic, Bedford, MA) (1). To determine body fat and lean mass repartition, we
used specific measures and analyses as described (2). Blood samples were collected after an overnight
fast of 12 h. Glycaemia was measured enzymatically. Serum insulin concentrations were measured
using a commercial IRMA kit (Bi-insuline IRMA CisBio International, France). Serum leptin and
adiponectin were determined using a radioimmunoassay kit (Linco Research, St. Louis, MO),
according to the manufacturer's recommendations, sensitivity: 0.5 ng/ml and 0.8 ng/ml for leptin and
adiponectin respectively.
Data are presented as means ± SEM (standard error of the mean).
Obese subjects
Number of
subjects
41
Age (years) 41.6 ±1.5
BMI (kg/m2) 47.74 ±1.2***
% of fat mass 43.22 ±5.32
% of lean mass 48.34±1.23
Adipocyte
volume (pL)
800.7 ±94.6
Glycaemia
(mmol/L)
4.66 ±0.57
Insulinemia
(µU/mL)
15.39 ±2.65
HOMA-IR 3.75 ±0.65
Leptin
(ng/ml)
63.17 ±12.56
Adiponectin
( µg/mL)
4.52 ±0.87
IL-6
(pg/ml)
2.93±0.53
Page 54 of 58Diabetes
16
Table S3
List of primer sequences used for real-time PCR
Gene Forward Reverse
h ATF4 ggtcagtccctccaacaaca ctatacccaacagggcatcc
h C/EBPζ aaggcactgagcgtatcatgt tgaagatacacttccttcttgaaca
h HSPA5 agctgtagcgtatggtgctg aaggggacatacatcaagcagt
h IGF-II gctggcagaggagtgtcc gattcccattggtgtctgga
h IGFBP-5 agagctaccgcgagcaagt gtaggtctcctcggccatct
h irisin tcgtggtcctgttcatgtg ggttcattgtccttgatgatgtc
h PGCα tgagagggccaagcaaag ataaatcacacggcgctctt
h PGC1β ggcaggcctcagatctaaaa tcatgggagccttcttgtct
h RPLPO acagggcgacctggaagt ggatctgctgcatctgctt
h titin tggccacactgatggtctta tcctacagtcaccgtcatcg
m β-actin gctctggctcctagcaccat gccaccgatccacacagagt
m CCL2 ggctcagccagatgcagttaa cctactcattgggatcatcttgct
m IGF-II cgcttcagtttgtctgttcg gcagcactcttccacgatg
mIGFBP-5 aaagcagtgtaagccctccc tccccatccacgtactccat
m IL-6 gtctggaagactcgcctacg aagtgcatcatcgttgttcataca
m IL-1β agttgacggaccccaaaag agctggatgctctcatcagg
m leptin agcatccactgctatggtagc tcttctagtcccaagcattttgg
m myo D agcactacagtggcgactca ggccgctgtaatccatca
m myogenin ccttgctcagctccctca tgggagttgcattcactgg
m PGC1α gaaagggccaaacagagaga gtaaatcacacggcgctctt
m PGC1β ctccagttccggctcctc ccctctgctctcacgtctg
m titin ` gaggtgccgaagaaacttgt ttgggtgcttccggtactt
h, human; m, mice
Page 55 of 58 Diabetes
17
Table S4. Spearman correlations between the gene expression of muscle markers in the
quadriceps muscle and the expression of leptin/IL-6 in both epididymal adipose tissue
and skeletal muscle.
20-week-old mice (n=16).
Significant correlations are indicated in bold
Epididymal Adipose Tissue Quadriceps
Quadriceps
Fat mass % Leptin IL-6 Leptin IL-6
R p R p R p R p R p
MyoD -0.314 0.127 -0.414 0.063 -0.824 0.0001 -0.433 0.053 0.293 0.144
MyoG -0.203 0.225 0.050 0.428 -0.516 0.021 -0.091 0.366 0.462 0.037
β-Actin -0.232 0.193 -0.577 0.011 -0.643 0.004 -0.225 0.198 0.253 0.172
Titin -0.04706 0.8626 0.1059 0.6963 0.1947 0.47 0.4297 0.0967 -0.08824 0.7452
IGF-II -0.482 0.036 -0.489 0.033 -0.577 0.013 -0.320 0.120 0.207 0.229
IGFBP-5 -0.2412 0.3682 -0.2735 0.3053 -0.4248 0.101 -0.4032 0.1214 0.3176 0.2306
PGC-1α 0.041 0.441 0.279 0.147 -0.077 0.385 0.155 0.283 0.391 0.068
PGC-1β -0.124 0.324 -0.006 0.494 -0.086 0.373 -0.019 0.470 0.218 0.208
Page 56 of 58Diabetes
18
Table S5. Spearman correlations between the gene expression of muscle markers in the
Gastrocnemius muscle and the expression of leptin and IL-6 in inguinal AT.
Gastrocnemius
Inguinal Adipose Tissue
Leptin IL-6
r p r p
MyoD -0.7794 0.0004 -0.01071 0.9698
MyoG -0.2029 0.4510 0.3750 0.1684
β-Actin -0.5000 0.0486 -0.3250 0.2372
Titin -0.5 0.0577 -0.2352 0.4183
IGF-II -0.6588 0.0055 -0.1714 0.5413
IGFBP-5 -0.6747 0.0081 0.1484 0.6286
PGC-1α -0.03736 0.8991 0.5824 0.0367
PGC-1β -0.4250 0.1143 0.08132 0.7823
20-week-old mice (n=16).
Significant correlations are indicated in bold
Page 57 of 58 Diabetes
19
Supplemental list
List of the genes present in the “Human myogenesis and myopathy PCR array”
Skeletal Muscle Contractility: Dystrophin-Glycoprotein Complex: CAMK2G, CAPN3, CAV3, DAG1, DMD (Dystrophin),
DYSF, LMNA, MAPK1, SGCA.
Titin Complex: ACTA1, ACTN3, CAPN3, CRYAB, DES, LMNA, MAPK1, MSTN, MYH1,
MYH2, MYOT, NEB, SGCA, TNNI2, TNNT1, TNNT3, TRIM63 (MuRF1), TTN.
Energy Metabolism: CS, HK2, PDK4, SLC2A4 (GLUT4).
Fast-Twitch Fibers: ATP2A1, MYH1, MYH2, TNNI2, TNNT3.
Slow-Twitch Fibers: MB, MYH1, TNNC1, TNNT1.
Other: DMPK, IKBKB, RPS6KB1.
Skeletal Myogenesis: ACTA1, ADRB2, AGRN, BCL2, BMP4, CAPN2, CAST, CAV1,
CTNNB1, DMD, HDAC5, IGF1, IGFBP3, IGFBP5, MEF2C, MSTN, MUSK, MYF5,
MYF6, MYOD1, MYOG, PAX3, PAX7, PPP3CA (Calcineurin Aa), RHOA, RPS6KB1,
UTRN.
Skeletal Muscle Hypertrophy: ACTA1, ACVR2B, ADRB2, IGF1, IGFBP5, MSTN, MYF6,
MYOD1, RPS6KB1.
Skeletal Muscle Autocrine Signaling: ADIPOQ, FGF2, IGF1, IGF2, IL6, LEP, MSTN,
TGFB1.
Diabetes/Metabolic Syndrome: ADIPOQ, LEP, PPARG, PPARGC1A (PGC-1a),
PPARGC1B (PGC-1β), PRKAA1
(AMPK), PRKAB2, PRKAG1, PRKAG3, SLC2A4 (GLUT4).
Skeletal Muscle Wasting/Atrophy: Autophagy: CAPN2, CASP3, FBXO32 (Atrogin-1), FOXO1, FOXO3, MSTN, NOS2,
PPARGC1A (PGC-1α),
PPARGC1B (PGC-1β), RPS6KB1, TRIM63 (MuRF1).
Dystrophy: AKT1, AKT2, FBXO32 (Atrogin-1), IL1B, MAPK1, MAPK14, MAPK3,
MAPK8, MMP9, NFKB1, TNF,
TRIM63 (MuRF1), UTRN.
Page 58 of 58Diabetes
20
Supplemental references
1. Perlemuter G, Naveau S, Belle-Croix F, Buffet C, Agostini H, Laromiguière M, et al. Independent
and opposite associations of trunk fat and leg fat with liver enzyme levels. Liver Int. 2008
Dec;28(10):1381–8. 2. Ciangura C, Bouillot J-L, Lloret-Linares C, Poitou C, Veyrie N, Basdevant A, et al. Dynamics of
change in total and regional body composition after gastric bypass in obese patients. Obesity
(Silver Spring). 2010 Apr;18(4):760–5.
Page 59 of 58 Diabetes