pcr is another in vitro dna synthesis reaction the twist in this case is that the reaction is...

36

Upload: internet

Post on 17-Apr-2015

110 views

Category:

Documents

1 download

Report

Download

Tags:

Embed Size (px):

TRANSCRIPT

Page 1: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 2: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between

the primers is amplified

Page 3: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

The first PCR cycle:The sequence between the two primers will be

amplified

Page 4: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Four cycles of PCR

Page 5: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Copy number of the sequence between the primers increases exponentially

Page 6: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

SEQUENCIAMENTO DE DNA

Profa. Dra. Maria Aparecida Fernandez

Depto de Biologia Celular e Genética

Universidade Estadual de Maringá

Page 7: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Structure of dideoxynucleotide triphosphates

Page 8: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist

DNAP requires a template and a primer

The [ddNTP] determines the distribution of chain lengths produced.

The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.

Page 9: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 10: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA

Alto peso molecular

Baixo peso molecular

Filme de raio X

Auto-radiograma

Leitura manual

Page 11: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Automated DNA Sequencing

Page 12: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Reação de seqüênciamentoReação de seqüênciamento

Page 13: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Fragmentos amplificados na reação de seqüênciamentoFragmentos amplificados na reação de seqüênciamento

Page 14: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Typical output of an automated sequencer

Page 15: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Eletroforese no seqüênciamentoEletroforese no seqüênciamento

Page 16: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 17: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Captura do fluorescente e processamento da informaçãoCaptura do fluorescente e processamento da informação

Page 18: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 19: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 20: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Seqüenciador automáticoSeqüenciador automático

Page 21: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 22: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 23: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 24: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 25: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 26: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 27: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 28: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 29: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Conjunto

de

16 capilares

Page 30: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 31: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 32: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 33: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Page 34: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Panorama no momento da corrida

Page 35: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Análise preliminar pós corrida

Page 36: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

ELETROFEROGRAMAS

Chapter 14: DNA Amplification by Polymerase Chain Reaction

DNA polymerase fidelity and the polymerase chain reaction. › alan.ward › Molecular... · DNA Polymerase Fidelity and the Polymerase Chain Reaction Kristin A. Eckert and Thomas

Polymerase Chain Reaction (DNA Polymerase – duplicates DNA when cells divide) DNA copying machine – creates the compliment strand (ATCG-TAGC)

DNA sequencing reaction DNA sequencing reactions are just like the PCR reactions for replicating DNA The reaction mix includes the template DNA, free

Forensic DNA Analysis PCR Polymerase Chain Reaction Forensic DNA Analysis

Reaction of Single-Stranded DNA with Hydroxyl Radical

9.2 Copying DNA KEY CONCEPT The polymerase chain reaction rapidly copies segments of DNA

Modeling DNA Amplification by Polymerase Chain Reaction (PCR)

The Polymerase Chain Reaction - Integrated DNA Technologies - Home

Gene/Reaction Knockouts - USU - 2017.pdf · Gene/Reaction Knockouts • Metabolic engineering has been successful is using the recombinant DNA technology to selectively alter cell

Utilizing Polymerase Chain Reaction and DNA Extraction · PDF fileBy utilizing polymerase chain reaction and DNA extraction, ... follows the general principle of polymerase chain reaction,

Amplification of DNA using the Polymerase Chain Reaction (PCR)

Amplificación de DNA in vitro : PCR (Polymerase Chain Reaction)

Polymerase Chain Reaction. The polymerase chain reaction (PCR) is a test tube method used to amplify a selected DNA sequence without biologic cloning

Polymerase Chain Reaction Cabinets - Fisher Biotec€¦ · What is PCR. Polymerase Chain Reaction* (PCR) is a process where millions of copies of DNA . are amplified from a single

Polymerase Chain Reaction - Open University of Sri Lanka · •PCR, polymerase chain reaction, is an in-vitro technique for amplification of a region of DNA whose sequence is known

Amplification and Detection of DNA Sequences. What you should know Polymerase Chain Reaction (PCR) is the amplification of DNA using complementary primers

12... · Web viewchemical reaction 13. ___ M ___ the subunit of DNA; DNA is made of many of these put together; it has three parts 14. ___ Q __ DNA replication is called this because,

The Polymerase Chain Reaction - Norwell High School...Polymerase chain reaction or PCR – Simplified version – Copies a specific sequence of DNA – Target is – Annealing . PCR:

Polymerase Chain Reaction and DNA Sequencing

Thermus DNA and reaction-amplified · PDF filedirect sequencingofpolymerasechain reaction-amplified DNA ... tion of DNAby the polymerase chain reaction (PCR) (9). Withthismethod,segmentsofsingle-copygenomicDNAcan

The Polymerase Chain Reaction (PCR) file/molecular... · What is the Polymerase Chain Reaction? • Chain reaction by DNA polymerase resulting ... Microsoft PowerPoint

1 Recombinant DNA and Other Topics in Biotechnology Recombinant DNA Technology Preparing Recombinant DNA Amplification of DNA by the Polymerase Chain Reaction

Introduction to DNA DNA Fingerprinting and the Polymerase Chain Reaction

Polymerase Chain Reaction (PCR) · in PCR is Dependent on the Primers • The PCR reaction will amplify the DNA section between the two primers. • If the DNA sequence is known,

Programming colloidal phase transitions with DNA strand displacement · ization reaction, known as toehold exchange or strand displacement, is widely used in the DNA nanotechnology

Polymerase chain reaction amplifying mycobacterial DNA

POLYMERASE CHAIN REACTION AMPLIFYING DNA What do you need to replicate DNA? umZT5z5R8

Programmable patterns in a DNA-based reaction–diffusion system

PCR Polymerase Chain Reaction Mimics the natural duplication of DNA during replication - protein enzyme is called DNA polymerase Allows amplification of

Recombinant DNA and Polymerase Chain Reaction

1 Chapter 2: DNA replication and applications DNA replication in the cell Polymerase chain reaction (PCR) Sequence analysis of DNA

Stable DNA-based reaction–diffusion patterns

Chapter 20 DNA Technology and Genomics. DNA cloning DNA probe hybridization Polymerase Chain Reaction (PCR) Gel Electrophoresis Southern Blot DNA sequencing

The Polymerase Chain Reaction - Semantic Scholar · Polymerase chain reaction or PCR – Simplified version of bacterial DNA replication – Copies a specific sequence of DNA •