Milk broadly consists of lipid, lactose and protein. The protein fraction iscomprised of two general classes--soluble lactoalbumins and the dispersed phase micelle of casein. Casein is a remarkable protein in that it readily undergoes coagulative denaturation under acidic conditions or by action of certain proteinasesdesignated as rennets. The resulting curd is then manipulated to form cheeses and other fermented milk foods.

Ads by GoogleParticle Size Measurementwww.Dispersion.com  Concentrated system. No dilution. Zeta potential optional. Titration

Milk is readily fractionated into lipid and nonlipid fractions. The latter fraction can be dried into a shelf-stable powder designated nonfat dry milk (NFDM). Likewise the whey byproduct of cheese manufacture is readily dried into a stablepowder. Both products are used extensively as functional ingredients in many food products. In general milk and derived milk products are bought and sold on the basis of milk solids content. Most processed milk products have standards of identitydefining the moisture and solids content. In this regard milk solids content is highly variable--for example yogurt is approximately 10% solids and romano cheese approximately 77% solids. Hence yield is highly correlated with recovered milk solids andany method that recovers traditionally lost milk solids into the final product could have substantial economic impact. In the case of cheese, whey solids represent unrecovered material.

With the advent of consumer demand for reduced calorie and no fat variants of standardized products, increased moisture incorporation to reduce caloric density and partially replace lipids is an area of considerable interest. For suchnonstandardized dairy products yield is still indexed to recovered milk solids but additionally is leveraged by increased moisture content; every additional pound of moisture incorporated into the finished product results in a net one pound gain ofproduct. Hence yield enhancement for these products is a combination of milk solids recovery and moisture incorporation, provided a product with satisfactory organoleptic quality can be achieved.

For purposes of describing this invention, yield enhancement or improvement refers to the incremental increase in the amount of recovered product versus a control experiment. The incremental increase will result from a combination of additionalincorporated milk solids and moisture.

The dairy industry has long been concerned with yield improvement (see for example "Factors Affecting the Yield of Cheese" published by the International Dairy Federation (Brussels, Belgium) 197p, 1991 and "Cheese Yield and Factors Affecting ItsControl" IDF (Brussels, Belgium) 540p, 1994). With the exception of products such as yogurt and buttermilk where the entire milk base is conserved, substantial losses of milk solids occur in the whey. Whey solids frequently represent a co-productliability as their cost of recovery matches or exceeds their market value. A method of incorporating more whey solids into fermented dairy products would not only enhance recovered product yield, but could materially contribute to a reduction in wheydischarge.

It has now been found that certain forms of cellulose designated structurally expanded celluloses (SEC) which are described below, have the unexpected effect of dramatically increasing curd yield when incorporated into skim or full fat milk. TheSEC appears to become intimately incorporated into the caseinate gel structure early on reducing the rate and extent of syneresis characteristic of caseinate curds. The result is that more whey and whey protein solids are incorporated into the curdstructure and carried into the low pH cooking environment. Depending on the product, it has been found that much more moisture is retained in mechanically dewatered curds. Insofar as is known, it has not previously been proposed to use SEC in the artof making cheese and fermented milk products.

In order to appropriately define and distinguish structurally expanded cellulose, SEC, from other forms of cellulose and hydrocolloidal polymers and gums mentioned herein, it is necessary to briefly examine cellulose structure and methods ofmanipulation. For example powdered cellulose is known in the art of cheese manufacture as an anticaking agent for ground cheese products. Carboxymethyl cellulose and other cellulose ethers have been considered as useful additives to enhance texture oflow-fat skim and processed cheese products. Hence differentiation of SEC from other types of "cellulose" known in the art of cheese manufacture is important for distinguishing SEC from prior art.

In chemical terms cellulose specifically designates a class of plant derived linear, glucose homopolysaccharides with B 1-4 glycosyl linkage. It is the dominant structural polysaccharide found in plants and hence the most abundant polymer known. The function of cellulose is to provide the structural basis for the supramolecular ensemble forming the primary wall of the plant cell. Differentiation and aggregation at

1

the cellular level are highly correlated with cellulose biosynthesis andassembly. In combination with lignin, heteropolysaccharides such as pectin and hemicelluloses and proteins, the cellulosic containing primary cell wall defines the shape and spatial dimensions of the plant cell. Therefore cellulose is intimatelyinvolved in tissue and organelle specialization associated with plant derived matter. Over time the term "cellulose substance" or simply "cellulose" has evolved as a common commercial describer for numerous non-vegetative plant derived substances whoseonly commonality is that they contain large amounts of B 1-4 linked glucan. Commercially, combinations of mechanical, hydrothermal and chemical processing have been employed to enrich or refine the B 1-4 glucan content to various degrees for specificpurposes. However, only highly refined celluloses are useful substrates for structural expansion. Examples of highly refined celluloses are those employed as chemical grade pulps derived from wood or cotton linters. Other refined celluloses are papergrade pulps and products used in food. The latter are typically derived from nonwoody plant tissues such as stems, stalks and seed hulls.

Refined cellulose can be considered a supramolecular structure. At the primary level of structure is the B 1-4 glucan chain. All cellulose is similar at this level. Manipulation at this level would by necessity involve chemical modificationsuch as hydrolysis or substitution on the glycosyl moiety. However, as outlined next this level of structure does not exist as an isolated state in other than special solvent systems which are able to compete with extremely favorable intermolecularenergies formed between self associating B 1-4 glucan chains.

In contrast to primary structure, a stable secondary level of structure is formed from the nascent B 1-4 glucan chains that spontaneously assemble into rodlike arrays or threads, which are designated the microfibril. The number of chainsinvolved is believed to vary from 20 to 100. The dimension of the microfibril is under the control of genetic expression and hence cellulose differentiation begins at this level. Pure mechanical manipulation is not normally practiced at this level oforganization. However, reversible chemical modification is the basis for commercial production of reconstituted forms of cellulose fibers such as rayon. Chemical substitution by alkylation of the glycosyl moiety yields stable ether substituted B 1-4glycans which no longer self assemble. This reaction forms the basis for the production of commercial forms of cellulose ethers such as carboxymethyl (CMC), hydroxyethyl (HEC), hydroxypropyl (HPC) and methyl or ethyl (MC & EC) cellulose. One furthermodification at the secondary structural level involves intensive acid hydrolysis followed by application of high shear to produce colloidal forms of microcrystalline cellulose (MCC). This modification is best deferred to the next level of structure asmost forms of MCC are partially degraded microfibril aggregates.

The third level of cellulose structure is that produced by the assemblage of microfibrils into arrays and ribbon like structures to form the primary cell wall. As in the case of secondary structure, tertiary structure is under genetic controlbut additionally reflects cellular differentiation. It is at this level that other structural polymeric and oligomeric entities such as lignin and proteins are incorporated into the evolving structure. Selective hydrolytic epolymerization and removalof the non-cellulose components combined with application of sufficient shear results in individually dispersed cellular shells consisting of the cellulosic skeletal matrix. With the removal of strong chemically and physically associated polymericmoieties which strengthen the cellulose motif, structural expansion by mechanical translation and translocation of substructural elements of cellulose can begin to occur.

The process by which structural expansion occurs is that of rapid anisotropic application of mechanical shear to a dispersed phase. Particles of refined cellulose, consisting of cellular fragments, individual cells or aggregates of a few cells,are dispersed in a liquid. The continuous liquid phase serves as the energy transduction medium and excess enthalpy reservoir. While the individual forces maintaining secondary and tertiary structure of the refined cellulose particles are largelynoncovalent and hence of relatively low energy, the domains of collective ensembles possess extraordinary configurational stability due to the large number of interactions. Only by application of intense hydraulic gradients across a few microns and on atime scale that precludes or minimizes relaxation to mere translational capture, can sufficient energy be focused on segments of the refined cell wall to achieve disassembly of tertiary and secondary structure. In practice a small fraction of theapplied energy is captured by structural expansion of the dispersed phase. The vast majority of useful energy is lost into enthalpy of the continuous phase and can complicate processing due to high temperature excursions. As disassembly progresses andthe structures become smaller and selectively more internally ordered, disassembly rates diminish rapidly and the process becomes self limiting.

Three general processes are known in the art of cellulose manipulation to provide structurally expanded celluloses useful for practice of this invention. The simplest is structural modification from intense shear resulting from high velocityrotating surfaces such as a disk refiner or specialized colloid mill, as described in U.S. Pat. No. 5,385,640. A second process is that associated with high impact discharge such as that which

2

occurs in high pressure homogenization devices, such asthe Gaulin homogenizer described in U.S. Pat. No. 4,374,702. The third process is that of high speed, wet micromilling whereby intense shear is generated at the collision interface between translationally accelerated particles, as described in U.S. Pat. No. 4,761,203. It would be expected that anyone skilled in the art could apply one or combinations of the above processes to achieve structurally expanded forms of cellulose useful in the practice of this invention.

The entire disclosures of the above-mentioned U.S. Pat. Nos. 4,374,702, 4,761,203 and 5,385,640 are all incorporated by reference in the present specification, as if set forth herein in full.

Two other commercial modifications are commonly employed at this structural level and are mentioned to distinguish the resulting product from SECs. The first involves indiscriminate fragmentation by various dry grinding methods to producepowdered celluloses and is widely practiced. Such processes typically result in production of multimicron dimensional particles as intraparticle fragmentation and interparticle fusion rates become competitive in the low micron powder particle sizeregion. Typical powdered celluloses contain particle size distributions ranging from 5 to 500 microns in major dimension and may be highly asymmetric in shape. These products are employed as anticaking or flow improvement additives for ground andcomminuted forms of cheese. The second process involves strong acid hydrolysis followed by moderate dispersive shear producing colloidal microcrystalline cellulose (MCC). It is believed that certain less ordered regions comprising tertiary structureare more susceptible to hydrolytic depolymerization than highly ordered domains resulting in shear susceptible fracture planes. Dispersed forms of MCC are needlelike structures roughly three orders of magnitude smaller than powdered celluloses and rangefrom 5 to 500 nanometers in width to longitudinal dimension, respectively. On spray drying MCC aggregates to form hard irregular clusters of microcrystals whose particle dimensions range from 1 to 100 microns. The resulting MCC clusters can serve as aprecursor to a unique SEC best described as a microscopic "puff ball" reported in U.S. Pat. No. 5,011,701 and is reported to be a fat mimetic. MCC also finds application as a rheology control agent in processed cheese products.

Finally, the quaternary or final structural level of cellulose is that of the cellular aggregate and is mentioned only for completeness. These substances may be highly lignified such as woody tissue or relatively nonlignified such as thosederived from the structural stalks and seed hulls of cereal grain plants. Commercial types of these materials are basically dried forms of nonvegetative plant tissue. These moderately elastic substances respond to mechanical processing by deformationand ultimate fracture along the principal deformation vector. Consequently, these materials readily undergo macroscopic and microscopic size reduction and are reduced to flowable powders by conventional cutting, grinding or debridement equipment. Because of the cohesive strength of the molecular ensemble comprising quaternary structure, these materials are not candidates for systematic structural expansion at the submicron level without chemical intervention.

Structural expansion as defined herein is a process practiced on refined celluloses involving mechanical manipulation to disassemble secondary and tertiary cellulose structure. The ultimate level of expansion would be to unravel the cell wallinto individual microfibrils. Although plant specific, a typical microfibril is best described as a parallel array of 25 to 100 B 1,4 glucan chains with diameter in the 50 nanometer range and variable length ranging from submicron to micron multiples. In practice generation of a dispersed microfibril population is not a realistic objective and only of academic interest. What is usually achieved because of the relatively indiscriminate application of mechanical energy is a highly heterogeneouspopulation of miniature fibrils, ribbon-like and slab-like structures. These structures display irregular distention of individual microfibrils and aggregates of microfibrils from their surfaces and at internal and external discontinuities. The ensuingcollage consists of an entangled and entwined network of cell wall detritus to form a particle gel. Some of the larger structural features with dimensions in the micron range are discernible with the light microscope; however higher resolutiontechniques such as scanning transmission electron microscopy are necessary for detailed observation of submicron features. This particle gel network exhibits a vast increase in surface area associated with the volumetric expansion and projection of cellwall structure into the continuous phase medium. Lastly, structurally expanded celluloses useful for purposes of this invention may be further characterized by possessing a water retention value greater than 350 and a settled volume of at least 50% fora 5% w/w dispersion of said SEC in aqueous media.

It is contemplated that certain soluble hydrocolloids may be useful in practice of the invention. Dispersive hydrocolloids such as carboxymethylcellulose, CMC, are believed to bind to SECs through interaction of unsubstituted regions on theglucan backbone with the SEC surface, perhaps on the distended microfibril. The presence of carboxymethyl substituents imparts anionic polyelectrolyte character to the CMC backbone and hence on its association with SEC imparts a stationary negativecharge to the SEC surface. This stationary charge is believed to help control flocculative association of SEC and perhaps enhance

3

interaction with colloidal lipid and casein micelles. Other associative hydrocolloids which bind to cellulose such asglucomannans (for example guar gum) help to control water mobility. Colloids, such as MCC, and hydrocolloids, such as xanthan and gellan gums are SEC interactive and assist in fine tuning gel structure for the colloidal-network caseinate system. Locustbean gum, konjac gum, pectin and the like may also be used for this purpose.

The effect of SEC on curd yield is dramatic, particularly when used in the range from about 0.05% to about 0.5%, based on the weight of the milk with which it is admixed. For example the incorporation of SEC at levels of 0.1% w/w based on fluidmilk result in significant yield improvements two orders of magnitude greater than the incremental percent of SEC solids. The incorporation of SEC into fluid milk is readily achieved using both dried and prehydrated paste forms. The following examplesare illustrative for practice of the invention by one normally skilled in the art and are not intended to limit its scope. 

DESCRIPTION OF THE INVENTION AND EXAMPLES

Two methods for characterizing SEC are useful for purposes of practicing this invention. The first is a simple settled volume test. A powdered or prehydrated SEC is fully dispersed at a specified mass into a specified volume of water. Theapparatus usually employed to measure settled volume is the graduated cylinder. The dispersed cellulose phase is allowed to gravity settle to a constant bed volume (usually 24 hr) which to a first approximation reflects the specific dispersed phasevolume or degree of structural expansion. SEC useful for practicing this invention is characterized by gravity settled volumes of at least 50% for a 5% w/w aqueous suspension of cellulose. For example a 5% w/w suspension of powdered cellulosescharacterized as 200 mesh from cottonseed (BVF-200, International Filler Corporation, North Tonawanda, N.Y.), refined wood pulp (BW-200, Fiber Sales & Development Corporation, St. Louis, Mo.) and refined soy hulls (FI-1, Fibred Inc., Cumberland, Md.)yield settled volumes of 31.2%, 23.2% and 22.4%, respectively in 24 hr. These forms of cellulose while potential precursors for SEC are readily distinguished from SEC by this test. A second method of characterization involves viscometry. SEC begins toform volumetrically sustainable, continuous particle gels at concentrations in the vicinity of 0.5% w/w in the absence of other dispersed substances. This critical concentration may be significantly reduced in the presence of other dispersed colloidalmatter. The onset of formation of the particle gel and the gel strength are characteristic of the type of SEC and the degree of structural expansion. Typically, the particle gels exhibit well behaved, reversible pseudoplastic behavior in the 1% to 3%w/w concentration range. This behavior can be modeled by the power law using a rotational viscometer such as the Brookfield DVIII, a programmable rheometer (Brookfield Engineering Laboratories, Inc., Stoughton, Mass.). A log/log plot of the shear rateversus shear stress at a specified concentration gives two characteristic system parameters: the flow index and consistency index. The consistency index is reflective of intrinsic gel strength (resting state extrapolation) and the flow index which isindicative of the degree of pseudoplasticity or dynamic particle/particle shear dependent interactivity. SECs useful for the practice of this invention are preferably characterized by displaying pseudoplastic behavior which is modeled by the power law. In the range of 1-2% w/w at 20 deg. C. the preferred SECs display flow indexes less than unity and typically in the range of 0.2 to 0.7. The preferred consistency indexes typically range from 500 to 10,000 cp.

In the following examples, actually fermented cheese products are made in the usual way with the improvement that SEC is dispersed in milk at the beginning of the process. Thereafter, the appropriate culture is added to the milk which is thenallowed to ferment for the prescribed time, depending on the type of cheese, to establish a robust culture. A coagulant, e.g., rennet, is added or not, as the case may be. The coagulum is cut into pieces and then subjected to conditions causing waterto be expressed from the coagulum, which may be gravity draining, melting/agglomeration or mechanical pressing, it can again depending on the type of cheese.

Example 1

Skim Milk Curd

Four gallons of pasteurized skim milk were equilibrated at room temperature and pooled. The pooled milk contained 8.09% nonvolatile solids (104° C. oven to constant weight, typically 24 hr.). For each of four experiments a 3500 portionwas microwaved to reach a temperature of 88° F. A never dried paste concentrate of SEC from refined cotton seed linters (CS-SEC) was prepared as described in U.S. Pat. No. 5,385,640. The experiments were conducted at CS-SEC concentrations of0.00, 0.11, 0.17, and 0.22% w/w. The solids content of the paste was 6.66% on an "as is" basis and the power law characterization parameters were 0.35 and 4838 cp for the flow index and consistency index, respectively, determined for a 1.5% w/w aqueousdispersion at 20° C. The indicated amounts paste form of the CS-SEC was initially mixed

4

with sufficient milk to give a volume of 500 ml and dispersed into the milk by means of a rotor/stater dispersator (Omni Mixer ES, Omni International,Gainesville, Va.) operating with a 35 mm generator at 6000 rpm for 3 minutes. After dispersing the CS-SEC, it was added to the remainder of the milk plus any additional water and mixed on the dispersator assembly for 3 minutes at 8000 rpm. The activeculture was added two minutes into the mixing process. The culture employed was a freeze dried, mesophilic lactic culture (R707 Chr. Hansen, Inc., Milwaukee, Wis.). It was a direct vat culture (DVC) used at 1 unit/gal of milk. The culture wasprepared by addition of 1.54 g lyophilized powder to 120 g skim milk. After 15 minutes hydration, the culture was dispersed by means of a small hand held dispersator (Omni 1000, Omni International) operating a 10 mm generator for 1 min at 10000 rpm. A25 g aliquot of the culture solution was used for each 3500 g (approximate one gallon) milk experiment. The composition of each experiment is summarized in TABLE 1.

TABLE-US-00001 TABLE 1 skim CS-SEC culture milk paste water mixture #1 3500 g - 0 - 120 g 25 g #2 3500 g 60 g 60 g 25 g #3 3500 g 90 g 30 g 25 g #4 3500 g 120 g - 0 - 25 g

The mixtures were placed in a circulated air oven to incubate at 88 deg. F. (31 deg. C.). After one hour 0.25 ml of microbial chymosin (Chymax II, 50000 MCU/ml, Chr. Hansen, Inc.) was added to each and the incubation continued until the pHreached 4.6 (approximately 6 hours). The curds were cut and allowed to relax for 15 minutes. The following sequence of heating by microwave and gentle mixing was initiated to cook the curds. Each container containing the cut curds was first microwavedto reach a temperature of 107 deg. F. and placed in a circulated air oven at 130 deg F. After one hour the containers and contents were microwaved again to 125 deg F. and reincubated. After another 1.5 hour the containers and contents were microwavedto 130 deg F. and reincubated. Finally, after one hour the containers and contents were microwaved to 147 deg F. This ramped sequence of temperature increases represents a convenient laboratory scale, curd cooking protocol. After one hour the cookedcurd was drained using a cheese cloth lined colander at room temperature for 12 hours. The mass of recovered curd and whey was recorded and the nonvolatile solids of each fraction determined (104 deg C. to constant weight). The mass balance results aresummarized in TABLE 2.

TABLE-US-00002 TABLE 2 Starting whey curd final solids* solids solids solids % recovery #1 283.2 g 189.7 g 113.4 g 303.1 g 107% #2 287.2 g 175.3 g 124.8 g 300.1 g 104% #3 289.2.sup. 172.8 g 126.8 g 299.6 g 104% #4 291.2.sup. 177.2 g 135.4 g312.6 g 107% *milk solids @ 8.09% × 3500 g + CS-SEC solids

The mass balance appears self consistent from the above data. TABLE 3 summarizes the key yield parameters.

TABLE-US-00003 TABLE 3 % recovery of curd solids net yield of curd solids based on starting solids versus control #1 40.0% -- #2 43.4% 8.5% #3 44.1% 10.0% #4 46.5% 16.2%

It is clear that small amounts of CS-SEC impart relatively large systematic yield increases in curd yield as a function of increasing concentration.

Example 2

Cottage Cheese

Cottage cheese represents a fermented cheese product with the simplest curd processing. Basically, the cut, cooked curd is washed, salted and at the option of the processor remixed with a cream based dressing. A similar procedure to EXAMPLE 1was used for curd production with the exception that a mixed frozen culture was used. One gram of frozen cultures LB-12 and St-C-5 (Chr. Hansen, Inc., Milwaukee, Wis.) representing thermophilic lactic cultures Lactobacillus and Streptococcus,respectively, were dispersed into 105 g of skim milk according to the protocol of EXAMPLE 1. The skim milk was not pooled, but each gallon possessed the same production time stamp and the average solids content was 8.25%. The composition of eachexperiment is summarized in TABLE 4.

TABLE-US-00004 TABLE 4 Skim CS-SEC milk Water paste #1 3836 g 80 g - 0 - #2 3845 g 40 g 40 g #3 3842 g 20 g 60 g #4 3851 g - 0 - 80 g

After final cooking of the curd was complete, the curds were then suspended in two liters of cold water and gravity drained in a cheesecloth lined colander for 16 hours under refrigerated conditions. The drained curds were salted at 1% w/w. Theresults are summarized below in TABLE 5.

5

TABLE-US-00005 TABLE 5 First Wash Final Curd salt % % weight weiqht yield addn solids yield #1 663.4 g 588.0 g 100% 5.9 g 15.8 100 #2 783.3 g 684.8 g 117% 6.8 g 14.9 110 #3 1111.0 721.5 g 123% 7.2 g 14.7 114 #4 1233.8 733.0 g 124% 7.3 g 14.9 117

It is seen that the curd yield which represents both additional water and solids capture slightly exceeds the recovered solids yield of the right hand column. A major yield improvement arises from the first increment of CS-SEC representing 0.1%w/w CS-SEC solids.

Example 3

Mozzarella Cheese

Mozzarella cheese represents a form of cheese in which the cooked curd is thermally melted and dewatered in situ. The coalesced curd mass is formed into a ball and incubated in a saturated brine solution. A 3700 g aliquot of pasteurized skimmilk at 8.14% nonvolatile solids was equilibrated to room temperature (66 deg. F.). The control contained 60 g water plus 25 g of mixed culture and the test contained 60 g of the CS-SEC paste plus 25 g mixed culture solution described in EXAMPLE 2. The mixing, incubation and coagulation protocols were the same as in EXAMPLE 1 except the temperature was 92 deg. F. (33.5 deg C.). After cutting the curd the cut curd mixture was heated to 110 deg. F. (33.5 deg. C.) using a microwave oven. After 1hour the whey was drained to the level of the curd and the incubation continued at 110 deg F. until the pH reached 5.2. The curd was then drained and washed once with 1 liter of water. Salt was added at 0.75% w/w based on curd weight and the curd wasimmersed in 2 liters of water at 160 deg. F. The melting and coalescing curds were pressed into a coherent mass by means of a large wooden spoon. The curd mass was formed into a ball within a cheese cloth shroud and incubated in a saturated salt brinefor 2 hours. The results of the experiment are summarized in TABLE 6.

TABLE-US-00006 TABLE 6 Skim CS-SEC Water Final Cheese % % solids yield weight weight weight yield solids recovered #1 3700 g - 0 - 60 g 239.8 g 100% 46.4 36.9 #2 3700 g 60 g - 0 - 275.2 g 115 39.6 36.2

The results indicate that the yield of skim milk solids remained about the same and that the yield increase was largely due to additional water incorporation.

Example 4

Cheddar Cheese

Cheddar cheese represents a mechanically dewatered curd which is press formed into a wheel or plug shape, peripherally sealed and subsequently aged. During the latter process it undergoes an aging and fermentative development to develop a uniqueflavor profile. The yield of the cheese however is set prior to the aging process.

For the experiment described below a specialized pneumatic press was constructed to run four simultaneous experiments. It consisted of four parallel mounted pneumatic air cylinders each possessing an internal drive cylinder diameter of 2.5inches. The drive rod was connected to a Clevis adaptor attached to a 4.5 inch diameter plastic driver enclosed within a 4.6 inch diameter cylindrical press housing. Holes in the sides of the housing were drilled to allow vertical drainage of theexpressed whey. The bottom segment of the cylinder contained an elevated but structurally supported coarse lattice platform for bottom drainage. The assembly was pressurized by means of a nitrogen gas tank and the pressure regulated with a two stagediaphragm regulator. Typically the press cylinder was lined with nylon cheese cloth. A 4.25 inch circular 60 mesh stainless steel screen was employed as a retaining barrier and for support of the liner against the lattice base. The curd mass to bepressed was packed into the lined cylinder and the cheese cloth liner carefully folded over the top of the packed curd. A second 60 mesh stainless steel circular screen segment was placed on top and the drive assembly manually positioned in place. Thevolumetric compression of cheeses in the experiments to be described were not limited by mold design stops as are commercial presses. This allows unrestricted compression which is limited only by the compressibility or intrinsic water holding capacityof the curds in question. This provides a measure of the true cheese yield at equivalent compressive equilibrium conditions for an experimental set in which one or more parameters are systematically varied. Commercial yields would be in excess of thosereported here due to much greater water retention associated with controlled volumetric compression.

Pasteurized skim milk with a nonvolatile solids content of 8.40% w/w was used. CS-SEC past and BVF-200 (a powdered cotton seed cellulose) were identified and sourced previously. The culture used was the

6

lyophilized lactic acid preparation R707identified previously and used at 1.5 g per 3800 g skim milk. It was suspended in 100 ml of the skim milk and allowed to hydrate for 15 min. at which time it was dispersed by use of the Omni 1000 operating at 10000 rpm, 10 mm generator for 1 min. Thepredispersion of CS-SEC and BVF-200 prior to incorporation into the skim milk base was similar to that described in EXAMPLE 1. The skim milk base was preheated to 90 deg F. prior to admixing with the other components. The culture was added in sequencealso described in EXAMPLE 1. The composition of the experimental set is summarized in TABLE 7.

TABLE-US-00007 TABLE 7 Skim CS-SEC BVF-200 Culture milk Water paste fiber solution #1 3800 g 120 g - 0 - - 0 - 100 g #2 3800 g - 0 - 120 g - 0 - 100 g #3 3800 g 112 g - 0 - 8 g 100 g #4 3800 g 104 g - 0 - 16 g 100 g

The primary fermentation was run for 1 hr at 90° F. A 0.7 ml aliquot of Chymax II was added and the coagulation allowed to occur for 1 hr. The curd was cut and allowed to heal for 15 min. at which time the temperature was raised to100° F. by microwave treatment. The whey was drained by decantation and cheddaring started in a 100° F. circulating air oven. The curds were turned approximately every 15 minutes. After two hours the curd mass was shredded and salted(8 g) and incubated 15 min before moving to the press stage. The pressing sequence was 10 min @ 10 psi, rotate the press cake, 10 min @ 10 psi and rotate the press cake and 8 hr @ 40 psi. Note: the pressure reflects primary cylinder pressure wherebythe actual pressure at the press cake is 0.55 of the cylinder discharge pressure. The pressed cake was unloaded from the press assembly and encompassing cheese cloth, blotted and weighed. The pressed cheese cakes were then air dried for 48 hr on acutting board, turning the cheese piece approximately every 12 hr. After drying the individual cheese pieces were enrobed with wax and stored at 34-40° F. to age. At the time of this disclosure the cheeses were 5 months into their agingprocess. No organoleptic or moisture analyses have been performed on these cheeses to date and await the 12 month aging stage anniversary. The results of the experiment are summarized in TABLE 8.

TABLE-US-00008 TABLE 8 Curd Pressed Yield CS-SEC BVF-200 weight weight % DB wt DB wt #1 290.8 g 232.9 g 100% - 0 - - 0 - #2 517.0 g 312.4 g 133% 8 g - 0 - #3 325.6 g 254.8 g 109% - 0 - 8 g #4 353.5 g 249.2 g 107% - 0 - 16 g

The results show a substantial improvement in the exhaustively pressed cheese product for the CS-SEC at 0.2% w/w. The increased yields for the powdered cellulose were marginal at twice the concentration. Lastly, the pressed cheese based on SECwas uniform while the powdered cellulose containing cheeses were mottled and indicative of clumped aggregates of cellulose. These clumps presumably were the result of settling of the powdered cellulose particles to the bottom of the container duringcoagulation and continued segregation during shredding, subsequent mixing and pressing.

Example 5

Cheddar Cheese

In this example another form of cellulose is compared to SEC. Microcrystalline cellulose (MCC) has been described earlier and a commercially redispersible form CL-611 (FMC Corp., Philadelphia, Pa.) was used as a comparison. MCC is not consideredan SEC but is a colloidally dispersible form of cellulose that forms particle gels in the presence of CMC, albeit at higher concentrations than SEC. The purpose of this experiment was to show that SEC is much more effective than MCC in the production ofenhanced yields of cheddar cheese. The protocol of EXAMPLE 5 was employed with the same skim milk solids. MCC Cl-611 was used at the same concentrations as BVF-200 of the prior example. TABLE 9 summarizes the results.

TABLE-US-00009 TABLE 9 Curd Pressed Yield CS-SEC MCC weight weight % DB wt DB wt #1 322.6 g 254.9 g 100% - 0 - - 0 - #2 468.4 g 304.5 g 119% 8 g - 0 - #3 340.9 g 271.0 g 106% - 0 - 8 g #4 366.6 g 264.0 g 104% - 0 - 16 g

The results show that MCC at twice the concentration of SEC does not substantially improve pressed weight yield of cheddar.

Example 6

Processed Cheese

It is anticipated that SEC's will find extensive use in processed cheeses in addition to their use in naturally

7

fermented cheeses. The same interactions of SEC with the caseinate microcell that have been demonstrated to occur when premixed withmilk and subsequently coagulated are expected to be found in the case of admixture with precoagulated caseinates such as regular cheese melts and isolated sodium or calcium caesinates.

The present invention relates to the making of cheese, and particularly to the making of cheese ripened for two or more months such as Cheddar and Colby cheese.

Milk from many different mammals is used to make cheese, though cow's milk is the most common milk for cheese. Generally, cheese is made by developing acidity in milk and setting the milk with a clotting agent, such as rennet. The set milk iscut and whey is separated from the resulting curd. The curd may be pressed to provide a cheese block. The cheese-making process is essentially a concentration process that captures a portion of the protein, minerals, fat, water, and other minorcomponents present in the original milk component. Rennet-based cheeses include cheeses such as mozzarella, Cheddar, Swiss, and Colby cheese. In a typical Cheddar cheese, the concentration factor is about ten times, i.e., approximately 10 lbs ofnatural Cheddar cheese are produced from 100 lbs of milk, with the remaining (90 lbs or so per 100 lbs milk) of material removed in the whey byproduct. Typical Cheddar cheese has 1.4 g lactate per 100 g and contains 37.5% water.

Curing typically takes place over a lengthy period of time under controlled conditions. Cheddar cheese, for example, is cured for a period of at least four months and may be cured for a period in excess of one year to obtain the full flavordesired in cheddar cheese.

In contrast to the natural cheese-making process, process cheese is not manufactured directly from milk and process cheese manufacture does not produce any byproducts. Process cheese is produced by combining natural cheese, other dairy basedingredients, water and emulsifying salts into a blend that is subsequently heated (typically to at least 65.5° C. for not less than 30 seconds, see 21 C.F.R. 133.169) and mixed to produce a homogeneous product.

Recently, use of concentrated milk as the base ingredient for making cheese has become more popular. Milk can be concentrated prior to cheese making using a variety of techniques including ultra-filtration, micro-filtration, vacuum condensation,or the addition of dry milk solids such as nonfat dry milk. The use of concentrated milk provides increased efficiency to the cheese-making process. Use of concentrated milk also reduces the amount of whey produced for a given amount of cheese,facilitates standardization of formulation and production, and promotes more consistent quality and yields of the resultant cheese. The use of concentrated milk thus lowers cost and processing times for making cheese, particularly beneficial forsemi-continuous cheese manufacturing processes such as utilized in typical large-scale cheese plants. The semi-continuous cheese manufacturing includes numerous cheese vats that sequentially feed a draining/conveying belt and a salting belt. Thissemicontinuous cheese making system requires consistent and rapid production of acid by starter cultures used in the cheese manufacturing process. The efficiency of semi-continuous cheese manufacturing is substantially improved if the milk isconcentrated prior to cheese-making.

During the aging process, calcium lactate crystals can grow within and on the surface of cheese. These crystals are small white spots that can be seen, often without magnification, upon close inspection of the cheese. The crystals are notpresent in the cheese immediately after manufacture, but typically start to appear between two and six months of aging. While the calcium lactate crystals are not harmful to consumers, they can be perceived in mouthfeel as adding a slight amount ofgrittiness to the cheese. More importantly for affecting cheese sales, consumers often believe the crystals are mold. The growth of calcium lactate crystals is thus viewed as a defect representing substantial financial loss for cheese manufacturers.

For reasons that are not entirely clear, the use of concentrated milk and a semi-continuous cheese making process in making an aged cheese seems to worsen the calcium lactate crystal problem. Consequently cheese manufacturers have an unenviablechoice: they can either use a less efficient cheese-making process or they can use a more efficient manufacturing process that more likely results in calcium lactate crystals defects.

Factors influencing the formation of calcium lactate crystals have been extensively studied. Concentrations of calcium and lactate ions existing in cheese serum are very close to saturation, and small increases in the concentration of eithercomponent could result in super saturation and crystallization. It has also been theorized that milk citrate levels and the subsequent utilization of citrate by microorganisms may play a role in calcium lactate formation. Curd washing, curing, andstorage temperature may further contribute to

8

calcium lactate crystal formation. Other studies report that calcium lactate is formed when L (+)-lactate is converted into a racemic mixture of L(+)- and D(-)-lactate, the latter being much more prone tocrystallization. The conversion of L(+)-lactate to D(-)-lactate is thought to be carried out by certain strains of bacteria.

Prior art methods for limiting calcium lactate crystal formation in cheese include: 1) reducing the concentration of lactic acid in the final curd, 2) reducing or eliminating undesirable non-starter lactic acid bacteria ("NSLAB") from thecheese-making process, 3) controlling storage temperature, and 4) vacuum packaging cheese to minimize the airspace around the outer cheese surface. The use of certain starter culture strains may also increase or decrease the presence of calcium lactatecrystals, due to post manufacture fermentation by the selected starter culture.

Although progress has been made in developing strategies for prevention of calcium lactate crystals, the defect is still prevalent. Better methods of minimizing calcium lactate crystal formation in aged cheeses are needed.

BRIEF SUMMARY OF THE INVENTION

The present invention is a method of adding one or more ingredients to the typical cheese-making recipe to inhibit the growth of calcium lactate crystals as the cheese ages, and the cheese composition made by such a method and recipe. Thepreferred method of adding the calcium lactate crystal inhibitor is during the salting stage of the cheese-making process, and the calcium lactate crystal inhibitor may be provided in a salt carrier. The preferred added calcium lactate crystal inhibitoris gluconate provided by sodium gluconate, but other ingredients such as the sodium salts of organic acids sodium malate and sodium lactobionate and similar ingredients, are also beneficial. A method for modeling the beneficial prospects of the calciumlactate crystal inhibitor includes observing crystal formation on sand paper after storage in a calcium lactate solution containing the calcium lactate crystal inhibitor and performing calcium and lactate analyses on such stored solutions.

DETAILED DESCRIPTION

The present invention modifies conventional cheese-making and begins, as all cheeses do, with milk. Preferably the milk is whole cow's milk having 3 to 4% butterfat and in excess of 7% solids non-fat. However, it is believed that cheeses formedfrom milk of other mammals will similarly benefit from the present invention, as will cheeses formed from milks with different fat (including non-fat) and/or different solids non-fat concentrations.

The preferred milk starting ingredient is preferably concentrated to achieve efficiencies in the cheese-making process. Preferably the solids content of the milk is increased to have total solids within the range of 13 to 50%, more preferablywithin the range of 13 to 18%, and most preferably to have total solids within the range of 14 to 15%. While the concentrated milk could be formed merely by adding condensed skim milk, ultrafiltered skim milk, microfiltered skim milk or non-fat dry milksolids to the starting milk, more preferably the concentrated milk includes an addition of fat as well as non-fat milk solids. The preferred concentrated milk may thus be formed by adding various amounts of condensed skim milk, ultrafiltered skim milk,microfiltered skim milk or non-fat dry milk solids and cream to whole milk, thereby retaining the ratio of casein to fat present in whole milk. Calcium chloride may be added to the milk ingredient to generate firmer curds. Fortifying ingredients orcolorings may also be added to the milk ingredient.

The milk ingredient is acidified. If desired, the acidification can be achieved by adding an acidic ingredient, such as citric acid or tartaric acid, or through natural bacterial acidification. More preferably, the acidification is achieved byadding a starter culture, such as a mesophilic (lactococcus lactis ssp cremoris), thermophilic (streptococcus thermophilus) or helvetic (lactobacillus helveticus) bacteria culture. Most preferably (for Cheddar cheese) a mesophilic starter culture isused. If a starter culture is used, the mixture is then incubated between about 10 and 60 minutes, preferably about 30 minutes at a temperature between about 30 and 37° C., preferably about 31 to about 32° C.

After acidification, a coagulating agent, preferably rennet at about 0.02 to about 0.1 percent, is added to act on the casein and cause the milk ingredient to coagulate. The rennet may be animal, microbial or vegetable. The mixture is furtherincubated between about 10 and 60 minutes, preferably about 30 minutes, at a temperature between about 30 and 370° C., preferably about 31 to about 32° C. The addition of a coagulating agent, preferably rennet, causes the milk tocoagulate into a mass.

After coagulation, the mass is cut, stirred, and heated (i.e., from about 30 to about 42° C. and preferably

9

from about 31 to about 39° C.) for between about 10 and about 60 minutes, preferably about 30 minutes. The whey isdrained off and the curd is matted into a cohesive mass in the traditional Cheddaring process or is intermittently stirred when using the stirred curd process. Subsequently in the traditional Cheddar process the mass is cut into pieces and salted,whereas in the stirred curd process the curd is simply salted. About 1 to about 4% salt, and preferably about 1.5 to about 3% salt is added to the curd. The preferred salt is sodium chloride added most preferably (for a Cheddar cheese) at about 2.75%. The salted curd is stirred, further drained and pressed into forms. Approximately 65-90% of the salt added is retained in the cheese, and thus consequently a typical Cheddar cheese has 1.5 to 2.0% salt. The cheese is then aged for a time period inexcess of one week, preferably from one month to one year, and most preferably about 4 months prior to consumption.

Within this conventional cheese-making process, a calcium lactate crystal inhibitor ("CLC inhibitor") is added. The CLC inhibitor decreases the growth of calcium lactate crystals in cheese, such that the volume of calcium lactate crystals aftertwo months or more aging time is reduced by at least 50%. The preferred CLC inhibitor is gluconate. Alternative preferred CLC inhibitors include: malate, acetate, citrate, succinate, propinate, galactonate, and lactobionate. Polyphosphate might alsowork as a CLC inhibitor, such as provided in sodium polyphosphate. Salts of organic acids with a lower molecular weight like gluconate (C6H.sub.11O.sub.7; MW=195) and malate (C4H.sub.4O.sub.5; MW=132) are preferred over higher molecular weightorganic acids like lactobionate (C12H.sub.22O.sub.12; MW=358). This is the case because for a larger molecular weight, a larger amount of the salt of the organic acid is required to have the same molar concentration. Consequently a larger amountof sodium lactobionate would be required as compared to sodium gluconate or sodium malate to be an effective calcium lactate inhibitor.

The beneficial results of the present invention are believed to be primarily achieved by increasing the solubility of calcium, lactate and/or calcium lactate in the water component of the resultant cheese, which is believed to occur through theformation of metastable complexes with the CLC inhibitor and one or both of calcium and lactate. As used herein, the term "metastable complex" means that the compound is a mixture of various crystalline and non-crystalline forms and solid solutions ofthe CLC inhibitor ions and one or both of calcium ions and lactate ions, as well as salts of these ions, which does not reach final equilibrium in the cheese over an aging time period in excess of two weeks. The metastable complexes appear to havecombinations of crystalline and amorphous states. The CLC inhibitor appears to form metastable complexes which effectively remove one or both of the calcium and lactate ions from being available for the formation of calcium lactate crystals within thecheese during the aging process. The preferred CLC inhibitor is added in an effective amount to increase the solubility of lactate by at least 1 g/100 g water when calcium is also present at a concentration of at least 1.06%, taken at cheese agingtemperature. For instance, cheddar cheese is aged under refrigeration, so the CLC inhibitor increases the solubility of lactate in water by at least 1 g/100 water at 4° C. More preferably, the CLC inhibitor is added in an effective amount toincrease the solubility of lactate in water by at least 2.76 g/100 g water, thereby at least doubling the solubility of lactate in water when calcium is also present. Most preferably, the CLC inhibitor provides nearly a four fold increase in thesolubility of lactate in water when calcium is also present.

The solubility of anhydrous calcium lactate has been report to be 3.38, 4.04, and 6.41 g of CaLac2/100 g of water at 4, 10, and 24° C. respectively. Since cheese is often refrigerated during the aging process, the value at 4° C. of 3.38 g of anhydrous CaLac2/100 g of water is viewed as most important for the present invention. The molar ratio of lactate in CaLac2 is 81.6%, so 3.38 g of anhydrous CaLac2/100 g of water provides 2.76 g of lactate/100 g of waterand 0.62 g calcium/100 g of water. Thus, it is believed that calcium lactate crystals only form when greater than 2.76 g of lactate/100 g of water and 0.62 g of calcium/100 g of water are present in the cheese. Cheddar cheese contains approximately0.70% calcium. A portion of this calcium is bound to the protein network present in the cheese, whereas a portion is soluble in the water phase of cheese and is called soluble calcium. This so called soluble calcium is available to interact withlactate and participate in the formation of calcium lactate crystals. After the first week of ripening Cheddar cheese has about 0.4 g of soluble calcium/100 g of cheese. As mentioned previously a typical Cheddar cheese has 37.5% water. Consequentlythe concentration of soluble calcium in the water portion of a typical Cheddar cheese is 1.06 g/100 g of water (0.4/37.5×100). Additionally, typical Cheddar cheese has 1.4 g lactate per 100 g and again contains 37.5% water. Consequently theconcentration of lactate in the water portion of typical Cheddar cheese is 3.73 g per 100 g of water (1.4/37.5×100). Since 3.73 g lactate/100 g water and 0.06 g calcium/100 g water present in Cheddar cheese is larger than the 2.76 g of lactate/100g water and 0.62 g calcium/100 g water that is required to exceed the solubility of 3.38 g of anhydrous CaLac2/100 g at 4° C., it is no surprise that calcium lactate crystals are a major defect in many prior art cheddar cheeses.

The presence of gluconate, for instance, can increase the solubility of calcium lactate. This increase in

10

solubility of calcium lactate is believed to be the result of metastable complexes formed between gluconate and one or both of calcium andlactate. In order to prevent the formation of calcium lactate crystals as a result of formation of metastable complexes, a molecule of gluconate must be present for each molecule of calcium or lactate in excess of the 3.38 g of anhydrous calcium lactatethat is soluble in 100 g of water at 4° C. The concentration of 3.38 g of anhydrous calcium lactate/100 g water represents 0.127 moles of lactate and 0.028 moles of calcium. The typical concentration of 3.73 g of lactate/100 g of water in cheeserepresents 0.210 moles of lactate whereas the 1.06 g of calcium/100 g of water in cheese represents 0.265 moles of calcium. These calculations demonstrate that the molar concentration of calcium in excess of the molar concentration required for calciumlactate crystal formation (0.265-0.028=0.237) is larger than the molar concentration of lactate in excess of the molar concentration required for calcium lactate crystal formation (0.210-0.127=0.0834). Since the excess molar ration of lactate is smallerthan the excess molar ratio of calcium it can be used to determine the concentration of the gluconate required to form metastable complexes between calcium lactate and gluconate that will prevent the formation of calcium lactate crystals. For example,as previously mentioned, in typical Cheddar cheese the excess molar concentration of lactate is 0.0834. Consequently the incorporation of 0.0834 moles of gluconate into the water portion of cheese is required. This corresponds to 0.619 g ofgluconate/100 g of cheese.

If gluconate is used as the calcium lactate crystal inhibitor, the amount of gluconate should provide an amount of free gluconate which results in effective inhibiting of calcium lactate crystal growth. The preferred gluconate addition resultsin the inclusion of greater than zero to 5.8% gluconate in the final cheese products, and more preferably greater than zero to 4.5% gluconate in the final cheese product. Even more preferably, the gluconate is added to result in about 0.26 to 2.8%gluconate in the final cheese product, with the most preferred amount being 0.62% gluconate in the final cheese product.

The beneficial results of the present invention are believed to be secondarily achieved by a combination of additional factors. In particular, the preferred CLC inhibitors are believed to slow the bacterial production of additional lactic acidby the culture in the cheese. The preferred CLC inhibitors are also believed to affect the proteins within the cheese, causing the proteins to better bind water. The preferred cheeses in accordance with the present invention thus exhibit less weepingthan without the addition of the CLC inhibitor. The preferred CLC inhibitors are also believed to result in a change in pH of the cheese during ripening. As an additional secondary benefit, the preferred CLC inhibitors are believed to suppressbitterness in the cheese. The cause and effect relationships and interrelatedness of these various secondary factors (reduced lactic acid production, better water binding in proteins, change pH curve during ripening, decreased bitterness) in relation tothe formation of metastable complexes and changes in calcium, lactate and/or calcium lactate solubility is not known, but further study is being conducted.

The CLC inhibitor needs to be incorporated into the cheese during the manufacturing process, prior to aging. It could, for instance, be added to the starting milk ingredient, to the concentrated milk, to the starter culture or to the rennet. The preferred method for adding the CLC inhibitor, however, is during the salting step. This allows the use of a granulate form of the CLC inhibitor while minimizing the amount of the CLC inhibitor lost during whey separation, and without needlesslyincreasing the processing complexity of the cheese. The preferred CLC inhibitor ingredient is accordingly a salt, at least one of the ions of which increases the solubility of lactate in water. The addition of CLC inhibitor of the present invention isparticularly contemplated as being beneficial in natural, aged cheeses.

Sodium gluconate is the sodium salt of gluconic acid. Once sodium gluconate is incorporated into cheese during the salting step, it is believed to become solubilized in the water phase of the cheese, providing the necessary gluconate to formmetastable complexes of calcium-lactate-gluconate and prevent formation of calcium lactate crystals. Other edible salts of gluconate could alternatively be used, such as potassium gluconate.

The normal range of lactate found in Cheddar cheese is 1.1 to 1.9%. Sodium gluconate added during the salting step of cheese manufacture is believed to be retained at a rate similar to the retention of salt (approximately 65-90%). Accordingly,the preferred sodium gluconate of the present invention is added in a range of about 0.32 to 4.73% sodium gluconate (depending on the lactate content of the cheese and the amount of sodium gluconate retained in the cheese) to prevent the formation ofcalcium lactate crystals.

Although there are numerous alternative ways gluconate could be added (i.e. addition of glucona-delta-lactone to the milk, curd, or whey; development of a gluconate producing starter or adjunct culture), the most efficient, cost effective, andreadily available technique is to add sodium gluconate to the cheese during the salting step of the manufacturing process.

11

The calcium lactate inhibitor need be present in the cheese product during aging. If added during the salting step, most of the calcium lactate inhibitor remains in the cheese product at the time of purchase and consumption. This provides adouble benefit to cheese manufacturers, in that the calcium lactate inhibitor becomes an edible part of the final cheese product. That is, the addition of the calcium lactate inhibitor results in more cheese being manufactured and sold, so theadditional weight sold adds revenue for the cheese manufacturer.

Example 1

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a conventional milled curd method. A direct vat set, frozen, concentrated starter culture (Marschall.RTM. Superstarto concentrated cultures, Strain M30 and M42, Rhodia, Inc., DairyBusiness, Madison, Wis.) was used to manufacture the cheese. A total of 36 ml of starter culture (18 ml of each strain) and 15.6 ml of color (AFC-WS-1x, Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk, which was maintained at31° C. After a 45-minute ripening period, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) diluted with 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowed toheal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cooked with continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After thecurds and whey reached a pH of 6.25 (30 to 45 minutes) the whey was drained and the curds were ditched and packed. The matted curd was then cut into slabs, flipped and stacked in 20-minute intervals until the curd reach a pH of 5.4. A pH of 5.4 wasreached 1.5 to 2 hour after the whey was drained. The slabs of curd were then milled and approximately 60 lbs of milled curd were obtained. The 60 lbs of milled curd were then divided in half. Two separate salting treatments were then applied to eachportion of the curd. One half of the milled curd (30 lbs) was salted at a rate of about 2.75% with sodium chloride (0.825 lbs). The sodium chloride was applied in three equal portions (0.275 lbs each) and the curd was mixed for 10 minutes between eachsodium chloride application. The remained curd (30 lbs) was salted at a rate of about 2.75% sodium chloride (0.825 lbs) and 2.4% sodium gluconate (0.72 lbs, PMP Fermentation Products, Peoria, Ill.), such that the total sodium chloride/sodium gluconateaddition was about 5.15% (1.545 lbs). The sodium chloride and sodium gluconate were applied in three equal portions (0.275 lbs and 0.24 lbs for the sodium chloride and sodium gluconate respectively) and the curd was mixed for 10 minutes between eachsodium chloride/sodium gluconate application. Subsequently the curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separateblocks weighing approximately 24-26 lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-25 1 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.13, 1.87%, and 38.84% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.44, 1.51%, 1.29% and 40.32% respectively. It is recognized that the maximum moisture content allowed in Cheddar cheese is 39% and that minor adjustments in the cheese making procedure for the cheese containing sodium gluconatewill be required to reduce the moisture content to less than 39%.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The resultant cheese from the sodium gluconate treatment tasted smooth and smelledpleasant, with no perceptible taste, mouthfeel or odor added due to the sodium gluconate addition.

Example 2

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a stirred curd method. A bulk starter culture was prepared by inoculating steamed reconstituted NFDM with a direct vat set, frozen, concentrated starter culture (Marschall.RTM. Superstart.RTM. concentrated cultures, Strain M46, Rhodia, Inc., Dairy Business, Madison, Wis.) and incubating overnight. The concentrated cheese milk was then inoculated with the bulk culture at a rate of 2%. Additionally 15.6 ml of

12

color (AFC-WS-1x,Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk. The concentrated milk was then maintained at 31° C. for a 45-minute ripening period. Subsequently, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) dilutedwith 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowed to heal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cookedwith continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After the curds and whey reached a pH of 6.30 (30 to 45 minutes) the whey was drained and the curds were intermittently stirred untilthe curd reach a pH of 5.4. A pH of 5.4 was reached 1.5 to 2 hour after the whey was drained. Approximately 60 lbs of curd were obtained and subsequently divided in half. Two separate salting treatments were then applied to each portion of the curd. One half of the curd (30 lbs) was salted at a rate of about 2.75% with sodium chloride (0.825 lbs). The sodium chloride was applied in three equal portions (0.275 lbs each) and the curd was mixed for 10 minutes between each sodium chloride application. The remained curd (30 lbs) was salted at a rate of about 2.75% sodium chloride (0.825 lbs) and 2.4% sodium gluconate (0.72 lbs, PMP Fermentation Products, Peoria, Ill.), such that the total sodium chloride/sodium gluconate addition was about 5.15% (1.545lbs). The sodium chloride and sodium gluconate were applied in three equal portions (0.275 lbs and 0.24 lbs for the sodium chloride and sodium gluconate respectively) and the curd was mixed for 10 minutes between each sodium chloride/sodium gluconateapplication. Subsequently the curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separate blocks weighing approximately 24-26lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-251 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.35, 1.08%, and 39.0% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.42, 1.01%, 0.79% and 42.51% respectively. It is recognized that the maximum moisture content allowed in Cheddar cheese is 39% and that minor adjustments in the cheese making procedure for the cheese containing sodium gluconatewill be required to reduce the moisture content to less than 39%.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The resultant cheese from the sodium gluconate treatment tasted smooth and smelledpleasant, with no perceptible taste, mouthfeel or odor added due to the sodium gluconate addition.

Solubility Model

Example 3

A test was run to determine the ability of ionic gluconate provided by sodium gluconate in an aqueous solution to bind with lactate over time, to thereby model the believed primary phenomenon resulting in reduced formation of calcium lactatecrystal. In each sample of the model, 14.1 g of calcium lactate pentahydrate (CH3CHOHCOO)2 Ca.5H2O) was used to provide 10 g of calcium lactate (1.83 g calcium ion, 8.17 g lactate ion). Different amounts of sodium gluconate(NaC6H.sub.11O.sub.7), amounts shown in Table I below) were combined with the calcium lactate pentahydrate and diluted to 100 ml with water. The samples were prepared at room temperature and each mixed well. The samples were then refrigerated atabout 40° F. for 48 hours, with each sample being mixed several times during the 48 hour holding period. After the holding period, the samples were cold filtered (40° F.) and the filtrate analyzed for lactate, gluconate and calciumconcentrations. The results are shown in the table below:

TABLE-US-00001 TABLE I g of FILTRATE RESULTS NaC6H.sub.11O.sub.7 CH3CHOHCOO added (%) C6H.sub.11O.sub.7(%) Ca (%) 0 2.82 -- .64 5 4.16 2.97 .98 10 4.47 7.55 1.12 15 4.96 11.15 1.20 20 5.67 14.21 1.18 25 5.69 16.61 1.18

The results demonstrate that the presence of ionic gluconate does in fact increase the solubility of lactate and calcium. However, the increase in solubility plateaus when the amount of gluconate added reached about 15 g/100 ml, which isdifferent than the calcium solubility results reported for beverage applications of sodium gluconate. These results indicate that the prevention of calcium lactate crystal formation in cheese by the addition of gluconate is not obvious or completelyunderstood.

13

Solubility Model

Example 4

A control solution was prepared by adding 7.5 g of calcium L-lactate pentahydrate powder (C(CH3CHOHCOO)2.5H.sub.2O, USP grade, FisherChemicals, Fair Lawn, N.J.--which provides 5.31 g of calcium lactate) and 0.3 g of potassium sorbate(99%, Alfa Aesart.RTM., Shore Road, Heysham, Lancs--which prevents mold formation during storage) to a 250 ml flask. Demineralized water (60° C.) was then added to the flask to obtain a final weight of 100 g and the flask was stirred to dissolvethe calcium lactate powder. Subsequently a piece of 1.5×3 cm sand paper was added to the flask to provide a nucleation site for calcium lactate crystal formation and the flask was sealed with a rubber stopper.

Experimental solutions were prepared in the same manner as the control except that 1.5% of an additive ingredient was also added to the flask. The additive ingredients for this solubility model were: a) sodium gluconate powder (PMP FermentationProducts, Inc., Chicago, Ill.); b) malic acid disodium salt (C4H.sub.4O.sub.5Na.sub.2; Sigma-Aldrich, Inc., St. Louis, Mo.); c) acetic acid sodium salt (CH3COONa; Anhydrous; Sigma-Aldrich, Inc., St. Louis, Mo.); d) lactobionic acid(C12H.sub.22O.sub.12; Sigma-Aldrich, Inc., St. Louis, Mo.); and e) propionic acid sodium salt (CH3CH.sub.2COONa; Sigma-Aldrich, Inc., St. Louis, Mo.). All of the experimental solutions were adjusted to pH 6.6 using sodium hydroxide after aportion (approximately 80 ml) of the demineralized water was added and the calcium lactate had been dissolved. After preparation a sample of each solution was collected.

Subsequently all solutions were stored at 7° C. for 14 days. After 14 days the flasks were visually inspected for the presence of crystals on the sand paper and the solutions were filtered at 7° C. through filter paper (Whatman4; Whatman International Ltd., Maidstone, England). Crystal formation was visually observed on the sand paper in the control, sodium propionate, and sodium acetate solutions, whereas no crystals were visually observed in the sodium gluconate, sodiummalate, and sodium lactobionate solutions.

The supernatant and the sample collected prior to storage were analyzed for lactic acid using High Performance Liquid Chromatography (HPLC) and for calcium content by Atomic Absorption Spectroscopy (AAS), providing the results reported below inTables II and III.

TABLE-US-00002 TABLE II Calcium analysis Sample Initial Concentration After Storage % Reduction Control 1.12% .90% 19.64% 1.5% Sodium 1.09% 1.08% .92% gluconate 1.5% Sodium 1.07% 1.06% .93% malate 1.5% Sodium 1.12% 1.00% 10.71% acetate 1.5%Sodium 1.05% 1.04% .95% lactobionate 1.5% Sodium 1.09% .97% 11.01% proprionate

TABLE-US-00003 TABLE III Lactate analysis Sample Initial Concentration After Storage % Reduction Control 4.37% 3.82% 12.59% 1.5% Sodium 4.41% 4.41% 0.0% gluconate 1.5% Sodium 4.43% 4.47% +.92% malate 1.5% Sodium 4.56% 4.03% 11.62% acetate 1.5%Sodium 4.33% 4.33% 0.0% lactobionate 1.5% Sodium 4.33% 4.06% 6.24% proprionate

As shown in Table II and III the solutions with sodium gluconate, sodium malate, or sodium lactobionate had a minimal (10%) and lactate content (>6%). Consequently, in this model system the tested sodium salts of organic acids which qualify as CLCinhibitors are sodium gluconate, sodium malate and sodium lactobionate. CLC inhibitors are effective in preventing calcium lactate crystal formation will have no or essentially no visually observable crystals and a minimal reduction (less than 5.0%, andmore preferably less than 1.0%) in the calcium and lactate content of the solution after 14 days of storage at 7° C. Accordingly, sodium propionate and sodium acetate are not CLC inhibitors.

Although the present invention has been described with reference to preferred embodiments, workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention.

Other References1. Field of the Invention

The invention relates to the field of cheese products and methods for making the same.

2. Related Art

Cream cheese and similar products are ubiquitous in modern diets. These cheese products

14

generally have a creamy texture and a bland, unremarkable flavor. Spreadability makes cream cheese convenient to use, which is the primary basis for itschoice by consumers over other firmer cheeses and the reason for its high volume consumption as a topping, for example on breads including bagels. In the classic method for making cream cheese, a pasteurized milkfat fluid such as cream, having abutterfat concentration generally within a range of between about 34.5% by weight and 52% by weight, is the primary raw material. This milkfat fluid is subjected to thorough digestion by lactic acid-producing bacteria, homogenized, and clotted byenzymes or direct acidification. The milkfat fluid is thus transformed into a solid phase referred to as the curd, and a liquid phase referred to as the whey. Most of the butterfat from the milkfat fluid is retained in the curd; and significant proteincontent, having substantial nutritional value and much of the appealing potential flavor in the milkfat fluid, remains in the whey. The curd is then processed into the cream cheese product, and the whey is discarded, along with its nutrients and flavor. As a result, cream cheese typically has a bland, dull, virtually unnoticeable taste. The retention of some of the liquid whey in the curd is a problem in itself, as the liquid gradually leaks out of the curd in an unappealing and ongoing separation thatis called syneresis. In addition, large scale cream cheese production generates corresponding quantities of often unusable whey, which thus becomes a waste expense and environmental detraction unless some other use can be found for it. Syneresis cansimilarly be a problem in many other cheese products.

The minimum fat content for cream cheese is 33% by weight. It is a pervasive goal in the human diet to consume less fat; and the relatively high butterfat content of a typical cream cheese is not helpful in achieving this goal. Cream cheese mayalso include high concentrations of cholesterol and sodium. High fat concentrations are also a problem in many other cheese products.

The maximum fat content for low-fat cream cheese is 16.5% by weight. Countless attempts have been made to make low-fat cream cheese products, but the resulting cheese products have typically failed due to unacceptable taste and poor texture. Asan example, some so-called low-fat cream cheese products have exhibited a bitter aftertaste, a glossy appearance, and a somewhat dry, plastic texture. Hence, despite the broad popularity of cream cheese, its use typically entails consumer acceptance ofa minimum butterfat content of 33% by weight, along with high concentrations of cholesterol and sodium, and a bland, unremarkable taste.

Yogurt, which is another highly prevalent milk-derived product, has an entirely different consistency than cream cheese, as well as a fundamentally different flavor. In illustration, yogurt is considered to be a food, whereas cream cheese isconsidered to be a condiment. For example, cream cheese is a popular topping for bread products such as bagels, but yogurt is not. On the other hand, yogurt has a robust, appealing flavor. Yogurt also typically has lower concentrations of butterfat,cholesterol and sodium than cream cheese as well as a higher concentration of protein.

A health-conscious consumer might well make the simple observation that nonfat yogurt has a robust, appealing flavor, find the concept of combining yogurt and cream cheese to be appealing, and thus attempt to combine these products together. However, due to the disparate properties of cream cheese and yogurt, including for example their differing consistencies, water content, and food chemistries, combining cream cheese and yogurt in mutually appreciable proportions may only generate a runnymess or an unstable composition exhibiting marked syneresis over a reasonable storage period. A consumer might instead attempt to drain the liquid from the solid phase of the yogurt before combining in the cream cheese, thereby discarding whey includingprotein from the yogurt. Similar problems can be expected where other types of cheeses are substituted for cream cheese, if an attempt is made to combine such cheeses with yogurt.

Accordingly there is a continuing need for low-fat cheese products including a milkfat fluid, having the appealing texture and flavor of high-milkfat cheeses.

SUMMARY

In one implementation, a process is provided for making a Low-Fat Yogurt-Cheese Composition, including: providing a composition including a milkfat fluid; combining yogurt with the composition including a milkfat fluid to form a compositionincluding yogurt and a milkfat fluid; combining milk protein with the composition including yogurt and a milkfat fluid; and forming a blend including the milk protein and the composition including yogurt and a milkfat fluid.

In another example, a Low-Fat Yogurt-Cheese Composition is provided, including: cream cheese at

15

a concentration within a range of between about 75% by weight and about 15% by weight; yogurt at a concentration within a range of between about 40%by weight and about 10% by weight; and milk protein at a concentration within a range of between about 45% by weight and about 15% by weight.

Other systems, methods, features and advantages of the invention will be or will become apparent to one with skill in the art upon examination of the following figures and detailed description. It is intended that all such additional systems,methods, features and advantages be included within this description, be within the scope of the invention, and be protected by the accompanying claims. 

BRIEF DESCRIPTION OF THE FIGURES

The invention may be better understood with reference to the following figures. The components in the figures are not necessarily to scale, emphasis instead being placed upon illustrating the principles of the invention. Moreover, in thefigures, like reference numerals designate corresponding parts throughout the different views.

FIG. 1 is a flow chart showing an example of an implementation of a process 100 for making a Low-Fat Yogurt-Cheese Composition ("Low-Fat Yogurt-Cheese Composition").

FIG. 2 is a flow chart showing an implementation of an example of a process 200 for preparing a yogurt to be utilized in step 118 of FIG. 1.

FIG. 3 is a flow chart showing an example of an implementation of a process 300 for preparing a whipped Low-Fat Yogurt-Cheese Composition.

DETAILED DESCRIPTION

FIG. 1 is a flow chart showing an example of an implementation of a process 100 for making a Low-Fat Yogurt-Cheese Composition ("Low-Fat Yogurt-Cheese Composition"). The process starts at step 102. In step 104, a composition including a milkfatfluid is provided or prepared. Throughout this specification, the term "milkfat" refers to the fatty components of edible milk, for example, cow milk. These fatty components, commonly referred to collectively as butterfat, may include, as examples,triacylglycerols, diglycerides, monoacylglycerols, other lipids, and mixtures.

Throughout this specification, the term "milkfat fluid" refers to a liquefied composition including milkfat, which may as examples be directly derived from milk or reconstituted by hydrating a dehydrated milk product. In an implementation, themilkfat fluid may include cream. As examples, a milkfat fluid may be formulated from one or more sources, including for example, whole milk, cream, skim milk, and dry milk.

In an implementation, the milkfat fluid utilized in the composition including a milkfat fluid may have a butterfat content within a range of between about 10% and about 52% by weight. As another example, the milkfat fluid may have a butterfatcontent within a range of between about 34.5% and about 52% by weight. In a further implementation, the milkfat fluid may have a butterfat content within a range of between about 33% and about 50% by weight. As an additional example, the milkfat fluidmay have a butterfat content within a range of between about 39% and about 50% by weight. In another example, the milkfat fluid may have a butterfat content within a range of between about 40% and about 44% by weight. In yet another implementation, themilkfat fluid may have a butterfat content within a range of between about 17% and about 33% by weight. In an implementation, the milkfat fluid may have a water content within a range of between about 40% and about 70% by weight. As a further example,the milkfat fluid may include milk protein at a concentration of about 2% by weight. In an additional implementation, the milkfat fluid may be cream including butterfat at a concentration within a range of between about 52% by weight and about 10% byweight; protein at a concentration of about 2% by weight; and water at a concentration within a range of between about 40% by weight and about 70% by weight. As an example, heavy cream may have a butterfat content of about 37% by weight, a proteincontent of about 2% by weight, and a water content of about 58% by weight, with the balance made up by other milk solids. Butterfat may be a major ingredient in cheese, as butterfat may be coagulated together with proteins and other ingredients into acurd and further processed to produce cheese. The term "cheese" as utilized throughout this specification is broadly defined as a milkfat fluid that has been at least partially digested by culture bacteria, or otherwise coagulated.

16

In an implementation, a stabilizer may be combined with the composition including a milkfat fluid at step 104. Combining a stabilizer with the composition including a milkfat fluid may thicken the composition including a milkfat fluid, as anexample by binding water. The stabilizer may also contribute to binding together of the ingredients of the composition including a milkfat fluid. This thickening may result in increased retention of whey protein in the composition including a milkfatfluid during subsequent steps of the process 100. Combining into the composition including a milkfat fluid of a selected stabilizer having a water binding capability that effectively facilitates inclusion of a higher concentration of water may alsoyield a Low-Fat Yogurt-Cheese Composition having a more creamy texture. In another example (not shown), a stabilizer may be combined with the composition including a milkfat fluid following completion of bacteria culture in steps 108-112 discussedbelow. As another implementation, a stabilizer may be combined with the composition including a milkfat fluid at a different point in the process 100 that is prior to combination of yogurt with the composition including a milkfat fluid in step 118discussed below. In a further implementation, a stabilizer may be combined with the composition including a milkfat fluid at a later point in the process 100. As an example, a stabilizer may be combined with the composition including a milkfat fluidprior to homogenization at step 120 discussed below, so that any lumpy texture in the composition including a milkfat fluid resulting from combining the composition including a milkfat fluid and stabilizer may be minimized by homogenization at step 120. In another implementation, a stabilizer may be combined with a composition including yogurt, milkfat fluid and milk protein at step 122 discussed below.

The stabilizer may be selected from, as examples, guns, salts, emulsifiers, and their mixtures. Gums that may be suitable include, as examples, locust bean gum, xanthan gum, guar gum, gum arabic, and carageenan. In an implementation, salts thatmay be suitable include sodium chloride and potassium chloride. These salts may, as an example, be introduced in suitable concentrations as flavorings for the Low-Fat Yogurt-Cheese Composition. Emulsifiers that may be suitable include, as examples,sodium citrate, potassium citrate, mono-, di-, and tri-sodium phosphate, sodium aluminum phosphate, sodium tripolyphosphate, sodium hexametaphosphate, dipotassium phosphate, and sodium acid pyrophosphate. In an implementation, the stabilizer may includeK6B493. The stabilizer K6B493 may be in the form of a milled, dry product commercially available from CP Kelco US, Inc., 1313 North Market Street, Wilmington, Del. 19894-0001. As another example, the stabilizer that is utilized may include a distilledglyceride produced by the distillation of mono-glycerides themselves produced by esterification of a triglyceride and glycerol. In an implementation, a variety of stabilizers may be obtained through choices of triglycerides and a selected concentrationof monoglyceride. Distilled glycerides that may be suitable include those commercially available from Danisco USA Inc. under the trade name, DIMODAN.RTM.. Gum arabic may be commercially available from TIC Gums Inc., Belcamp, Md. As an example, astabilizer blend including xanthan gum, locust bean gum and guar gum may be commercially available from TIC Gums Inc. Gum-based stabilizers may contain sodium. In an implementation, this sodium may be taken into account in selecting ingredients formaking a Low-Fat Yogurt-Cheese Composition in order to avoid an excessively high overall sodium concentration. As an example, a stabilizer composition that does not include sodium may be selected. In another implementation, the incorporation of asignificant proportion of yogurt into the Low-Fat Yogurt-Cheese Composition may reduce the overall sodium concentration, as the yogurt may itself have a low sodium concentration.

In an example, a concentration of a stabilizer may be selected that is effective to cause a moderate thickening of the composition including a milkfat fluid. In an implementation, a stabilizer may be combined with the composition including amilkfat fluid in an amount to constitute a concentration within a range of between about 0.2% by weight and about 0.5% by weight of the Low-Fat Yogurt-Cheese Composition. In another implementation, a stabilizer may be introduced in an amount toconstitute a concentration of about 0.45% by weight of the Low-Fat Yogurt-Cheese Composition. As an example, as the butterfat content of a selected composition including a milkfat fluid may be relatively reduced, a concentration of a stabilizer to beutilized may be proportionally increased.

In an implementation, a milk protein may be combined in a small concentration with the composition including a milkfat fluid at step 104. As examples, the milk protein may include: milk protein concentrate, whole milk protein, whey proteinconcentrate, casein, Baker's cheese, yogurt powder, dry cottage cheese curd, milk protein curd, or a mixture. In an implementation, the milk protein may help increase the thickness of the composition including a milkfat fluid in order to reduce anytendency for separation of the composition including a milkfat fluid into butterfat and milk

17

protein phases to occur. Milk protein concentrate may be produced, as an example, by ultrafiltration of milk. Whey protein compositions having proteinconcentrations of about 30% by weight, about 50% by weight, and about 85% by weight, as examples, may be commercially available. In an implementation, a milk protein may be combined into the composition including a milkfat fluid at a resultingconcentration within a range of between about 1% by weight and about 15% by weight. As a further example, a milk protein may be combined into the composition including a milkfat fluid at a resulting concentration within a range of between about 5% byweight and about 9% by weight. In an additional implementation, a milk protein may be combined into the composition including a milkfat fluid at a resulting concentration of about 7% by weight.

In an implementation, an edible oil may be combined with the milkfat fluid in forming the composition including a milkfat fluid. As another example, the edible oil may be omitted. Throughout this specification, the term "oil" refers to anedible oil of vegetable or animal origin or of both vegetable and animal origin. In an implementation, a vegetable oil derived from seeds or fruit of one or more of the following may be utilized: soy, corn, canola, sunflower, safflower, olive, peanut,cottonseed, sesame, almond, apricot, avocado, coconut, flax, grapeseed, hazelnut, palm, pine, poppy, pumpkin, rice bran, tea, walnut, and wheat. As another example, an animal oil including one or more of the following may be utilized: lard, shortening,suet, and tallow. As an example, an edible oil that may reduce a serum cholesterol level in a consumer may be utilized. In an implementation, palm oil may so reduce a serum cholesterol level. In another example, an edible oil may be useful forpreparing a Low-Fat Yogurt-Cheese Composition having a creamy texture. Edible oils, however, may be substantially 100% fat. Hence, the combination of an edible oil with a milkfat fluid at step 104 may generate a composition including a milkfat fluidhaving a higher fat concentration than that of the milkfat fluid itself. As an example, the composition including a milkfat fluid may include a concentration of an edible oil (weight/weight as a fraction of the composition including a milkfat fluid)within a range of between about 3% and about 70%; and a weight/weight concentration of a milkfat fluid within a range of between about 97% by weight and about 30% by weight. In another implementation, the composition including a milkfat fluid mayinclude a weight/weight concentration of an edible oil within a range of between about 3% and about 40%, the balance being milkfat fluid. As a further example, the composition including a milkfat fluid may include a weight/weight concentration of anedible oil within a range of between about 5% and about 27%, the balance being milkfat fluid. In an additional implementation, the composition including a milkfat fluid may include a weight/weight concentration of an edible oil within a range of betweenabout 8% and about 11%, the balance being milkfat fluid. In an alternative implementation, an edible oil may be combined with the milkfat fluid at a later point in the process 100. As an example, an edible oil may be combined with the milkfat fluidprior to initiation of blending at step 124 discussed below, so that blending may result in a Low-Fat Yogurt-Cheese Composition having a substantially uniform texture. As an implementation, the Low-Fat Yogurt-Cheese Composition may include an oil at aconcentration within a range of between about 20% and about 5% by weight. In another example, the Low-Fat Yogurt-Cheese Composition may include an oil at a concentration within a range of between about 12% and about 9% by weight.

In an implementation, the composition including a milkfat fluid may be pasteurized at step 106. Prior to this step, the composition including a milkfat fluid may carry a wild bacteria load as is normally present in raw milk products. Pasteurization of the composition including a milkfat fluid is required at some point in order to kill these wild bacteria, as well as other wild microbes, to an extent reasonably feasible. Furthermore, if the composition including a milkfat fluid is tobe subjected to culture bacteria in steps 108-112 or steps 128-132 discussed below, pasteurization needs to be completed in advance of those steps or the wild bacteria in the raw milkfat fluid will typically digest and thereby spoil the composition. Where a source of pre-pasteurized milkfat fluid is employed, further pasteurization at this point may be unnecessary.

Pasteurization causes irreversible heat-induced denaturation and deactivation of bacteria. Effective pasteurization is a function of both time and temperature; pasteurization may be completed at higher temperatures in correspondingly shortertimes. In one implementation, pasteurization of the composition including a milkfat fluid in step 106 may be carried out in a vat process at a temperature of about 150° Fahrenheit ("F") for about 30 minutes; or about 165° F. for about 15minutes; or if a more strenuous process is selected, about 170° F. for about 30 minutes. Other time and temperature treatment parameters that may be effective are known; and substitution of high surface area contact methods for the vat processmay permit shorter effective treatment times. High temperature short time pasteurization for example, in which the composition including a milkfat fluid may be pumped through an in-line tube within a temperature-controlled shell, may be

18

used. Milkfatfluids having relatively high butterfat content may require more heat exposure than low butterfat fluids in order to obtain effective pasteurization. Further background information on pasteurization of milk is provided in the Grade "A" Pasteurized MilkOrdinance published on May 15, 2002 by the U.S. Food & Drug Administration, particularly at pages 62 and 63; the entirety of which is hereby incorporated herein by reference.

Agitation may be provided and may be initiated prior to the heating process during pasteurization to facilitate more even heating throughout the composition including a milkfat fluid and to avoid localized overheating. The force applied by theagitation may be moderated to avoid strong shearing, which may degrade proteins and butterfat in the composition including a milkfat fluid. In an example, pasteurization may be carried out in a tank equipped with a heater and agitator. Any such vesselmay generally be used, such as, for example, a Groen kettle. In another example, step 106 may be omitted.

In an implementation, the temperature of the composition including a milkfat fluid may be adjusted at step 108 to a bacteria culture temperature. As an example, the temperature of the composition including a milkfat fluid may be adjusted towithin a range of between about 65° F. and about 92° F. In an additional implementation, the temperature of the composition including a milkfat fluid may be adjusted to within a range of between about 70° F. and about 85° F. As a further example, the temperature of the composition including a milkfat fluid may be adjusted to within a range of between about 79° F. and about 85° F. In another implementation, the temperature of the composition including amilkfat fluid may be adjusted to within a range of between about 80° F. and about 81° F. In yet a further example, the temperature of the composition including a milkfat fluid may be adjusted to about 82° F. In another example,step 108 may be omitted.

As an example, culture bacteria may be combined with the composition including a milkfat fluid at step 110, and then cultured at step 112. These steps may generate robust culture-induced flavor in the composition including a milkfat fluid. Milkcontains lactose sugars that may be digested by selected bacteria, producing lactic acid, glucose and galactose as metabolites. Hence, the culture bacteria generally may be selected from among those that can digest lactose. In an example, a strain ofmesophilic bacteria suitable for culturing cheese may be used. Such bacteria strains may be chosen, as an example, to produce diacetyl flavor. Bacteria strains may require ongoing rotational use, to prevent background bacteriophage populations frombecoming resistant to a particular strain of bacteria, which may result in shutdown of the culture process and contamination of the Low-Fat Yogurt-Cheese Composition during its production. For example, the culture bacteria may be selected from varyingcombinations of strains, which may be rotated on an ongoing basis, of (1) lactic acid-producing Lactococcus lactis subspecies lactis or subspecies cremoris; and (2) diacetyl flavor-producing Lactococcus lactis subspecies diacetylactis or Leuconostocstrains. Bacteria strains that may be suitable are commercially available under the trade name pHage Control™ from Chr. Hansen, Boge Alle 10-12, DK-2970 Horsholm, Denmark. Grades 604, 608, 2000-10, 2000-30 and 2000-90, as examples, may beeffective. These particular bacteria strain blends may be used continuously without rotation, provided that proper sanitation is maintained. Further bacteria strains that may be suitable are commercially available under the trade names Flav Direct™ and DG™ Cultures from Degussa BioActives, 620 Progress Avenue, P.O. Box 1609, Waukesha, Wis. 53187-1609.

Once a culture bacteria strain or strain mixture is selected, an amount may be combined with a given batch of composition including a milkfat fluid that may be effective to propagate live cultures throughout the batch in a reasonable time at thechosen culture temperature. For example, 500 grams of bacteria may be effective to inoculate up to 7,500 pounds of composition including a milkfat fluid using an inoculation proportion of about 0.015% by weight. As an example, an inoculation proportionwithin the range of between about 0.013% by weight and about 0.026% by weight may be used. In general, greater proportional inclusions of culture bacteria in a batch of the composition including a milkfat fluid may lead to somewhat reduced processingtime, at the expense of increased costs for the bacteria.

In an implementation, the composition including a milkfat fluid may be agitated during or following the introduction of the culture bacteria. The culture bacteria may be combined in a small proportion compared with the composition including amilkfat fluid, and hence may need to be dispersed so that they may act throughout the composition including a milkfat fluid. Agitation may begin, as an example, prior to introduction of the culture bacteria, and may be continued after dispersion of theculture bacteria. The shear force applied by the agitation may be selected to be sufficient to

19

disperse the culture bacteria in a reasonable time, but not so strong as to substantially shear and thus degrade the culture bacteria or the proteins andbutterfat in the composition including a milkfat fluid. As an example, moderate agitation of the composition including a milkfat fluid containing the culture bacteria may be continued for a time period within a range of between about 10 minutes andabout 25 minutes. In another implementation, moderate agitation may be continued for about 15 minutes.

In step 112, the culture bacteria, if introduced at step 110, may be cultured in the composition including a milkfat fluid. In an implementation, the composition including a milkfat fluid may be held at a suitable temperature long enough forcultures of the selected bacteria to begin development, resulting in a slight thickening of the composition including a milkfat fluid. The necessary duration of such bacteria culturing depends on a variety of factors including, as examples, the level ofbacteria activity, the selected culture temperature, the initial bacteria concentration, and the ingredients in the composition including a milkfat fluid. The culture bacteria may digest lactose sugars in the milk. High culture temperatures and highinitial bacteria concentrations may generally shorten the culture time needed. The culture temperature employed, however, must be within a range tolerable to the survival and growth of the selected culture bacteria. In an example, the compositionincluding a milkfat fluid may be cultured with the selected bacteria for a time period within a range of between about 60 minutes and about 90 minutes. A bacteria culture step of such a limited duration may generate a mild thickening of the compositionincluding a milkfat fluid. In another example, steps 108-112 may be omitted.

In an implementation, the composition including a milkfat fluid may be pasteurized at step 114. As an example, pasteurization step 114 may be carried out as discussed above in connection with step 106. In an implementation, the compositionincluding a milkfat fluid may be pasteurized at step 114 before the bacteria culture of step 112 has caused any substantial thickening of the composition including a milkfat fluid to occur. This pasteurization at step 114 may thus terminate bacteriaculture step 112. Very little change in the pH of the composition including a milkfat fluid may occur in such a mild bacteria culture step. As an example, limiting the bacteria culture of step 112 to a mild thickening of the composition including amilkfat fluid in this manner may be a fundamental and major departure from a typical process for the production of cream cheese. In a typical process for the production of cream cheese, bacteria culture may be permitted to run its course until a pH of amilkfat fluid may be reduced to within a range of between about 5.0 and about 4.1.

In a further implementation, a temperature of the composition including a milkfat fluid may be gradually raised during steps 104-114, so that pasteurization may be initiated at step 114 in due course when the composition including a milkfat fluidreaches an effective pasteurization temperature. In another example, step 114 may be omitted.

In another implementation, bacteria culture at step 112 may be continued for a sufficient time to partially or substantially digest the composition including a milkfat fluid, as may be limited by an attendant reduction of the pH toward anendpoint where bacteria activity may markedly decrease. Lactic acid may be formed as a byproduct of metabolism of lactose by the bacteria in step 112. Hence, a measured pH of the composition including a milkfat fluid, which may gradually decline withlactic acid buildup, may be an indication of the progress of the bacteria culture. In an example, bacteria culture at step 112 may be continued until the pH of the composition including a milkfat fluid may be within a range of between about 5.0 andabout 4.1. As another implementation, bacteria culture at step 112 may be continued until the pH of the composition including a milkfat fluid may be within a range of between about 4.6 and about 4.4. The bacteria activity may become substantiallydormant within either of these pH ranges.

In an implementation, the composition including a milkfat fluid resulting from some or all of the process steps 104-114 may be a cream cheese. Throughout this specification, "cream cheese" designates a composition including cream that has beencultured using the bacteria discussed above in connection with step 110 or the bacteria discussed below in connection with step 130, or both. The bacteria culture may as an example be continued until a pH within a range of between about 4.7 and about4.5 is reached. In another example, the bacteria culture may be terminated at a pH greater than about 5.0, and a pH within a range of between about 4.7 and about 4.5 may be reached in step 134 discussed below, by a direct set process including additionof an edible acid to the milkfat fluid. As an example, the bacteria culture may be terminated at a pH within a range of between about 6.5 and about 6.8, followed by a direct set at step 134. In a further implementation,

20

any ingredient satisfying thestandard of identity for cream cheese, including cream cheese, Neufchatel cheese, reduced fat cream cheese, or a cream cheese designated as low-fat or light, as codified by federal regulations of the U.S. government or as defined in specifications forcream cheese of the U.S. Department of Agriculture, may be utilized as an ingredient at step 118 instead of carrying out steps 104-114. Cream cheese includes not more than 55% by weight moisture and not less than 33% by weight milkfat. Neufchatelcheese includes not more than 65% by weight moisture and not less than 20% by weight milkfat, but also includes less than 33% by weight milkfat. Reduced fat cream cheese includes not more than 70% by weight moisture and not less than 16.5% by weightmilkfat, but also less than 20% by weight milkfat. Low-fat or light cream cheese includes not more than 70% by weight moisture and not more than 16.5% by weight milkfat.

In an implementation, the temperature of the composition including a milkfat fluid may be adjusted at step 116 to a temperature suitable for subsequent combination of yogurt together with the composition including a milkfat fluid at step 118. Inan example, the temperature of the composition including a milkfat fluid may promptly be lowered, following completion of pasteurization at step 114, to a more moderate level in order to minimize ongoing heat damage to butterfat and milk proteins as wellas any other components of the composition including a milkfat fluid. As another implementation, the temperature of the composition including a milkfat fluid may be lowered to a more moderate level following completion of pasteurization at step 114 soas not to unduly shock or kill beneficial culture bacteria present in the yogurt during combination of the yogurt with the composition including a milkfat fluid at step 118 as discussed below. If the yogurt is exposed to a temperature suitable forpasteurization, the beneficial yogurt bacteria may be killed.

As a further example, the composition including a milkfat fluid may be cooled at step 116 to a temperature suitable for carrying out further steps of the process 100. In an implementation, the composition including a milkfat fluid may be cooledat step 116 to a temperature within a range of between about 110° F. and about 128° F. As another example, the composition including a milkfat fluid may be cooled at step 116 to a temperature within a range of between about 115° F. and about 128° F. The composition including a milkfat fluid may be cooled at step 116 in an additional implementation to a temperature within a range of between about 120° F. and about 125° F. As a further example, thecomposition including a milkfat fluid may be cooled at step 116 to a temperature of about 125° F. In another implementation, the composition including a milkfat fluid may be cooled at step 116 to a refrigeration temperature such as a temperaturewithin a range of between about 34° F. and about 38° F., and may then be temporarily stored prior to further processing.

Following the completion of some or all of steps 104-116 as discussed above, the composition including a milkfat fluid may be combined together with yogurt at step 118 to form a composition including yogurt and a milkfat fluid. As an example,the composition including a milkfat fluid resulting from some or all of steps 104-116 of the process 100 may be a uniform material that may include butterfat and whey protein among its ingredients. In an implementation, steps 104-116 of the process 100may not include a direct acidification step. Direct acidification of the composition including a milkfat fluid prior to its combination with yogurt at step 118 may cause the curd and whey of the composition including a milkfat fluid to separate fromeach other. This separation may inhibit the incorporation of whey protein, such as whey protein from the milkfat fluid, into the Low-Fat Yogurt-Cheese Composition. Whey protein may generally become separated in liquid form from the curd in conventionalcream cheese production, the curd essentially constituting the product. Hence, the composition including a milkfat fluid that may result from completion of some or all of steps 104-116 and that may have not been subjected to direct acidification, is nota cream cheese. As an example, substitution of cream cheese for the composition including a milkfat fluid as an ingredient in step 118 may decrease a maximum concentration of whey protein that may be incorporated into the Low-Fat Yogurt-CheeseComposition. Further, the direct combination together of cream cheese and yogurt in mutually substantial proportions may not yield a homogenous single-phase product. Substitution of other conventional cheeses for the composition including a milkfatfluid may similarly inhibit incorporation of whey protein into the Low-Fat Yogurt-Cheese Composition.

In an implementation (not shown), a conventional cheese such as cream cheese may be combined as an ingredient into the Low-Fat Yogurt-Cheese Composition. As an example, conventional cream cheese may be combined with the composition including amilkfat fluid at step 118 or at another point in the process 100, in a selected concentration. As the concentration of conventional cheese in the Low-Fat Yogurt-Cheese Composition is increased, the overall fat concentration of the Low-

21

Fat Yogurt-CheeseComposition may accordingly increase as well.

In an implementation, a yogurt and the composition including a milkfat fluid may be combined together at step 118 to form a composition including yogurt and a milkfat fluid. As an example, any yogurt may be utilized. Yogurt may be broadlydefined as a milkfat fluid that has been cultured by at least one bacteria strain that is suitable for production of yogurt. In an implementation, a yogurt may be utilized that includes: butterfat at a concentration within a range of between about 0%and about 3.25% by weight; milk protein at a concentration within a range of between about 3% and about 15% by weight; and water at a concentration within a range of between about 82% and about 97% by weight. In another example, a yogurt may be utilizedthat includes: butterfat at a concentration within a range of between about 0.5% and about 3.25% by weight; milk protein at a concentration within a range of between about 6% and about 12% by weight; and water at a concentration within a range of betweenabout 85% and about 94% by weight. As a further implementation, a yogurt may be utilized that includes: butterfat at a concentration within a range of between about 0.5% and about 2.0% by weight; milk protein at a concentration of about 9% by weight;and water at a concentration within a range of between about 89% and about 91% by weight. A yogurt may be utilized in another example that includes: butterfat at a concentration of about 0.16% by weight; milk protein at a concentration of about 9% byweight; and water at a concentration of about 91% by weight. In an implementation, a yogurt may be utilized having a total solids content of at least about 8% by weight.

FIG. 2 is a flow chart showing an implementation of an example of a process 200 for preparing a yogurt to be utilized in step 118 of FIG. 1. Referring to FIG. 2, the process 200 starts at step 210, and milk for preparing the yogurt may beprovided at step 220. The milk selected for preparing the yogurt may be, as examples, whole milk, reduced fat milk, or skim milk. Butterfat present in the milk may facilitate the process 200, as butterfat may contribute to the feasibility of thickeningthe yogurt to a selected consistency. However, butterfat present in the milk that is utilized to prepare the yogurt also contributes to the overall fat concentration in the Low-Fat Yogurt-Cheese Composition. In an implementation, skim milk may beutilized in step 220, in order to reduce the overall fat concentration of the Low-Fat Yogurt-Cheese Composition. As another example, milk having a butterfat content of less than about 1% by weight may be utilized. In a further implementation, theselected milk may be liquid milk such as cow milk, or the milk may be reconstituted from dry milk.

In an implementation, a solids concentration of the milk to be utilized in preparing the yogurt may be standardized to within a range of between about 18% and about 22% by weight. In another implementation, the solids concentration of the milkmay be standardized to about 22% by weight. As an example, if the solids concentration of the milk is substantially in excess of 22% by weight, the bacteria culture utilized to prepare the yogurt may digest the milk too slowly for completion of theprocess 200 within a reasonable time period. In a further example, a robust bacteria strain may be selected or the milk may be inoculated with an extra high bacteria load, to facilitate utilization of milk having a relatively high solids concentration. In another implementation, the solids concentration of the milk may be standardized to within a range of between about 10% and about 12% by weight, as may be selected in a conventional process for the preparation of yogurt. As an example, however, sucha relatively low solids concentration may hinder production of a Low-Fat Yogurt-Cheese Composition having an acceptably thick texture. In an implementation, an initial solids concentration of milk selected for utilization at step 220 may be increased toa selected higher concentration by any process suitable to yield a condensed milk. As an example, a condensation process that does not involve heating the milk, such as an ultrafiltration process, may be utilized in order to minimize resultingdegradation of the milk.

At step 230, the milk may be pasteurized. In an implementation, this pasteurization may be carried out as earlier discussed with regard to step 106. As an example, pasteurization of the milk may be carried out by maintaining the milk at atemperature of at least about 165° F. for at least about 15 minutes. In another implementation, pasteurization of the milk may be carried out by maintaining the milk at a temperature of about 170° F. for about 30 minutes. As a furtherexample, the milk may be agitated during the pasteurization, which may facilitate more uniform heating of the milk and may avoid its localized overheating.

At step 240, the milk may be cooled to a bacteria culture temperature. As an example, the temperature of the milk may be promptly reduced to a moderate level following completion of its pasteurization in order to reduce ongoing heat damage ofthe milk. In another example, the milk

22

may not be maintained at the high temperatures necessary for pasteurization when bacteria may be cultured in the milk at steps 250-260 discussed below, or the bacteria may not survive. In an implementation, themilk may be cooled at step 240 to a temperature within a range of between about 90° F. and about 115° F. In another example, the milk may be cooled at step 240 to a temperature within a range of between about 106° F. and about110° F. As an additional implementation, the milk may be cooled at step 240 to a temperature of about 108° F.

At step 250, culture bacteria may be combined with the milk. In an implementation, bacteria strains that may be suitable for the preparation of yogurt may be utilized. As examples, Lactobacillus delbrueckii subspecies bulgaricus, Streptococcusthermophilus, Lactobacillus acidophilus, Bifidobacterium, and Lactobacillus paracasei subspecies casei may be utilized. As another implementation, other lactic acid-producing bacteria strains that may be suitable for preparing yogurt may be utilized. Yogurt culture bacteria strains that may be suitable are commercially available under the trade name Yo-Fast.RTM. from Chr. Hansen, Boge Alle 10-12, DK-2970 Horsholm, Denmark. The bacteria strain F-DVS YoFast.RTM.-10 as an example, which may containblended strains of Streptococcus thermophilus, Lactobacillus delbrueckii subspecies bulgaricus, Lactobacillus acidophilus, Bifidobacterium, and Lactobacillus paracasei subspecies casei, may be utilized. In another implementation, DVS YoFast.RTM.-2211may be utilized. As an additional implementation, a yogurt culture including Lactobacillus acidophilus, Bifidobacterium, and L. casei may be utilized. In an example, Yo-Fast.RTM. 20 cultures that may include mixtures of Lactobacillus acidophilus,Bifidobacterium, and L. casei, may be utilized. Such yogurt cultures may develop a very mild flavor and may contribute to an appealing texture in the Low-Fat Yogurt-Cheese Composition. These yogurt cultures may also make possible a reduction in aneeded concentration of or possibly an elimination of stabilizers that may otherwise be needed for increasing the thickness of the composition to an adequate, appealing level. These yogurt cultures may require minimal direct acidification, which mayresult in a longer shelf life for the Low-Fat Yogurt-Cheese Composition. Such yogurt cultures may also lend an appealing mouth feel and creaminess to the Low-Fat Yogurt-Cheese Composition. In another implementation, further bacteria strains that may besuitable are commercially available under the trade names Ultra-Gro.RTM. and Sbifidus.RTM. from Degussa BioActives, 620 Progress Avenue, P.O. Box 1609, Waukesha, Wis. 53187-1609.

In an implementation, step 250 may include combining a selected culture bacteria strain with the milk at a bacteria concentration that is effective to propagate live bacteria cultures throughout a given batch of milk in a reasonable time at aselected culture temperature. As an example, a relatively higher concentration of culture bacteria may correspondingly reduce the time period needed to complete step 250, but at the expense of increased costs for the bacteria.

In an implementation, the milk may be agitated during all or part of step 250, as the concentration of the culture bacteria may be small compared with that of the milk. As an example, the culture bacteria may be actively dispersed throughout themilk. In another implementation, agitation may be initiated before the culture bacteria are combined with the milk, and agitation may also be continued after the culture bacteria have been dispersed in the milk. In an example, a shear force of theagitation may be sufficient to disperse the culture bacteria in a reasonable time, but may not be so strong as to degrade the culture bacteria, or the proteins and butterfat in the milk. In an implementation, the milk and culture bacteria may besubjected to moderate agitation for a time period within a range of between about 10 minutes and about 25 minutes. As another example, the milk and culture bacteria may be subjected to moderate agitation for a time period of about 15 minutes.

In step 260, bacteria introduced at step 250 may be cultured in the milk. In an implementation, the milk may be maintained at a temperature suitable for cultures of the selected bacteria to develop, over a time period sufficient so that avisible curd may form throughout the milk. The visible curd may be accompanied by a substantial thickening of the milk. As an example, the milk may be maintained for a selected time period at a temperature within a range of between about 95° F.and about 112° F. In another implementation, the milk may be maintained for a selected time period at a temperature within a range of between about 100° F. and about 110° F. As a further example, the milk may be maintained for aselected time period at a temperature within a range of between about 106° F. and about 110° F. In an additional implementation, the milk may be maintained for a selected time period at a temperature of about 108° F. In anexample, an optimum duration of the bacteria culturing may depend on the level of bacteria activity, the selected culture temperature, the initial bacteria concentration, and the composition of the milk. In an implementation, the milk may

23

be culturedwith selected bacteria for a time period within a range of between about 4 hours and about 6 hours. As another example, the milk may be cultured with selected bacteria at a temperature of about 108° F. for about 6 hours.

Lactic acid may be formed as a byproduct of metabolism of lactose by the bacteria in step 260. Hence, a measured pH of the milk, which may gradually decrease with lactic acid buildup, may be an indication of the progress of the bacteria culturetoward completion. In an implementation, when a pH of the milk reaches about 4.4, the level of bacteria activity may begin to markedly decrease. As an example, the bacteria culture in step 260 may be continued until a pH of the milk is within a rangeof between about 5.0 and about 4.1. In another implementation, the bacteria culture step 260 may be continued until a pH of the milk is within a range of between about 4.6 and about 4.4. As a further example, the bacteria culture step 260 may becontinued until a pH of the milk is about 4.5.

When the milk reaches a selected pH, the process 200 may end at step 270. The resulting product is yogurt that may contain live culture bacteria. As an example, the yogurt may have a uniform consistency and a solids content of at least about 8%by weight.

Returning to step 118 of FIG. 1, yogurt and the composition including a milkfat fluid may be combined together to form a composition including yogurt and a milkfat fluid. In an implementation, the yogurt and the composition including a milkfatfluid may be simultaneously prepared so that some or all of steps 118-138 of the process 100 discussed below may then immediately be carried out. As an example, yogurt prepared according to the process 200 discussed above may already be at a suitabletemperature for its combination with the composition including a milkfat fluid at step 118. In an implementation, the composition including a milkfat fluid may have already been cooled at step 116 to that same temperature or to another compatibletemperature.

In an implementation, yogurt may be prepared in advance of carrying out any or all of steps 104-116 of the process 100. As an example, yogurt may be prepared prior to preparing a composition including a milkfat fluid in step 104, and may then becooled to a refrigeration temperature to retard continuation of bacteria activity in the yogurt until selected steps from among steps 104-116 of the process 100 have been executed. In an implementation, the yogurt may be so cooled to a temperaturewithin a range of between about 34° F. and about 38° F., and then may be reheated. As an example, the yogurt may be so reheated to a temperature within a range of between about 95° F. and about 112° F. In anotherimplementation, the yogurt may be so reheated to a temperature within a range of between about 100° F. and about 110° F. As a further example, the yogurt may be reheated to a temperature within a range of between about 106° F. andabout 110° F. In an additional implementation, the yogurt may be reheated to a temperature of about 108° F. As an example, yogurt may be prepared while or after some or all of steps 104-116 are carried out, so that the yogurt may bedirectly combined with the composition including a milkfat fluid at step 118 without reheating. Directly combining yogurt and the composition including a milkfat fluid at step 118 without reheating the yogurt may minimize degradation of the yogurt thatmay be caused by such reheating, including precipitation of the curd, attendant syneresis, and a reduction in the concentration of live culture bacteria.

Ambient air may contain bacteria that may be harmful to and cause degradation of the yogurt and the composition including a milkfat fluid. In an implementation, the yogurt and the composition including a milkfat fluid may be handled in a mannerto minimize their exposure both during and after their preparation to ambient air, as well as to minimize the exposure of the composition including yogurt and a milkfat fluid to ambient air.

As an example, the preparations of the yogurt and the composition including a milkfat fluid to be combined together at step 118 may be completed substantially at the same time. In an implementation, the respective temperatures of the yogurt andthe composition including a milkfat fluid may be selected and controlled with attention to preserving live culture bacteria in the yogurt, to minimizing further heating and cooling operations, and to preventing shock to or death of the live yogurtculture bacteria. In another example, live yogurt bacteria cultures, which themselves may provide well-known health benefits to the consumer, may be included in the Low-Fat Yogurt-Cheese Composition. As a further implementation, the temperature of thecomposition including a milkfat fluid and the temperature of the yogurt may each be adjusted if such temperatures are found to be too hot or too cold. In another example, the temperature of the composition including a milkfat fluid and the temperatureof the yogurt may be adjusted, before combining them together, to within a range of between about 110° F. and about 128° F., and to within a range of between about

24

95° F. and about 112° F., respectively. As an additionalimplementation, the temperature of the composition including a milkfat fluid and the temperature of the yogurt may be adjusted, before combining them together, to within a range of between about 115° F. and about 128° F., and to within arange of between about 100° F. and about 110° F., respectively. In a further example, the temperature of the composition including a milkfat fluid and the temperature of the yogurt may be adjusted, before combining them together, towithin a range of between about 120° F. and about 125° F., and to within a range of between about 100° F. and about 108° F., respectively. As another implementation, the temperature of the composition including a milkfatfluid and the temperature of the yogurt may be adjusted, before combining them together, to temperatures of about 125° F. and about 108° F., respectively.

In an implementation, relative concentrations of yogurt and composition including a milkfat fluid to be combined at step 118 may be selected. As an example, the composition including a milkfat fluid may contain a higher concentration ofbutterfat than does the yogurt. As another example, the yogurt may contain lower concentrations of cholesterol and sodium, and a higher concentration of milk protein, than the composition including a milkfat fluid. In another implementation, combininga substantial concentration of yogurt with the composition including a milkfat fluid may provide a robust flavor, a reduced concentration of cholesterol, and healthful active culture bacteria to the Low-Fat Yogurt-Cheese Composition. In an example, asufficient concentration of yogurt may be combined into a given batch of composition including a milkfat fluid to yield a selected substantial improvement in the flavor and texture of the Low-Fat Yogurt-Cheese Composition and to yield a selectedconcentration of healthful active culture bacteria in the composition.

In an implementation, the composition including yogurt and a milkfat fluid formed at step 118 may include yogurt at a resulting concentration within a range of between about 20% and about 45% by weight, and a composition including a milkfat fluidat a concentration within a range of between about 80% by weight and about 55% by weight. As a further example, the composition including yogurt and a milkfat fluid formed at step 118 may include yogurt at a resulting concentration within a range ofbetween about 30% and about 40% by weight, and a composition including a milkfat fluid at a concentration within a range of between about 70% by weight and about 60% by weight. As an additional example, the composition including yogurt and a milkfatfluid formed at step 118 may include yogurt at a resulting concentration of about 35% by weight, and a composition including a milkfat fluid at a concentration of about 65% by weight.

In an implementation, the yogurt and the composition including a milkfat fluid may be combined together at step 118 within a reasonable time following completion of some or all of steps 104-116 discussed above. As another example, the yogurt andthe composition including a milkfat fluid may be separately prepared and stored, provided that excessive bacteria activity or heat-induced degradation is not permitted to take place in either of these ingredients over an extended time period before theyare combined together in step 118.

In an implementation, step 118 may include thoroughly mixing together the yogurt with the composition including a milkfat fluid. As an example where the concentration of yogurt may be smaller than the concentration of the composition including amilkfat fluid, the yogurt may be combined with the composition including a milkfat fluid in order to carry out step 118. In an implementation, the mixing may be carried out in a vessel having an agitator. As an example, the yogurt and the compositionincluding a milkfat fluid may be combined together with moderate agitation for a selected time period. As another example, care may be taken to select an agitation level that may effectively mix the yogurt and the composition including a milkfat fluidtogether but that may also minimize shearing of milk proteins, butterfat, and live culture bacteria. In an implementation, mixing may be continued over a time period within a range of between about 10 minutes and about 30 minutes. As a further example,mixing may be continued over a time period of about 15 minutes. Thorough mixing together of the yogurt and the composition including a milkfat fluid at step 118, prior to homogenization at step 120 discussed below, may lead to a more uniform consistencyin the Low-Fat Yogurt-Cheese Composition.

In an implementation, a vessel utilized for carrying out step 118 may include heating and cooling exchangers suitable for adjusting and controlling a temperature of the composition including yogurt and a milkfat fluid to a selected temperature. As another example, the composition including yogurt and a milkfat fluid prepared at step 118 may be maintained at a temperature within a range of between about 118° F. and about 125° F. In a further implementation, the compositionincluding yogurt and a milkfat fluid prepared at step 118 may be maintained at a temperature within a range

25

of between about 118° F. and about 120° F.

The arrow A shows that step 120 follows step 118 in FIG. 1. At step 120, the composition including yogurt and a milkfat fluid may be homogenized by subjecting the composition including yogurt and a milkfat fluid to an elevated pressure for aselected period of time, and then rapidly releasing the pressure. In an example, application of such an elevated pressure may break down butterfat globules in the composition including yogurt and a milkfat fluid and substantially reduce their potentialfor subsequent recombination and agglomeration, so that a composition including yogurt and a milkfat fluid having a substantially uniform texture may be prepared. As a further example, application of such an elevated pressure may cause butterfat andmilk protein to be thoroughly interdispersed, so that a composition including yogurt and a milkfat fluid having a substantially reduced potential for syneresis may be prepared. As an implementation, homogenization may be carried out at an elevatedpressure applied to the composition including yogurt and a milkfat fluid by any suitable means, such as, for example, hydraulic or mechanical force. As another example, the composition including yogurt and a milkfat fluid may be compressed to a selectedpressure and then passed through an orifice to quickly reduce the pressure.

In an implementation, the homogenization at step 120 may be carried out at a relatively high temperature. As an example, the fluidity of the composition including yogurt and a milkfat fluid may increase at higher temperatures, which may improvethe efficiency of the homogenization process. In an implementation, live and active yogurt bacteria may not be able to survive at a temperature greater than about 128° F., and temperatures above about 125° F. may result in gradual deathof such bacteria. As an example, the homogenization in step 120 may be carried out at a selected and controlled temperature that is not in excess of about 125° F. In another implementation, homogenization in step 120 may be carried out at aselected and controlled temperature that is within a range of between about 118° F. and about 125° F. As a further example, homogenization in step 120 may be carried out at a selected and controlled temperature that is within a range ofbetween about 118° F. and about 120° F. As an example, a temperature for the homogenization process may be selected that will not kill a substantial proportion of the live culture bacteria in the composition including yogurt and a milkfatfluid prepared at step 118. In an implementation, homogenization may be carried out in a Gaulin homogenizer.

In an implementation, homogenization may be carried out at a pressure within a range of between about 2,000 pounds per square inch (PSI) and about 4,000 PSI. As another example, homogenization may be carried out at a pressure within a range ofbetween about 2,500 PSI and about 3,200 PSI. In a further implementation, a thickness of the Low-Fat Yogurt-Cheese Composition may increase as the pressure applied during homogenization at step 120 increases. As an example, a pressure to be applied tothe composition including yogurt and a milkfat fluid during homogenization may be selected to yield a Low-Fat Yogurt-Cheese Composition having a selected consistency.

As an example, step 120 may be carried out using a homogenizer having a homogenization chamber, an inlet chamber, and an outlet chamber. The inlet chamber may in an example be a vessel suitable for staging a supply of the composition includingyogurt and a milkfat fluid, on a continuous or batch basis, for introduction into the homogenization chamber. In an implementation, the homogenization chamber may be a vessel having controllable orifices for input and output of the composition includingyogurt and a milkfat fluid, and may be reinforced to withstand containment of an elevated pressure suitable for homogenization. As a further example, the outlet chamber may be a vessel suitable for staging a supply of the homogenized compositionincluding yogurt and a milkfat fluid, on a continuous or batch basis, for execution of some or all of steps 122-138 discussed below. In an implementation, the composition including yogurt and a milkfat fluid may be passed through the inlet chamberbefore being pumped into the homogenization chamber. Following homogenization, the composition including yogurt and a milkfat fluid may, as an example, be expelled from the homogenization chamber into the outlet chamber. These flows may, as examples,be carried out on a continuous or batch basis. As a further implementation, the pressure within the homogenization chamber may be adjusted to a selected homogenization pressure and maintained at that pressure during homogenization. In an example, thepressure in the inlet chamber may be within a range of between about 20 PSI and about 40 PSI. The pressure may be generated, as an implementation, by pumping of the composition including yogurt and a milkfat fluid into the inlet chamber. As anotherexample, the pressure in the outlet chamber may be within a range of between about 20 PSI and about 40 PSI. The pressure may be generated, as an implementation, by expelling the composition including yogurt and a milkfat fluid from the

26

homogenizationchamber and then containing it in the outlet chamber. The composition including yogurt and a milkfat fluid may, as an example, undergo a pressure drop by ejection of the composition through a hole upon passing from the homogenization chamber to theoutlet chamber. In an implementation, such a hole may have a diameter of about a centimeter. As an additional example, the pressures within the inlet chamber, the outlet chamber, and the homogenization chamber may be selected and carefully controlledso that air may not be entrained into the homogenization chamber. In an example, such entrained air may cause cavitation, which may degrade the composition including yogurt and a milkfat fluid and may lead to an explosive release of the homogenizationpressure.

In an implementation, milk protein may be combined with the composition including yogurt and a milkfat fluid at step 122 to form a composition including yogurt, milkfat fluid and milk protein. As examples, the milk protein may include: milkprotein concentrate, whole milk protein, whey protein concentrate, casein, Baker's cheese, yogurt powder, dry cottage cheese curd, milk protein curd, or a mixture. A whey protein concentrate having a protein concentration of about 30% by weight, about50% by weight, or about 85% by weight, as examples, may be utilized. As another example, a Hahn's.RTM. Baker's cheese commercially available from Franklin Foods, Inc. may be utilized. As an example, the milk protein may include live and activeculture bacteria. As skim milk, a condensed skim milk or a high protein condensed skim milk dressing, as examples, may be utilized. In an implementation, a milk protein may be combined with the composition including yogurt and a milkfat fluid at aresulting concentration within a range of between about 45% by weight and about 15% by weight. As a further example, a milk protein may be combined with the composition including yogurt and a milkfat fluid at a resulting concentration within a range ofbetween about 35% by weight and about 25% by weight. As another implementation, a milk protein may be combined with the composition including yogurt and a milkfat fluid at a resulting concentration of about 29% by weight. Combining milk protein withthe composition including yogurt and a milkfat fluid at step 122 reduces the overall fat concentration of the Low-Fat Yogurt-Cheese Composition.

Combining a milk protein with the composition including yogurt and a milkfat fluid at step 122 may also, as an example, facilitate incorporation of a higher overall concentration of water into the Low-Fat Yogurt-Cheese Composition. Milk proteinmay, however, have an unappealing flavor and texture. As an example, milk protein may have a strong, unpleasant, astringent flavor. In another example, milk protein may have a lumpy, grainy texture.

In an implementation, combining yogurt with the composition including a milkfat fluid at step 118 of the process 100 may counteract and minimize adverse effects of combining a milk protein with the composition including yogurt and a milkfat fluidat step 122 while making possible the preparation of a Low-Fat Yogurt-Cheese Composition having a reduced overall fat concentration compared with cream cheese. As an example, the yogurt may provide the Low-Fat Yogurt-Cheese Composition with an appealingflavor and a creamy, moist texture in spite of the inclusion of the milk protein. As an example, combination with the milkfat fluid of yogurt at step 118 and a milk protein at step 122 may facilitate production of a Low-Fat Yogurt-Cheese Compositionthat may have attributes including a low overall fat concentration and an appealing taste and texture.

In an implementation, step 122 may include standardizing the composition including yogurt, milkfat fluid and milk protein to a selected overall fat concentration. As another example, the projected fat concentration of the Low-Fat Yogurt-CheeseComposition to be prepared from the composition including yogurt, milkfat fluid and milk protein in further steps of the process 100 may also be determined, based on the selected concentrations of milk protein and the composition including yogurt and amilkfat fluid to be combined together, and based on the overall fat concentration in the composition including yogurt, milkfat fluid and milk protein. In an implementation, low-fat cream cheese may be defined to include a maximum fat concentration of16.5% by weight. Given the variable nature of raw milk, standardization of the fat content in a given batch of the composition including yogurt, milkfat fluid and milk protein may also be useful, as an example, in furtherance of stability of the process100 and of preparation of a uniform Low-Fat Yogurt-Cheese Composition. In an implementation, the overall fat concentration of the composition including yogurt, milkfat fluid and milk protein formed at step 122 may be adjusted to within a range ofbetween about 5% and about 33% by weight. As another example, the overall fat concentration of the composition including yogurt, milkfat fluid and milk protein may be adjusted to within a range of between about 5% and about 16.5% by weight. In afurther implementation, the overall fat concentration of the composition including yogurt, milkfat fluid and milk protein may be adjusted to within a range of between about 9% and about 14% by weight. As an additional example, the overall

27

fatconcentration of the composition including yogurt, milkfat fluid and milk protein may be adjusted to about 11.2% by weight.

As an example, the texture and mouth feel of cheese products may improve with higher overall fat content. The fat content of the composition including yogurt and a milkfat fluid may include butterfat from the milkfat fluid, as an example. In animplementation, a high overall fat content may provide better tolerance of the composition including yogurt, milkfat fluid and milk protein to processing steps, such as agitation shear that may degrade protein and butterfat molecules. However, a highoverall fat concentration in the composition including yogurt, milkfat fluid and milk protein may also lead to a correspondingly higher fat concentration in the Low-Fat Yogurt-Cheese Composition, which may not be optimal from a consumer healthstandpoint. It is understood that standardization may be carried out at other points in the process 100, such as following combination of a milkfat fluid and a stabilizer at step 104 or following combination of yogurt with the composition including amilkfat fluid at step 118, as examples.

In an implementation, a butterfat concentration in a milkfat fluid may be measured using a standard Babcock test. For background, see Baldwin, R. J., "The Babcock Test," Michigan Agricultural College, Extension Division, Bulletin No. 2,Extension Series, March 1916, pp. 1-11; the entirety of which is incorporated herein by reference. Where the butterfat concentration in a milkfat fluid is too high, downward adjustment of the butterfat concentration may be accomplished, as an example,by combining the milkfat fluid with a nonfat ingredient such as skim milk. Introduction of water, as an example, may generally be ineffective because the water concentration of the milkfat fluid may directly affect the texture of the Low-FatYogurt-Cheese Composition. As an example, there may accordingly be a limited feasibility of directly combining water with the composition including yogurt, milkfat fluid and milk protein to reduce the overall fat concentration in the Low-FatYogurt-Cheese Composition. In an implementation, the overall fat concentration of a milkfat fluid may be downwardly adjusted by combining an appropriate amount of nonfat dry milk with the milkfat fluid, together with adequate water to rehydrate thenonfat dry milk. This combination of the milkfat fluid with nonfat dry milk has the advantage of not contributing excess water to the milkfat fluid. In the event that the initial butterfat concentration present in a given milkfat fluid needs to beupwardly adjusted, this may be accomplished by combining in an ingredient containing a higher concentration of butterfat, such as, for example, cream.

In an implementation, the relative concentrations of butterfat, milk protein and water to be provided in the Low-Fat Yogurt-Cheese Composition may all be selected. As an example, the overall fat concentration of the Low-Fat Yogurt-CheeseComposition may be selected. In an implementation, the overall fat concentration of the Low-Fat Yogurt-Cheese Composition may be selected to be less than about 16.5% by weight. In another example, the overall milk protein concentration of the Low-FatYogurt-Cheese Composition may be maximized due to the nutritional benefits, provided that a good texture and "mouth feel" may be retained. As an additional implementation, a sufficient concentration of yogurt may be included in the Low-Fat Yogurt-CheeseComposition to contribute to a flavor and texture appealing to the consumer. Milk protein inclusion increases the overall protein concentration of the Low-Fat Yogurt-Cheese Composition. Milk protein may be hygroscopic, and its capability to absorbwater may tend to degrade the texture of the Low-Fat Yogurt-Cheese Composition, making the composition somewhat grainy. The yogurt may counteract this texture degradation and graininess, and may facilitate the preparation of a Low-Fat Yogurt-CheeseComposition having a texture appealing to the consumer. Water is a secondary ingredient that may be needed both to facilitate processing, as well as to provide an appealing, moist texture in the Low-Fat Yogurt-Cheese Composition. However, excessivewater may not be retained in the Low-Fat Yogurt-Cheese Composition and hence may become a processing hindrance, an expense, and a disposal issue.

As another implementation, the milk protein and the composition including yogurt and a milkfat fluid as combined together at step 122 may be blended at step 124 to form a blend. As an example, milk protein may be hygroscopic, and may accordinglyhave a somewhat crumbly, grainy, sticky, agglomerative texture. The hygroscopicity and crumbly, sticky texture of the milk protein may hinder the formation of a uniform composition at step 122. As an example, blending may accordingly be carried out bysubjecting the composition including yogurt, milkfat fluid and milk protein to high shear in a suitable vessel equipped with a bladed agitator. In an implementation, the composition including yogurt, milkfat fluid and milk protein may be blended by abladed agitator for a time period within a range of between about 10 minutes and about 20 minutes. In a further implementation, a Breddo Lor liquefier having a 300 gallon capacity and a 75 horsepower motor

28

driving the bladed agitator, or a Breddo Lorliquefier having a 500 gallon capacity and a 110 horsepower motor driving the bladed agitator, may be utilized.

In a further implementation, the yogurt may be combined with the composition including a milkfat fluid at step 118 as discussed above and the resulting composition including yogurt and a milkfat fluid may then be homogenized at step 120, prior tocombining the milk protein with the composition including yogurt and a milkfat fluid at step 122. This order of process steps 118-122 may facilitate a breakdown of the crumbly, grainy, agglomerative texture of the milk protein during subsequent blendingin step 124. This facilitated breakdown of the milk protein texture and a resulting dispersion of the milk protein throughout the composition including yogurt and a milkfat fluid may make possible the combination of higher concentrations of milk proteintogether with the composition including yogurt and a milkfat fluid. In another implementation, step 118 may be executed after step 124 so that the yogurt may be combined together with the composition including a milkfat fluid after the combination andblending in of the milk protein. In this latter implementation the absence of the yogurt when step 124 is carried out may lead to poor blending in of the milk protein, possibly necessitating a longer blending cycle as well as imposing a lower ceiling ona maximum concentration of milk protein that may be effectively incorporated into the composition including a milkfat fluid in steps 122 and 124.

In another implementation, combination of the milkfat fluid with the milk protein as discussed above in connection with step 122 may instead or additionally be carried out in step 104. As an example, the composition including a milkfat fluid maybe homogenized following step 104 in the same manner as discussed above in connection with step 120, and next blended as discussed above in connection with step 124.

As an additional implementation, the blend may be pasteurized at step 126. This pasteurization may, as an example, be carried out in a manner as discussed above in connection with step 106. In a further implementation, the pasteurization may becarried out partially or completely at the same time as the blending in step 124. In an example, a Breddo Lor liquefier or a similar apparatus capable of heating and bladed agitation of the composition including yogurt, milkfat fluid and milk proteinmay be utilized to carry out both steps 124 and 126. As an implementation, preparation of a Low-Fat Yogurt-Cheese Composition may be complete following blending and pasteurization at steps 124 and 126. In another example, one or more further steps ofthe process 100, discussed below, may be carried out.

In an example, the blend may be cooled to a bacteria culture temperature at step 128, the blend may then be combined with live culture bacteria in step 130, and the bacteria may be cultured in step 132. As an implementation, these steps 128-132may be selected to be carried out when, in an execution of the process 100, the yogurt that was combined with the composition including a milkfat fluid at step 118 did not contain live culture bacteria.

In another example, the blend may be cooled to a yogurt bacteria culture temperature at step 128 in a manner as discussed above in connection with step 240 of the process 200. As a further implementation, live yogurt culture bacteria may becombined with the blend in step 130 in a manner as discussed above in connection with step 250 of the process 200. In an additional example, the bacteria may be cultured in step 132 in a manner as discussed above in connection with step 260 of theprocess 200. In an implementation, live yogurt bacteria cultures that may themselves provide well-known health benefits to the consumer may be included in the Low-Fat Yogurt-Cheese Composition.

In another example, the blend may be cooled to a cream cheese bacteria culture temperature at step 128 in a manner as discussed above in connection with step 108 of the process 100. As a further implementation, live cream cheese culture bacteriamay be combined with the blend in step 130 in a manner as discussed above in connection with step 110 of the process 100. In an additional example, the bacteria may be cultured in step 132 in a manner as discussed above in connection with step 112 ofthe process 100. In an implementation, the cream cheese bacteria may not provide the same health benefits that may be provided to the consumer by live yogurt bacteria.

In an implementation, the bacteria culture step 132 may be continued until the pH of the blend is within a range of between about 5.0 and about 4.1. As another example, the bacteria culture step 132 may be continued until the pH of the blend iswithin a range of between about 4.6 and about 4.4. In a further implementation, the bacteria culture step 132 may be continued until the pH of the

29

blend is about 4.5.

In an implementation, step 132 may include thickening the blend by combining the composition with a coagulating enzyme, in substitution for or in addition to directly acidifying the composition. As an example, a coagulating enzyme may causecasein protein in milk to form a gel. As another implementation, the action of a coagulating enzyme may require much more time for completion than direct acidification, meanwhile allowing far more culture bacteria activity to occur and delaying thecompletion of acidification. In a further example, the enzyme coagulation process may also be accompanied by syneresis and a resulting loss of albumin protein from the gelled curd. As an implementation, enzyme coagulation may yield an inferior Low-FatYogurt-Cheese Composition having a reduced thickness and a reduced protein concentration. In an example, enzymatic coagulation may take about 12 hours for completion. As an additional implementation, any casein protein coagulating enzyme of animal-,plant-, microbe, or other origin may be used. In another example, the coagulating enzyme may include chymosin, which is also referred to as rennin and is the active component of rennet. Rennet may be purified from calf stomachs. Chymosin may breakdown casein protein to paracasein. Paracasein may combine with calcium to form calcium paracaseinate, which may then precipitate and form a solid mass. Milkfat and water may become incorporated into the mass, forming curds. One part rennin maycoagulate about 10,000 to about 15,000 parts milkfat fluid. In another example, pepsin, which may be purified from the stomachs of grown calves, heifers, or pigs, may be used.

As an example, the pH of the blend may be tested at step 134. In an implementation, the pH of the blend may be measured using a pH meter. As an example, a Fisher Scientific pH meter may be utilized. In an implementation, step 134 may alsoinclude adjusting the pH of the blend to a selected value. As another example, the pH of the blend may be adjusted to within a range of between about 5.0 and about 4.1. In a further implementation, the pH of the blend may be adjusted to within a rangeof between about 4.6 and about 4.4. As an additional example, the pH of the blend may be adjusted to about 4.5. In an implementation, the pH of the blend for preparing a plain flavor Low-Fat Yogurt-Cheese Composition, meaning one that does not containor that contains minimal concentrations of fruits, vegetables, nuts, flavorings, condiments or other food additives, may be adjusted to within a range of between about 4.40 and about 4.50. As another example, the pH of the blend for a flavored Low-FatYogurt-Cheese Composition, meaning one that does contain a significant concentration of fruits, vegetables, nuts, flavorings, condiments or other food additives, may be adjusted to within a range of between about 4.38 and about 4.48. In animplementation, the taste to the palate of plain and flavored Low-Fat Yogurt-Cheese Compositions may begin to become sharp at a pH lower than about 4.40 or 4.38, respectively. In another example, the taste to the palate of either a plain or flavoredLow-Fat Yogurt-Cheese Composition may be too tart at a pH of about 4.2 or lower. In a further implementation, the thicknesses of plain and flavored Low-Fat Yogurt-Cheese Compositions may decline to a poor body or runniness at a pH higher than about 4.50or 4.48, respectively.

In an implementation, the pH adjustment of step 134 may be carried out by combining the blend with an appropriate amount of an edible acid. As examples, edible acids may include lactic acid, phosphoric acid, acetic acid, citric acid, andmixtures. In another implementation, an aqueous mixture of edible acids having a pH within a range of between about 0.08 and about 1.4 may be available under the trade name Stabilac.RTM. 112 Natural from the Sensient Technologies Corporation, 777 EastWisconsin Avenue, Milwaukee, Wis. 53202-5304. As a further example, similar edible acid mixtures may also be available from Degussa Corporation, 379 Interpace Parkway, P.O. Box 677, Parsippany, N.J. 07054-0677. As an additional implementation, theedible acid selected for use may include lactic acid. Lactic acid is a metabolite that may be naturally produced by lactose-consuming bacteria that may be utilized in preparing the yogurt and the composition including a milkfat fluid.

In an implementation, an edible acid may be combined with the blend to rapidly reduce the pH of the blend to a selected value, which may serve to control the thickness of the Low-Fat Yogurt-Cheese Composition. As an additional example, thisdirect acidification of the blend may slow down further propagation of culture bacteria in the composition, as culture bacteria present in the composition may become substantially dormant at a pH substantially below about 4.38. In an implementation,yogurt culture bacteria may substantially survive direct acidification at step 134 and thus may still provide the health benefits of active yogurt cultures to a consumer. As another example, the edible acid present in the Low-Fat Yogurt-CheeseComposition may contribute a good-tasting bite to the flavor of the composition.

30

In an implementation, the pH of the blend may be tested at step 134 following culture of the blend at steps 128-132, and any direct pH adjustment of the blend that is needed may then be promptly completed. As another example, the pH testing andany needed direct acidification may be completed within less than about three (3) hours following combination of the blend with culture bacteria at step 130. In another implementation, pH testing and any needed direct acidification may be completedwithin less than about two (2) hours following combination of the blend with culture bacteria at step 130. As a further implementation, the pH testing and any needed direct acidification may be completed within less than about one (1) hour followingcombination of the blend with culture bacteria at step 130. In an example where direct acidification of the blend may be delayed substantially beyond three hours following combination of the blend with culture bacteria at step 130, the thickness of theLow-Fat Yogurt-Cheese Composition may be correspondingly reduced, and the consistency of the composition may tend to break down with attendant syneresis. In an implementation, excessive culture bacteria activity in the composition including yogurt and amilkfat fluid may be a substantial contributing cause of these adverse effects.

In another implementation, the pH of the composition including yogurt and a milkfat fluid may be tested at step 118 where yogurt is utilized including live culture bacteria, and any direct pH adjustment that is needed may then be promptlycompleted. As another example, the pH testing and any needed direct acidification may be completed within less than about three (3) hours following preparation of the composition including yogurt and a milkfat fluid, utilizing yogurt including liveculture bacteria at step 118. In another implementation, pH testing and any needed direct acidification may be completed within less than about two (2) hours following preparation of the composition including yogurt and a milkfat fluid at step 118. Asa further implementation, the pH testing and any needed direct acidification may be completed within less than about one (1) hour following preparation of the composition including yogurt and a milkfat fluid, utilizing yogurt including live culturebacteria at step 118.

In an implementation, a first point in time T1 when the yogurt and the composition including a milkfat fluid and the live culture bacteria are combined together at step 118 to produce the composition including yogurt and a milkfat fluid, and asecond point in time T2 when the blend may be directly acidified at step 134, may be selected and controlled. In another implementation, a first point in time T1 when the blend may be combined together with culture bacteria at step 130 and a secondpoint in time T2 when the blend may be directly acidified at step 134, may be selected and controlled. As another example, T2 may be a time that is within about three (3) hours or less following T1. In an additional implementation, T2 may be withinabout two (2) hours or less following T1. As another example, T2 may be within about one (1) hour or less following T1.

In an implementation where the time delay between the first and second points in time T1 and T2 may be selected, monitored and controlled, the time delay may be managed between the point in time of preparation of a given portion of blend orcomposition including yogurt and a milkfat fluid including live culture bacteria and the point in time of direct acidification of that same portion. The term "monitored" means that the first and second points in time T1 and T2 may be registered in asuitable manner, which may for example be automated or manual. The term "controlled" means that the time delay between the first and second points in time T1 and T2 may be regulated in a suitable manner, which may for example be automated or manual. Asan example, controlling the time delay between T1 and T2 may ensure that a Low-Fat Yogurt-Cheese Composition prepared from a given portion of blend or composition including yogurt and a milkfat fluid including live culture bacteria will have a selectedtexture and shelf life. In an implementation, execution of the process 100 in a continuous manner may facilitate production of a Low-Fat Yogurt-Cheese Composition having a consistently satisfactory quality, without pockets of thin consistency or ofpropensity to accelerated spoilage. As another example, execution of the process 100 in a batch manner may facilitate production of a Low-Fat Yogurt-Cheese Composition batch having a consistently satisfactory quality, rather than resulting in pockets ofpoor quality or in sub-batches of varying quality. As an example, processing a large batch of blend through step 134 as a series of sub-batches may ensure that no portion of the batch including live culture bacteria awaits direct acidification for morethan about three hours.

In an implementation, step 134 may include measures for retarding culture bacteria activity other than or in addition to direct acidification. As an example, the temperature of the blend may be reduced following completion of step 122 to belowan optimum temperature zone for rapid bacteria growth. In an implementation, an optimum temperature zone for bacteria growth may be within a

31

range of between about 75° F. and about 115° F. As an example, the process 100 may be carriedout to minimize a time period during which the blend and the Low-Fat Yogurt-Cheese Composition may be exposed to temperatures within this range. In an implementation, such temperature control may permit acidification in step 134 to be delayed for up toabout seven (7) hours following preparation of a composition including yogurt with live bacteria cultures and milkfat fluid at step 118 or combination of culture bacteria with the blend at step 130.

In an implementation, the pH testing and direct acidification of step 134 may both be carried out together with blending at step 124 and pasteurization at step 126. As an example, a Breddo Lor liquefier may be utilized to blend and pasteurizethe composition including yogurt, milkfat fluid and milk protein, as well as to directly acidify the composition. In this manner, step 134 may be carried out during step 124 or as soon as blending in step 124 has been completed. As a further example,steps 124, 126 and 134 may be carried out on a continuous and simultaneous basis. As an example, blending may be discontinued upon reaching a selected pH for the composition including yogurt, milkfat fluid and milk protein, in order to avoid excessiveshearing and possible breakdown of the texture of the blend. In an implementation, direct acidification may be carried out at the same temperature range or temperature employed for pasteurization. As a further example, direct acidification may becarried out at a lower temperature than that employed for pasteurization in step 126, although the composition thickness and attendant difficulty of mixing in the direct acidification agent may increase as the temperature is reduced. In animplementation, the temperature of the blend may be reduced to a temperature no greater than a temperature within a range of between about 112° F. and about 114° F. during or after direct acidification in step 134. As an additionalexample, the temperature of the blend may be reduced to a temperature of less than about 100° F. during or after direct acidification in step 134. In a further implementation, the temperature of the blend may be reduced to a temperature of lessthan about 75° F. at a point during or after direct acidification in step 134.

As an example, carrying out direct acidification may become gradually more difficult as the temperature of the blend is lowered, due to a steadily increasing composition thickness. In another implementation, direct acidification of the blend ata temperature below about 60° F. may result in a lumpy composition texture. In an example, cooling of the composition may be effected by holding the composition in a jacketed tank containing a glycol refrigerant maintained at a selectedtemperature to withdraw heat from the blend in the tank. In an additional implementation, the blend may be deemed to be a finished Low-Fat Yogurt-Cheese Composition after completion of step 134, and may as examples be hot-packed, or cooled and packed,at a selected temperature.

In an implementation, direct acidification of the composition including yogurt, milkfat fluid and milk protein as discussed in connection with step 134 may be carried out before blending the composition in step 124. However, direct acidificationmay cause a substantial thickening of the composition including yogurt, milkfat fluid and milk protein, which may hinder the blending step. As another example, step 134 may include lowering the temperature of the blend to a temperature suitable forrefrigeration, to further reduce ongoing bacteria activity. In an implementation, the temperature may be lowered to within a range of between about 34° F. and about 38° F.

In another implementation, step 134 may include combining a suitable preservative with the blend to retard bacteria, yeast and mold growth. As examples, potassium sorbate, sodium benzoate, sorbic acid, ascorbic acid or nisin may be utilized. Inan implementation, the preservative may be combined with the composition before direct acidification and consequent thickening, to facilitate dispersion of the preservative at a minor concentration throughout the blend. Nisin, as an example, is aprotein preservative that may be expressed by Lactococcus lactis. In an additional implementation, flavorings, condiments and the like may be combined with the blend. As an example, a butter flavoring may be combined with the blend. Butter flavoringsmay be commercially available, as examples, from Spice Barn Inc., 499 Village Park Drive, Powell, Ohio 43065; and from Kernel Pops of Minnesota, 3311 West 166th Street, Jordan, Minn. 55352, an affiliate of R.D. Hanson & Associates, Inc. Inanother implementation, a coloring may be combined with the blend. As an example, beta carotene may be utilized as a yellow coloring, which may give the blend a buttery appearance. Adjuvants that may be vulnerable to attack by bacteria, includingfruits and vegetables as examples, may in an implementation be combined with the blend after the temperature of the composition has been reduced below about 75° F. In an implementation, such adjuvants may themselves be treated for increasedresistance to such bacteria.

In an implementation, live yogurt culture bacteria may be combined with the blend in step 136,

32

provided that the temperature of the blend is low enough at and following such introduction to avoid killing or unduly shocking the live culturebacteria. Step 136 may, as an example, be carried out in a manner as discussed in connection with step 130. As an example, the live yogurt bacteria may reinforce the health-related benefits of live and active yogurt culture bacteria that may alreadythen be present in the blend. In an implementation, a need for inclusion of such live culture bacteria at step 136 as well as a concentration of such bacteria to be combined with a given blend may be determined by carrying out a bacteria activity test. As an example a Man, Rogosa and Sharpe ("MRS") broth test may be carried out.

In an implementation, the blend may be passed through a heat exchanger at one or a plurality of selected and controlled temperatures or temperature ranges in step 138. In a further implementation, a heat exchanger may be used that maycontinuously move the blend in contact with a heat exchange surface area in a confined space. As an example, this heat exchange step may yield a blend having a creamier, more uniform texture, with a reduced tendency to exhibit syneresis. In anotherimplementation, this heat exchange step may facilitate incorporation of a higher overall concentration of water into the blend than would otherwise remain stably incorporated. As an example, the heat exchange step may be accompanied by agitation. Inanother implementation, the blend may be passed through a confined space including a heat exchange surface and having an agitator, and then ejected from the confined space through a opening such as a nozzle. As an implementation, the blend may be passedthrough a scraped surface heat exchanger, such as a Waukesha Cherry-Burrell Thermutator.RTM. or Votator.RTM. with agitation while simultaneously controlling the temperature. In another example, a Terlotherm.RTM. vertical scraped surface heatexchanger may be employed. Terlotherm.RTM. machinery is commercially available from Terlet USA, 6981 North Park Drive, East Bldg., Suite 201, Pennsauken, N.J. 08109. In another implementation, a scraped surface heat exchanger may be equipped towithdraw heat from the blend in order to facilitate reduction of the temperature of the composition in the course of the composition's passage through the heat exchanger. As an additional example, the blend may pass through two scraped surface heatexchangers in series. In an implementation, the two scraped surface heat exchangers may be maintained at two or more different temperatures or temperature ranges.

As an example, the blend may be passed with agitation through a heat exchanger at a temperature within a range of between about 58° F. and about 70° F. In a further implementation, the blend may be passed with agitation through aheat exchanger at a temperature within a range of between about 58° F. and about 68° F. As an additional example, the blend may be passed with agitation through a heat exchanger at a temperature within a range of between about 58° F. and about 62° F. As a further implementation, step 138 may include multiple cooling steps that may reduce the temperature of the blend in a staged, controlled manner. As examples, this cooling may be carried out with a smooth and gradualtemperature reduction or in discrete steps. In an implementation, the blend may be cooled to a temperature no higher than about 90° F. before being packed into containers. As an example, the blend may be too sticky at a temperature higher thanabout 100° F. in order to be efficiently packed.

In an implementation, the agitation of the blend in a scraped surface heat exchanger may be controlled to a selected level in order to subject the blend to a selected amount of shear. As an example, the normal operating speed of the agitator ina Waukesha Cherry-Burrell Thermutator.RTM. or Votator.RTM. may need to be reduced, for example to within a range of between about 800 and 1,000 revolutions per minute, in order to avoid excessive shear. As an example, the process 100 may end at step140 after completion of some or all of steps 104-138. In another implementation (not shown), the blend may be cooled in step 138 to a temperature suitable for culture bacteria survival, before combining live bacteria with the blend in the same manner asdiscussed above in connection with step 136.

In an implementation, the Low-Fat Yogurt-Cheese Composition prepared by the process 100 may have the appearance, consistency, and texture of a cheese or butter product. As an example, the texture of the Low-Fat Yogurt-Cheese Composition may besimilar to that of cream cheese, or of another soft cheese. In another implementation, the texture of the Low-Fat Yogurt-Cheese Composition may be similar to that of butter or margarine, in brick or spread form. As an additional example, the Low-FatYogurt-Cheese Composition may have the robust, appealing flavor of yogurt. In a further implementation, the Low-Fat Yogurt-Cheese Composition may include whey protein retained from the milkfat fluid discussed above in connection with step 104. As afurther example, retained whey protein may amplify the flavor of the Low-Fat Yogurt-Cheese Composition and

33

provide a robust taste. In an implementation, facilitating retention of the whey in the Low-Fat Yogurt-Cheese Composition prepared by the process100 may introduce natural flavor while eliminating the pollution and economic loss that may result from separating and discarding whey protein as in conventional cheese production. As an additional example, the Low-Fat Yogurt-Cheese Composition mayinclude a concentration of yogurt selected to counteract graininess and dryness of the milk protein introduced at step 122, thus improving the spreadability of and providing a creamy texture to the composition.

In an implementation, the Low-Fat Yogurt-Cheese Composition may include yogurt at a concentration within a range of between about 40% and about 10% by weight. As a further example, the Low-Fat Yogurt-Cheese Composition may include yogurt at aconcentration within a range of between about 30% and about 20% by weight. As an additional example, the Low-Fat Yogurt-Cheese Composition may include yogurt at a concentration of about 25% by weight. In an implementation, the yogurt itself may besubstantially fat-free or may have a low concentration of fat, so that the yogurt reduces the overall fat concentration of the Low-Fat Yogurt-Cheese Composition.

As an implementation, the Low-Fat Yogurt-Cheese Composition may include butterfat at a concentration within a range of between about 33% and about 5% by weight. In another example, the Low-Fat Yogurt-Cheese Composition may include butterfat at aconcentration within a range of between about 16.5% and about 5% by weight. In a further example, the Low-Fat Yogurt-Cheese Composition may include butterfat at a concentration within a range of between about 14% and about 9% by weight. In yet anotherimplementation, the Low-Fat Yogurt-Cheese Composition may include butterfat at a concentration of about 11.2% by weight.

As an implementation, the Low-Fat Yogurt-Cheese Composition may include milk protein at a concentration within a range of between about 40% and about 5% by weight. In another example, the Low-Fat Yogurt-Cheese Composition may include milkprotein at a concentration within a range of between about 20% and about 10% by weight. As an additional implementation, the Low-Fat Yogurt-Cheese Composition may include milk protein at a concentration of about 13% by weight.

As an example, the Low-Fat Yogurt-Cheese Composition may include cream cheese at a concentration within a range of between about 75% by weight and about 15% by weight; yogurt at a concentration within a range of between about 40% by weight andabout 10% by weight; and milk protein at a concentration within a range of between about 45% by weight and about 15% by weight. As another implementation, the Low-Fat Yogurt-Cheese Composition may include cream cheese at a concentration within a rangeof between about 55% by weight and about 35% by weight; yogurt at a concentration within a range of between about 30% by weight and about 20% by weight; and milk protein at a concentration within a range of between about 35% by weight and about 25% byweight. As a further example, the Low-Fat Yogurt-Cheese Composition may include cream cheese at a concentration of about 46% by weight; yogurt at a concentration of about 25% by weight; and milk protein at a concentration of about 29% by weight.

In an implementation, a proportion of the overall protein content in the Low-Fat Yogurt-Cheese Composition, within a range of between about 10% and about 50% by weight may be contributed by milk protein combined with other ingredients during step104, and a proportion within a range of between about 40% and about 50% by weight may be contributed by milk protein combined with other ingredients during step 122, and a proportion within a range of between about 5% and about 40% by weight may becontributed by yogurt combined with other ingredients during step 118. As another example, a proportion of the overall protein content in the Low-Fat Yogurt-Cheese Composition, within a range of between about 25% and about 40% by weight may becontributed by milk protein combined with other ingredients during step 104, and a proportion within a range of between about 40% and about 50% by weight may be contributed by milk protein combined with other ingredients during step 122, and a proportionwithin a range of between about 12% and about 25% by weight may be contributed by yogurt combined with other ingredients during step 118. In an additional implementation, about 34.8% by weight of the overall protein content in the Low-Fat Yogurt-CheeseComposition, may be contributed by milk protein combined with other ingredients during step 104, and about 47% by weight may be contributed by milk protein combined with other ingredients during step 122, and about 17% by weight may be contributed byyogurt combined with other ingredients during step 118. As another example, a selected proportion of milk protein in the Low-Fat Yogurt-Cheese Composition contributed by milk protein combined at step 122 may be greater than a selected proportion of milkprotein in the Low-Fat Yogurt-Cheese Composition

34

contributed by milk protein combined at step 104.

In an example, the Low-Fat Yogurt-Cheese Composition may include cholesterol at a concentration of less than about 0.05%. In an additional example, the Low-Fat Yogurt-Cheese Composition may include cholesterol at a concentration of less thanabout 0.034%. As a further implementation, the Low-Fat Yogurt-Cheese Composition may include sodium at a concentration within a range of between about 0.2% and 0.4% by weight. In another example, the Low-Fat Yogurt-Cheese Composition may include waterat a concentration within a range of between about 58% and about 63% by weight.

In an implementation, the Low-Fat Yogurt-Cheese Composition may include inulin. Inulin is a polysaccharide that may naturally be found in many plants. Inulin has a mildly sweet taste and is filling like starchy foods, but may not normally beabsorbed in human metabolism and therefore may not affect the sugar cycle. Inulin may reduce the human body's need to produce insulin, which may help to restore a normal insulin level. In addition to being thus potentially beneficial for diabetics,inulin may increase the thickness of the Low-Fat Yogurt-Cheese Composition, which may facilitate the incorporation of as much as between about 2% and about 4% by weight more yogurt into a given Low-Fat Yogurt-Cheese Composition. Inulin also is aprebiotic that may extend the viability of yogurt bacteria in the digestive tract of the consumer, so that the beneficial effects of such bacteria in the body may be increased. Inulin may, however, be implicated in food allergies, and may induceanaphylactic shock in some people. In an implementation, other non-digestible oligosaccharides, and oligosaccharides that may be resistant to human metabolism, collectively referred to herein as "digestion-resistant polysaccharides", such as lactuloseand lactitol, may be utilized instead of or together with inulin. As an example, a minor concentration of a digestion-resistant polysaccharide may be combined with the composition including yogurt and a milkfat fluid at or before blending step 124.

Syneresis may lead to an unattractive and wasteful phase separation between curds and whey when milk is directly coagulated. In an implementation, the Low-Fat Yogurt-Cheese Composition may exhibit substantially no syneresis, or less than about1% syneresis by weight, after being maintained at a temperature within a range of between about 74° F. to about 75° F. for about 15 hours.

As an implementation, the texture and consistency of the Low-Fat Yogurt-Cheese Composition may be the same as that of ordinary cream cheese. In another example, the Low-Fat Yogurt-Cheese Composition may have a consistency similar to that ofbrick butter.

FIG. 3 is a flow chart showing an example of an implementation of a process 300 for preparing a whipped Low-Fat Yogurt-Cheese Composition. In an implementation, the process 300 may be carried out in place of step 138 discussed above. Theprocess 300 starts at step 310, and at step 320 a composition including yogurt, milkfat fluid and milk protein (a "blend") may be prepared by carrying out some or all of steps 104-136 of the process 100. In step 330, the blend may be agitated in thepresence of an inert gas at an elevated pressure. As an example, the blend may be passed through a confined space having an agitator, while being simultaneously subjected to an inert gas at an elevated pressure.

In an implementation, an inert gas may be provided in the confined space at an initial pressure within a range of between about 150 PSI and about 240 PSI. As another example, the inert gas may be provided in the confined space at an initialpressure within a range of between about 220 PSI and about 240 PSI. As a further implementation, the pressure of the inert gas may be controlled throughout the confined space in order to expose the blend to a selected pressure for a defined time as thecomposition travels through the confined space. In an additional example, the inert gas may be injected into the confined space at a selected initial pressure, which may then be permitted to dissipate in the confined space. As an implementation, theblend may be exposed to a selected pressure for a time period within a range of between about 3 seconds and about 6 seconds. As another example, the blend may be exposed to a selected pressure for a time period within a range of between about 4 secondsand about 5 seconds. Although as examples any inert gas may be used, nitrogen may in an implementation be a typical and practical choice. The term "inert" means that the gas substantially does not cause or at least minimizes harmful effects on theblend, its preparation, and the consumer.

In an implementation, injection of a gas into the blend under high pressure may be problematic due

35

to an extreme density mismatch between the gas and the blend. As an example, the blend may resist diffusion of the gas into the composition. Inan implementation, diffusion of the gas throughout the blend may not be instantaneous or rapid even under agitation. As an example, dispersion of the gas throughout the blend in a reasonable time may require a gas delivery pressure that is substantiallyabove a pressure that would be sufficient for equilibration with the prevailing pressure within the blend. This resistance to gas dispersion in the blend may be ameliorated, as an example, by employing an in-line gas injection system providingcontrollable gas injection pressure. In an implementation, such an in-line gas injection system may have a relatively large bore gas delivery orifice. A mass flow controller such as, for example, a GFC-171S mass flow controller commercially availablefrom Aalborg Instruments & Controls, Inc., 20 Corporate Drive, Orangeburg, N.Y. 10962, may be used.

In an implementation, the temperature of the blend may be reduced by cooling the blend at step 340 in advance of step 330, and so maintained or further cooled during step 330. As an example, a scraped surface heat exchanger as earlier discussedmay be used to provide the needed agitation during step 330 while simultaneously reducing the temperature. As another implementation, the temperature of the blend may be reduced to a suitable inert gas injection temperature at step 340, and may then beso maintained or further reduced during step 330. The temperature reduction at step 340 may, as an example, increase the retention of the inert gas in the blend during subsequent step 330. In the absence of such a temperature reduction at step 340before injection of the inert gas at step 330, excessive escape of the inert gas from the blend prior to or during step 330 may as an example retard the whipping process and result in a Low-Fat Yogurt-Cheese Composition having an inadequately whippedtexture. In an implementation, the blend may be cooled at step 340 to an inert gas injection temperature within a range of between about 65° F. and about 68° F., and agitation in the presence of the inert gas at an elevated pressure maythen be carried out at a temperature within a range of between about 58° F. and about 62° F. within a confined space at step 330. In another implementation, the blend may be cooled at step 340 to a whipping temperature within a range ofbetween about 65° F. and about 90° F. As an example, using a temperature above about 90° F. at step 340 may counteract the effect of the pressurized gas in causing the blend to expand into a whipped form. As another example, theblend may be cooled to a whipping temperature of no higher than about 80° F. at step 340. In an implementation, a temperature within a range of between about 58° F. and about 70° F. may then be employed within the confined spaceat step 330. In another example, a temperature within a range of between about 58° F. and about 68° F. may be employed within the confined space at step 330. Either or both of steps 340 and 330 may as examples include multiple coolingsteps that may reduce the temperature of the blend in a staged, controlled manner. This cooling may be carried out, as examples, with a smooth and gradual temperature reduction or in discrete steps. In an implementation, the agitation within a confinedspace such as a scraped surface heat exchanger may be controlled to a selected level in order to maintain the blend within the scraped surface heat exchanger for an adequate time for the pressurized inert gas to act on the composition. As anotherexample, the blend may pass through two scraped surface heat exchangers in series as earlier discussed. The process 300 may then end at step 350.

The resulting product may be a whipped Low-Fat Yogurt-Cheese Composition. The texture and consistency of the Low-Fat Yogurt-Cheese Composition may be, as an example, the same as that of ordinary cream cheese. In another implementation, thetexture and consistency of the Low-Fat Yogurt-Cheese Composition may be the same as that of whipped butter. As another implementation, solid adjuvants such as fruits, vegetables and nuts may be combined with the Low-Fat Yogurt-Cheese Composition afterthe whipping process 300 has been completed.

It is understood that the orders of some of the steps in the processes 100, 200 and 300 may be changed, and that some steps may be omitted. As examples, bacteria culture steps 108-112 and pasteurization step 106, bacteria culture steps 128-132,and bacteria introduction step 136 may be omitted. In another implementation, pasteurization step 114 may be omitted provided that pasteurization step 126 is executed. As a further example, milk protein combination step 122 may be carried out prior tohomogenization step 120 or prior to yogurt combination step 118 or both, although these modifications may increase the difficulty of completing the milk protein combination step and may yield a Low-Fat Yogurt-Cheese Composition having a thin texturelacking in body. As a further implementation, the milkfat fluid may not be homogenized until after its combination with yogurt at step 118, as shown in FIG. 1. In another example, temperature adjustment step 116 may be omitted. Homogenization of themilkfat fluid at an earlier point in the process 100 may be unnecessary and may merely subject the milkfat fluid to extra processing damage, time and

36

expense while not substantially contributing to the quality of the Low-Fat Yogurt-Cheese Composition. In another implementation, stabilizer combination may alternatively be carried out following step 104 but prior to pasteurization at step 114, or at a later point in the process 100. Carrying out stabilizer combination after yogurt combination step 118may result in greater difficulty in handling the composition including yogurt and a milkfat fluid, which may accordingly have a thinner consistency. As an additional example, pH testing and adjustment step 134 may be omitted. As a further example,pre-prepared yogurt not necessarily made according to the process 200 may be utilized. It is further understood that whipping of a blend according to the process 300 may be omitted.

EXAMPLE 1

A batch of 1,500 pounds of pre-pasteurized heavy cream having a butterfat content of 44% by weight is pumped into a kettle equipped with a heater and an agitator. After 15 minutes of agitation, 21.75 pounds of K6B493 stabilizer, 333.26 pounds ofnonfat dry milk and 534 pounds of water are added to the cream with agitation to thicken the mixture. In addition, 169.95 pounds of a milk protein-whey protein composition and 56 pounds of inulin are added to the mixture. The composition includes 57%by weight of Simplesse.RTM.100 microparticulated whey protein concentrate having about 53.2% plus or minus 2% by weight of protein, commercially available from CP Kelco; and 43% by weight of a skim milk protein concentrate having about 42% by weight ofprotein. Sodium chloride in an amount of 24.75 pounds is added to the heavy cream. The cream is then pasteurized by heating it with agitation to 165° F. and holding at that temperature for 15 minutes. The cream is then cooled with agitation to85° F., whereupon 500 milligrams of pHage Control™ 604 cream cheese culture bacteria are added to the cream with agitation for 15 minutes. The cream is then maintained at 85° F. for 75 minutes. The cream is then pasteurized again byheating it with agitation to 165° F. and holding at that temperature for 15 minutes. The temperature of the resulting composition including a milkfat fluid is adjusted down to 130° F. Approximately 12.2% by weight of the protein contentin this composition including a milkfat fluid is derived from the cream.

Meanwhile, yogurt is separately and simultaneously prepared. A batch of 935 pounds of condensed nonfat milk having a solids content of 33% by weight is provided. The solids content is adjusted to about 22% by weight, by addition of 481 poundsof water. The condensed milk is then pasteurized by heating it with agitation to 165° F. and holding at that temperature for 15 minutes. The temperature of the condensed milk is then adjusted to 108° F., whereupon 250 milligrams ofF-DVS YoFast.RTM.-10 yogurt culture bacteria are added to the condensed milk with agitation for 15 minutes. The condensed milk is then maintained at 108° F. for 6 hours. The resulting yogurt is then ready for combination with the compositionincluding a milkfat fluid.

Next, 1,416 pounds of the prepared yogurt are mixed into 2,639 pounds of the composition including a milkfat fluid with agitation. The resulting composition including yogurt and a milkfat fluid is cooled to a temperature of 125° F., andthen homogenized by subjecting the mixture to a pressure of about 3,000 PSI at a temperature of 125° F. for about 5 seconds. Next, 1,657 pounds of a milk protein composition including about 20% by weight of protein are then blended for about 10to about 20 minutes with the composition including yogurt and a milkfat fluid in a Breddo Lor Heavy Duty 2200 RPM Likwifier.RTM. apparatus having a 500 gallon tank with a bladed agitator driven by a 110 horsepower motor. The temperature of the blend isgradually raised in the Breddo Lor agitator tank to about 165° F. and maintained at that temperature for 15 minutes to pasteurize the composition. The temperature of the blend is then adjusted to 108° F., whereupon 250 milligrams ofF-DVS YoFast.RTM.-10 yogurt culture bacteria are added to the blend with agitation for 15 minutes. The blend is then maintained at 108° F. for 6 hours. The pH of the blend is then tested, and the composition is acidified to a pH of about 4.5 byaddition of 57.5 pounds of Stabilac.RTM. 12 Natural acid. The blend is then passed through a Waukesha Cherry-Burrell Thermutator.RTM. scraped surface heat exchanger with agitation for a residence time of about 5 seconds at a temperature within a rangeof between about 58° F. and about 62° F.

The resulting Low-Fat Yogurt-Cheese Composition may include about 11.1% by weight of butterfat; about 11% by weight of milk protein; about 0.0359% by weight of cholesterol; about 0.211% by weight of sodium; about 57% by weight of water; and about43% by weight of solids. The protein content of this Low-Fat Yogurt-Cheese Composition may include approximately: 30.5% by weight derived from the nonfat dry milk together with the whey protein and the stabilizer; 4.3% by weight derived from the cream;47% by weight derived from the milk protein composition, and 18.2% by

37

weight derived from the yogurt. The Low-Fat Yogurt-Cheese Composition may yield substantially no syneresis after 15 hours at about 74° F. to about 75° F.

EXAMPLE 2

A batch of 1,335 pounds of pre-pasteurized heavy cream having a butterfat content of 44% by weight is pumped into a kettle equipped with a heater and an agitator. Sodium chloride in an amount of 214 pounds is added to the heavy cream. After 15minutes of agitation, 19.3 pounds of K6B493 stabilizer, 296 pounds of nonfat dry milk and 475 pounds of water are added to the cream with agitation to thicken the mixture. In addition, 151 pounds of a milk protein-whey protein composition are added tothe mixture. The composition includes 57% by weight of Simplesse.RTM.100 microparticulated whey protein concentrate having about 54% by weight of protein, commercially available from CP Kelco; and 43% by weight of a skim milk protein concentrate havingabout 42% by weight of protein. The cream is then pasteurized by heating it with agitation to 165° F. and holding at that temperature for 15 minutes. The cream is then cooled with agitation to 85° F., whereupon 500 milligrams of pHageControl™ 604 cream cheese culture bacteria are added to the cream with agitation for 15 minutes. The cream is then maintained at 85° F. for 75 minutes. The cream is then pasteurized again by heating it with agitation to 165° F. andholding at that temperature for 15 minutes. The temperature of the resulting composition including a milkfat fluid is adjusted down to 128° F. Approximately 12.3% by weight of the protein content in this composition including a milkfat fluid isderived from the cream; the balance being derived from the nonfat dry milk and the milk protein-whey protein composition.

Meanwhile, yogurt is separately and simultaneously prepared in the same manner as discussed in connection with Example 1. Next, 1,260 pounds of the prepared yogurt is mixed into 2,298 pounds of the composition including a milkfat fluid withagitation. The resulting composition including yogurt and a milkfat fluid is cooled to a temperature of 125° F., and then homogenized by subjecting the mixture to a pressure of about 3,000 PSI at a temperature of 125° F. for about 5seconds. Next, 1,474 pounds of a milk protein composition including about 20% by weight of protein are then blended for about 10 to about 20 minutes with the composition including yogurt and a milkfat fluid in a Breddo Lor Heavy Duty 2200 RPMLikwifier.RTM. apparatus having a 500 gallon tank with a bladed agitator driven by a 110 horsepower motor. The temperature of the blend is gradually raised in the Breddo Lor agitator tank to about 165° F. and maintained at that temperature for15 minutes to pasteurize the composition. The temperature of the blend is then adjusted to 108° F., whereupon 250 milligrams of F-DVS YoFast.RTM.-10 yogurt culture bacteria are added to the blend with agitation for 15 minutes. The blend is thenmaintained at 108° F. for 6 hours. The pH of the blend is then tested, and the composition is acidified to a pH of about 4.5 by addition of 25 pounds of Stabilac.RTM. 12 Natural acid. The blend is then passed through a Waukesha Cherry-BurrellThermutator.RTM. scraped surface heat exchanger with agitation for a residence time of about 5 seconds at a temperature within a range of between about 58° F. and about 62° F.

The resulting Low-Fat Yogurt-Cheese Composition may include about 11% by weight of butterfat; about 10% by weight of milk protein; about 0.0359% by weight of cholesterol; about 0.211% by weight of sodium; about 57% by weight of water; and about43% by weight of solids. The protein content of this Low-Fat Yogurt-Cheese Composition may include approximately: 30.8% by weight derived from the nonfat dry milk together with the stabilizer; 4.2% by weight derived from the cream; 47% by weight derivedfrom the milk protein composition, and 18% by weight derived from the yogurt. The Low-Fat Yogurt-Cheese Composition may yield substantially no syneresis after 15 hours at about 74° F. to about 75° F.

Although the invention has been described with reference to particular examples of implementations, it will be apparent to those skilled in the art that various changes and modifications can be made without departing from the scope of theinvention. Such changes and modification are intended to be covered by the appended claims. The present application is the U.S. National phase of international application number PCT/NZ03/000027, filed Feb. 18, 2003, and claims priority under 35 U.S.C. .sctn.119 to New Zealand application number 517293, filed Feb. 19, 2002 and NewZealand application number 521690, filed Sep. 30, 2002.

FIELD OF THE INVENTION

The present invention relates to a novel process of making cheese and to a cheese product made by said process.

38

BACKGROUND OF THE INVENTION

Traditional cheesemaking processes typically form a coagulum by the addition of an enzyme that sets a vat of cheesemilk. The coagulum is then mechanically cut to form curd particles which allow syneresis to occur.

In this traditional vat setting and cutting process considerable variability in the curd characteristics can occur resulting in impaired product consistency such that compositional and functional characteristics of the final cheese may not fallwithin the standards acceptable by the industry or consumer.

In particular, texture, melt and flavour characteristics are important cheese characteristics. Any method of cheese making that can reduce the variability and criticality of one of the traditional cheese making steps, yet maintain flexibility inthe functional characteristics of the end cheese product, gives the cheese making industry a way of producing a cheese having the required functional characteristics in a consistent manner. This is beneficial to the cheese making industry, largeconsumers such as the pizza industry, as well as individual consumers.

It is an object of the present invention to provide such a process and/or at least to provide the public with a useful choice.

SUMMARY OF THE INVENTION

The present invention provides a process of manufacturing cheese whereby the traditional step of producing a solid coagulated mass of protein or a coagulum from a protein containing starting milk, which requires cutting to aid separation of thecurd from the whey, is replaced with a step whereby such a coagulated mass is caused to disaggregate into small curd particles without mechanical cutting and whereby the curd particles are separated from the whey by simple screen sieving or mechanicalseparation. The production of such curd particles provides a more reliable and consistent curd for cheese making in general. The curd produced by the present invention is then heated and mechanically worked (stretched) such as in traditional mozzarellacheese making processes by either immersing the curd in hot water or heating and working in a substantially liquid-free environment. Moreover, a range of cheeses may be made by this method including but not limited to cheddar, cheddar-like, gouda,gouda-like, as well as mozzarella and mozzarella-like (pizza) cheeses. The term mozzarella in this document includes the generic range of mozzarella cheese types including standard fat and moisture mozzarella, part-skimmed mozzarella and low-moisturemozzarella.

Other GRAS (Generally Regarded As Safe) ingredients common to cheese making process may be added at any suitable stage of the above mentioned processes to alter any functional characteristic or improve flavour, texture, colour and the like, aswould be understood by a person of skill in the art.

The present invention is also directed to a cheese including a soft, semi-soft, hard and extra hard cheese produced by a process according to the invention. Preferred cheeses include cheddar, cheddar-like, gouda, gouda-like, mozzarella andmozzarella-like cheeses. By mozzarella and mozzarella-like (pizza) cheese is meant a cheese made using a process of the present invention, which has stringy characteristics on melting. 

DESCRIPTION OF THE FIGURES

The present invention will now be described with reference to the figures of the accompanying drawings in which:

FIG. 1 shows a schematic drawing of the process of a preferred embodiment of the invention.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides an alternative process of making a cheese having consistent compositional and functional characteristics, such as melt and sensory characteristics.

39

In particular it is an advantage of the present invention that the formation of the coagulum and its subsequent disaggregation into curds and whey is conducted as an in-line, continuous flow process that does not require vat setting or mechanicalcutting of the coagulum.

Specifically, the novel process of the present invention comprises the continuous production of small curd particles in place of the vats of coagulated cheesemilk produced in traditional cheese making processes, in combination with a mechanicalprocessing step whereby the curd particles are heated and worked into a cheese mass in accordance with the traditional mozzarella-type cheese making process.

Surprisingly, cheeses of all types, including soft, semi-soft, hard and extra hard such as cheddar, cheddar-like, gouda, gouda-like, as well as mozzarella and mozzarella-like cheeses may be made by this novel process.

The advantages of the novel process of the present invention include the ability to closely control the functional and compositional characteristics of the end cheese products to enable the consistent production of cheeses having enhancedfunctional and compositional characteristics. In particular, this process allows for the production of cheeses having a higher moisture and lower calcium content than may be achieved using traditional processes.

The continuous production of a liquid stream containing small curd particles is taught in NZ 199366 in relation to the manufacture of milk based foodstuffs including cheese and cheese-like products for incorporation as a raw material intoprocessed foodstuffs.

The present invention uses the curd particles produced by the method of NZ 199366 in combination with a heating and mechanical processing step to produce natural cheeses including cheddar, cheddar-like, gouda, gouda-like mozzarella andmozzarella-like (pizza) cheese for the first time. In addition, the novel process allows for the control of the characteristics of the curd particles so that such cheeses have higher moisture and lower calcium content that the product produced by themethod of NZ 199366 alone.

The present invention provides a method of making cheese comprising adding a coagulating agent to a pasteurised and standardised starting milk and reacting at a temperature which suppresses the formation of a coagulum, passing the reacted mixturealong a flow path while adjusting the pH within a range between 4.0 to 6.0, and cooking said mixture at a temperature of up to 55° C. while inducing controlled turbulence in the mixture to cause rapid coagulation and then disaggregation intosmall curd particles within the flow, separating the curd particles from the whey liquid, heating and mechanically working the curd into a cheese mass at a curd temperature of 50 to 90° C., shaping and cooling the cheese mass.

The curd may be made into a final cheese product immediately while still fresh, or may be frozen and/or dried, and thawed and/or reconstituted before making into cheese.

Preferably, the invention provides a process of making cheese comprising steps of: a. providing a starting milk composition having a fat content of at least 0.05%; b. optionally pasteurising and/or acidifying the milk composition of step (a) topH 6.0 to 6.5; c. adding a coagulating agent to the starting milk composition and reacting preferably for up to 20 hours at a temperature which suppresses the formation of a coagulum; d. optionally adjusting the pH of the reacted milk between pH 4.0 and6.0; e. cooking the milk composition under conditions which allows the formation of coagulated curd particles; f. separating the whey from the curd particles; g. optionally washing the curd particles of step (f) h. optionally freezing and/or drying thecurd particles; i. heating and mechanically working the fresh curd particles of steps (f) or (g) or thawed and/or reconstituted curd particles of step (h), at a curd temperature of 50° C. to 90° C.; and j. shaping and cooling the cheesemass.

The general steps of this preferred process are set out in FIG. 1 and may be carried out in any suitable order as would be appreciated by a skilled worker. Preferably steps (a) to (j) of the process are performed in the recited order.

The cheese made by this process may comprise a soft, semi-soft, hard or extra hard cheese including cheddar, cheddar-like cheese, gouda, gouda-like cheese, mozzarella and mozzarella-like cheese.

40

The starting milk may be selected from one or more of the group comprising whole fat milk; whole milk retentate/concentrate; semi skimmed milk; skimmed milk; skimmed retentate/concentrate; butter milk; butter milk retentate/concentrate and wheyprotein retentate/concentrate or from products made from milk as would be appreciated by a person skilled in the art. One or more powders, such as whole milk powder, skimmed milk powder, milk protein concentrate powder, whey protein concentrate powder,whey protein isolate powder and buttermilk powder or other powders made from milk, reconstituted or dry, singularly or in combination may also be selected as the starting milk or be added to the starting milk.

The starting milk may be sourced from any milk producing animal.

The protein and fat composition of the starting milk composition may be altered by a process known as standardisation. The process of standardisation involves removing the variability in the fat and protein composition of the starting milk toachieve a particular end cheese composition. Traditionally, standardisation of milk has been achieved by removing nearly all the fat (cream) from the starting milk (separation) and adding back a known amount of cream thereto to achieve a predeterminedprotein/fat ratio in the starting milk. The amount of fat (cream) required to be removed will depend upon the fat content of the starting milk and the required end cheese composition. Preferably, the starting milk has a fat content of at least 0.05%. If higher fat contents are required a separate side stream of cream may be added to raise the fat content of the starting milk or the final cheese product as would be appreciated by a skilled worker. Additionally or alternatively, the proteinconcentration may be altered by adding a protein concentrate such as a UF retentate or powder concentrate to a starting milk composition, or by any other method as would be appreciated by a person skilled in the art.

Pasteurisation may be carried out on any liquid stream at any stage of the process and in particular the starting milk and cream streams under standard condition as is known in the art. Optionally the cream is homogenised.

Optionally the starting milk may be preacidified using any food approved acidulent to preferably a pH of 6.0 and 6.5.

The coagulating agent is added to the standardised starting milk and the mixture agitated to distribute the agent. The starting milk composition, containing coagulating agent is reacted under conditions which will not allow the formation of acoagulum, typically at a temperature of <22° C., preferably 8 to 10° C., at a suitable concentration of enzyme for sufficient time to react with the kappa casein. Typically, this reaction period is for 3 to 20 hours. This process isknown as "cold setting" or "cold rennetting". In particular, the coagulating agent is held in the starting milk for a sufficient time to allow the enzyme to cleave the bond of kappa-casein and expose the casein micelle. This starting milk wouldcoagulate but for the temperature control of the reaction mixture.

Preferably the coagulating agent is an enzyme, and preferably the enzyme is chymosin (rennet). Sufficient coagulating agent is added to the starting milk so that the cheese milk will coagulate at the cooking step. For chymosin (rennet), thisconcentration ranges from 1 part rennet to 5,000 parts starting milk and 1 part rennet to 50,000 parts starting milk. A more preferred rennet concentration is between 1 part to 15,000 starting milk and 1 part to 20,000 starting milk.

At this stage the milk composition is pumped through a plant and subjected to in-line treatment.

After reacting with the coagulating agent, the pH of the milk composition (the "reacted milk") is adjusted, if necessary, to pH 4.0 to 6.0 preferably 5.2 to 6.0 by the addition of an acidulent.

Preferably the acidulent is a food grade acid such as lactic acid, acetic acid, hydrochloric acid, citric acid or sulphuric acid and is diluted with water to approximately 1 to 20% w/w and then added to the reacted milk. More preferably, strongacids such as hydrochloric acid, are diluted to 2 to 5% w/w and weak acids such as lactic acid diluted to 10 to 15% w/w before adding to the reacted milk. The acidulent may be dosed in-line, directly into the reacted milk to reduce the pH to the desiredpH.

Alternatively, the acidulent may comprise a growth medium which has been inoculated with a starter culture and reacted to form a fermentate.

41

Pasteurised skimmilk is a preferred growth medium. Fermentation may be induced by adding a starter culture to the growth medium and holding at a suitable temperature for a suitable time for the generation of acid to lower the pH to a level ofbetween pH 4.0 and pH 6.0, preferably pH 4.6.

The starter culture to be added to the pasteurised growth medium stream can be mesophilic or thermophilic or a mix and added at 0.0005 to 5%, preferably 0.01 to 0.2%, most preferably 0.1% of the milk volume. Examples of starter cultures are:Streptococcus thermophilus, Lactobacillus bulgaricus, Lactobacillus helveticus, Lactococcus lactis subspecies cremoris, Lactococcus lactis subspecies lactis.

Once the fermentate stream has reached the target pH, the fermentate can be mixed in-line with the reacted milk. Where the two streams are combined, a further step of mixing and holding the two streams is required, typically for 1 to 20 minutesto ensure that, where the fermentate comprises a milk based medium, such as skimmilk, the coagulating agent in the reacted milk has time to act on the kappa casein in the fermentate. Optionally, the fermentate may be cooled and held for subsequent use.

Optionally a combination of food grade acid and fermentate may be used to acidify the reacted milk.

Once the fermentate and/or food grade acid (if required) have been added and mixed by the liquid flow or using mechanical mixers such as an in-line static mixer, and held at the target pH, the milk composition is heated/cooked preferably to atemperature of 30 to 55° C. by using direct or indirect heating means to coagulate the protein and form coagulated curd particles. In the case of direct heating, steam can be injected into the liquid milk composition flow and in the case ofindirect heating, a jacketed heater or heat exchanger is associated with the pipe along which the liquid is being pumped. The final temperature reached by the curd mixture is determined by the properties required in the final cheese curd. For exampleto decrease the moisture retained in the curd the cook temperature is raised. In a preferred embodiment the flow velocity during cooling is high enough to ensure turbulence in the liquid mixture being passed there along. This enables the proteincoagulum to fragment into small relatively uniform curd particles and syneresis commences. Preferably, the resulting curd particles are between 0.5 cm and 2 cm.

It is necessary to allow time for the syneresis to proceed. Preferably the holding time in the cooking tube is 10 to 50 seconds at the desired final cooking temperature and the flow is laminar. The cooked mixture is passed to a separator toseparate the curds from the whey. The separation may be achieved by any physical means, preferably by sieve or decanter. Optionally, after separation of the curd, the curd may be washed in water. In a preferred embodiment the pH of the water may beadjusted and the washing system may consist of a set of holding tubes. At the end of the holding tubes the washed curd may be separated by any physical means, preferably by sieve or decanter.

A reduction of the pH in the wash water results in solubilisation and removal of calcium from the curd. A preferred embodiment is washing under turbulent conditions with heated water at between 30 and 90° C. at pH 3.0 to 5.4.

Mineral adjustment, and particularly calcium adjustment, is a critical step in the cheesemaking process as the calcium content of the end cheese product affects its functionality and compositional characteristics. The pH of the acidulent, the pHtarget of the acidulated enzyme treated mixture, the cooking temperature and the pH of the wash water (if used) are all steps in this process where calcium solubilisation can be controlled. Surprisingly, the present invention allows a cheese product tobe produced with a significantly lower calcium content than can be achieved using a traditional cheese making process.

The removal of whey and subsequent wash water is referred to in the art as dewheying and dewatering. Optionally the dewheyed/dewatered curd may be frozen and held for future use. In a further option the dewheyed/dewatered curd may be dried. Ina further option the dewheyed/dewatered curd may be allowed to cheddar into a cohesive mass of curd. Cheddaring is known in the art of cheesemaking. The cheddared curd is subsequently milled into particles and optionally salted.

In more traditional cheese making processes all the salt or a portion of the salt is added at this point or none at all. If salt is added after milling, time is allowed for the salt to penetrate the curd

42

(mellowing).

In the next stage of the process the curd particles are converted into a cheese mass by fusing them together by mechanically working and heating at a suitable temperature. In a preferred embodiment a heated mixing device is used to fuse the curdparticles. A time of 1 to 30 minutes is required to conduct the mixing and heating procedure to attain a homogenous cheese mass. About 8 to 12 minutes are preferred.

The heating and mechanical working (stretching) step takes place at a curd temperature of between about 50° C. and 90° C. and may occur by immersing the curd in hot water or hot whey as in a traditional mozzarella cheese makingmethod, or this step may take place in a dry environment as described in U.S. Pat. No. 5,925,398 and U.S. Pat. No. 6,319,526. In either method, the curd is heated and worked into a homogenous, plastic mass. Preferably the curd is heated to a curdtemperature of between about 50° C. to 75° C. using equipment common in the art, such as a single or twin screw stretcher/extruder type device or steam jacketed and/or infusion vessels equipped with mechanical agitators (waterlesscookers).

Optionally cream, high fat cream or milk fat, water, whey protein retentate or whey protein concentrate or salt may be added to the curd during this mixing step. When cream is added, the cream is preferably homogenised.

The hot cheese mass may be immediately extruded into moulds or hoops and the cheese cooled by spraying chilled water/brine onto the surface of the hoops as in traditional mozzarella cheese making processes. This initial cooling step hardens theoutside surface of the block providing some rigidity. Following this initial cooling the cheese is removed from the moulds and placed in a salt brine (partially or completely saturated) bath for a period of time to completely cool the cheese and enableuptake of the salt to the required level. Once cooled the cheese is placed in plastic liners, air removed and the bag is sealed Alternatively, the hot cheese mass may be extruded into sheet-like or ribbon-like form and directly cooled without moulding.

An alternative process sometimes used in commercial practice is to completely dry salt the cheese curd, mellow, heat work and pack directly into plastic liners contained in hoops and the liners sealed. The hoops plus cheese are then immersed inchilled water.

Cooled cheese is stored at between 2° C. to 10° C. Once ready for use the cheese may be used directly or the block frozen or the block shredded and the shreds frozen.

Where the hot cheese mass is extruded as a ribbon or sheet, which provides rapid cooling, shredding and freezing of the shreds may take place in-line, immediately following cooling.

Other GRAS (generally accepted as safe) ingredients common to the cheese making process may be added at any suitable step in the process as would be appreciated by a person skilled in the art. GRAS ingredients include non-dairy ingredients suchas stabilisers, emulsifiers, natural or artificial flavours, colours, starches, water, gums, lipases, proteases, mineral and organic acid, structural protein (soy protein or wheat protein), and anti microbial agents as well as dairy ingredients which mayenhance flavour and change the protein to fat ratio of the final cheese. In particular, flavour ingredients may comprise various fermentation and/or enzyme derived products or mixtures thereof as would be appreciated by a skilled worker. Preferably,such GRAS ingredients may be added after the curd has been milled and/or during the "dry" mechanical working step; and/or to the extruded sheet-like or ribbon-like hot stretched curd; and mixed or worked into the curd to disperse evenly. Alternatively,GRAS ingredients may be added to the starting milk, during in-line acidification, or to the separated coagulated curd particles as would be understood by a skilled worker. The flexibility of allowing any combination of additives to be added at any stepin the process allows the final composition of the cheese to be precisely controlled, including the functionality characteristics.

In a further embodiment, the present invention provides a soft, semi-soft, hard or extra hard cheese product produced by the processes of the invention.

In a further embodiment, the present invention provides a mozzarella or mozzarella-like (pizza) cheese product produced by the processes of the invention.

43

The present invention also provides a food product comprising the mozzarella or mozzarella-like (pizza) cheese of the present invention, such as a pizza.

Any ranges mentioned in this patent specification are intended to inherently include all of the possible values within the stated range.

This invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, and any or all combinations of any two or more of said parts,elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which this invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.

The invention consists in the foregoing and also envisages constructions of which the following gives examples.

EXAMPLE 1

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight for approximately 16 hours at 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking, to reduce the pH to pH 5.4. The mixture was heated by direct steam injection at 42 to 44° C. and held for 50 seconds in holding tube. The coagulated cooked curd particleswere separated from the whey using a screen, washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd) and separated from the wash water using a decanter. After dewatering the curd was frozen for later use.

On thawing the aggregated curd was milled and partially dried using a ring drier to 48% moisture. Salt (0.2 kg), high fat cream (7 kg), 0.272 kg of lactic acid (16% solution) and flavours were added to 7 kg of milled and partially dried curd.

The flavours comprised a mixture of pre-prepared concentrated fermentation and enzyme-derived flavour ingredients [1.5% Alaco EMC (DairyConcepts, USA), 350 ppm Butyric acid and 16 mM acetate in final product (Bronson & Jacobs Ltd, NZ)].

The curd and added ingredients were blended in a twin screw auger blender/cooker (Blentech Kettle, model CL0045, Twin screwcooker 1994, Rohnert Park, Calif., United States of America) for approximately 30 seconds at 50 rpm. Speed of mixing wasincreased to 90 rpm and direct steam injection applied to bring the temperature of the mixture to 50° C. Mixing speed was then further increased to 150 rpm and the temperature raised to approximately 68° C. Once at approximately68° C. the now molten curd mixture was worked at 150 rpm for a further 1 minute.

The molten curd was held for 1 to 3 minutes and then packaged into 0.5 kg pottles and the pottles were air cooled for >12 hours to approximately 5° C.

After 1 month storage this cheese had a firm texture and exhibited a cheesy-cheddar-like flavour.

The final cheese composition was 35.0% fat, 38.5% moisture, 1.84% salt, pH 5.44 and a calcium level of 101 mmol Ca/kg cheese.

EXAMPLE 2

Approximately 1800 L of skimmilk was pasteurized and then cooled to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 10° C. Dilute sulphuric acid was then added tothe cold renneted milk, in-line immediately prior to cooking, to reduce the pH to pH 5.4, and the mixture heated by direct steam injection at 42 to 44° C. and held for 50 seconds in a holding tube. The coagulated curd particles were separatedfrom the whey using a screen, washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd) and separated from the wash water using a decanter. After dewatering the curd was frozen for later use.

On thawing the coagulated curd was milled and partially dried using a ring drier to 49% moisture. Salt (0.265 kg), high fat cream (6.25 kg), 0.272 kg of lactic acid (16% solution) and flavours were

44

added to 7 kg of milled and partially driedcurd.

The flavours comprised prepared concentrated fermentation and enzyme-derived flavour ingredients [50 ppm Butyric acid, 8 mM acetate and 2.5 ppm diacetyl in final product (Bronson and Jacobs Ltd, NZ) and 1 ppm Lactone].

The curd and added ingredients were blended and heated according to the procedure given in Example 1.

The molten curd was packaged into 0.5 kg pottles and the pottles were air cooled for >12 hours.

Following cooling the curd was analysed for moisture, fat, salt and pH.

After 1 month storage this cheese had a firm texture and exhibited a sweet Gouda-like flavour.

The final cheese composition was 35.5% fat, 39.1% moisture, 1.81% salt, pH 5.51 and a calcium level of 54 mmol Ca/kg cheese.

EXAMPLE 3

Approximately 1800 L of skimmilk was pasteurised and then cooled to 8 to 10° C. before rennet was added (100 ml, i.e. 55 ml/1000 L). The renneted milk was left to stand for approximately 16 hours at 8 to 10° C. After 16 hoursdilute sulphuric acid was added to the cold renneted milk, in-line immediately prior to cooking, to reduce the pH to pH 5.3 and the mixture heated by direct steam injection at 42° C. and held for 50 seconds in a holding tube.

The coagulated curd particles were separated from the whey using a screen and washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd). The washed coagulated curd particles, with a moisture content of about 52%, wereseparated from the wash water using a decanter. After dewatering the curd was milled. Salt (0.2 kg), water (2.0 kg) and high fat cream (4.0 kg) were added to 7 kg of milled curd.

The curd and ingredients were blended according to the procedure given in Example 1, with the exception that the final temperature was 72° C.

The molten curd was packaged into 0.5 kg pottles and the pottles were air (12 hours.

Following cooling the curd was analysed for moisture, fat, salt and pH.

The final cheese composition was 21.0% fat, 53.7% moisture, 1.42% salt, pH 5.42 and a calcium level of 61 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days following manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms ofblister size, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 4

Approximately 1200 L of reconstituted skimmilk powder (8.3% solids) was pasteurized and then cooled to 8 to 10° C. before rennet was added (66 ml). The renneted milk was subsequently acidified with diluted sulphuric acid (2.5% w/w),cooked (42 to 45° C.) and the coagulated curd separated and washed as outlined in Example 3

Salt (0.2 kg), water (1.8 kg), lactic acid (0.272 kg of a 16% solution) and high fat cream (4.0 kg) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅72° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.5% fat, 52.9% moisture, 1.40% salt, pH 5.80 and a calcium

45

level of 106 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days following manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms ofblister size, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 5

Approximately 2250 L of skimmilk was pasteurised and then cooled to 15° C. before a microbial enzyme Fromase 45TL (DMS Food Specialities, NSW, Australia) was added (200 ml). The Fromase treated milk was left to stand for approximately 3hours at 15° C. After 3 hours dilute sulphuric acid was added to the cold renneted milk, in-line immediately prior to cooking at 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

The coagulated curd particles with a moisture content of about 53% were separated from the wash water using a decanter. After dewatering separation the curd was milled. Salt (0.2 kg), water (2.0 kg) and high fat cream (4.0 kg) were added to 7kg of milled curd. The curd and ingredients were blended in a twin screw auger blender/cooker, heated to ≅72° C. and packed and stored under chilled conditions as outlined in Example 3. The final cheese composition was 20.5% fat, 55.6%moisture, 1.42% salt, pH. 5.97 and a calcium level of 93 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days following manufacture pizzas made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 6

Approximately 450 L of skimmilk was pasteurised and then cooled to 7° C. before a microbial enzyme Fromase 45TL (DMS Food Specialities, NSW, Australia) was added (40 ml). The Fromase treated milk was left to stand for approximately 3hours at 7° C. After 3 hours dilute sulphuric acid was added to the cold renneted milk, in-line immediately prior to cooking at 50° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

The coagulated curd particles with a moisture content of about 53% were separated from the wash water using a decanter. After dewatering separation the curd was milled.

Salt (0.2 kg), water (2.0 kg) and high fat cream (4.0 kg) were added to 7 kg of milled curd. The curd and ingredients were blended in a twin screw auger blender/cooker, heated to ≅72° C. and packed and stored under chilledconditions as outlined in Example 3.

The final cheese composition was 21% fat, 55.0% moisture, 1.44% salt, pH. 5.98 and a calcium level of 92 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blister size, coverageand colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 7

Approximately 450 L of skimmilk was pasteurised and then cooled to 7° C. before a microbial enzyme Fromase 45TL (DMS Food Specialities, NSW, Australia) was added (40 ml). The Fromase treated milk was left to stand for approximately 3hours at 7° C. After 3 hours dilute sulphuric acid was added to the cold renneted milk, in-line immediately prior to cooking at 38° C., to reduce the pH to pH 5.35. The cooking process used was as outlined in Example 3. Washing was notcarried out.

46

The coagulated curd particles with a moisture content of about 54% were separated from the whey using a decanter. After whey separation the curd was milled. Salt (0.2 kg), water (2.0 kg) and high fat cream (4.0 kg) were added to 7 kg of milledcurd. The curd and ingredients were blended in a twin screw auger blender/cooker, heated to ≅72° C. and packed and stored under chilled conditions as outlined in Example 3. The final cheese composition was 23% fat, 50% moisture, 1.61%salt, pH. 5.87 and a calcium level of 115 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 8

Approximately 2250 L of skimmilk was pasteurized and cooled to 8 to 10° C. and rennet was added (125 ml, i.e. 55 ml/1000 L). The renneted milk was left to stand overnight for approximately 16 hours at 8 to 10° C. A second milkstream comprising 900 L of skimmilk and a lactic acid culture (Lactococcus lactis subspecies cremoris) was prepared and also left to stand overnight for approximately 16 hours at 26° C. to reduce the pH of the milk to pH 4.6. The second milkstream was then added to the cold renneted milk and mixed. The pH of the mixture was 5.3. The mixture was then cooked using direct steam injection at 48° C. and held for 50 seconds in a holding tube. The coagulated curd particles wereseparated from the whey using a screen and washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd). The washed, coagulated curd with a moisture content of about 53% was separated from the wash water using a decanter, milledand salted. Salt (0.2 kg), water (1.4 kg) and high fat cream (4 kg) were added to 7 kg of milled curd. The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅62° C. and packed and stored underchilled conditions as outlined in Example 3.

The final cheese composition was 22.2% fat, 54.3% moisture, 1.50% salt, pH 5.09, and a calcium level of 53 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

In the ensuing examples, the coagulated curd particles were separated from the whey using a screen and washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd). The washed, coagulated curd was separated from the washwater using a decanter and typically had a moisture content of between 52 and 54% w/w.

EXAMPLE 9

Approximately 600 L of skimmilk was pasteurised and then cooled to 8 to 10° C. before rennet was added (33 ml). The renneted milk was left to stand for approximately 16 hours at 8 to 10° C. After 16 hours dilute lactic acid (0.25M) was added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled and salted. Salt (0.2 kg), water (1.9 kg) and high fat cream (4.0 kg) and Lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd. The curd and ingredients were blended in a twin screwauger blender/cooker, heated to ≅60° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 20.5% fat, 54.3% moisture, 1.37% salt, pH. 5.64 and a calcium level of 93 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process similar functional properties in terms of blister size,coverage and colour, background colour, melt

47

appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 10

Approximately 600 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (33 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute acetic acid (0.25 M) wasthen added to the cold renneted milk, in-line immediately prior to cooling at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled and salted. Salt (0.2 kg), water (1.9 kg), high fat cream (4.0 kg), lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated and to ≅65° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 20.5% fat, 54.1% moisture, 1.39% salt, pH 5.64 and a calcium level of 101 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 11

Approximately 600 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (33 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute hydrochloric acid (0.25 M)was then added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled. Salt (0.2 kg), water (1.9 kg), high fat cream (4.0 kg), lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅65° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.0% fat, 53.3% moisture, 1.41% salt, pH 5.64 and a calcium level of 99 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 12

Approximately 600 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (33 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid (0.25 M)was then added to the cold renneted milk, in-line immediately prior to cooling at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled. Salt (0.2 kg), high fat cream (4.0 kg) and lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅65° C. and worked as outlined in Example 3

48

Once at approximately 65° C. water (0.95 kg) was added and the now molten curd mixture was worked at 150 rpm for a further 1 minute.

The molten curd was then packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.0% fat, 54.0% moisture, 1.39% salt, pH 5.52 and a calcium level of 91 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 13

Approximately 2250 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (125 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid (0.25 M)was then added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3

After dewatering the curd was milled. Salt (0.18 kg), emulsification salts (0.035 kg trisodium citrate), water (2.4 kg), high fat cream (4.15 kg) and lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅65° C. and packed and stored under chilled conditions as outline in Example 3.

The final cheese composition was 21.0% fat, 54.5% moisture, 1.24% salt, pH 5.84 and a calcium level of 91 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 14

Approximately 2250 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (125 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid (0.25 m)was then added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled. Salt (0.22 kg), gums (1.4 kg of an aqueous 10% kappa carrageenan solution), water (1.3 kg), high fat cream (4.0 kg) and lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅65° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.5% fat, 53.3% moisture, 1.61% salt and pH 5.78 and a calcium level of 98 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

49

EXAMPLE 15

Approximately 2250 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (125 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid (0.25 m)was then added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled. Salt (0.21 kg), whey protein concentrate (cheese whey derived with 80% protein) derived from cheese whey (0.385 kg of an aqueous 20% solution), water (2.15 kg), high fat cream (4.15 kg) and lactic acid(0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated at ≅65° C. and packed at stored under chilled conditions as outlined in Example 3.

The final cheese composition was 20.0% fat, 55.1% moisture, 1.40% salt, pH 5.82 and a calcium level of 92 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blister size,coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 16

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 42 to 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was frozen for later use. On thawing the aggregated curd was milled. Water (1.8/kg), salt (0.2 kg), high fat cream (4 kg) and 0.272 kg of lactic acid (16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅68° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 22.0% fat, 54.0% moisture, 1.41% salt, pH 5.38 and a calcium level of 73 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 17

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 42 to 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was allowed to cheddar and frozen for later use. On thawing the cheddared curd was milled. Water (1.45 kg), salt (0.2 kg), high fat cream (3.5 kg) and 0.272 kg of lactic acid (16% solution) were added to 7 kg of milledcurd.

50

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅68° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.0% fat, 53.6% moisture, 1.49% salt, pH 5.31 and a calcium level of 63 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 18

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 42 to 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was allowed to cheddar and frozen for later use. On thawing the cheddared curd was milled. Water (1.1 kg), salt (0.2 kg), high fat cream (3.0 kg) and 0.272 kg of lactic acid (16% solution) were added to 7 kg of milledcurd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅68° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 19.5% fat, 53.3% moisture, 1.61% salt, pH 5.33, and a calcium level of 61 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 19

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 42 to 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was allowed to cheddar and frozen for later use. On thawing the cheddared curd was milled. Water (0.75 kg), salt (0.165 kg), high fat cream (2.5 kg) and 0.272 kg of lactic acid (16% solution) were added to 7 kg ofmilled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to 68° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 17.0% fat, 53.5% moisture, 1.42% salt, pH 5.33 and a calcium level of 68 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made made by this process showed similar functional properties in terms ofblister size, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 20

51

Approximately 2200 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (120 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was allowed to cheddar and was then chilled for use 5 days later. When required the cheddared curd was milled. Water (3.1 kg), salt (0.69 kg), high fat cream (7.0 kg) and (0.035 kg) Tri Sodium Citrate were added to 12kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅68° C. as outlined in Example 3.

The 68° C. homogenous mass of curd was then placed in a dry, twin screw Mozzarella pilot plant cooker/stretcher (in-house design) and pumped through a (60 to 65° C.) jacketed, 10 barreled (16 mm×200 mm) String cheeseextrusion head. The Mozzarella cooker/stretcher was used as a pump to push the molten curd through the extrusion head.

Strings were cut into approximately 300 to 400 mm lengths and cooled in chilled water for approximately 10 to 15 minutes. On removal from the chilled water bath the lengths of String cheese were trimmed to 200 mm, laid on trays and blast frozen(-32° C.) for at least 1 hour.

The final String cheese composition was 20.5% fat, 54.1% moisture, 2.28% salt, pH 6.03 and a calcium level of 87 mmol/kg cheese.

The String cheese made by this process showed similar fibrous texture and flavour characteristics as those obtained in commercial String cheese made from Mozzarella curd.

INDUSTRIAL APPLICATION

The processes of the present invention and cheese made using the processes have commercial application in the cheese industry. In particular, mozzarella cheese made by this process has application in the pizza making industry that utilisesmozzarella and mozzarella-like (pizza) cheese in significant quantities.

It will be appreciated that it is not intended to limit the invention to the above examples only, many variations, such as might readily occur to a person skilled in the art being possible without departing from the scope as defined in theappended claims.

2. 1. Field of the Invention

The present invention relates to dairy products that are manufactured by using a protein deamidating enzyme and present smooth oral sensation with suppressed acidic taste and bitter taste. The present invention also provides a method ofmanufacturing the foregoing.

2. Discussion of the Background

Dairy products such as cheese, yogurt, etc. were once unfamiliar foodstuffs for Japanese. However, in recent years, their consumption has increased due to their health and nutrition-related functions. Thus, a variety of dairy products are onthe market to meet diversified food preference of consumers.

Rennet is a milk-clotting enzyme for cheese, which is well-known in the filed for manufacturing dairy products. Further, a method utilizing a transglutaminase for cheese (Japanese Patent Application Laid-Open (Kokai) No. Hei 8-173032) and amethod utilizing the same for yogurt (Japanese Patent Application Laid-Open (Kokai) No. Hei 6-197688) are also known.

Japanese Patent Application Laid-Open (Kokai) No. 2000-50887 discloses a method for using a protein deamidating enzyme to deamidate casein, thereby to improve the dispersibility and solubility thereof, and a method of manufacturing pudding-likefoods which comprises allowing a transglutaminase to act on concentrated milk, wherein a protein deamidating enzyme is added to terminate the transglutaminase action. Japanese Patent Application Laid-Open (Kokai) No. 2001-218590 discloses a methodwherein a protein deamidating enzyme is allowed to act on a milk

52

caseinate or a whey protein, in order to deamidate, thereby to improve the foaming properties, emulsification, and solubility thereof. Japanese Patent Application Laid-Open (Kokai) No.2003-250460 discloses a method wherein a protein deamidating enzyme is allowed to act on β-lactoglobulin, in order to deamidate, thereby to improve the properties in foaming and emulsification.

However, these patent documents do not describe a method for providing a dairy product according to the present invention which presents smooth oral sensation with suppressed acidic taste and bitter taste. In particular, none of the foregoingreferences disclose a cheese and/or yogurt which present smooth oral sensation with suppressed acidic taste and bitter taste. As such, there remains a critical need for a method of producing a dairy product according to the present invention whichpresents smooth oral sensation with suppressed acidic taste and bitter taste, as well as a dairy product produced thereby.

SUMMARY OF THE INVENTION

It is an object of the present invention to provide a dairy product which presents smooth oral sensation with suppressed acidic taste.

It is also an object of the present invention to provide a method for manufacturing a dairy product which presents smooth oral sensation with suppressed acidic taste, in order to meet diversified preference in taste of consumers.

The present inventors have made an intensive and extensive study to solve the above-mentioned objects, and found that a protein deamidating enzyme can be added to raw milk to act on the milk protein in the raw milk. As such, the presentinvention is exemplified by the following embodiments:

(1.) A method for manufacturing a dairy product comprising adding a protein deamidating enzyme to raw milk and maintaining said protein deamidating enzyme in contact with said milk protein in the raw milk for a time and under conditions suitableto permit the enzyme to deamidate said milk protein.

(2.) The method according to (1), wherein said protein deamidating enzyme is prepared from culture liquid of a microorganism producing said protein deamidating enzyme.

(3.) The method according to (1), wherein said protein deamidating enzyme is powderized prior to said adding.

(4.) The method according to (1), wherein the activity of said protein deamidating enzyme is confirmed prior to said adding by a method comprising: (a) An aqueous solution (10 μl) containing a protein deamidating enzyme is added to 100 μlof 176 mM phosphate buffer (pH 6.5) containing 30 mM of Z-Gln-Gly, incubated at 37° C. for 10 minutes and the reaction is stopped by an addition of 12% TCA solution; (b) The enzyme concentration is adjusted to 0.05 mg/ml by an appropriatedilution with using 20 mM phosphate buffer (pH 6.0) and, after a centrifugal separation, the supernatant liquid is subjected to quantitative measurement of NH3; (c) 10 μl of the supernatant liquid and 190 μl of 0.1 M triethanolamine buffer (pH8.0) are added to 100 μl of a reagent II liquid, the mixture is allowed to stand at room temperature for 5 minutes and the absorbance at 340 nm is measured; (d) Measurement of the concentration of protein is carried out at a detection wavelength of595 nm using a protein assay CBB (Coomassie Brilliant Blue) solution; and (e) The activity of a protein deamidating enzyme is determined by the following expression: Specific Activity (U/mg)=[(Ammonia concentration (μmol/ml) in reactionsolution)×(Amount (ml) of reaction solution)×(Diluted rate of enzyme)]/[(Amount (ml) of enzyme solution)×(Concentration (mg/ml) of protein)×(Reaction time (min))].

(5.) The method according to (1), wherein said raw milk is an edible milk selected from the group consisting of cow milk, buffalo milk, goat milk, sheep milk, and horse milk.

(6.) The method according to (1), wherein said raw milk is in a form selected from the group consisting of a pasteurized milk, a milk formulated in milk fat, a diluted milk, a concentrated milk, a dried milk, a defatted dry milk, a defatted milksolution, and a processed milk.

(7.) The method according to (1), wherein said dairy product is a solid food.

53

(8.) The method according to (1), wherein said dairy product is a gel food.

(9.) The method according to (1), wherein said dairy product is a solid food or a gel food produced from a raw material selected from the group consisting of a natural cheese, a processed cheese, a set yogurt, a stirred yogurt, a bavarois, amilk jelly, and a pudding.

(10.) The method according to (1), wherein said dairy product is cheese or yogurt.

(11.) The method according to (1), wherein said protein deamidating enzyme is added in an amount ranging from 0.1 to 500 units per 1 L of said raw milk.

(12.) The method according to (1), wherein said protein deamidating enzyme is added in an amount ranging from 0.1 to 100 units per 1 L of said raw milk.

(13.) The method according to (1), wherein the temperature during said maintaining ranges from 5 to 80° C.

(14.) The method according to (1), wherein the temperature during said maintaining ranges from 20 to 60° C.

(15.) The method according to (1), wherein the pH during said maintaining ranges from 2 to 10.

(16.) The method according to (1), wherein the pH during said maintaining ranges from 4 to 8.

(17.) The method according to (1), wherein said maintaining is for a time ranging from 10 seconds to 48 hours.

(18.) The method according to (1), wherein said maintaining is for a time ranging from 10 minutes to 24 hours.

(19.) The method according to (1), wherein said protein deamidating enzyme is encoded by a polynucleotide having the sequence of SEQ ID NO: 1.

(20.) The method according to (1), wherein said protein deamidating enzyme has the amino acid sequence of SEQ ID NO: 2.

(21.) The method according to (1), wherein said protein deamidating enzyme corresponds to the mature peptide fragment of the amino acid sequence of SEQ ID NO: 2.

(22.) A dairy product produced by the method of (1). 

The above objects highlight certain aspects of the invention. Additional objects, aspects and embodiments of the invention are found in the following detailed description of theinvention.

DETAILED DESCRIPTION OF THE INVENTION

Unless specifically defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled artisan in enzymology, biochemistry, cellular biology, molecular biology, and the food sciences.

All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications,patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only andare not intended to be limiting, unless otherwise specified.

The protein deamidating enzyme according to the present invention acts directly on the amide groups of a protein and has an activity to deamidate with neither peptide bond cleavage nor protein crosslink accompanied. The protein deamidatingenzyme is not particularly limited in type so far as it has the action. An enzyme disclosed in Japanese Patent Application Laid-Open (Kokai) No.

54

2000-50887 or Japanese Patent Application Laid-Open (Kokai) No. 2001-21850 is an example of such enzymes,but the enzymes of the present invention are not limited to them. A protein deamidating enzyme may be used, which has been prepared from the culture broth of a microorganism producing the protein deamidating enzyme. Microorganisms to be used forpreparation of the protein deamidating enzyme are not particularly limited.

In order to prepare the protein deamidating enzyme from the culture broth of a microorganism, any known method for protein separation and protein purification (centrifugation, UF concentration, salting-out, and various chromatographies using ionexchange resin or the like) may be used. For example, a culture broth can be centrifuged to remove the microorganism cells, followed by salting out, chromatography and the like in combination to obtain the target enzyme.

In order to collect the intracellular enzyme from microbial cells, for example, the microbial cells are first subjected to pressurization, ultrasonic treatment or the like to crush, and the target enzyme is then separated and purified asdescribed above. In this connection, a microorganism culture broth may be in advance subjected to filtration or centrifugation to collect the microorganism cells, which are subjected to a series of the above-mentioned steps (disrupt of the microbialcells, separation, purification of the enzyme). The enzyme may be powdered by drying step such as freeze drying, reduced-pressure drying, or the like, during which appropriate bulking agent(s) or drying aid(s) may be used.

Activity of a protein deamidating enzyme of the present invention is determined by a modified method of the method described in Japanese Patent Application Laid-Open (Kokai) No. 2000-50887. Specifically, the following method may be employed:

(1) 10 μl of an aqueous solution containing the protein deamidating enzyme is added to 100 μl of 176 mM phosphate buffer (pH 6.5) containing 30 mM Z-Gln-Gly, and the reaction mixture is incubated at 37° C. for 10 min, followed byadding 100 μl of 12% TCA solution thereto, whereby the reaction is terminated.

(2) The resultant solution is diluted appropriately with 20 mM phosphate buffer (pH 6.0) to adjust an enzyme concentration to 0.05 mg/ml, and centrifuged (12000 rpm, 4° C., 5 min) to obtain a supernatant, which is analyzed to quantifyNH3 by an F-kit ammonia (manufactured by Roche).

(3) 10 μl of the supernatant and 190 μl of 0.1 M triethanolamine buffer (pH 8.0) are added to 100 μl of the reagent II solution (F-kit accessory), and left to stand at room temperature for 5 min. 100 μl of the resulting solution isused to determine the absorbance at 340 nm. The remaining 200 μl of the resulting solution is added with 1.0 μl of the reagent III (F-kit accessory, glutamate dehydrogenase), left to stand at room temperature for further 20 min, and then is usedto determine the absorbance at 340 nm. The ammonia standard solution attached to the F-kit is used to make a calibration curve showing a relation between ammonia concentration and change in absorbance (340 nm), and the curve is used to determine theconcentration of ammonia in the reaction solution.

(4) The protein assay CBB (Coomassie Brilliant Blue) solution (manufactured by Nacalai Tesque) is used to determine a protein concentration at a detection wavelength of 595 nm. BSA (manufactured by Pierce) is used as the standard.

(5) The activity of the protein deamidating enzyme is determined by the following equation: Specific activity (U/mg)=(Concentration of ammonia in reaction solution (μmol/ml)×Reaction solution volume (ml)×Enzyme dilutionrate)/(Volume of enzyme solution (ml)×Protein concentration (mg/ml)×Reaction time (min))

As used in the present specification, an enzyme activity that releases 1 μmol of ammonia per 1 minute is defined as 1 unit (U).

The raw milk to be used according to the present invention is an edible milk such as cow milk, buffalo milk, goat milk, sheep milk, horse milk and the like. Further, for each of the foregoing, a pasteurized milk, a milk formulated in componentsuch as milk fat, a diluted milk, a concentrated milk, a dried milk, a defatted dry milk, a defatted milk solution, and a processed milk are included in this category.

The dairy product of the present invention includes a solid or gel food produced using, as the raw

55

material, a natural cheese, a processed cheese, a set yogurt, a stirred yogurt, a bavarois, a milk jelly, a pudding and the like.

The protein deamidating enzyme may be added to raw milk, alone or in combination with other raw material(s). The reaction conditions for the protein deamidating enzyme (such as enzyme amount, reaction time, temperature, pH of the reactionsolution and the like) are not particularly limited, but the enzyme is added preferably in an amount of 0.1 to 500 units, more preferably 0.1 to 100 units per 1 L of the raw milk.

In the case of a processed milk such as diluted milk, concentrated milk, dried milk, defatted dry milk or the like, the protein deamidating enzyme is used in an amount based on the volume in terms of a volume of the raw milk before processed. For example, when 100 g of defatted dry milk is obtained from 1 L of the raw milk, 0.1 to 500 units of the enzyme per 100 g of the defatted dry milk that corresponds to 1 L of the raw milk are preferable and 0.1 to 100 units are more preferable.

The reaction temperature is preferably 5-80° C., more preferably 20-60° C.

The pH of the reaction solution is preferably 2-10, more preferably 4-8.

The reaction time is preferably 10 sec to 48 hours, more preferably from 10 min to 24 hours.

The foregoing conditions may be changed or adjusted appropriately depending on purity of the enzyme to use, kind and purity of protein to use, or the like. The solution after enzyme reaction may be, for example, heated to deactivate the enzymein order to manufacture a dairy product, or may be subjected to no special deactivation in the same way as a rennet is.

The dairy product such as defatted dry milk or the like, which is improved in quality by adding raw milk with a protein deamidating enzyme to deamidate, may be added at a step for manufacturing other dairy products such as cheese, yogurt and thelike. For example, a modified defatted dry milk, which is produced by adding 100 g of a defatted dry milk with 0.1 to 500 units, preferably 20 to 100 units of the enzyme, can be added to raw milk at a rate of 1-5% to manufacture a yogurt whichsmoothness is imparted to.

In accordance with the present invention, it is possible to provide a diary product with smooth oral sensation and suppressed acidic taste and bitter taste, and to manufacture cheese at improved curd yields. Therefore, the present invention isextremely useful in the industrial field of foods.

The above written description of the invention provides a manner and process of making and using it such that any person skilled in this art is enabled to make and use the same, this enablement being provided in particular for the subject matterof the appended claims, which make up a part of the original description. Preferred embodiments of the invention are similarly fully described and enabled.

As used above, the phrases "selected from the group consisting of," "chosen from," and the like include mixtures of the specified materials.

Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and subranges within a numerical limit or range are specifically included as if explicitly written out.

The above description is presented to enable a person skilled in the art to make and use the invention, and is provided in the context of a particular application and its requirements. Various modifications to the preferred embodiments will bereadily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention. Thus, this invention is not intended to be limitedto the embodiments shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.

Having generally described this invention, a further understanding can be obtained by reference to certain specific examples, which are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwisespecified.

EXAMPLES

56

Example 1

A protein glutaminase derived from Chryseobacterium was used as the protein deamidating enzyme. The gene sequence of the protein glutaminase (EC.3.5.1) derived from Chryseobacterium proteolyticum strain has already been determined [Eur. J,Biochem. 268, 1410-1421 (2001)]. In view of the sequence, a gene sequence represented by SEQ ID NO: 1 was constructed following codon optimization, wherein the native codons were converted to the corresponding frequently used codon in Corynebacteriumglutamicum. This sequence includes a signal sequence (pre-portion) and a pro-portion of the protein glutaminase, and a region for coding the mature protein glutaminase. The whole gene sequence was produced by synthesis.

Based on the gene sequence represented of SEQ ID NO: 1, primers having sequences represented by SEQ ID NO: 5 (5'-CATGAAGAACCTTTTCCTGTC-3') and SEQ ID NO: 6 (5'-GTAAAAGGATCCATTAATTAAAATCC-3') were synthesized. The primer of SEQ ID NO: 5 includedthe N-terminal sequence of the signal sequence of the protein glutaminase, and the primer of SEQ ID NO: 6 included the C-terminal sequence of the mature protein glutaminase and the recognition sequence for BamHI. The DNA of SEQ ID NO: 1 was used as thePCR template, and the primers having the sequences of SEQ ID NO: 5 and SEQ ID NO: 6 were used to perform PCR, thereby to amplify the regions coding for the pro-portion of the protein glutaminase and the mature protein glutaminase.

The resulting PCR fragment was inserted into SmaI site of pVC7 described in Japanese Patent Application Laid-Open (Kokai) No. Hei 9-070291 to produce a plasmid. Competent E. coli JM109 cells (manufactured by Takara Shuzo) were then transducedwith the plasmid to produce a strain carrying the plasmid with the cloned protein glutaminase gene therein. The plasmid was then collected from E. Coli JM109. The nucleic acid sequence of the fragment cloned in this plasmid was determined to confirmthat it coincided with the sequence of SEQ ID NO: 1.

The sequence of TorA gene including TorA signal peptide derived from E. coli has been previously described (Mol. Microbiol. 11:1169-1179 (1994)). Primers shown in SEQ ID NO: 7 (5'-ATGAACAATAACGATCTCTTTCAGG-3') and in SEQ ID NO: 8(5'-CCGGATCCTGGTCATGATTTCACCTG-3') were synthesized based on the known sequence of the TorA gene. Chromosomal DNA of E. coli W3110 strain prepared according to standard protocols (Method by Saitoh and Miura [Biochim. Biophys. Acta, 72, 619 (1963]) wasused as the PCR template, thus amplifying the region for coding TorA and the region including the signal sequence located upstream. The PCR reaction was performed using Pyrobest DNA polymerase (manufactured by Takara Shuzo) under reaction conditionsestablished according to the protocol recommended by the vendor. Notably, the sequence shown in SEQ ID NO: 8 included a recognition sequence for restriction enzyme BamHI.

The DNA sequence coding the signal sequence of TorA is shown in SEQ ID NO: 3. Plasmid pPKSPTG1 described in International Patent Publication WO 01/23591 was used as the template, and the primer having sequences shown in SEQ ID NO: 9(5'-AAATTCCTGTGAATTAGCTGATTTAG-3') and SEQ ID NO: 10 (5'-AAGAGATCGTTATTGTTCATAGAGGCGAAGGCTCCTTGAATAG-3') were used for PCR amplification of the regions for coding the promoter and the signal peptide. The sequence shown in SEQ ID NO: 10 includes the5'-terminal sequence of the gene for coding the TorA signal peptide.

The PCR product was then mixed with the PCR product comprising a region containing a gene sequence for coding the TorA amplified by the primers having the sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8 and a signal sequence located upstreamthereof, at a ratio of 1:1 to give a mixture. This mixture was used as a template to perform cross-over PCR using the primers having the sequences of SEQ ID NO: 8 and SEQ ID NO: 9. Through these manipulations, a fusion gene comprising a sequenceincluding a PS2 promoter region, a TorA signal sequence and a sequence coding for the TorA was amplified. This cross-over PCR product was digested by restriction enzymes ScaI and BamHI, and subjected to agarose gel electrophoresis to detect anapproximately 3.1 kbp DNA fragment. The 3.1 kbp DNA fragment was separated from the agarose gel, collected by EasyTrapVer.2 (manufactured by Takara Shuzo), and inserted into the ScaI-BamHI site of the plasmid pPK4 described in Japanese PatentApplication Laid-Open (Kokai) No. Hei 9-322774 resulting in a pPKT-TorA plasmid. Determination of the nucleic acid sequence of the gene sequence inserted into this plasmid confirmed that the expected fusion gene had been constructed.

57

This plasmid was used as the template, and primers having their respective sequences shown in SEQ ID NO: 9 and SEQ ID NO: 11 (5'-GATTTCCTGGTTGCCGTTGGAATCCGCAGTCGCACGTCGCGGCG-3') were used to perform a PCR, thereby to amplify a portion includingthe promoter region of PS2 and the region for coding the TorA signal peptide. The sequence shown in SEQ ID NO: 11 has the 5'-terminal sequence of the region for coding a protein deamidating enzyme with a pro-sequence.

Next, a plasmid wherein a protein deamidating enzyme was cloned was used as the template, and primers having their respective sequences shown in SEQ ID NO: 6 and SEQ ID NO: 12 (5'-GATTCCAACGGCAACCAGGA-3') were used to PCR amplify the regioncoding for the protein glutaminase with a pro-sequence. Further, these PCR products were mixed at a ratio of 1:1 to give a mixture, which was used as the template, and primers having their respective sequences shown in SEQ ID NO: 6 and SEQ ID NO: 9 wereused to perform a cross-over PCR to amplify a fusion gene of the gene for coding the PS2 promoter region and the gene for coding the TorA signal sequence and the protein glutaminase with a pro-sequence.

This PCR product was digested by restriction enzymes ScaI and BamHI, and subjected to agarose gel electrophoresis to detect an approximately 3.1 kbp DNA fragment. This DNA fragment was separated from the agarose gel, collected usingEasyTrapVer.2 (manufactured by Takara Shuzo), and inserted into ScaI-BamHI site of the plasmid pPK4 described in the said Japanese Patent Application Laid-Open (Kokai) No. Hei 9-322774 to obtain a plasmid pPKT-PPG. Determination of the nucleic acidsequence of the inserted sequence in the plasmid confirmed that it was the expected fusion gene. The amino acid sequence of a protein glutaminase with a pro-sequence is shown in SEQ ID NO: 2 and the amino acid sequence of the TorA signal peptide isshown in SEQ ID NO: 4.

However, it was anticipated that the amino acid sequence of a natural type protein glutaminase would be maturated by a commercially available protease to give no correctly cleaved pro-sequence. Accordingly, "QTNK" in the C-terminal sequence ofthe pro-sequence was changed to "FGPK" so that the pro-sequence might be cleaved to get the same sequence as the N-terminal sequence of the natural type protein glutaminase. Primers having their respective sequences shown in SEQ ID NO: 13 (5'-CTT GGGGCC GAA GCC CTT GAC TTC TTT GGT CAG-3') and SEQ ID NO: 14 (5'-TTC GGC CCC AAG TTG GCG TCC GTC ATT CCA GAT-3') were used in order to change to "FGPK". The sequence shown in SEQ ID NO: 13 is a primer for amplifying the pro-sequence portion, and thesequence shown in SEQ ID NO: 14 is a primer for amplifying the matured form portion.

Using pPKT-PPG as the template, the primers having their respective sequences shown in SEQ ID NO: 12 and SEQ ID NO: 13 were used to amplify the pro-sequence portion of the protein glutaminase, and the primers having their respective sequencesshown in SEQ ID NO: 14 and SEQ ID NO: 6 were used to amplify the matured form portion of the protein glutaminase. These PCR products were mixed at a ratio of 1:1 to give a mixture, which was used as the template, and the primer having their respectivesequences shown in SEQ ID NO: 6 and SEQ ID NO: 12 were used to perform a cross-over PCR to amplify the protein glutaminase gene with a pro-sequence wherein the C-terminal of the pro-sequence was changed to FGPK. This cross-over PCR product was clonedinto the SmaI site of pUC18 (pUCPPG (FGPK)) to confirm the nucleic acid sequence, indicating that the pro sequence had been changed. Next, an AatII-BstPI fragment (large) of pPKT-PPG and an AatII-BstPI fragment (small) of pUCPPG (FGPK) were ligated toconstruct pPKT-PPG (FGPK).

C. glutamicum ATCC13869 was transformed with the plasmid pPKT-PPG (FGPK), and incubated in CM2G agar culture medium containing 25 mg/l of kanamycin to select a transformant. The selected strain was incubated in the MM liquid culture containing25 mg/l of kanamycin at 30° C. for 48 hours. The C. glutamicum culture broth was centrifuged to obtain a supernatant, which was then filtered off (0.45 μm). The filtered solution was condensed using an ultrafiltration membrane (to excludethose having a molecular weight of 10,000 Da or less). The buffer was exchanged with 50 mM phosphate buffer (pH 7.5), and the pro-sequence portion of the protein deamidating enzyme was cleaved by trypsin to allow maturation. Then, the resultantsolution was concentrated again, and the buffer was exchanged (20 mM acetate buffer, pH 5.0). The concentrated sample obtained was subjected to cation exchange chromatography to purify the active fraction of the protein deamidating enzyme. The activityper protein of the purified enzyme was analyzed according to the

58

previously described method, and it was around 100-140 U/mg.

Full-fat milk was homogenized (pre-heated at 60° C., 30 kgf/cm2), pasteurized (72° C., 15 sec), and cooled to 31° C. to give a raw milk. 25 L of the raw milk was divided into caldrons to which a lactic acidbacterium starter (CHN-01: four-in-one mixture) (1% of the milk) was added along with 2, 10, and 50 units of the above-mentioned purified protein deamidating enzyme product (100 units/mg) per 1 L of the raw milk. Further, 0.01% CaCl2, and 0.003%rennet were added to perform cutting (pH 6.2 on cutting). The resultant mass was added with hot water with light stirring, warmed (32° C.), left to stand, and the whey was removed when the pH lowered down to 5.8. Further, the resultant curd wassubjected to matting (set temperature 34° C., up to pH 5.2) and molding (reversed twice or three times every 30 min), left to stand overnight at 20° C. (pH 5.2), and then cut into 125 g/piece. The pieces were salted (immersed insaturated NaCl solution for 3 min), dried (3 days at 5° C.), vacuum-packed, and matured at 13° C. The product was molded, left to stand overnight to give a curd, the weight of which was measured to calculate a curd yield. The freshcheese left for one week was subjected to sensory test. Results obtained are shown in Table 1.

As shown in Table 1, treatment of raw milk with the protein deamidating enzyme improves a curd yield and allows production of cheese with smooth oral sensation and suppressed acidic taste.

TABLE-US-00001 TABLE 1 Curd Yield and Results of Sensory Test on Fresh Cheese Amount of enzyme added Curd yield Smoothness of (Unit/milk 1 L) (%) oral sensation Acidic taste 0 13.7 ± ± 2 14.4 ++ -- 10 14.8 +++ -- 50 15.6 +++ -- ±:Control, +: Increase, -: Decrease

Example 2

800 mL of commercially available low-temperature pasteurized milk was added to a jug, heated to 90° C. with stirring on a hot-water bath, and cooled down to 48° C. 80 ml of a started ("Danone" yogurt) was added to the jug anddivided into every 100 ml, which was then added with the purified protein deamidating enzyme product (100 units/mg) prepared according to the method described in Example 1 by 1, 5, 10, 50, or 100 units per 1 L of the milk, stirred thoroughly, and dividedinto every approximately 20 mL in a container before it got cold. It was incubated in an incubator set to 48° C. for 3-4 hours, and found to have a yogurt pH of 4.4 to 4.5, upon which it was stored in a refrigerator to terminate fermentation. It was stored overnight at 4° C., and, on the following day, analyzed using a texture analyzer to perform property determination and sensory test. Results are shown in Table 2.

As shown in Table 2, the addition of protein deamidating enzyme to the raw milk allowed production of a yogurt with smooth oral sensation and suppressed acidic taste. Similarly, a method, wherein the protein deamidating enzyme acted on the rawmilk at 50° C. for 90 min, and then heated at 90° C. for 5 min to be deactivated, followed by adding a starter and fermenting at 38° C. to have a pH of 4.5, provided a yogurt with smooth oral sensation, especially very smooth oralsensation felt at the end of its eating.

TABLE-US-00002 TABLE 2 pH and Results of Sensory Test of Yogurt Amount of enzyme Smoothness added Rupture stress of oral Acidic (Unit/milk 1 L) pH (g) sensation Taste 0 4.52 24.2 ± ± 1 4.59 23.5 + - 5 4.47 19.8 ++ -- 10 4.45 16.8 +++ --50 4.47 12.7 ++++ -- 100 4.51 Measurement +++++ --- impossible 500 4.60 Measurement +++++ --- impossible ±: Control, +: Increase, -: Decrease

Example 3

40 g of defatted dry milk (low heat; manufactured by National Federation of Dairy Cooperative Associations) was suspended in 800 ml of distilled water. To the resultant suspension 0.2 or 1 unit of the purified protein deamidating enzyme product(100 units/mg) prepared according to the method described in Example 1 was added, per 1 g of the defatted dry milk (20 units or 100 units in terms of per 1 L of the raw milk), and subjected to reaction at 40° C. for 2.5 hours, followed by heatingto deactivate (at 65° C. for 30 min; 1 hour for rising temperature). The deactivated mass was freeze-dried to prepare a modified defatted dry milk. Raw milk was added to the modified defatted dry milk at a rate of 1 to 5% of the raw milk, toprepare a yogurt according to the same method as in Example 2. The amount of 0.2 U/g was a condition for slightly deamidating the Gin in the defatted dry milk, and the amount of 1 U/g was a condition for deamidating approximately 50%

59

of the Gln whichwas able to be deamidated. As a control, an unmodified defatted dry milk was used.

A sensory test was carried out for each of the samples and it was found that the enzyme-untreated defatted dry milk could be added to provide a yogurt with increased solid content, thereby to furnish it with improved oral sensation andhigh-quality sense, compared with a yogurt with no defatted dry milk added. Meanwhile, the defatted dry milk, which was treated with 0.2 U/g of the protein deamidating enzyme, could be added to produce a yogurt with smooth oral sensation that began at arate of 1% of the raw milk and got remarkably effective at that of 3% or more. The defatted dry milk, which was treated with 1 U/g of the enzyme, could be added at a rate of 1% of the raw milk to produce a yogurt with remarkable smooth oral sensation,retained hardness, and remarkably increased favorability.

Example 4

Full-fat milk was homogenized (pre-heated to 60° C., 30 kgf/cm2), pasteurized (75° C., 15 sec), and cooled to 31° C. to give a raw milk. 25 L of the raw milk was divided into caldrons to which a lactic acidbacterium starter (CHN-01: four-in-one mixture) (1.4% relative to the milk) was added along with 2 or 10 units of the above-mentioned purified protein deamidating enzyme product (100 units/mg) per 1 L of the raw milk, and left to stand for 1 hour. Further, to the resultant mass 0.01% CaCl2 and 0.009% rennet was added, and confirmed 1 hour later to be coagulated to perform cutting (acidity 0.130, temperature 31° C. on cutting). After cutting, the resultant mass was removed of 1/3volume whey, added with hot water with light stirring, warmed (35° C.), left to stand (approximately 20 min), and removed of another 1/3 volume whey. The resultant mass was gradually added with hot water to reach 38° C., and stirredgently at the same temperature for 1 hour.

Then, the resultant mass was squeezed in a vat at 38° C. for about 30 min, and subjected to molding and cheese curd reverse. After 30 min of preliminary squeezing (3 kg/cm2), the resultant mass was reversed and substantiallysqueezed (5 kg/cm2), then immersed into water together with the mold to cool (10° C., overnight), salted (immersed into saturated saline solution for 4 hours), dried (at 12° C. for 10 days), vacuum-packed, and matured at 12° C. to produce a hard cheese. Evaluation of the cheese was performed upon curd production and after maturation. Results of evaluation upon cheese curd production are 20 shown in Table 3, and the results of sensory test after 6 months of maturation areshown in Table 4.

As shown in Table 4, addition of protein deamidating enzyme to raw milk can provide a matured cheese with smooth oral sensation and suppressed acidic taste and bitter taste.

TABLE-US-00003 TABLE 3 Results of Assessment upon cheese curd production Amount of enzyme added Observation of Curd texture (Unit/milk 1 L) (Cut section) Acidic taste 0 Good ± 2 Good -- 10 Good -- ±: Control, +: Increase, -: Decrease

TABLE-US-00004 TABLE 4 Sensory Test of Cheese Curd after 6 Months of Maturation Amount of enzyme added (Unit/milk 1 L) Smoothness Hardness Bitter taste 0 ± ± ± 2 +++ - -- 10 ++++ -- -- ±: Control, +: Increase, -: Decrease

Numerous modifications and variations and variations on the present invention are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the accompanying claims, the invention may be practicedotherwise than as specifically described herein. 

>

NAChyrseobacterium proteolyticummisc_featureprotein glutaminase; nucleotide sequence aacc ttttcctgtc catgatggcc ttcgtgaccg tcctcacctt caactcctgc 6tccaacggcaacca ggaaatcaac ggcaaggaga agctttccgt taacgattct tgaagg atttcggcaa gaccgttccg gttggcatcg acgaagagaa cggcatgatc tgtcct tcatgttgac tgcgcagttc tacgagatca agccaaccaa ggaaaacgag 24atcg gtatgcttcg ccaggctgtt aagaacgaat ctccagtccacattttcctc 3aaaca gcaatgaaat cggcaaggtg gagtctgcat ccccagagga cgtccgctac 36acga tcctgaccaa agaagtcaag ggccagacca acaaattggc gtccgtcatt 42gtgg ctaccctcaa ctctctcttc aaccaaatca agaaccagtc ttgcggtacc 48gcgt cctccccatg catcaccttccgctacccag tcgacggctg ctacgcacgc 54aaga tgcgccagat cttgatgaac aacggctatg actgtgagaa gcaattcgtg 6taacc tcaaggcatc caccggcacc tgctgcgtgg cgtggagcta ccacgttgca 66gtga gctacaaaaa cgcttccggc gtgacggaaa aacgcattat tgatccatcc

60

72tccagcggtcctgt gaccgatacc gcatggcgca acgcttgcgt taacacctct 78tctg catccgtttc ctcttacgct aacaccgcag gaaatgttta ttaccgctcc 84aatt cttacctgta tgacaacaat ctgatcaata ccaactgtgt cctgactaaa 9cctgc tttccggctg ttctccttca cctgcaccgg atgtctccagctgtggattt 963232rseobacterium roteollyticumMISC_FEATUREprotein glutaminase; amino acid sequence 2Met Lys Asn Leu Phe Leu Ser Met Met Ala Phe Val Thr Val Leu Thrsn Ser Cys Ala Asp Ser Asn Gly Asn Gln Glu Ile Asn Gly Lys 2Glu Lys Leu Ser Val Asn Asp Ser Lys Leu Lys Asp Phe Gly Lys Thr 35 4 Pro Val Gly Ile Asp Glu Glu Asn Gly Met Ile Lys Val Ser Phe 5Met Leu Thr Ala Gln Phe Tyr Glu Ile Lys Pro Thr Lys Glu Asn Glu65 7Gln Tyr Ile Gly Met Leu Arg GlnAla Val Lys Asn Glu Ser Pro Val 85 9 Ile Phe Leu Lys Pro Asn Ser Asn Glu Ile Gly Lys Val Glu Ser Ser Pro Glu Asp Val Arg Tyr Phe Lys Thr Ile Leu Thr Lys Glu Lys Gly Gln Thr Asn Lys Leu Ala Ser Val Ile Pro Asp Val Ala Leu Asn Ser Leu Phe Asn Gln Ile Lys Asn Gln Ser Cys Gly Thr Ser Thr Ala Ser Ser Pro Cys Ile Thr Phe Arg Tyr Pro Val Asp Gly Tyr Ala Arg Ala His Lys Met Arg Gln Ile Leu Met Asn Asn Gly Asp Cys GluLys Gln Phe Val Tyr Gly Asn Leu Lys Ala Ser Thr 2hr Cys Cys Val Ala Trp Ser Tyr His Val Ala Ile Leu Val Ser 222s Asn Ala Ser Gly Val Thr Glu Lys Arg Ile Ile Asp Pro Ser225 234e Ser Ser Gly Pro Val Thr Asp ThrAla Trp Arg Asn Ala Cys 245 25l Asn Thr Ser Cys Gly Ser Ala Ser Val Ser Ser Tyr Ala Asn Thr 267y Asn Val Tyr Tyr Arg Ser Pro Ser Asn Ser Tyr Leu Tyr Asp 275 28n Asn Leu Ile Asn Thr Asn Cys Val Leu Thr Lys Phe Ser Leu Leu 29ly Cys Ser Pro Ser Pro Ala Pro Asp Val Ser Ser Cys Gly Phe33scherichia colimisc_featureTorA signal sequence; nucleotide sequence 3atgaacaata acgatctctt tcaggcatca cgtcggcgtt ttctggcaca actcggcggc 6gtcg ccgggatgctggggccgtca ttgttaacgc cgcgacgtgc gactgcg RTEscherichia coliMISC_FEATURETorA signal peptide 4Met Asn Asn Asn Asp Leu Phe Gln Ala Ser Arg Arg Arg Phe Leu Alaeu Gly Gly Leu Thr Val Ala Gly Met Leu Gly Pro Ser Leu Leu 2Thr Pro ArgArg Ala Thr Ala 3552ificial Sequencesynthetic olygonucleotide 5catgaagaac cttttcctgt c 2Artificial Sequencesynthetic olygonucleotide 6gtaaaaggat ccattaatta aaatcc 26725DNAArtificial Sequencesynthetic olygonucleotide 7atgaacaata acgatctctttcagg 25826DNAArtificial Sequencesynthetic olygonucleotide 8ccggatcctg gtcatgattt cacctg 26926DNAArtificial Sequencesynthetic olygonucleotide 9aaattcctgt gaattagctg atttag 26Artificial Sequencesynthetic olygonucleotide atcgt tattgttcatagaggcgaag gctccttgaa tag 43Artificial Sequencesynthetic olygonucleotide cctgg ttgccgttgg aatccgcagt cgcacgtcgc ggcg 44Artificial Sequencesynthetic olygonucleotide caacg gcaaccagga 2AArtificial Sequencesyntheticolygonucleotide ggccg aagcccttga cttctttggt cag 33Artificial Sequencesynthetic olygonucleotide cccca agttggcgtc cgtcattcca gat 33The present invention relates to a process for producing cheese from enzyme-treated cheese milk, and the use of the resulting produced cheese as ingredient in food products. The present invention also relates to a process for stabilizing thefat in a milk composition.

BACKGROUND OF THE INVENTION

In cheese products, the state of the fat phase is important to the properties of the cheese. The fat phase is particularly important for the stabilisation of the cheese during production and ripening, but also for the final cheese to be used,eaten as such, or used in prepared ready-to-eat dishes e.g. pizza, toast or burgers.

Also, the oiling-off properties of cheese products is an important quality parameter. Oiling-off is the tendency to form free oil upon storage and melting. Excessive oiling-off is a defect most often related to heated products wherein cheeseis used, e.g. pizza and related foods (cf. e.g. Kindstedt J. S; Rippe J. K. 1990, J Dairy Sci. 73: 867-873. It becomes more and more important to control/eliminate this defect, as the consumer concern about dietary fat levels increases. Free oil/fatin a product is perceived as a high fat content, and is generally undesirable.

In other food products the fat phase is often stabilised by mechanic emulsification, e.g. homogenisation. This technology is generally not applicable in cheese production as homogenisation of the cheese milk has a negative influence on thecoagulation properties of the cheese milk and on the yield as well as the taste of the cheese produced therefrom.

In GB 1,525,929 it is disclosed as known to prepare stabilized oil-in-water emulsions using monoacyl glycero-phosphatide obtained by subjecting diacyl glycerophosphatide to the action of phospholipase A. GB 1,525,929 further describes use ofphospholipase A treated phospholipoprotein-containing material for preparing oil-in-water emulsions, i.e. use of phospholipase treated material as an emulsion stabiliser for oil-in-water emulsions of which sauces, dressings and mayonnaise is mentioned. Cheese is not disclosed in GB 1,525,929.

So-called lecithinase activity, disclosed as phospholipase activity, has been reported for bacterial

61

contaminants in milk, as well as the use of such milk for cheese production: "J. J Owens, Observations on lecithinases from milk contaminants,Process Biochemistry, vol. 13 no. 1, 1978, page 10-18" and "J. J Owens, Lecithinase Positive Bacteria in Milk, Process Biochemistry, vol. 13, page 13-15, 1978".

U.S. Pat. No. 4,861,610 discloses a process for preparing a cheese composition, i.e. processed cheese, for incorporation into food material where monoacyl glycero-phospholipid, fat, water and molten salt is added to cheese. The processcomprises a heating treatment to dissolve the cheese (the cheese being mixed with among others mono acyl glycero phospholipid) before the addition of fat. Subsequently the cheese-composition is emulsified by a mixer. U.S. Pat. No. 4,861,610 does notdisclose treatment of milk with phospholipase and manufacturing of cheese from the enzyme treated milk.

There is a need for an improved process for the manufacturing of cheese, in particular a process for improving the stability of the fat in cheese.

SUMMARY OF THE INVENTION

The invention provides a process for producing cheese, which comprises the steps of: a) treating cheese milk or a fraction of cheese milk with a phospholipase; and b) producing cheese from the cheese milk.

wherein step a) is conducted before and/or simultaneously with step b).

There is provided a process for improving the properties of cheeses; in particular the fat stability of cheese and cheese milk is improved by the present invention. The inventor has found that enzyme treatment of cheese milk significantlyenhances the stability during a heat treatment of cheese produced from said phospholipase-treated cheese milk. By the process of the invention is also provided a method for increasing the yield in cheese production.

The invention further relates to the use of phospholipase in the manufacturing of cheese products, wherein the phospholipase treatment is conducted on the cheese milk or a fraction thereof before and/or during the production of the cheese. Theinvention also relates to cheeses obtainable, in particular obtained, by any of the processes described herein. 

DETAILED DISCLOSURE OF THE INVENTION

The present invention relates to a process for producing cheese, which comprises the steps of: a) treating cheese milk or a fraction of cheese milk with a phospholipase; and b) producing cheese from the enzyme-treated cheese milk of step a),wherein step a) is conducted before step b) and/or simultaneously with step b).

Thus, step a) and b) of the process of the invention may be conducted simultaneously, i.e. the phospholipase reacts in the cheese milk at more or less the same time as the milk coagulant forms the coagulum.

Cheese Milk and the Production of Cheese:

In the present context, the term "cheese" may be any kind of cheese and includes, e.g., natural cheese, cheese analogues and processed cheese. The cheese may be obtained by any suitable process known in the art, such as, e.g., by enzymaticcoagulation of the cheese milk with rennet, or by acidic coagulation of the cheese milk with food grade acid or acid produced by lactic acid bacteria growth. In one embodiment, the cheese manufactured by the process of the invention is rennet-curdcheese. Thus, in one embodiment, the cheese is manufactured with rennet. In step b) of the process of the invention the cheese milk may be subjected to a conventional cheese-making process. Rennet is commercially available, e.g. as Naturen.RTM. (animal rennet), Chy-max.RTM. (fermentation produced chymosin), Microlant.RTM. (Microbial coagulant produced by fermentation), all from Chr-Hansen A/S, Denmark).

Processed cheese may be manufactured from natural cheese or cheese analogues by cooking and emulsifying the cheese including emulsifying salts (e.g. phosphates and citrate), and may also include spices/condiments. In one embodiment, the cheeseproduct of the process of the invention

62

is not processed cheese.

By cheese analogues is understood cheese-like products, in which part of the composition is non-milk constituents, such as e.g. vegetable oil. Another example for cheese analogue is cheese base. The process of the present invention isapplicable in producing cheese analogues as long as the product contains fat (e.g. milk fat, such as, e.g., cream) as a part of the composition.

The cheeses produced by the process of the present invention comprise all varieties of cheese, such as, e.g. Campesino, Chester, Danbo, Drabant, Herregȧrd, Manchego, Provolone, Saint Paulin, Soft cheese, Svecia, Taleggio, Whitecheese, including rennet-curd cheese produced by rennet-coagulation of the cheese curd; ripened cheeses such as Cheddar, Colby, Edam, Muenster, Gryere, Emmenthal, Camembert, Parmesan and Romano; fresh cheeses such as Mozzarella and Feta; acid coagulatedcheeses such as cream cheese, Neufchatel, Quarg, Cottage Cheese and Queso Blanco; and pasta filata cheese. One embodiment relates to the production of pizza cheese by the process of the invention.

In cheese manufacturing the coagulation of the casein in milk may be performed in two ways: the so-called rennet-curd and acid-curd cheese. In cheese production these two types of curds makes up two major groups of cheese types. Freshacid-curd cheeses refer to those varieties of cheese produced by the coagulation of milk, cream or whey via acidification or a combination of acid and heat, and which are ready for consumption once the manufacturing without ripening are completed. Freshacid-curd cheeses generally differ from rennet-curd cheese varieties (e.g. Camberbert, Cheddar, Emmantal) where coagulation normally is induced by the action of rennet at pH values 6.4-6.6, in that coagulation normally occurs close to the isoelectricpoint of casein, i.e. e.g. at pH 4.6 or at higher values when elevated temperatures are used, e.g. in Ricottta pH 6.0 and 80° C. In a preferred embodiment of the invention, the cheese belongs to the class of rennet curd cheeses. In furtherembodiments the term cheese also includes acid curd cheese, including fresh acid-curd cheeses.

Mozzarella is a member of the so-called pasta filata, or stretched curd, cheeses which are normally distinguished by a unique plasticizing and kneading treatment of the fresh curd in hot water, which imparts the finished cheese itscharacteristic fibrious structure and melting and stretching properties, cf. e.g. "Mozzarella and Pizza cheese" by Paul S. Kindstedt, Cheese: Chemistry, physics and microbiology, Volume 2: Major Cheese groups, second edition, page 337-341, Chapman &Hall. Pizza cheese as used herein includes cheeses suitable for pizzas and they are usually pasta filata/stretched curd cheeses. In one embodiment, the process of the invention further comprises a heat/stretching treatment as for pasta filata cheeses,such as for the manufacturing of Mozzarella.

The cheese milk to be treated by the process of the present invention may comprise one or more of the following milk fractions: skim milk, cream, whole milk, buttermilk from production of sweet or acidified butter, whey protein concentrate, andbutter or butter oil. The cheese milk to be phospholipase treated by the process of the invention may also comprise raw milk.

In further embodiments of the invention, the cheese milk to be phospholipase-treated is prepared totally or in part from dried milk fractions, such as, e.g., whole milk powder, skim milk powder, casein, caseinate, total milk protein orbuttermilk powder, or any combination thereof.

The term "cheese milk", in particular in step b) of the process of the invention, is the milk-based composition from which the cheese is prepared. Thus, in the process of the invention the cheese may be produced from a milk-based composition("the cheese milk") of which all or only a portion has been subjected to a phospholipase treatment.

The term "cheese milk" as used herein may encompass the term "fraction of the cheese milk" unless it is clear from the context that the two terms refer to different meanings. The term "fraction of the cheese milk" in the context of theinvention, in particular in step a) of the process of the invention, means the fraction of the cheese milk which is subjected to the enzymatic treatment of the invention. "The fraction of the cheese milk" may comprise one or more of the milk fractionsas defined herein, i.e., e.g., skim milk, cream, whole milk, buttermilk from production of sweet or acidified butter, whey protein concentrate, butter and butter oil. The butter may, e.g., be in a melted form. The fraction of the cheese milk to betreated may also comprise raw milk and it may also be prepared from dried milk fractions as already described herein. The term "fraction of the cheese

63

milk" in the context of the present invention means one or more of the components of the cheese milkto be treated. When a fraction of the cheese milk is phospholipase treated in step a) then step a) is performed before and not during step b). After the enzymatic treatment of the fraction of the cheese milk, the fraction is combined with one or moremilk fractions to make of the cheese milk from which the cheese is prepared in step b).

The enzyme treatment in step a) may be conducted on a fraction of the cheese milk or it may be conducted on the cheese milk as such. Thus, within the scope of the invention is a process for producing cheese, which comprises the steps of: stepi) treating a fraction of cheese milk with a phospholipase; step ii) preparing cheese milk from the treated fraction of step i); and step iii) producing cheese from the cheese milk of step ii). It is also contemplated that in step ii) the enzyme treatedcheese milk fraction of step i) may be combined with (a) non-phospholipase and/or (a) phospholipase treated cheese milk fraction(s) to provide the cheese milk from which the cheese is produced in step iii). Step i) corresponds to step a); and step iii)corresponds to step b) as used herein.

In preferred embodiments, the cheese milk or the cheese milk fraction, which is to be enzyme-treated, comprises or consists of cream. In further embodiments, the cheese milk or the fraction of the cheese milk, which is to be enzyme-treated,comprises or consists of butter. In still further embodiments, the cheese milk or the fraction of the cheese milk, which is to be enzyme-treated, comprises or consists of buttermilk. In one embodiment, the enzyme treated milk of step a) is not driedbefore step b). In further embodiments, the process of the invention does not include a particular step for lowering the total fat content of the cheese, such as, e.g., the process disclosed in EP 531 104 A2 which relates to a process for reducing thelipid content in food.

Milk from different species of animals may be used in the production of cheese. Thus, "milk" may be the lacteal secretion obtained by milking, e.g., cows, sheep, goats, buffaloes or camels.

The milk for production of cheese may be standardised to the desired composition by removal of a portion or of all of any of the raw milk components and/or by adding thereto additional amounts of such components. This may be done by separationof the raw milk into cream and skim milk at arrival to the dairy. Thus, the cheese milk may be prepared as done conventionally by fractioning the raw milk and recombining the fractions so as to obtain the desired final composition of the cheese milk. The separation may be made in continuous centrifuges leading to a skim milk fraction with very low fat content (i.e. e.g. 35% fat. The "cheese milk" may be composed by mixing cream and skim milk. In a preferredembodiment the cheese milk or the fraction of the cheese milk to be treated with phospholipase is not derived from cheese.

The cheese milk, including the cheese milk fraction, to be treated with phospholipase comprises phospholipids, such as e.g. lecithin. The cheese milk may have any total fat content which is found suitable for the cheese to be produced by theprocess of the invention, such as, e.g., about 25% fat (of dry matter), such as e.g. in the range 10-50% fat, of which, e.g., about 0.06% is phospholipids, such as e.g. 0.02-5% (w/w) of the total fat content is phospholipids.

Conventional steps may be taken to secure low bacterial counts in the cheese milk. It is generally preferred not to pasteurise the skim milk because heat denatured proteins in the cheese milk has a negative influence on the coagulation of themilk, and retards the ripening of the cheese. The bacterial count of the skim milk fraction may thus be lowered by other technologies, as for instance microfiltration or bactofugation. The cream may be pasteurised to get the low bacterial count in theproduct.

The process of the invention may further comprise the step of c) subjecting the treated cheese milk or the cheese milk fraction to a heating treatment after step a) and before step b). In one embodiment, the process of the invention comprisesthe steps of: step i) treating a fraction of cheese milk (such as, e.g., cream) with a phospholipase; step ii) subjecting the enzyme treated fraction of step i) to a heating treatment; step iii) combining the milk fraction of step ii) with (a) non-enzymeand/or (a) phospholipase treated milk fraction(s) to obtain the cheese milk from which the cheese is produced; and step iv) producing cheese from the cheese milk of step iii), wherein step i) corresponds to step a); and step iv) corresponds to step b) asused herein. Accordingly, in one embodiment the process of the invention, wherein the fraction of cheese milk is cream, may further comprise the step of subjecting the cream to pasteurization after step a) and before step b).

64

In the process of the invention the cheese milk or the fraction of the cheese milk may be subjected to a homogenization process before the production of cheese, such as e.g. in the production of Danish Blue Cheese. The homogenization may beapplied before and/or after the treatment with the phospholipase. In other embodiments, however, the cheese milk in step b) is not subjected to a homogenization process before the production of cheese.

The Enzymatic Treatment:

The enzymatic treatment in the process of the invention may be conducted by dispersing the phospholipase into cheese milk or a fraction of the cheese milk, and allowing the enzyme reaction to take place at an appropriate holding-time at anappropriate temperature. The treatment with phospholipase may be carried out at conditions chosen to suit the selected enzymes according to principles well known in the art. The enzymatic treatment is a treatment in which the milk fat fraction of thecheese milk is treated with phospholipase.

The enzymatic treatment may be conducted at any suitable pH, such as e.g. in the range 2-10, such as at a pH of 4-9 or 5-7. It may be preferred to use pH of 5.5-7.0.

The process of the invention may be conducted as a phospholipase treatment of cheese milk or a fraction of the cheese milk during cold storage at 3-7° C., e.g. for at least 2 hours, e.g. in the range of 2-48 hours, or at least 5 hours,e.g. 5-24 hours. The process may also be conducted so that the phospholipase is allowed to react at coagulation conditions 30-45° C. (e.g. for at least 5 minutes, such as, e.g., for at least 10 minutes or at least 30 minutes, e.g. for 5-60minutes) during, e.g., the cheese making process of step b). Further, the process may be conducted so that before coagulation of the cheese milk, the phospholipase is allowed to react on a milk fraction, e.g. cream, at the temperature optimum for thephospholipase, e.g. at 45-80° C., such as 47-80° C., or 50-80° C., e.g. for at least 10 minutes, such as at least 30 minutes, e.g. in the range of 10-180 minutes.

Optionally, after the enzymatic treatment the phospholipase enzyme protein is removed/reduced and/or the enzyme is inactivated.

A suitable enzyme dosage will usually be in the range of 0.01-1% (w/w) of the fat content, such as, e.g., 0.1-1.0%, particularly 0.2% (w/w) corresponding to 2000 IU per 100 g fat. One IU (International Unit) is defined as the amount of enzymeproducing 1 micro mole of free fatty acid per minute under standard conditions: Egg yolk substrate (approximately 0.4% phospholipids), pH 8, 40° C., 6 mM Ca++, Analytical method AF 280 available on request from Novo Nordisk A/S and isdescribed in the Examples. The enzyme dosage is based on w/w fat content of the treated cheese milk such as cream illustrated in the examples. Alternatively, the enzyme dosage may be determined by the other assays as described herein.

The enzymatic treatment may be conducted batchwise, e.g. in a tank with stirring, or it may be continuous, e.g. a series of stirred tank reactors.

In one embodiment, the phospholipase is added to the cream fraction to carry out a separate phospholipase treatment of this fraction at a temperature in the range 45-80° C. In further embodiments, the phospholipase is added immediatelybefore, or at the same time as the cheese rennet, e.g., at 32-36° C.

Enzymes to be Used in the Process of the Invention:

The enzyme used in the process of the present invention include a phospholipase, such as, phospholipase A1, phospholipase A2 and phospholipase B. In the process of the invention the phospholipase treatment may be provided by one ormore phospholipase, such as two or more phospholipases, e.g. two phospholipases, including, without limitation, treatment with both type A and B; both type A1 and A2; both type A1 and B; both type A2 and B; or treatment with twodifferent phospholipase of the same type. Included is also treatment with one type of phospholipase, such as A1, A2 or B.

Phospholipids, such as lecithin or phosphatidylcholine, consist of glycerol esterified with two fatty acids in an outer (sn-1) and the middle (sn-2) positions and esterified with phosphoric acid in the third position; the phosphoric acid, inturn, may be esterified to an amino-alcohol. Phospholipases are enzymes which participate in the hydrolysis of phospholipids. Several types of phospholipase

65

activity can be distinguished, including phospholipases A1 and A2 which hydrolyze onefatty acyl group (in the sn-1 and sn-2 position, respectively) to form lysophospholipid; and lysophospholipase (or phospholipase B) which can hydrolyze the remaining fatty acyl group in lysophospholipid. Thus, the invention relates to use of enzymesthat has the ability to hydrolyze one and/or both fatty acyl groups in a phospholipid.

Phospholipase A1 is Defined According to Standard Enzyme EC-classification as EC 3.1.1.32.

Official Name: Phospholipase A1. Reaction catalyzed. phosphatidylcholine+H(2)O <> 2-acylglycerophosphocholine+a fatty acid anion Comment(s) has a much broader specificity than ec 3.1.1.4. Phospholipase A2 is Defined Accordingto Standard Enzyme EC-classification as EC 3.1.1.4 Official Name: phospholipase A2. Alternative Name(s):phosphatidylcholine 2-acylhydrolase. lecithinase a; phosphatidase; or phosphatidolipase. Reaction catalysed: phosphatidylcholine+h(2)o<>1-acylglycerophosphocholine+a fatty acid anion comment(s): also acts on phosphatidylethanolamine, choline plasmalogen and phosphatides, removing the fatty acid attached to the 2-position.

The term "Phospholipase A" used herein in connection with an enzyme of the invention is intended to cover an enzyme with Phospholipase A1 and/or Phospholipase A2 activity.

"Phospholipase B": Phospholipase B is Defined According to Standard Enzyme EC-classification as EC 3.1.1.5.

Official Name: lysophospholipase Alternative Name(s):lecithinase b; lysolecithinase; phospholipase b; or plb. Reaction catalysed: 2-lysophosphatidylcholine+h(2)o<>glycerophosphocholine+a fatty acid anion

The term "phospholipase" used herein in connection with an enzyme of the invention is intended to cover enzymes which has enzyme activity towards phospholipids as defined herein. The term phospholipase as used herein, includes enzymes withphospholipase activity, i.e., e.g. phospholipase A (A1 or A2) or phospholipase B activity. The phospholipase activity may be provided by enzymes having other activities as well, such as e.g. a lipase with phospholipase activity. Thephospholipase activity may e.g. be from a lipase with phospholipase side activity. In other embodiments of the invention the phospholipase enzyme activity is provided by an enzyme having essentially only phospholipase activity and wherein thephospholipase enzyme activity is not a side activity. In one embodiment of the invention, the phospholipase is not lipases having phospholipase side activity as defined in WO 98/26057.

The phospholipase may be of any origin, e.g. of animal origin (such as, e.g. mammalian), e.g. from pancreas (e.g. bovine or porcine pancreas), or snake venom or bee venom. Alternatively, the phospholipase may be of microbial origin, e.g. fromfilamentous fungi, yeast or bacteria, such as the genus or species Aspergillus, e.g. A. niger, Dictyostelium, e.g. D. discoideum; Mucor, e.g. M. javanicus, M. mucedo, M. subtilissimus; Neurospora, e.g. N. crassa; Rhizomucor, e.g. R. pusillus; Rhizopus,e.g. R. arrhizus, R. japonicus, R. stolonifer, Sclerotinia, e.g. S. libertiana; Trichophyton, e.g. T. rubrum; Whetzelinia, e.g. W. sclerotiorum; Bacillus, e.g. B. megaterium, B. subtilis; Citrobacter, e.g. C. freundii; Enterobacter, e.g. E. aerogenes, E.cloacae Edwardsiella, E. tarda; Erwinia, e.g. E. herbicola; Escherichia, e.g. E. coli; Klebsiella, e.g. K. pneumoniae; Proteus, e.g. P. vulgaris; Providencia, e.g. P. stuartii; Salmonella, e.g. S. typhimurium; Serratia, e.g. S. liquefasciens, S.marcescens; Shigella, e.g. S. flexneri; Streptomyces, e.g. S. violeceoruber, Yersinia, e.g. Y. enterocolitica. Thus, the phospholipase may be fungal, e.g. from the class Pyrenomycetes, such as the genus Fusarium, such as a strain of F. culmorum, F.heterosporum, F. solani, or a strain of F. oxysporum. The phospholipase may also be from a filamentous fungus strain within the genus Aspergillus, such as a strain of Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus niger orAspergillus oryzae. A preferred phospholipase is derived from strain of Fusarium, particularly F. oxysporum, e.g. from strain DSM 2627 as described in WO 98/26057, especially described in claim 36 and SEQ ID NO. 2 of WO 98/26057. In furtherembodiments, the phospholipase is a phospholipase as disclosed in PCT/DK/00664 (Novo Nordisk A/S, Denmark).

The phospholipase used in the process of the invention may be derived or obtainable from any of the sources mentioned herein. The term "derived" means in this context that the enzyme may have been isolated from an organism where it is presentnatively, i.e. the identity of the amino acid

66

sequence of the enzyme are identical to a native enzyme.

The term "derived" also means that the enzymes may have been produced recombinantly in a host organism, the recombinant produced enzyme having either an identity identical to a native enzyme or having it a modified amino acid sequence, e.g.having one or more amino acids which are deleted, inserted and/or substituted, i.e. a recombinantly produced enzyme which is a mutant and/or a fragment of a native amino acid sequence. Within the meaning of a native enzyme are included natural variants. Furthermore, the term "derived" includes enzymes produced synthetically by e.g. peptide synthesis. The term "derived" also encompasses enzymes which have been modified e.g. by glycosylation, phosphorylation etc., whether in vivo or in vitro. The term"obtainable" in this context means that the enzyme has an amino acid sequence identical to a native enzyme. The term encompasses an enzyme that has been isolated from an organism where it is present natively, or one in which it has been expressedrecombinantly in the same type of organism or another, or enzymes produced synthetically by e.g. peptide synthesis. With respect to recombinantly produced enzyme the terms "obtainable" and "derived" refers to the identity of the enzyme and not theidentity of the host organism in which it is produced recombinantly.

Accordingly, the phospholipase may be obtained from a microorganism by use of any suitable technique. For instance, a phospholipase enzyme preparation may be obtained by fermentation of a suitable microorganism and subsequent isolation of aphospholipase preparation from the resulting fermented broth or microorganism by methods known in the art. The phospholipase may also be obtained by use of recombinant DNA techniques. Such method normally comprises cultivation of a host celltransformed with a recombinant DNA vector comprising a DNA sequence encoding the phospholipase in question and the DNA sequence being operationally linked with an appropriate expression signal such that it is capable of expressing the phospholipase in aculture medium under conditions permitting the expression of the enzyme and recovering the enzyme from the culture. The DNA sequence may also be incorporated into the genome of the host cell. The DNA sequence may be of genomic, cDNA or synthetic originor any combinations of these, and may be isolated or synthesized in accordance with methods known in the art.

Suitable phospholipases are available commercially. As typical examples of the enzymes for practical use, pancreas-derived phospholipase A2 such as Lecitase.RTM. (manufactured by Novo Nordisk A/S) is preferably used.

In further embodiments, the source of the phospholipase in the process of the invention, is from expressing the enzyme by the starter organism used in the production of the cheese, such as e.g. by over-expressing the phospholipase in a lacticacid bacterium, including e.g. lactobacillus. Alternatively, the treatment of the cheese milk or the fraction of cheese milk is conducted by the addition of the phospholipase, optionally in combination with the phospholipase provided from the starterculture as described herein.

In a preferred embodiment, the phospholipase is not obtained from microbial milk contaminants. Accordingly, in the process of the invention, the phospholipase enzyme treatment is not provided by the enzymatic action of phospholipase expressedby a microbial milk contaminant present in the milk or the milk fraction, at least not a major portion. The microbial milk contaminants may be one or more of the group consisting of Bacillus cereus, Bacillus cereus var. mycoides, Pseudomonas sp.,Enterobacter liquifacians (Klebsialla cloacae), Alcalignes viscolactis, corynefrom rod. In one embodiment, the phospholipase is not obtained from these contaminants. In further embodiments the phospholipase is not identical to the enzymes disclosed in"J. J Owens, Observations on lecithinases from milk contaminants, Process Biochemistry, vol. 13 no. 1, 1978, page 10-18" and "J. J Owens, Lecithinase Positive Bacteria in Milk, Process Biochemistry, vol. 13, page 13-15, 1978".

In the process of the invention, the phospholipase treatment may be performed by contacting the cheese milk and/or the cheese milk fraction with a purified phospholipase. The term "purified" as used herein covers phospholipase enzyme proteinfree from components from the organism from which it is derived. The term "purified" also covers phospholipase enzyme protein free from components from the native organism from which it is obtained, this is also termed "essentially pure" phospholipaseand may be particularly relevant for phospholipases which are naturally occurring phospholipases and which have not been modified genetically, such as by deletion, substitution or insertion of one or more amino acid residues.

67

Accordingly, the phospholipase may be purified, viz. only minor amounts of other proteins being present. The expression "other proteins" relate in particular to other enzymes. The term "purified" as used herein also refers to removal of othercomponents, particularly other proteins and most particularly other enzymes present in the cell of origin of the phospholipase. The phospholipase may be "substantially pure", i.e. free from other components from the organism in which it is produced,i.e., e.g., a host organism for recombinantly produced phospholipase. Preferably, the enzymes are at least 75% (w/w) pure, more preferably at least 80%, 85%, 90% or even at least 95% pure. In a still more preferred embodiment the phospholipase is an atleast 98% pure enzyme protein preparation. In other embodiments the phospholipase is a phospholipase not naturally present in milk.

The term phospholipase includes whatever auxiliary compounds that may be necessary for the enzyme's catalytic activity, such as, e.g. an appropriate acceptor or cofactor, which may or may not be naturally present in the reaction system.

The phospholipase may be in any form suited for the use in question, such as e.g. in the form of a dry powder or granulate, a non-dusting granulate, a liquid, a stabilized liquid, or a protected enzyme. Granulates may be produced, e.g. asdisclosed in U.S. Pat. Nos. 4,106,991 and 4,661,452, and may optionally be coated by methods known in the art. Liquid enzyme preparations may, for instance, be stabilized by adding stabilizers such as a sugar, a sugar alcohol or another polyol,lactic acid or another organic acid according to established methods. Protected enzymes may be prepared according to the method disclosed in EP 238,216.

By the process of the invention, the lecithin content of the cheese may be reduced by at least 5%, such as at least 10%, at least 20%, at least 30%, at least 50%, such as in the range of 5-95% compared to a similar cheese making process butwithout the enzymatic treatment in step a).

In cow milk the lecithin constitutes normally more than 95% of the phospholipids in milk whereas the lysolecithin is approximately 1% of the phospholipids. Although the phospholipids represent normally less than 1% of the total lipids in cowmilk, they play a particularly important role, being present mainly in the milk fat globule membrane. By the process of the present invention the lecithin content in the cheese of step b) may be less than 90%, such as e.g. less than 80%, e.g. less than60% or less than 50% of the total content of phospholipid in the cheese. In other embodiments of the invention the lysolecithin content in the cheese constitutes at least 5%, such as at least 10%, at least 20%, at least 30%, at least 50%, such as, e.g.in the range 5-99%, e.g. 5-90%, 10-90%, or 30-90% or 40-80% of the total content of phospholipids in the cheese. The lecithin or lysolecithin content may be measured by any method known by the skilled person, e.g. by HPLC.

In a preferred embodiment, it is to be understood that the relative amount of lecithin to lysolecithin in the cheese produced is provided by conversion of lecithin to lysolecithin by the treatment of the cheese milk or cheese milk fraction withphospholipase. In cheese the fat content is generally 65% (w/w), such as in the range of 10-60%.

The invention also relates to the use of phospholipase in the process of the invention. Accordingly, one embodiment relates to the use of a phospholipase in the manufacturing of a cheese product, comprising adding the phospholipase to cheesemilk or a fraction of the cheese milk, and processing the cheese milk to make the cheese. Thus, within the scope of the invention is the use of a phospholipase in the manufacturing of a cheese product, wherein the phospholipase treatment is conducted oncheese milk or a fraction thereof before and/or during the production of the cheese.

The present invention further relates to use of the cheese produced by the process of the invention in pizza, ready-to-eat dishes, processed cheese or as an ingredient in other food products. Accordingly, the cheese produced according to theprocess of the invention may be used in further processed food products like processed cheese, pizza, burgers, toast, sauces, dressings, cheese powder or cheese flavours.

In further embodiments, the process of the invention further comprises the step of subjecting the cheese of step b) to a heating treatment, such as, e.g. in the range 150-350° C.

The invention also relates to a cheese obtainable, in particular obtained, by the process of the invention.

68

In a preferred embodiment, the invention relates to a process for improving the stability of the fat in cheese, the process being as described herein. In one embodiment, the cheese manufactured by the process of the invention has a lowereddiffusion of fat/oil, such as, e.g., a decrease in the "oily" diameter of at least 5%, such as at least 10%, at least 20%, at least 40%, e.g. a decrease of the "oily" diameter in the range 20-800%, e.g. 20-600%; the "oily diameter" being measured asdefined herein in Example 1 or 2.

In one embodiment, the invention relates to a process of the invention for increasing the yield of cheese, such as an increase in cheese fat yield and/or cheese protein yield in cheese production. Accordingly, by the present invention isprovided a cheese manufacturing process leading to higher yield of the cheese and better stability of the fat phase of the cheese produced by the process of the invention. Thus, one embodiment relates to a process of the invention for improving the fatstability of cheese and/or increasing the yield in cheese production. The increase in fat-yield by the process of the invention may be at least 0.5%, such as e.g. in the range 0.5-10%, such as in the range of 0.5%-5%, measured e.g. as "fat bydifference" as described in Example 3.

Further Aspects of the Invention:

The invention also provides a process for stabilizing the fat of a milk composition, which comprises treating a milk or a fraction of the milk with an enzyme selected from the group of phospholipases. The inventor has found that the emulsionstability of a milk composition can be improved by treating it with phospholipase. Thus, the invention also relates to a process for stabilizing the fat emulsion of a milk composition, which comprises treating a milk or a fraction of the milk with aphospholipase. The process may be conducted as in step a) of the process described herein.

By the present invention is also provided a method for producing improved UHT cream, in particular having improved fat stability, which process for producing UHT-cream comprises the steps of: step a) treating cream with a phospholipase; and stepb) subjecting the phospholipase treated cream of step a) to UHT treatment, wherein step a) is performed before step b). The invention further relates to UHT-cream obtainable or obtained from such process of the invention. Finally, the invention relatesto the use of a phospholipase in the manufacturing of UHT-cream.

By the present invention is also provided a process for producing a cream liquor, which comprises the steps of: step a) treating a milk composition (such as, e.g., cream) with a phospholipase; and step b) producing a cream liquor from the enzymetreated milk composition. The invention further relates to cream liquor obtainable or obtained from such process of the invention. Finally, the invention relates to the use of a phospholipase in the manufacturing of cream liquor.

The present invention is further illustrated in the following examples which is not to be in any way limiting to the scope of protection.

EXAMPLES

Determination of Phospholipase Activity:

The determination of the phospholipase activity may be made according to the principles described in the following. In this method is used egg yolk as a lecithin-rich substrate.

Principle: pH stat titration. Homogenized egg yolk containing phospholipids is hydrolyzed by phospholipase in the presence of calcium and sodium deoxycholate at pH 8.0 and 40° C. in a pH-stat. The released fatty acids are titrated with0.1 N sodium hydroxide and base volume is monitored as a function of the time. One phospholipase unit is defined as the enzyme quantity which under standard conditions produces one micro-equivalent free fatty acid. Reagents: 0.016 M Sodium deoxycholate(C24H.sub.39NaO.sub.4), 0.32 M Calcium chloride, 0.1 N Hydrochloric acid, 0.1 N Sodium hydroxide. Substrate: Add one egg yolk to 100 ml water and homogenize in a disperser. Filter the homogeneous substrate trough double gauze. Add 5 ml of 0.32 Mcalcium chloride to stabilize the filtrate. Titrate mixture: Mix 100 ml if substrate with 50 ml of 0.016 sodium deoxycholate.

Alternatively, the following assays may be used for qualitative or quantitative determination of phospholipase activity as described in DK 99/00664 (Novo Nordisk A/S, Denmark): "Phospholipase

69

activity (PHLU)", "Phospholipase activity (LEU)","Phospholipase monolayer assay", "Plate assay 1" and "Plate assay 2" or as described in WO 98/26057 (Novo Nordisk A/S): the "NEFA-C test".

Example 1

Phospholipase Treatment of Cream for Cheese Production

In this example cream was treated with phospholipase before combined with skim milk to prepare the cheese milk.

Raw Materials

Composition of the Cheese Milk:

TABLE-US-00001 Skim milk 0.1% fat 1820 ml cream 38.0% fat 180 ml Butter milk (comprising the starter culture) 50 ml CaCl2 0.4 g

Enzymes: 1) Rennet (Acid aspartic Rhizomucor miehei protease--EC 3.4.23.6) dosage: 0.107 g 2) Lecitase.RTM. (pancreas-derived phospholipase A2 obtainable Novo Nordisk A/S), dosage (based on fat):0.2% (w/w) Cheese Production

Method: The cream was treated separately with phospholipase (Lecitase.RTM., manufactured by Novo Nordisk A/S, Denmark; dosage 0.2% (based on w/w fat content)) by incubating the mixture in a 50° C. water bath for 30 minutes. The treatedcream was mixed with the skim milk to a total fat content of 3.5% (w/w) of the mix, and placed in a 33-35° C. water bath. CaCl2 was added to the 2 liter cheese milk, and starter culture (i.e. butter milk) was added, and the mixture wasstirred for 5-10 minutes. The milk was left for 30 minutes without any stirring. Then, rennet (acid aspartic Rhizomucor miehei protease) was added, and the milk was stirred for 1 minute. Subsequently, the clotting point was defined (approximately 12minutes), and the milk was standing for about 25-26 minutes before cutting.

The clotting point (clotting time) is the time passed from the addition of rennet to the first sign of flocculation, and is determined by moving a black rod in the milk i.e. the clotting point is the point when the first visible precipitation ofparacasein is observed on the rod.

The actual cutting time was defined by doing a test as follows: With a clotting stick a small cut was made on the surface of the cheese, the stick was putted under the cut and moved forward, when the cheese was separated with two sharp edges,and the whey would collect in between the two edges then the cheese was ready for cutting.

The cheese was stirred gently with a whisk to break it up, and was left for two minutes. After the two minutes, the cheese was occasionally stirred during 10-15 minutes to separate the whey from the curd. The steadily appearing whey and thecurd were transferred to a sieve containing a cloth. The whey drained away through the cloth for 1-2 hours. A 0.6 kg weight was placed on the top of the cheese to remove more whey, and thereafter the cheese was stored overnight at room temperature.

Result: The cheese production data (clotting time, cutting time, amount of whey, protein in whey and amount of cheese) are presented in table 1.

Melting of Cheese

Method: Before melting, the cheese was cut into pieces with a height of about 2.5 cm and diameter of about 8 cm. The cheese samples was heated in a oven at 250° C. for 8 minutes. The diameter of the cheese after heating was measured asthe average of two diameters.

Result: cf. Table 1 below.

Diffusion of Fat/Oil

Method: Before the diffusion test was made, the cheese was cut into pieces with a height of about 2.5 cm and diameter of about 8 cm. The diffusion of fat/oil was measured after heating the cheese

70

samples in an oven at 200° C. for 3minutes. The diameter on the liquid diffused out on a filter paper--Whatman 40--after heating was measured as the average of four diameters.

Result: cf. Table 1 below.

The Measurements of Samples Obtained in Example 1 are Shown in Table 1

The trials were conducted as two set of trials, where different batches of milk/cream raw materials were used. One set is the column 1 and 2. The second set is column 3, 4 and 5.

TABLE-US-00002 TABLE 1 Trials with phospholipase used for treatment of cream in cheese production. Trial no. 1* 2 with 3* 4 with 5 with Control Lecitase Control Lecitase Lecitase Data from Cheese production Clotting, minutes 1330 14151620 1700 1600 Cutting, minutes 3130 3130 3550 3550 3430 Weight of whey 1635.5 1660.1 1625.8 1645.8 1668.7 Weight of cheese 314.75 296.74 327.44 322.75 318.77 % protein in whey 0.96 0.92 0.84 0.83 0.83 g protein inwhey 15.7 15.3 13.7 13.7 13.9 Result melting of cheese Average diameter after 8.0 7.5 8.0 7.3 7.3 heating, cm Result diffusion of fat/oil "Oily" diameter on filter 6.6 5.8 6.8 5.4 5.4 paper after heating, cm *Trials 1 and 3, no Lecitase .RTM. added. Trial 1* is the control for trial no. 2 and Trials 3* is the control for trial no. 4-5.

From the Result Table (cf. "melting of cheese" and "diffusion of fat/oil" shown at the bottom of Table 1) it clearly appears that cheese made with an initial phospholipase treatment of the cream improves the stability of the cheese during aheat treatment. This is seen from the measurements of the average diameter of sample after heating, which is smaller when the cream for the cheese milk has been treated with phospholipase. Further, the oily diameter on the filter paper is reduced whentreating the cream with phospholipase.

The results demonstrate that it is possible to obtain a stability improvement of cheese during heat treatment with the process of the invention.

Example 2

Phospholipase Treatment of Cream to Test the Stabilising Effect on the Cream

Method: Cream (200 g) was incubated 15 minutes at 50° C. with 3 different dosages of Lecitase.RTM. 10 L, (Novo Nordisk A/S, Denmark) (dosage based on estimated fat=36%): 1. Dosage 0% 2. Dosage 0.2% (=0.0725% of the cream) 3. Dosage1.0% (=0.36% of the cream)

After the incubation the cream was cooled to 5° C. The cream was whipped in a standardised way (Philips mixer 5 speed, the first 2 minutes run at speed 4, and speed 5 the rest of the time). 100 g whipped cream was filled into a funneland allow to stand dripping for 1 hour at room temperature.

Samples and Results:

Sample 1 was whipped for 7 minutes and 25 seconds. About 300 ml cream. Amount of dripping after 1 hour in funnel=2.5 ml.

Sample 2 was whipped 20 minutes and no foam formation was observed. The sample became a little bit thicker, and obtained a light yellow colour.

Sample 3 was whipped for 15 minutes and no foam formation was observed. The sample became a little bit thicker and obtained a light yellow colour.

The ability to foam was destroyed by Lecitase.RTM. treatment. The foam formation in cream is based on collapse of fat globules, and formation of a continuous fat phase forming the foam. In accordance with the process of the present inventionthe above results show that Lecitase.RTM. treatment improves emulsification and stabilisation of the fat in the cream.

Example 3

Phospholipase Treatment of Cream for Mozzarella Cheese Production

71

In this example cream was treated with phospholipase before being combined with skim milk to produce the cheese milk.

Raw Materials

Composition of the Cheese Milk:

TABLE-US-00003 Skim milk, pasteurised 0.83% fat 13.63 L cream 30% fat 1.37 L CaCl2 0.4 g/2 kg cream

Starter cultures LH100 and TA061 (Lactic acid bacteria) from Rhodia Foods (Rhodia Inc, Madison, Wis., USA) 0.6 g of each. Enzymes: 1) Rennet (Acid aspartic Rhizomucor miehei protease--EC 3.4.23.6) dosage w 50 KRU/g (KRU method obtainable formNovo Nordisk A/S: 0.60 g 2) Lecitase.RTM. (pancreas-derived phospholipase A2 obtainable Novo Nordisk A/S), dosage (based on fat):0.2% (w/w) Cheese Production

Method: The cream was treated separately with phospholipase (Lecitase.RTM., manufactured by Novo Nordisk A/S, Denmark; dosage 0.2% (based on w/w fat content)) by incubating the mixture in a 50° C. water bath for 30 minutes withCaCl2. The treated cream was mixed with the skim milk to a total fat content of 3.5%, and placed in 15 L cheese vat (using a cheese unit with 2×15 L vats obtainable from GEA Liquid processing, Haderslevvej 36, 6000 Kolding, Denmark). Themilk was equilibrated to 34.4° C., and starter culture was added, and the mixture was gently agitated for 4-5 minutes before the rennet was added. Then, rennet (acid aspartic Rhizomucor miehei protease) was added, and the milk was stirred for 3minutes. Subsequently the milk was standing for about 35 minutes before cutting

The actual cutting time was defined by doing a test as follows: With a clotting stick a small cut was made on the surface of the cheese--then the stick was putted under the cut and moved forwards so as the cheese was separated with two sharpedges, and the whey would collect in between the two edges. The cutting was performed with 1/2 inch knifes.

The cutted curd was then heated to 41.1° C. (takes about 30 min). The cheese was then agitated gently until the curd pH reached pH 5.90, whereafter the whey was drained and piled to a 5 cm mat. The curd is cut into 1.5 inch cubes whenthe pH reach 5.25 and covered in cold tap water for 15 min. The curd is weighed after tap water is drained of NaCl (0.2% of the cheese milk weight) was added dry to the cubed curd in 3 portions. The curd was then stretched at 63° C. at 9 rmp bytwin screw stretcher (Supreme Micro Mixing Machine obtained from Stainless Fabricating Inc., Columbus. WI, USA), where after the stretched curd is placed in 7° C. water for 30 min and 7° C. F brine (23% NaCl) for another 90 minutes.

The cheese production data (Protein in cheese, measured by Dumas Combustion Method (LECO) moisture measured by CEM Automatic Volatility Computer, model AVC-80 from CEM Corp., Matthews, N.C., 28108, and fat by difference) are collected in table2.

Result: cf. Table 2 below.

Diffusion of Fat/Oil

Method: The diffusion of fat/oil was tested on cheese samples heated in the oven at 90° C. for 5 minutes. Before the diffusion test was made, the cheese was ground in an osterizer blender to achieve uniformity of sample. Subsequently2.0 grams were molded into a metal ring (2 cm) and placed in the center of a Whatman # 4 filter. The oiling off was determined by difference in the areas between the ring of oil and the circle of the cheese (triplicate determinations). Result: cf. Table 2 below.

Meltability

Method: squeeze-flow rheometry, ref. Ak, M. M., and Gunasekaran. 1995. J. Texture Stud. 26: 695-711.

Parameters: 0.1 mm/sec crosshead speed on Stable Micro Systems, TA-XT2 texture analyzer. Cylindrical samples diameter 25 mm, height 15 mm) were placed in 50° C. water bath for 5 min. to

72

equilibrate temperature.

The meltabilities of the P-lipase treated samples were only slightly lower than their respective controls.

Measurements of Samples Obtained in Examples 3 are Shown in Table 2

The trials were conducted as two set of trials, where different batches of milk/cream raw materials were used.

TABLE-US-00004 TABLE 2 Data for Example 3: Trials with phospholipase used for treatment of cream in cheese production. Trial no. 1 1-control 2 2 control Data from cheese production Protein in cheese 18.8% 18.1% 20.4% 20.5% Moisture 43.1% 45.1%46.3% 46.9% Fat by difference 38.1% 36.8% 33.3% 33.6% Result from oiling off "Oily" area on filter paper 57% 176% <10% 61% after heating, in percent of the cheese area * Trials 1 and 2 is with Lecitase .RTM. added. Trial 1-control and 2-control arethe corresponding trials run in parallel but without Lecitase .RTM.. In experiment 1 the oiling of was measured after 5 days in refrigeration, and in experiment 2 the oiling of was measured after storage in refrigeration for 8 days.

From the Result Table 2 it clearly appears that mozzarella cheese made with an initial phospholipase treatment of the cream reduces the oiling off significantly, which is a key quality parameter for Mozzarella. The results demonstrate that itis possible to obtain a stability improvement of cheese during heat treatment with the process of the invention. It is furthermore seen that the Phospholipase increases the fat content in the cheese, likely caused by a reduced fat loss duringprocessing. Thus, the initial treatment with phospholipase leads to an increase yield in cheese production. 1. Field of the Invention

The present invention relates to the field of cream cheese products and methods of making the same.

2. Background of the Invention

Cream cheese and similar products are ubiquitous in modem diets. They generally have a smooth texture and a bland, unremarkable flavor. Spreadability makes cream cheese convenient to use, which is the primary basis for its choice by consumersover other firmer cheeses and the reason for its high volume consumption as a topping, for example on breads including bagels. In the classic method for making cream cheese, a pasteurized milkfat fluid such as cream, having a butterfat content generallywithin a range of between about 10% by weight and 52% by weight, is the primary raw material. This milkfat fluid is subjected to thorough digestion by lactic acid--producing bacteria, homogenized, and clotted by enzymes or direct acidification. Themilkfat fluid is thus transformed into a solid phase containing a high concentration of fat that is referred to as the curd, and a liquid phase containing much of the nutritious protein from the milkfat fluid, referred to as the whey. The curd is thenprocessed into the desired cream cheese product, and the whey is discarded. As a result, cream cheese typically has a bland, dull, virtually unnoticeable taste. The retention of liquid whey in the curd is a problem in itself, as the liquid graduallyleaks out of the curd in an unappealing and ongoing separation that is called syneresis. In addition, large scale cream cheese production generates corresponding quantities of often unusable whey, which thus becomes a waste expense and environmentaldetraction unless some other use can be found for it.

Accordingly it would be highly desirable to provide a process for making an improved cream cheese product from a milkfat fluid, having the consistency of high-milkfat cream cheese including a mouth-pleasing texture and convenient spreadability,desirably having the robust flavor of whey retained from the milkfat fluid. The resulting cream cheese product would be a welcome substitute for its faintly-tasting progenitors while simultaneously improving cheese production economics and protectingthe environment.

SUMMARY

In one implementation, a process is provided for making a cream cheese product comprising steps of: providing a milkfat fluid comprising butterfat; pasteurizing said milkfat fluid; homogenizing said milkfat fluid; and culturing bacteria in saidmilkfat fluid; producing a cream cheese product

73

comprising live probiotic bacteria cultures.

In another implementation, a cream cheese product is provided, comprising: between about 10% by weight and about 55% by weight of total butterfat; and a live probiotic bacteria culture.

A more complete understanding of the present invention, as well as other features and advantages of the present invention, will be apparent from the following detailed description and the accompanying drawings. 

BRIEF DESCRIPTION OF THEFIGURES

FIG. 1 is a flow chart of an exemplary process for making a cream cheese product according to the present invention; and

FIG. 2 is a flow chart of an exemplary process for making a whipped cream cheese product according to the present invention.

DETAILED DESCRIPTION

Referring to FIG. 1, a flow chart of an exemplary process 100 is shown for making a cream cheese product 165. For purposes of this disclosure, the term "cream cheese product" denotes a product resulting from the digestion of a milkfat fluid byculture bacteria, said cream cheese product comprising live probiotic culture bacteria. For purposes of this disclosure, the term "culture bacteria" denotes a bacteria strain that is selected and added to milkfat fluid in order to at least partiallydigest the milkfat fluid and form the cream cheese product, and/or to constitute a live, probiotic ingredient in the cream cheese product. Cream cheese itself generally has a milkfat content of at least about 33% by weight. Neufchatel cheese generallyhas a milkfat content within a range of between about 17% and about 33% by weight. Light cream cheese generally has a milkfat content within a range of between about 10% and about 17% by weight. Cream cheese, Neufchatel cheese, and light cream cheeseare all within the scope of the definition herein of the term "cream cheese product".

Process 100 begins with provision of a milkfat fluid at step 105. By milkfat is meant a composition comprising the fatty components of edible milk, for example, cow milk. Such fatty components, commonly referred to collectively as butterfat,can include, for example, triacylglycerols, diglycerides, monoacylglycerols, and other lipids. By fluid is meant a liquefied composition comprising milkfat, which can either be directly derived from milk, or reconstituted by hydrating a dehydrated milkproduct. For example, the milkfat fluid can be cream. The milkfat fluid can be formed from a mixture of sources, including, for example, whole milk, cream, skim milk, and dry milk. Ambient air contains harmful bacteria that can degrade the milkfatfluid 105. Accordingly, exposure of the milkfat fluid to air is avoided.

In one implementation, the butterfat content of the milkfat fluid is standardized at step 115 to a desired level. The butterfat content of the final cream cheese product can then be projected. For example, cream cheese is defined to include aminimum butterfat content of 33% by weight. Given the variable nature of raw milk, for example, standardization of the butterfat content in a given batch of milkfat fluid may generally be desirable in furtherance of process stability and production of auniform product. In one implementation, the milkfat fluid has a butterfat content within a range of between about 10% and about 52% by weight. In a further implementation, the milkfat fluid has a butterfat content within a range of between about 30%and about 52% by weight. In another implementation, the milkfat fluid has a butterfat content within a range of between about 33% and about 50% by weight. In a further implementation, the milkfat fluid has a butterfat content within a range of betweenabout 39% and about 50% by weight. In another implementation, the milkfat fluid has a butterfat content within a range of between about 40% and about 44% by weight. In yet another implementation, the milkfat fluid has a butterfat content within a rangeof between about 17% and about 33% by weight. In general, the texture and mouth feel of cream cheese products improves with higher butterfat content. Higher butterfat levels also provide better tolerance of the milkfat fluid to subsequent processingsteps, such as agitation shear that can degrade butterfat and protein molecules.

In an additional implementation, the milkfat fluid has a water content within a range of between about 50% and about 60% by weight. For example, heavy cream may have a butterfat content of

74

about 37% by weight, a protein content of about 2% byweight, and a water content of about 58% by weight, with the balance made up by other milk solids. In a further implementation, the final cream cheese product has a water content within a range of between about 50% by weight and about 55% by weight. Butterfat is an essential ingredient in cheese, as the butterfat is coagulated together with proteins and other elements into a curd and further processed to produce the cheese. The term "cheese" is broadly defined for purposes of this disclosure as amilkfat fluid that has been at least partially digested by culture bacteria.

The initial butterfat level present in a given batch of milkfat fluid can be measured, for example, using a standard Babcock test. For background, see Baldwin, R. J., "The Babcock Test," Michigan Agricultural College, Extension Division,Bulletin No. 2, Extension Series, March 1916, pp. 1-11; the entirety of which is herein incorporated by reference. Where the initial butterfat level present in a given batch of milkfat fluid is too high, adjustment can be accomplished by adding anonfat material such as skim milk. Addition of water is generally ineffective since the water content of the curd directly affects the cream cheese product viscosity, and the feasibility of adding water alone to adjust the butterfat level in the finalcream cheese product is accordingly limited. In one implementation, the butterfat content of a batch of milkfat fluid is downwardly adjusted by addition of an appropriate amount of nonfat dry milk together with adequate water to rehydrate the nonfat drymilk, which has the advantage of not contributing excess water to the batch. In the event that the initial butterfat level present in a given batch of milkfat fluid needs to be upwardly adjusted, this can be accomplished by addition of a materialcontaining a higher concentration of butterfat, such as, for example, cream.

According to a further implementation, the relative milkfat fluid concentrations of butterfat, milkfat protein and water are controlled. As explained above, the butterfat content of the final cream cheese product is selected as desired. Forexample, cream cheese includes at least about 33% by weight of butterfat. Regarding protein, higher concentrations are generally desirable for nutritional considerations. Water is a secondary ingredient that is necessary to a reasonable degree tofacilitate processing, as well as to provide a desirable texture in the product. However, excessive water will not be retained in the curd and hence becomes a processing hindrance and expense, and a disposal issue. In one implementation, the milkfatfluid comprises about 10% to about 52% butterfat, about 4% milk protein, and about 51.5% to about 36% water, with the balance constituted by other milk solids.

Referring to FIG. 1, in one implementation a stabilizer is added to the milkfat fluid at step 120. Stabilizers thicken the milkfat fluid by binding water, which may contribute to retention of whey in the milkfat fluid during subsequentprocessing. The stabilizer may be selected from, for example, gums, salts, emulsifiers, and their mixtures. Suitable gums include, for example, locust bean gum, xanthan gum, guar gum, gum arabic, and carageenan. Suitable salts include, for example,sodium chloride and potassium chloride. These salts can also be added in suitable concentrations, if desired, as flavoring for the cream cheese product. Suitable emulsifiers include, for example, sodium citrate, potassium citrate, mono-, di-, andtri-sodium phosphate, sodium aluminum phosphate, sodium tripolyphosphate, sodium hexametaphosphate, dipotassium phosphate, and sodium acid pyrophosphate. In one implementation, the stabilizer is K6B493, a milled, dry product that is commerciallyavailable from CP Kelco US, Inc., 1313 North Market Street, Wilmington, Del. 19894-0001. Gum arabic is commercially available from TIC Gums Inc., Belcamp, Md. A stabilizer blend comprising xanthan gum, locust bean gum and guar gum is also commerciallyavailable from TIC Gums Inc. Gum--based stabilizers typically contain sodium, which should be taken into account in order to avoid excessive sodium concentrations in the final cream cheese product. For this reason, use of salts as stabilizers is alsonot preferred.

In one implementation, an amount of a stabilizer effective to cause a moderate thickening of the milkfat fluid is added. For example, a stabilizer may be added in an amount constituting between about 0.25% by weight to about 0.45% by weight ofthe cream cheese product. In another implementation, a stabilizer may be added in an amount constituting between about 0.3% by weight to about 0.4% by weight of the cream cheese product. As the butterfat content of the chosen milkfat fluid is reduced,the proportion of stabilizer used desirably is increased.

In one implementation, the milkfat fluid is pasteurized at step 125. Prior to this step, the milkfat fluid typically carries the wild bacteria load normally present in raw milk products. Pasteurization of the milkfat fluid is required at somepoint in order to kill these undesirable bacteria, as well as other undesired microbes, to the extent reasonably feasible. Pasteurization needs to be completed in

75

advance of bacteria culture steps 140-145 discussed below, or the wild bacteria in the rawmilkfat fluid will typically digest and thereby spoil the product. Where a source of pre-pasteurized milkfat fluid is employed, further pasteurization at this point may be unnecessary.

Pasteurization causes irreversible heat-induced denaturation and deactivation of bacteria. Effective pasteurization is a function of both time and temperature; pasteurization can be completed at higher temperatures in correspondingly shortertimes. In one implementation, pasteurization of the milkfat fluid in step 125 is carried out in a vat process at a temperature of about 150° Fahrenheit ("F") for about 30 minutes; or about 165° F. for about 15 minutes; or if a morestrenuous process is desired, about 170° F. for about 30 minutes. Other effective time and temperature treatment parameters are known; and substitution of high surface area contact methods for the vat process can permit shorter effectivetreatment times. High temperature short time pasteurization for example, in which the milkfat fluid is pumped through an in-line tube within a temperature-controlled shell, can be used. Milkfat fluids having relatively high butterfat content generallyrequire more heat exposure than low butterfat fluids in order to obtain effective pasteurization. Further background information on pasteurization of milk is provided in the Grade "A" Pasteurized Milk Ordinance published on May 15, 2002 by the U.S. Food & Drug Administration, particularly at pages 62 and 63; the entirety of which is hereby incorporated herein by reference.

Agitation is desirably provided and initiated prior to the heating process during pasteurization to facilitate even heating throughout the milkfat fluid and to avoid localized overheating. The force applied by the agitation should not be sostrong as to substantially shear and thus degrade the butterfat and proteins in the milkfat fluid. Desirably, pasteurization is carried out in a tank equipped with a heater and agitator. Any suitable vessel can be used, such as, for example, a Groenkettle.

At step 130, the milkfat fluid is homogenized by subjecting it to an elevated pressure, desirably at an elevated temperature, for a suitable period of time. Application of such an elevated pressure breaks down the butterfat globules in themilkfat fluid, resulting in substantially increased product uniformity. In general, homogenization is carried out at an elevated pressure, which can be applied to the milkfat fluid by any suitable means, such as, for example, hydraulic or mechanicalforce. In one implementation, the milkfat fluid is compressed to the selected pressure and then passed through an orifice to quickly reduce such pressure. Homogenization is desirably carried out at a relatively high temperature, because the resultingfluidity of the milkfat fluid increases the efficiency of the homogenization step. In one implementation, the homogenization step 130 is carried out at a controlled temperature within a range of between about 155° F. and about 165° F.Lower temperatures can be used if desired. Homogenization can be carried out, for example, in a Gaulin homogenizer.

In one implementation, the homogenization pressure is within a range of between about 2,000 pounds per square inch (PSI) to about 4,000 PSI. In another implementation, the homogenization pressure is within a range of between about 2,500 PSI toabout 3,200 PSI. As the applied pressure increases, the resulting viscosity of the final cream cheese product accordingly increases. Hence, the pressure to be applied is desirably chosen to yield a final product of the desired consistency.

In one implementation, a homogenizer is employed having a homogenization chamber, an inlet chamber, and an outlet chamber. The inlet chamber is a vessel suitable for staging a supply of the milkfat fluid, on a continuous or batch basis, forintroduction into the homogenization chamber. The homogenization chamber is a vessel having controllable orifices for input and output of the milkfat fluid, and is reinforced to withstand containment of an elevated pressure suitable for homogenization. The outlet chamber is a vessel suitable for staging a supply of the homogenized milkfat fluid, on a continuous or batch basis, for further processing. The milkfat fluid passes through the inlet chamber before being pumped into the homogenizationchamber. Following homogenization, the milkfat fluid is expelled from the homogenization chamber into the outlet chamber. These flows are typically carried out on a continuous basis, although a batch process can also be done. The pressure within thehomogenization chamber is adjusted to the chosen homogenization pressure and maintained there during homogenization. The pressure in the inlet chamber may be, for example, within a range of between about 20 PSI and about 40 PSI, generated by pumping ofthe milkfat fluid into the inlet chamber. Similarly, the pressure in the outlet chamber may be, for example, within a range of between about 20 PSI and about 40 PSI, generated by expelling the milkfat fluid from the homogenization chamber and thencontaining it in the outlet chamber. The milkfat fluid can undergo a pressure drop upon passing from the homogenization chamber to the outlet chamber, by ejection through a hole, such as for example a

76

hole having a diameter of about a centimeter. Thepressures within the inlet chamber, outlet chamber and homogenization chamber are carefully controlled so that air is not entrained into the homogenization chamber. Such air can cause cavitation, which can degrade the product and potentially lead to anexplosive release of the homogenization pressure.

The temperature of the milkfat fluid is adjusted at step 135 to a bacteria culture temperature. In one implementation, culture bacteria generally suitable for the production of a cream cheese are used, and the temperature of the milkfat fluid isadjusted, before bacteria addition in step 140, to a temperature within a range of between about 65° F. and about 92° F. In an additional implementation, the temperature of the milkfat fluid is adjusted to within a range of between about70° F. and about 85° F. In another implementation, the temperature of the milkfat fluid is adjusted to about 82° F.

In a further implementation, culture bacteria generally suitable for the production of yoghurt, or another probiotic culture bacteria, are used and the temperature of the milkfat fluid is adjusted, before bacteria addition in step 140, to atemperature within a range of between about 95° F. and about 110° F. The term "probiotic" means that the subject bacteria, in live and active form, are beneficial to the consumer when ingested. For example, certain yoghurt culturebacteria including Lactobacillus delbrueckii subspecies bulgaricus, Streptococcus thermophilus, Lactobacillus acidophilus, Bifidobacterium, and Lactobacillus paracasei subspecies casei, are retained in the digestive tract where they aid in fooddigestion. In an additional implementation, the temperature of the milkfat fluid is adjusted to within a range of between about 100° F. and about 108° F. In yet a further implementation, the temperature of the milkfat fluid is adjustedto about 106° F.

In one implementation, culture bacteria are added to the milkfat fluid at step 140, and then cultured at step 145. The purpose of these steps is to generate robust culture-induced flavor in the milkfat fluid. Milk contains lactose sugars thatcan be digested by selected bacteria, producing lactic acid, glucose and galactose as metabolites. Hence, the culture bacteria generally are selected from among those that can digest lactose. Desirably, a strain of mesophilic bacteria suitable forculturing cream cheese is used. Such bacteria strains are typically chosen to produce diacetyl flavor. Bacteria strains may require ongoing rotational use, to prevent background bacteriophage populations from becoming resistant to a particular strainof bacteria, which can result in shutdown of the culture process and contamination of the product in production. For example, the culture bacteria may be selected from varying combinations of strains, desirably rotated on an ongoing basis, of (1) lacticacid--producing Lactococcus lactis subspecies lactis or subspecies cremoris; and (2) diacetyl flavor--producing Lactococcus lactis subspecies diacetylactis or Leuconostoc strains. Suitable bacteria strains are commercially available under the trade namepHage Control™ from Chr. Hansen, Boge Alle 10-12, DK-2970Horsholm, Denmark. Grades 604 and 608 are particularly effective. These particular bacteria strain blends can be used continuously without rotation, provided that proper sanitation ismaintained. Further suitable bacteria strains are commercially available under the trade names Flay Direct™ and DG™ Cultures from Degussa BioActives, 620 Progress Avenue, P.O. Box 1609, Waukesha, Wis. 53187-1609.

In another implementation, other bacteria strains beyond those discussed above, providing health benefits to the consumer, can be used. Bacteria strains recognized as probiotics, for example, can be used. Desirably, a thermophilic bacteriastrain suitable for producing yogurt, for example, is used. Among the additional bacteria strains that can be employed in step 140 are Lactobacillus delbrueckii subspecies bulgaricus, Streptococcus thermophilus, Lactobacillus acidophilus,Bifidobacterium, and Lactobacillus paracasei subspecies casei. Suitable culture bacteria strains are commercially available, for example, under the trade name Yo-Fast.RTM. from Chr. Hansen, Boge Alle 10-12, DK-2970Horsholm, Denmark. In oneimplementation, F-DVS YoFast.RTM.-10 is used, which contains blended strains of Streptococcus thermophilus, Lactobacillus delbrueckii subspecies bulgaricus, Lactobacillus acidophilus, Bifidobacterium, and Lactobacillus paracasei subspecies casei. Inanother implementation, DVS YoFast.RTM.-2211 is used. In a further implementation, culture bacteria comprising Lactobacillus acidophilus, Bifidobacterium, and L. casei is used. For example, Yo-Fast.RTM. 20 cultures comprise mixtures of Lactobacillusacidophilus, Bifidobacterium, and L. casei. Such culture bacteria can develop a very mild flavor and have high texturing properties, making possible the reduction or elimination of stabilizers and additives that may otherwise be needed for increasingthe product viscosity. These culture bacteria also lend a desirable mouth feel and creaminess to low-fat products. Further suitable bacteria strains are commercially available under the trade names Ultra-Gro.RTM. and Sbifidus.RTM. from DegussaBioActives, 620 Progress Avenue, P.O. Box 1609, Waukesha, Wis.

77

53187-1609.

Once a culture bacteria strain or strain mixture is selected, an amount is added to a given batch of milkfat fluid that is effective to propagate live cultures throughout the batch in a reasonable time at the chosen culture temperature. Forexample, 500 grams of bacteria may be effective to inoculate up to 7,500 pounds of milkfat fluid using an inoculation proportion of about 0.015%. If desired, an inoculation proportion within the range of between about 0.013% and about 0.026%, forexample, may be used. In general, greater proportional additions of culture bacteria to a milkfat fluid batch will lead to somewhat reduced processing time, but at the expense of increased costs for the bacteria.

In one implementation, the milkfat fluid is agitated following the addition of the culture bacteria, since the culture bacteria are typically added in a small proportion compared with the milkfat fluid, and hence desirably are dispersed so thatthey can act throughout the milkfat fluid. Agitation can if desired begin prior to addition of the culture bacteria, and can if desired be continued after dispersion of the culture bacteria. The shear force applied by the agitation should be sufficientto disperse the culture bacteria in a reasonable time, but not so strong as to substantially shear and thus degrade the culture bacteria, or the butterfat and proteins in the milkfat fluid. In one implementation, moderate agitation of the milkfat fluidcontaining the culture bacteria is continued for between about 10 minutes and about 25 minutes. In another implementation, moderate agitation is continued for about 15 minutes.

In step 145, the bacteria added at step 140 are cultured in the milkfat fluid. The necessary duration of such bacteria culturing depends on the type of bacteria used, the level of bacteria activity, the selected culture temperature, the initialbacteria concentration, and the composition of the milkfat fluid. The bacteria digest lactose sugars in the milkfat fluid. Higher culture temperatures and initial bacteria concentrations generally shorten the culture time needed. The temperatureemployed, however, must be within a range tolerable to the survival and growth of the selected culture bacteria. In one implementation, the milkfat fluid is held at a suitable temperature for cultures of the selected bacteria to develop for a sufficienttime so that there is visible curd formation throughout the milkfat fluid, resulting in a substantial thickening.

In one implementation, culture bacteria suitable for the production of a cream cheese product are employed, and the milkfat fluid is held at a temperature within a range of between about 65° F. and about 92° F. In anotherimplementation, the milkfat fluid is held at a temperature within a range of between about 70° F. and about 85° F. In an additional implementation, the milkfat fluid is held at a temperature of about 82° F. In one implementation,the milkfat fluid is cultured with such selected bacteria for between about 14 hours and about 16 hours. In another implementation, the milkfat fluid is cultured with such selected bacteria at a temperature of about 82° F. for about 14 hours.

In another implementation, culture bacteria suitable for preparation of a product comprising live and active probiotic bacteria cultures, such as thermophilic yogurt culture bacteria, is employed, and the milkfat fluid is held at a temperaturewithin a range of between about 95° F. and about 112° F. In another implementation, the milkfat fluid is held at a temperature within a range of between about 100° F. and about 110° F. In a further implementation, themilkfat fluid is held at a temperature within a range of between about 106° F. and about 110° F. In an additional implementation, the milkfat fluid is held at a temperature of about 108° F. In one implementation, the milkfat fluidis cultured with such selected bacteria for between about 4 hours and about 8 hours. In another implementation, the milkfat fluid is cultured with such selected bacteria at a temperature of about 108° F. for about 6 hours.

Lactic acid is formed as a byproduct of metabolism of lactose by the bacteria in step 145. Hence, the measured pH of the milkfat fluid, which gradually decreases with lactic acid buildup, is an indication of the progress of the bacteria culture. Further, when the pH of the milkfat fluid reaches about 4.4, the level of bacterial activity begins to markedly decrease. In one implementation, the bacteria culture step 145 is continued until the pH of the milkfat fluid is within a range of about 5.0to about 4.1. In another implementation, the bacteria culture step 145 is continued until the pH of the milkfat fluid is within a final target pH range of about 4.6 to about 4.4; and more desirably about 4.5. In one implementation, the bacteria culturestep 145 is continued until the pH of the milkfat fluid reaches a target pH for the finished cream cheese product 165. As the pH of the milkfat fluid approaches this target, the milkfat fluid viscosity increases and the bacterial activity slows down. Hence, in one implementation, the milkfat fluid pH is monitored over time during step 145, and

78

additional culture bacteria are added during step 145 if desired, to reinvigorate the bacteria culture process. In another implementation, if the target pH isnot reached after a desired bacteria culture time period, then the culture bacteria concentration to be employed in subsequent practice of the process 100 is adjusted upward.

In one implementation, the milkfat fluid is acidified at step 150. Step 150 may be unnecessary, for example if the desired target pH for the cream cheese product can be reached in bacteria culture step 145. Desirably, such acidification iscontinued, if carried out at all, until a target pH for the finished cream cheese product 165 is reached. Desirably, acidification is carried out promptly following bacteria culture of the milkfat fluid at step 145. The optimum temperature zone forrapid bacterial growth is generally within a range of between about 75° F. and about 115° F. Accordingly, the milkfat fluid and the resulting cream cheese product are desirably exposed to temperatures within this range for as short a timeperiod as reasonably possible in order to minimize undesirable and excessive bacterial activity and spoilage in the product. Acidification can be carried out, for example, in a set tank internally equipped with a scraped surface agitator to ensure rapidand thorough mixing of added acid with the milkfat fluid. Agitation desirably is discontinued upon reaching the desired product pH, in order to avoid excessive shearing and possible resulting breakdown of the viscosity of the cream cheese product. Acidification can generally be carried out at an elevated temperature, provided that the temperature is not high enough to kill any live bacteria cultures remaining in the milkfat fluid from steps 140-145. For example, acidification can be carried outat a temperature within the ranges discussed in connection with step 135, depending on the type of bacteria culture used, such as thermophilic or mesophilic. If desired, acidification can be carried out at a lower temperature, although the milkfat fluidviscosity increases as the temperature is reduced, and feasibility of mixing the acidification agent into the milkfat fluid is also important. In a further implementation, the temperature of the milkfat fluid is reduced to a temperature of less thanabout 75° F. during or after acidification in step 150. Carrying out acidification becomes gradually more difficult as the temperature of the milkfat fluid is lowered, due to the steadily increasing viscosity. Furthermore, acidification at atemperature below about 60° F. may result in a lumpy cream cheese product texture. Cooling can be effected, for example, using jacketed tanks containing a glycol refrigerant maintained at a desired temperature to withdraw heat from the milkfatfluid in the tank.

In one implementation, the pH of the milkfat fluid is adjusted to within a range of about 5.0 to about 4.1, more desirably about 4.6 to about 4.4, and still more desirably about 4.5. In another implementation, the pH of the milkfat fluid forproducing a plain cream cheese product, meaning one that does not contain or contains minimal concentrations of fruits, vegetables, nuts, flavorings, condiments or other food additives, is adjusted to within a range of between about 4.40 and about 4.50. In a further implementation, the pH of the milkfat fluid for a flavored cream cheese product, meaning one that does contain a significant concentration of fruits, vegetables, nuts, flavorings, condiments or other food additives, is adjusted to within arange of between about 4.38 and about 4.48. At a pH of the milkfat fluid lower than about 4.40 or 4.38 for plain or flavored cream cheese products respectively, the taste begins to become sharp, and at a pH of about 4.2 or lower is generally too tart. At a pH of the milkfat fluid above about 4.50 or 4.48 for plain or flavored cream cheese products respectively, the product viscosity begins to undesirably decline, potentially resulting in poor body or runniness.

In one implementation, the pH adjustment is carried out by adding an appropriate amount of an edible acid to the milkfat fluid. Edible acids include, for example, lactic acid, phosphoric acid, acetic acid, citric acid, and mixtures. Forexample, a suitable aqueous mixture of edible acids having a pH within a range of between about 0.08 and about 1.4 is available under the trade name Stabilac.RTM. 12 Natural from the Sensient Technologies Corporation, 777 East Wisconsin Avenue,Milwaukee, Wis. 53202-5304. Similar edible acid mixtures are also available from Degussa Corporation, 379 Interpace Parkway, P.O. Box 677, Parsippany, N.J. 07054-0677. In another implementation, the edible acid is lactic acid, being a metabolitenaturally produced by lactose--consuming bacteria.

Bacteria present in the final product become substantially dormant at a pH substantially below about 4.38. Hence, acidification substantially slows down bacteria further propagation in the product, extending its shelf life. However, thedesirable culture bacteria are not killed by this acidification process, and thus can still provide the health benefits of live and active bacteria cultures to the consumer. The edible acid present in the final cream cheese product also serves toprovide a good-tasting bite to the flavor. At a pH of less than about 4.2, the product not only

79

becomes too tart but may also start to soften, reducing the product viscosity.

In an alternative embodiment, a coagulating enzyme can be substituted for or used in conjunction with direct acid addition. Coagulating enzymes cause the casein protein in milk to form a gel. However, the action of coagulating enzymes generallyrequires much more time to completion than direct acidification, meanwhile allowing far more culture bacteria activity to occur and delaying the completion of acidification. The enzyme coagulation process is also accompanied by syneresis and theresulting loss of albumin protein from the gelled curd. Hence, enzyme coagulation generally results in an inferior cream cheese product having a reduced thickness and protein content. Enzymatic coagulation typically takes a long time, 12 hours forexample. In general, any suitable coagulating enzyme of animal-, plant-, microbe, or other origin can be used. In one embodiment, the coagulant enzyme is chymosin, also referred to as rennin, which is the active component of rennet. Rennet is purifiedfrom calf stomachs. Chymosin breaks down casein protein to paracasein. Paracasein then combines with calcium to form calcium paracaseinate, which precipitates and starts formation of a solid mass. Milkfat and water become incorporated into the mass,forming curds. One part rennin can coagulate about 10,000 to about 15,000 parts milkfat fluid. Alternatively, pepsin, which is purified from the stomachs of grown calves, heifers, or pigs, can be used.

In one implementation, following completion of acidification step 150 the temperature of the finished cream cheese product is reduced at step 155 to a suitable refrigeration temperature, such as, for example, about 34° F. to about38° F.

If desired, a suitable preservative can be added to the cream cheese product to retard bacteria, yeast and mold growth. For example, potassium sorbate, sodium benzoate, sorbic acid, ascorbic acid or nisin can be added. Nisin, for example, is aprotein expressed by Lactococcus lactis. Further, if desired, flavorings, condiments and the like can be added. Adjuvants that are vulnerable to attack by the live bacteria are desirably added after reducing the temperature of the cream cheese productbelow about 75° F., and may need to be made resistant to such bacteria.

In one implementation, live probiotic culture bacteria are added to the cream cheese product in step 160 following completion of bacteria culture step 145 and desirably following completion of acidification in step 150; and provided that thetemperature of the cream cheese product is low enough at and following such addition to avoid killing or unduly shocking the live culture bacteria. Step 160 can be carried out in the same manner as discussed above in connection with step 140. However,in step 160, the bacteria employed generally comprise live probiotic bacteria, although other bacteria among the strains discussed above in connection with step 140 can also be included. Such probiotic bacteria reinforce the health-related benefits oflive and active culture bacteria in the cream cheese product, as earlier discussed. The desirability of such live probiotic culture bacteria addition and the concentration of such bacteria to be added to a given cream cheese product can be determined bycarrying out a bacteria activity test. For example a Man, Rogosa and Sharpe ("MRS") broth test can be carried out.

FIG. 1 shows an implementation of an order of steps that can be carried out. Other orders of steps can be used. Pasteurization step 125 destroys the wild bacteria typically present in raw milkfat fluid such as whole milk or cream. If apre-pasteurized milkfat source is used, then further pasteurization may be unnecessary. If pasteurization step 125 is to be carried out, then desirably any further ingredients are combined with the milkfat fluid before carrying out pasteurization step125, so that contamination of the milkfat fluid by harmful wild bacteria is avoided. Hence, butterfat adjustment step 115 and stabilizer addition step 120 are both desirably carried out, if at all, prior to carrying out pasteurization step 125. Butterfat adjustment step 115 and stabilizer addition step 120 can be carried out in either order as desired. Homogenization step 130 is desirably carried out following, and desirably immediately following, pasteurization step 125. The elevatedtemperatures necessary during pasteurization step 125 are beneficial in carrying out homogenization step 130, as the viscosity of the milkfat fluid, and its resistance to homogenization, are reduced by the elevated temperatures. Homogenization isdesirably carried out after combining all other ingredients to ensure their thorough mixing during step 130. However, homogenization is desirably carried out before bacteria culture steps 140 and 145 so that the culture bacteria are not damaged orkilled during such homogenization. Acidification step 150 often causes a substantial thickening of the milkfat fluid and other ingredients. Desirably, acidification step 150 is carried out, if at all, following homogenization step 130, so that suchthickening does not increase the difficulty of homogenizing the ingredients. Addition of live and active probiotic bacteria in step 160 desirably is carried out as a post-treatment following all of the foregoing steps, so that such probiotic bacteriaare not damaged

80

or killed during the other process steps.

The cream cheese product made according to the process of the present invention generally has the appearance, consistency, and texture of cream cheese. In addition, this product desirably includes retained whey from the milkfat fluid, whichdramatically amplifies the flavor of the product, giving it a greatly superior and robust taste. Retention of the whey in this manner adds natural flavor without subjecting the product to large proportions of adulterating additives or heavy extraprocessing steps, and eliminates the pollution and economic loss resulting from whey separation in conventional cream cheese production. Further, the cream cheese product comprises live and active probiotic culture bacteria, which provide healthbenefits to the consumer. In one implementation, the cream cheese product comprises between about 10% and about 55% butterfat. In a further implementation, the cream cheese product comprises between about 33% and about 40% butterfat. In anotherimplementation, the cream cheese product comprises between about 17% and about 33% butterfat. In a further implementation, the cream cheese product comprises between about 10% and about 17% butterfat. In yet another embodiment according to the presentinvention, the cream cheese product further comprises between about 2% by weight and about 10% by weight of milk protein, more preferably between about 3% by weight and about 7% by weight of milk protein, and still more preferably about 4% by weight ofmilk protein. In another implementation, the cream cheese product comprises between about 0.05% and about 0.09% by weight of cholesterol; between about 0.2% by weight and 0.4% by weight of sodium; and between about 58% by weight and 63% by weight ofwater.

In one implementation, inulin is added to the cream cheese product. Inulin is a polysaccharide that is naturally found in many plants. Inulin has a mildly sweet taste and is filling like starchy foods, but is not normally absorbed in humanmetabolism and therefore does not affect the sugar cycle. Inulin reduces the body's need to produce insulin, helping to restore normal insulin levels. Inulin also is a probiotic that extends the viability of the live and active bacteria in thedigestive tract of the consumer, so that their beneficial effects in the body are increased. Inulin may, however, be implicated in food allergies, and can potentially induce anaphylactic shock in some people. Other non-digestible oligosaccharides andoligosaccharides resistant to metabolism, collectively referred to herein as "digestion-resistant polysaccharides", such as lactulose and lactitol, can also be used.

Various highly processed dairy derivatives have the potential for use in modifying the flavor and texture of the cream cheese products. These derivatives include, for example, milk protein concentrate, whole milk protein, whey proteinconcentrate, casein, Baker's cheese, yogurt powder and dry cottage cheese curd. Milk protein concentrate, for example, is produced by ultrafiltration of milk. Such materials can be added to the cream cheese product, or introduced during preparation ofthe product. However, their use is not preferred, and can by practice according to the present invention be minimized. Furthermore, addition of such agents generally is a poor substitute for the retention of whey from the milkfat fluid, as can beachieved in accordance with the present invention.

Syneresis leads to an unattractive and wasteful phase separation between curds and whey when milk is directly coagulated. In one embodiment according to the present invention, the cream cheese product exhibits substantially no syneresis, or lessthan about 1% syneresis by weight, after 15 hours at a temperature within a range of between about 74° F. to about 75° F.

The texture and consistency of the cream cheese product made in accordance with one implementation is the same as that of ordinary cream cheese. For example, the cream cheese product may have a viscosity within a range of between about 2,000,000centipoises and about 5,000,000 centipoises at a temperature of about 74° F. In another implementation, the cream cheese product has a viscosity within a range of between about 3,000,000 centipoises and about 4,000,000 centipoises at atemperature of about 74° F. Viscosity is conventionally measured, using, for example, a Brookfield viscometer. Viscosities as low as about 1,500,000 centipoises may also be acceptable.

In yet a further implementation, the consistency of the cream cheese product can be modified to yield a whipped, more easily spreadable product. Referring to FIG. 2, an exemplary process 200 for carrying out a whipping operation is shown. Theprocess begins with providing a cream cheese product at step 210, in accordance with the above teachings. At step 220, the cream cheese product is agitated in the presence of an inert gas at an elevated pressure. For example, the cream cheese productcan be passed through a confined space having an agitator, while being

81

simultaneously subjected to an inert gas at an elevated pressure.

In one implementation, the inert gas is provided at an initial pressure within a range of between about 150 PSI and about 240 PSI. In another implementation, the inert gas is provided at an initial pressure within a range of between about 220PSI and about 240 PSI. In yet a further implementation, the pressure of the inert gas is controlled throughout the agitator in order to expose the cream cheese product to a desired pressure for a defined time as it travels through the agitator. Inanother implementation, the inert gas is injected into the agitator at a chosen initial pressure, which is then permitted to dissipate in the region of the agitator. In one implementation, the cream cheese product is exposed to a desired pressure forbetween about 3 seconds and about 6 seconds. In an additional implementation, the cream cheese product is exposed to a desired pressure for between about 4 seconds and about 5 seconds. Although any inert gas can be used, nitrogen is the typical andmost practical choice. By "inert" is meant a gas that does not cause or at least minimizes undesirable effects on the cream cheese product, its production, and the consumer.

Injection of a gas into the cream cheese product under high pressure is problematic due to the extreme density mismatch of the gas and the cream cheese product. The gas diffuses into the cream cheese product. Diffusion of the gas throughout thebody of cream cheese product is not instantaneous even with agitation, effectively requiring a gas delivery pressure above and beyond that necessary for equalizing the prevailing pressure within the body of cream cheese product. This resistance to gasdispersion in the semi-solid cream cheese product can be ameliorated by employing an in-line gas injection system providing controllable gas injection pressure and desirably having a relatively large bore gas delivery orifice. A mass flow controllersuch as, for example, a GFC-171S mass flow controller commercially available from Aalborg Instruments & Controls, Inc., 20 Corporate Drive, Orangeburg, N.Y. 10962, can be used.

In one implementation, the temperature of the cream cheese product is reduced at step 240, and so maintained or further modified during step 220. For example, a scraped surface heat exchanger, such as a Waukesha Cherry-Burrell Thermutator.RTM. or Votator.RTM., can be used to provide the needed agitation while simultaneously controlling the temperature. In one implementation, the temperature of the cream cheese product is reduced to a suitable inert gas injection temperature at step 240, andis then so maintained or further reduced during step 220. This temperature reduction at step 240 increases retention of the inert gas in the cream cheese product during subsequent step 220. In the absence of such a temperature reduction beforeinjection of the inert gas, excessive escape of the inert gas from the cream cheese product prior to or during step 220 may retard the desired whipping process and result in a product having a less whipped texture than desired. In one implementation,the cream cheese product is cooled at step 240 to an inert gas injection temperature within a range of between about 65° F. and about 68° F., and agitation in the presence of the inert gas at an elevated pressure is then carried out at atemperature within a range of between about 58° F. and about 62° F. within the agitator at step 220. Using higher temperatures counteracts the effect of the pressurized gas in causing the cream cheese product to expand into whipped formand accordingly is to be avoided. If desired, however, the cream cheese product may in general be cooled to a whipping temperature within a range of between about 65° F. and about 90° F., and more desirably cooled at least to about80° F., at step 240. A temperature within a range of between about 58° F. and about 70° F., more desirably about 68° F. or lower, may then be employed within the agitator at step 220. Either or both of steps 240 and 220can include multiple cooling steps that reduce the cream cheese product temperature in a staged, controlled manner. This cooling can be carried out, for example, with a smooth and gradual temperature reduction or in discrete steps. In oneimplementation, step 240 is carried out immediately following completion of acidification in step 150.

The agitation within the scraped surface heat exchanger may be controlled to a desired level in order to maintain the cream cheese product within the exchanger for an adequate time for the pressurized inert gas to act on the product. The normaloperating speed of the agitator in a Waukesha Cherry-Burrell Thermutator.RTM. or Votator.RTM. may need to be reduced, for example to within a range of between about 800 and 1,000 revolutions per minute, in order to avoid excessive shear. In order tofacilitate further reduction of the temperature of the cream cheese product in the course of passage through the scraped surface heat exchanger, such exchanger is equipped to withdraw heat from the product, which is then dissipated in a suitable manner. In one implementation, two scraped surface heat exchangers are operated in series so that the cream cheese product is successively passed through both exchangers, which jointly cool and apply

82

pressurized inert gas to the cream cheese product. In anotherimplementation, a Terlotherm.RTM. vertical scraped surface heat exchanger is employed. Terlotherm.RTM. machinery is commercially available from Tenet USA, 6981 North Park Drive, East Bldg., Suite 201, Pennsauken, N.J. 08109.

The resulting product indicated at 230 is a whipped cream cheese product. The texture and consistency of the cream cheese product is the same as that of ordinary whipped cream cheese. In one implementation, the whipped cream cheese product mayhave a viscosity within a range of between about 500,000 centipoises and about 1,500,000 centipoises at a temperature of about 74° F.

Where it is desired to add solid adjuvants such as fruits, vegetables or nuts to the cream cheese product, they are desirably added after the whipping process is completed.

Example 1

A batch of 1,500 pounds of heavy cream having a butterfat content of 44% is pumped into a kettle equipped with a heater and an agitator. The butterfat content of the cream is then adjusted to 33% by weight by the addition with agitation of 195.8pounds of nonfat dry milk and 180 pounds of water. After 15 minutes of agitation, 9.01 pounds of K6B493 stabilizer is added to the cream with agitation to thicken the mixture. The mixture is then pasteurized by heating it to a temperature of about165° F. and maintaining that temperature for about 15 minutes. The mixture is then homogenized by subjecting the mixture to a pressure of about 3,000 PSI for about 5 seconds. The mixture is then cooled with agitation to 85° F.,whereupon 500 milligrams of pHage Control™ 604 cream cheese culture bacteria are added to the cream with agitation for 15 minutes. The mixture is then maintained at 85° F. for about 14 hours until a pH of about 4.5 is reached. The mixtureis then acidified to a pH of about 4.4 by addition of about 8 pounds of lactic acid. Sodium chloride in an amount of 11.4 pounds is added.

The resulting cream cheese product comprises about 33% by weight of butterfat; about 3.6% of protein; about 0.0813% by weight of cholesterol; and about 0.569% by weight of sodium. The cream cheese product comprises about 53% by weight of waterand about 47% by weight of solids. The cream cheese product has a viscosity of about 1,336,000 centipoises at a temperature of about 74° F.

Example 2

A batch of 1,335 pounds of heavy cream having a butterfat content of 44% is pumped into a kettle equipped with a heater and an agitator. The butterfat content of the cream is then adjusted to 23.5% by weight by the addition with agitation of 244pounds of nonfat dry milk and 765 pounds of water. After 15 minutes of agitation, 11.25 pounds of K6B493 stabilizer is added to the cream with agitation to thicken the mixture. The mixture is then pasteurized by heating it to a temperature of about165° F. and maintaining that temperature for about 15 minutes. The mixture is then homogenized by subjecting the mixture to a pressure of about 3,000 PSI for about 5 seconds. The mixture is cooled with agitation to 85° F., whereupon 500milligrams of pHage Control™ 604 cream cheese culture bacteria are added to the cream with agitation for 15 minutes. The mixture is then maintained at 85° F. about 14 hours until a pH of about 4.5 is reached. The mixture is then acidifiedto a pH of about 4.4 by addition of about 8 pounds of lactic acid. Sodium chloride in an amount of 13.68 pounds is added to the product.

The resulting light cream cheese product comprises about 24% by weight of butterfat; about 3.6% by weight of milk protein; about 0.0613% by weight of cholesterol; and about 0.569% by weight of sodium. The cream cheese product comprises about 62%by weight of water and about 38% by weight of solids. The cream cheese product has a viscosity of about 1,500,000 centipoises at a temperature of about 74° F. The cream cheese product yields less than about 1% syneresis by weight after 15 hoursat about 74° F. to about 75° F.

While the present invention has been disclosed in a presently preferred context, it will be recognized that the present teachings may be adapted to a variety of contexts consistent with this disclosure and the claims that follow. For example,the process shown in the figures and discussed above can be adapted in the spirit of the many optional parameters described, to yield a variety of cream cheese products.

83

he present invention generally relates to the cheese making art and, more particularly, to a method of improving the quality of cheese produced from a curd and whey mixture by monitoring coagulation and syneresis using a large field of viewsensor.

BACKGROUND OF THE INVENTION

The first major step in the cheese making process is the coagulation of the milk, such as by enzymatic hydrolysis of κ-casein. To achieve this end, enzyme extracts from calf stomachs, microbially produced enzymes, or other enzyme sourcesare utilized. The hydrolysis of κ-casein leads to destabilization of the colloidal system of the milk. This is followed by aggregation of the micelles into clusters. Over time, the clusters grow in size. This growth in size is followed bycross-linking between chains which eventually transform the milk into a gel or coagulum. Once a desired endpoint is reached in the coagulation process, the coagulum is "cut," for example by traversing with wire knives to slice the coagulum into cubes. Accurate prediction of the optimal cutting time is an important factor in consistent, batch-to-batch quality and moisture content in the final cheese product.

The second major step in cheese making is syneresis, which initiates immediately following the coagulum cutting step. Syneresis is the phase separation process in cheese making that follows the cutting of the milk coagulum into cubes. Syneresisis generally promoted by thermal and/or mechanical treatments (cutting), and also may be slightly influenced by use of additives such as calcium chloride. During syneresis, rearrangement of the casein network, which constitutes the gel matrix, causesthe shrinkage of the curd matrix and results in expulsion of whey from the curd grains, resulting in a solid:liquid mixture whose proportions change over time as syneresis endpoint nears.

Syneresis control influences cheese quality and yield as a result of its effects on moisture, mineral and lactose content of the curd. Syneresis also influences protein and fat losses in whey, which in turn affects cheese yield.

Curd syneresis is a kinetically complex process. Currently, there are no suitable techniques for reliably and reproducibly measuring syneresis as a means for studying and monitoring the syneresis process, particularly techniques adaptable toonline, automated monitoring systems. The majority of techniques can be classed as either separation or dilution methods. Each method presents unique drawbacks.

At present, in the cheese industry worldwide, syneresis is empirically controlled by vat temperature, milk pH, stirring speed and time, depending on cheese type and the cheese maker's preferences. Unfortunately, inadequate curd moisture controlresulting from such empirical process controls can lead to heterogeneous cheese ripening and quality, rather than providing homogenous conditions leading to a consistent end product from batch to batch. Better control of syneresis would give moreconsistent curd moisture content and pH, and more consistent curd concentration of minerals and lactose at the beginning of the curing process, resulting in a more homologous quality of product from batch to batch.

The present invention relates to a method of improving the quality of cheese produced from a curd and whey mixture. More specifically, the present method provides improved monitoring of both milk coagulation and curd syneresis during cheesemaking. Even more, the method and sensor are easily adapted for continuous, online monitoring of the cheese making process from initiation of coagulation to syneresis endpoint, and also prediction of endpoints for both processes, allowing better controlof the entire cheese making process to ensure moisture content consistency and better cheese quality.

SUMMARY OF THE INVENTION

In accordance with the foregoing need identified in the ale as described herein, in one aspect there is provided a method of improving quality of cheese produced from a milk batch, comprising the steps of impinging a light beam from an incidentlight source onto a surface of the milk batch, and optically detecting light backscattered from said milk batch during a coagulation process to collect light backscatter data. Those light backscatter data are correlated to an optimum cutting timewhereby a syneresis process is initiated. Next is the step of optically detecting light backscattered from a biphasic curd and whey mixture derived from that milk batch during the

84

syneresis process, and correlating that light backscatter data to anoptimum syneresis endpoint. The light backscatter data, optical parameters developed from analysis of the light backscatter data, and/or whey fat dilution may be correlated to at least one of said backscattered light data, optical parameters developedfrom analysis of the backscattered light data, and whey fat dilution to at least one of a milk protein %, a milk fat %, a milk total solids content, a milk processing temperature, a curd moisture content, a curd moisture change over time, whey fatcontent, a whey fat loss, and a final curd yield. Advantageously, the present method is predictive, not only of an optimal cutting time during a coagulation process, but also of an optimum syneresis endpoint after collection of light backscatter datafor about 15 minutes following the cutting step which initiates syneresis.

In one embodiment, the steps of impinging the light beam, optically detecting light backscattered from the milk batch during the coagulation process, and optically detecting light backscattered by the milk batch during the syneresis process areaccomplished by providing a light guide for guiding the light beam onto the milk batch surface, with the light guide having a diameter of about 0.2 inches, and providing a light collector for collecting backscattered light reflected from the milk batchsurface, with the light collector having a diameter of about 0.2 inches. The light guide and the light collector are separated by a distance of about 0.4 inches to about 0.6 inches. The light source may emit light at a wavelength of from about 950 nmto about 1000 nm. An optical detector receives light from the light collector for further processing.

In another aspect, there is provided a method of predicting an optimum endpoint for a syneresis process in a cheese making process. The method comprises impinging a light beam from an incident light source onto a surface of a biphasic curd andwhey mixture derived from a milk batch, and optically detecting light backscattered from said curd and whey mixture during the syneresis process. The collected light backscatter data are correlated to an optimum syneresis endpoint. Equations predictiveof the optimum syneresis endpoint are provided, which equations include parameters selected from at least one of a milk protein % parameter, a milk fat % parameter, a milk total solids content parameter, a milk processing temperature parameter, a curdmoisture content parameter, a curd moisture change over time parameter, a whey fat content parameter, a whey fat loss parameter, and a final curd yield parameter. A sensor is provided for accomplishing the method.

In the following description there are shown and described several different embodiments of this invention, simply by way of illustration of some of the modes best suited to carry out the invention. As it will be realized, the invention iscapable of other different embodiments and its several details are capable of modification in various, obvious aspects all without departing from the invention. Accordingly, the drawings and descriptions will be regarded as illustrative in nature andnot as restrictive. 

BRIEF DESCRIPTION OF THE DRAWINGS

The accompanying drawings incorporated herein and forming a part of the specification, illustrate several aspects of the present invention and together with the description serve to explain certain principles of the invention. In the drawings:

FIG. 1 schematically depicts a large field of view (LFV) sensor and optical configuration for monitoring coagulation and syneresis in a cheese making process;

FIG. 2 illustrates a representative LFV sensor response (average of 3 replicates) during coagulation and syneresis (temperature=32° C.; CaCl2=2 mM) at wavelengths between 900 and 1060 nm, with time measured from rennet addition(time=0 min);

FIGS. 3a and 3b illustrate light backscatter ratio profiles and their characteristic first and second derivatives versus time for the (a) LFV sensor and (b) CL sensor (temperature=32° C., β=2.5, CaCl2=2 mM));

FIG. 4 illustrates a representative LFV sensor response during coagulation and syneresis (temperature=32° C.; CaCl2=2 mM) at 980 nm; and

FIG. 5 compares predicted vs. measured curd moisture content obtained using a model set forth in the present description as Model V.

85

Reference will now be made in detail to the present preferred embodiments of the invention, examples of which are illustrated in the accompanying drawings.

DETAILED DESCRIPTION OF THE INVENTION

In accordance with the purposes of the present invention as described herein, a method is provided for improving the quality of cheese produced from a milk sample. The method comprises the steps of: (1) optically monitoring the milk during thecoagulation process; (2) optically monitoring the curd and whey mixture during the subsequent syneresis process; (3) predicting an optimal coagulum cutting time based on that coagulation monitoring; and (4) predicting an optimal syneresis endpoint basedon that syneresis monitoring in optional combination with that coagulation monitoring and also optionally with certain milk composition variables (e.g., milk fat, protein fat ratio, and the like) and operating parameters (e.g., temperature), therebyallowing maximizing of curd yield and minimizing whey fat loss. In this manner, such optical monitoring steps allow production of a cheese curd with a consistent moisture content, batch to batch. The monitoring step includes directing light from alarge field of view sensor 10 onto a surface of the milk or curd and whey mixture, in accordance with whether milk coagulation or curd syneresis is being monitored during the cheese making process, and detecting light backscattered from that surface.

EXAMPLE 1

As shown schematically in FIG. 1, a large field of view (LFV) sensor 10 was provided having a light source 20 (in the depicted embodiment, a tungsten halogen light source having a spectral range of 360-2000 nm). The light source 20 is powered bya power supply 21.

Light from the light source 20 was directed through a light guide 22, in the depicted embodiment an optical fiber, and optionally through a vertical polarizing plate 24, and a large-diameter glass window 26 to impinge on a milk sample 25. Thelarge-diameter glass window 26 allowed scattered light to be collected from a large area. An optional second polarizing plate 28 allowed selective detection of horizontally polarized light. Collected backscattered light was transmitted through a lightcollector 30 (in the depicted embodiment, a second optical fiber), a SMA connector 32, and a fiber optic cable 34 (~800 μm diameter fiber optic cable; Spectran Specialty Optics, Avon, Conn., USA) to the master unit of a dual miniature fiberoptic spectrometer 38 (model SD2000, Ocean Optics, Inc., Dunedin, Fla., USA).

In the depicted embodiment, near-infrared light was impinged on a milk sample to be monitored at a wavelength of from about 970 nm to about 990 nm (average of 980 nm). First (light transmitting) and second (backscattered light collecting)optical fibers 22, 30 were provided having 0.200 inch diameters, with first and second optical fibers 92, 30 being spaced 0.516 inches apart (centerline to centerline), facilitating transmission of light. This was hypothesized to be important,particularly during syneresis, due to progressively decreasing light backscatter from the curd:whey mixture over time. Thus, an increased transmission/collection area was evaluated to compensate for the decreasing signal during syneresis.

The spectrometer 38 master unit had a 25 μm slit, a 300 lines mm-1 diffraction grating with a range of 300-2000 nm and a detection bandwidth of 200 to 1100 nm. The unit was equipped with a 2048-pixel linear CCD-array silicon detector(Sony ILX 511, Tokyo, Japan) with a response range of 200 to 1100 nm and a sensitivity of 86 photons per count at 1 s integration time. Spectra were collected over the range 300 nm to 1100 nm with a resolution of 0.7 μm.

Light emerging from the fiber optic cable was processed in the spectrometer and data were transferred to a computer 40 through an A/D converter. The integration time was set to 7 s by the computer 40 software (OOIBase, Version 1.5, Ocean Optics,Inc.). Each spectral scan was automatically processed by subtracting the dark background spectral scan. Each spectral scan was reduced to 38 averages by dividing them into 20 nm wavebands with mid-wavelengths of 340+20n (1≤n≤38) giving 38wavebands in the range (360-1100 nm) and averaging the optical response for the wavelengths constituting each waveband. The voltage readings (sensor output) for the first min of data were averaged within each waveband to calculate the initial voltageresponse, V0. The voltage intensity at every waveband, V was divided by its corresponding V0 to obtain the light backscatter ratio, R. The first derivative, R' of the light backscatter ratio profile was calculated by conducting linearleast-squares regression on the most recently collected 4 min of data, if t*max was ≤8 min or the most recently collected 5 min of data, if t*max was >8 min. This was because the sensor response at

86

low milk temperatures, i.e. thoseexperiments with t*max>8 min, contained a greater degree of noise and a 5 min interval was required to smooth the R' profile. The calculated slope was assigned to the midpoint of the data subset used. The second derivative (R'') was calculatedin a similar manner but using 60 data points to smooth the R'' profile.

As shown in FIG. 1, the sensor 10 of the present invention was adapted to be secured to a suitable cheese making vessel, such as via a port traversing a portion of a cheese making vat wall 42. Conveniently, this provided a mechanism whereby thecheese making process could be monitored intermittently or continuously for a portion or an entirety thereof. Thus, the method and LFV sensor 10 of the present invention may be adapted for continuous, online monitoring of the cheese making process toallow monitoring and control of both the coagulation and syneresis processes from start to finish.

EXAMPLE 2

Milk coagulation tests were conducted over a broad range of conditions typically used in the cheese making industry. A three-factor, filly randomized, spherical, central composite design (CCD) was employed to evaluate the response of theproposed syneresis sensor prototype over a wide range of coagulation and syneresis rates. The CCD consisted of a 2k factorial (k=3) with 2k axial points and six center points (i.e., 20 runs in total) and was carried out in triplicate. The threefactors selected as independent variables were coagulation temperature (T), calcium chloride (CaCl2) addition level (CCAL) and cutting time (tcut). The experimental factors, their selected levels and coded values are presented in Table 1.

TABLE-US-00001 TABLE 1 The experimental factors and levels employed in the central composite rotatable experimental design Factors Temperature Added CaCl2 Cutting time (β) (Coded value) (° C.) (mM) (dimensionless)a -1.68223.6 0.318 1.32 -1 27.0 1.00 1.80 0 32.0 2.00 2.50 1 37.0 3.00 3.20 1.682 40.4 3.68 3.68 aExperimental cutting time levels were selected as β t*max, where t*max was the time from enzyme addition to the inflection point of the lightbackscatter profile obtained using a CoAguLite ™ sensor.

Unpasteurized and unhomogenized milk was obtained from a local milk processing plant. Milk was pasteurized at 65° C. for 30 min and rapidly cooled to 2° C. A 40 mL sample of milk was removed for compositional analysis, using aMilkoScan FT 120 (Foss Electric, Denmark), and a further 7.20 kg of the milk was weighed for use in each experiment. CaCl2 at the required level was added to the 7.20 kg of milk and stirred for 3 min then left to equilibrate for 30 min in a coldroom at 2° C. Milk was adjusted in the cold room to a pH of 6.51 using an experimentally obtained linear regression between 1.0 M HCl and pH to determine the volume of acid to add. The milk was stored in the cold room overnight. Milk pHadjustment after CaCl2 addition ensured that any observed effect of calcium level on dependent variables was not due to an indirect effect of CaCl2 on milk pH.

On the day of coagulation trials the milk was adjusted to a final pH of 6.5 at 2° C. using 1.0 M HCl. A constant dilution rate was assured by adding de-ionized water for a total added volume of HCl plus de-ionized water of 60 mL. Milkwas slowly heated to the coagulation temperature ±0.15° C., to minimize the impact of the temperature change on casein micelle equilibrium. Seven kg of the heated milk were added to the vat and left to equilibrate until thermal equilibriumwas achieved. Coagulation temperature was controlled using a single jacket cheese vat supplied with temperature controlled water through a copper-coil connected to a water bath having a control accuracy of ±0.01° C. (Lauda, RM 20, BrinkmanInstrument Inc., Westbury, N.Y., USA). Milk temperature was measured with a precision thermistor (model 5831 A, Omega Engineering, Stanford, Conn., resolution ±0.01° C.; accuracy ±0.2° C.). The enzyme used for milk coagulation waschymosin (CHY-MAX.RTM. Extra; EC 3.4.23.4 isozyme B, 643 IMCU mL-1; Chr. Hansen Inc., Milwaukee, Wis., USA). Once thermal equilibrium was achieved Chymosin was added to the milk in the vat at a level of 0.06 mL kg -1 milk. Data acquisitionfor optical sensors commenced upon addition of the enzyme i.e. time tc(0).

A CoAguLite™ (CL) sensor (Model 5, Reflectronics Inc., Lexington, Ky., USA; U.S. Pat. No. 5,172,193) was employed to select the different experimental levels of cutting time during coagulation, and also as a reference light backscattersensor to which the signal from the LFV (Example 1) could be compared. This sensor transmitted near infrared light at 880 nm through two 600 μm diameter fibers. One fiber transmitted infrared radiation into the milk sample while the other fibertransmitted the radiation scattered by the milk particles to a silicon photo-detector. For calibration, the CL sensor was zeroed by excluding light and adjusting the output voltage to 1 V. The sensor gain was

87

calibrated to give a 2 V signal responsewhen placed in the milk sample. Response data were collected every 6 s. It is noted that parameters in the text and or tables herein superscripted with an asterisk denote that they were calculated from the CL sensor response, as differentiated fromthose obtained from the LFV sensor. The initial voltage response (V*0) was calculated by averaging the first ten data points after correction for the 1 V offset. A light backscatter ratio (R*) was calculated by dividing the sensor output voltageat any time (less the 1 V output) by V*0. The first derivative (R'*) of the light backscatter ratio profile was calculated by conducting linear least-squares regression on the most recently collected 4 min of data. The calculated slope wasassigned to the midpoint of the data subset used. The second derivative (R''*) was calculated in a similar manner but using 60 data points to smooth the R''* profile.

Light backscatter response from both sensors was continuously monitored from the time of rennet addition (tc0) to the end of syneresis (ts85). Experimental cutting time levels were selected by light backscatter measurements using theCL sensor as described below. The CL sensor also provided a reference light backscatter measurement to which the LFV sensor response could be compared in order to determine the LFV sensors ability to monitor coagulation and syneresis. A number of lightbackscatter parameters were derived from both the LFV and CL sensor response during coagulation and syneresis. The light backscatter parameters are defined in Table 2. The optical parameters derived from the light backscatter profiles duringcoagulation can be classified as time-based, response-based or mixed-based parameters (Table 2).

TABLE-US-00002 TABLE 2 Definition of optical parameters derived from the light backscatter ratio profiles during coagulation and syneresis. Parameter Units Definitiona tmaxmin Time to the first maximum of R' tcut min Time to gelcutting t2max min Time to the first maximum of R'' t2min min Time to the first minimum of R'' Rmax dimensionless Value of R at tmax R2max dimensionless Value of R at t2max R2min dimensionless Value of R at t2minRcut dimensionless Value of R at tcut R'max min-1 Value of R' at tmax R''max min-2Value of R'' at tmax ΔRcoag Percent (%) Percent increase in R from tc(o) to tc(cut) ΔRsyn Percent(%) Percent decrease in R from ts(o) to ts(85) aR = light backscatter ratio; R' = 1stderivative of the light backscatter ratio R'' = 2nd derivative light backscatter ratio; tc(o) = time of enzyme addition; tc(cut) =end of coagulation; ts(o) = start of syneresis. ts(85) = end of syneresis.

Experimental cutting times used in each experiment were selected based on measurements of light backscatter using the CL sensor. The CL sensor gave a real time target value for tcut for each experiment using the following predictionequation: t*cut=βt*max (1) where t*max was the first maximum of R'*max, and β was a constant. A number of different β values (1.3, 1.8, 9.5, 3.2, and 3.7) obtained in compliance with the experimental design shown inTable 1 were used to establish the range of target t*cut values for the experiment.

When optimum cutting time was indicated by the CL data acquisition software, the gel was cut by pushing a cutting knife vertically through the gel. This cut the gel into prismatic columns. The knife was then rotated once ensuring all the gelwas cut into cubes of approximately 1 cm3. The last recorded time point prior to cutting is designated tc(cut), with the next time point defined as the start of the syneresis process (ts(0)), The curd was left to heal for 4.5 min beforestirring at 10±0.02 rpm was initiated (Servodyne mixer 50003-10, Cole Parmer Instrument Co. IL, USA). The stirring process continued at this speed up to 85 min (ts(85)).

Sampling and compositional analysis of curd and whey was carried out using reported procedures [Fagan, C. C.; Leedy, M.; Castillo, M.; Payne, F. A.; O'Donnell, C. P.; O'Callaghan, D. J., Development of a light scatter sensor technology foron-line monitoring of milk coagulation and whey separation. J. Food Eng. 83 (2007): 61-67]. Samples of curd and whey were removed for compositional analysis at ts(5) and every 10 min thereafter up to ts(85) (i.e. 9 samples). Curd and wheywas separated using a sieve (75 μm pore size). 3 g of curd and 5 g of whey were weighed into dishes using an analytical balance. The dishes were dried in a convection oven at 102° C., until they reached a constant weight (~15 h). Samples were analyzed in triplicate. Chemical composition of whey was also determined using the MilkoScan FT120. Compositional analysis of the milk showed that there were minimal differences between batches. The average composition of the milk ± the standard deviation (SD) was 3.7±0.3%, 3.5±0.1% and 12.2±0.3% for fat, protein and total solids contents respectively.

A number of authors have observed that during syneresis, whey separation and curd shrinkage followed first order kinetics. Therefore the following first order equation was fitted to the curd moisture experimental data during syneresis:CMt=CM.sub.∞+(CM0-CM.sub.∞)e-k.sup.CM.sup.t (2) where CMt was the curd moisture (%) at time t (min), CM∞represented the curd moisture (%) at an infinite time, CM0 was

88

the curd moisture content (%) at thebeginning of syneresis, ts(0), i.e. the milk moisture content, and kCM was the kinetic rate constant (min-1) for curd moisture content changes during syneresis. Procedure NLIN in SAS was used to determine the parameters CM∞ and kCM, while CM0 was set at the known value for the milk moisture content in each experiment.

Whey fat concentration in the vat has been found to follow a first order response. Similarly, temperature affects whey fat release during syneresis. At temperatures below 37° C. whey fat concentration decreased during syneresis, but at37° C. or higher whey fat concentration increased during syneresis. Therefore two equations were required to characterize the change in whey fat concentration during syneresis. At temperatures below 37° C. whey fat concentration wasfitted to a first order decreasing equation: WFt=WF.sub.∞+(WF5-WF.sub.∞)e-k.sup.WF.sup.t, (3) while at temperatures of 37° C. or higher a first order increasing equation was used:WFt=WF.sub.5+(WF∞-WF.sub.5)(1-e-k.sup.WF.sup.t), (4) where WFT was the whey fat concentration (%) at time t (min), WF∞ represented the whey fat content (%) at an infinite time, WF5 was the whey fat content (%)five minutes after cutting time, ts(5), and kWF was the kinetic rate constant (min-1) for whey fat concentration changes during syneresis (using the term whey fat dilution to describe the changes of whey fat concentration duringsyneresis). Procedure NLIN was used to predict the parameters WF∞, WF5 and kWF.

It was expected that for the signal from the LFV sensor to be related to curd moisture or whey fat concentration or both, the signal should follow first order kinetics for most conditions, except for high temperature conditions, where the signalmay reflect the particular effect of temperature on whey fat content. Therefore the LFV sensor response during syneresis was also fitted to a first order equation as follows: Rt=R.sub.∞+(R0-R.sub.∞)e-k.sup.LFV.sup.t, (5) whereRt was the light backscatter ratio at time t (min), R∞represented the light backscatter ratio at an infinite time, R0 was the light backscatter ratio at ts(0), and kLFV was the kinetic rate constant (min-1) for theLFV sensor response during syneresis. Procedure NLIN was used to predict the parameters R∞, R0 and kLFV.

A typical light backscatter profile derived from the LFV sensor during coagulation and syneresis at wavelengths between 900 and 1060 nm is shown in FIG. 2. Enzyme was added at time zero and the light backscatter ratio (ratio of light backscattersensor signal to light backscatter sensor signal at time zero) was calculated. The coagulation phase ended and the syneresis phase began at a process time in the range 10 to 50 min (~18 minutes in FIG. 4) when the gel was cut. During coagulationthe light backscatter ratio increased, and the LFV sensor response was greatest at 980 nm as indicated by the peak at this wavelength observed throughout coagulation (FIG. 2). With the onset of syneresis following cutting of the gel, the signaldecreased exponentially over time. FIG. 2 also shows that the LFV sensor response during syneresis was further characterized by a valley at 980 nm. This trend, of a maximum increase during coagulation and the maximum decrease during syneresis at 980nm, was consistently observed for all experimental conditions. For all conditions the average increase during coagulation at 980 nm was 20.5±5.8% (mean±SD), while during syneresis the average decrease was 59.4±12.0% (mean±SD). Generally theLFV sensor signal also incorporated less noise at 980 nm than at other wavelengths. On this basis the following analysis of the LFV sensor response has been carried out at 980 nm.

In order to determine if the LFV sensor was comparable to the CL sensor for monitoring coagulation, optical parameters, as defined in Table 2, were derived from the LFV and CL light backscatter ratio profiles during coagulation. FIG. 3 shows theLFV and CL response to coagulation and their respective derivatives. It is clear the LFV sensor response contains a high degree of scatter, which could present a difficulty in calculating important parameters such as tmax. Despite the degree ofnoise in the light backscatter ratio, R, it was still possible to successfully calculate R' and R'' and derive the same time, response, and mixed based parameters that were derived from the CL sensor response and which can be used to characterizecoagulation. Correlations between the CL and LFV derived parameters are shown in Table 3.

TABLE-US-00003 TABLE 3 Pearson correlation coefficients (r) and significancea between parameters derived from the LFV and CL sensors coagulation profile. t2max t2minRmax R'max t*max t*2max t*- 2minR*max R'*max tmax 0.97*** 0.98*** -0.41** -0.89*** 0.99*** 0.99*** 0.99*** -0.76**- * -0.89*** t2max 1 0.96*** -0.44*** -0.89*** 0.97*** 0.96*** 0.97*** -0.76*** -0- .90*** t2min 1 -0.38** -0.83*** 0.99*** 0.97*** 0.99***-0.68*** -0.83*** Rmax 1 0.63*** -0.46*** -0.47*** -0.46*** 0.63*** 0.62*** R'max 1 -0.89*** -0.92*** -0.89*** 0.89*** 0.97*** t*max 1 0.99*** 1.00*** -0.76*** -0.89*** t*2max 1 0.99*** -0.79*** -0.92*** t*2min 1 -0.76*** 0.90***R*max 1 0.94*** aSignificance: ***P < 0.001; **P < 0.01; N = 60.

These results demonstrate the close relationship between the CL and LFV derived parameters

89

obtained during milk coagulation. All LFV derived parameters were significantly correlated with CL derived parameters. In particular the LFV parameters,tmax, t2max, t2min, and R'max were very significantly correlated with their CL derived counterparts (correlation coefficient (r)=0.99-0.96, P≤0.001). Considering the level of scattering in R the correlation between Rmaxand R*max are still reasonable and significant (r=0.63, P<0.001). The parameters tmax, R'max were dependent on coagulation rate and, as expected, were found to be significantly and negatively correlated (r=-0.89, P<0.001).

These results showed also that the LFV sensor, which has a wider field of view, is sensitive, like the CL sensor, to both aggregation of casein micelles and the development of curd firmness. Therefore the LFV sensor can monitor milk coagulationand predict optimal gel cutting time at least as well as already-proven technology (the CL sensor).

The light backscatter ratio during the milk coagulation step contained three phases: latent, sigmoidal, and exponential. These are substantially as described in U.S. Pat. No. 5,172,193 to Payne et al. The parameters obtained from the lightbackscatter profile during the coagulation step are shown in FIG. 3, and defined as follows: tmax=the time between adding the enzyme and the occurrence of the maximum rate of change in the light backscatter ratio, minutes, Rmax=value of R attmax, dimensionless, ΔRcoag=increasein R during milk coagulation, percent, R'=the slope of R with respect to time, min-1, R'max=value of R' at tmax, min-1. The light backscatter ratio during the coagulation phase wasmeasured between 400 and 1200 nm for the test conducted. The increase in light backscatter ratio, ΔRcoag, was found to be maximal at 980 nm. The average increase was 20.5±5.8%. Accordingly, subsequent experiments were conducted usinglight emitted at 980 nm.

The syneresis phase starts with the gel cutting (process time of ~18 minutes, light emitted at 980 nm; see FIG. 4). The light backscatter ratio, R, decreased exponentially with time following gel cutting and was described by the followingequation: Rt=R.sub.∞+(R0-R.sub.∞)e-kt (6) where R0=light backscatter ratio at time zero for the syneresis step (when the gel is cut syneresis time is zero), dimensionless, Rt=light backscatter ratio at time t aftergel cutting, dimensionless, R∞=light backscatter ratio at an infinite time after gel cutting, dimensionless t=time, min, k=kinetic rate constant estimated from the light backscatter sensor response for the syneresis phase, min-1.

The decrease in light backscatter ratio during curd syneresis, ΔRsyn (% decrease in R), was found to be a maximum for infrared light at a wavelength of 980 nm (FIG. 4). The average ΔRsyn value was 59.4±12.0%. Theobservation of a maximum increase during coagulation and the maximum decrease during syneresis was consistently observed at 980 nm for all experimental conditions tested.

It was observed that the changes in R during syneresis were a response to curd shrinkage or compositional changes in whey fat content and followed a first order reaction. The experimental data were fitted with a first order equation formodelling the changes in curd moisture, whey fat concentration, and light backscatter ratio. The following rate constants were determined: k=kinetic rate constant estimated from the light backscatter sensor response for the syneresis phase, min -

1,kCM=kinetic rate constant estimated from the curd moisture changes during the syneresis phase, min-1, kIVF=kinetic rate constant estimated from the whey fat changes during the syneresis phase, min-1.

Regression analysis showed that the changes in these three variables during syneresis followed first order kinetics. The optically derived kinetic rate constant, k, was found to be significantly related to both coagulation and syneresisparameters, but most importantly, k was significantly and positively correlated with kCM (P<0.001, r=0.84) and kWF(P<0.01, r=0.42). These results indicated that the response of the LFV sensor during syneresis was related to changes incurd moisture content and whey fat content. These data confirmed that LFV sensor response (via the optically derived kinetic rate constant, k) could be used for monitoring syneresis and predict changes in curd moisture and whey fat content. Inaddition, since kCM and kWF are correlated the measurement of the kinetics of whey fat dilution may also be used to monitor syneresis and predict changes in curd moisture content. Thus, fat globule dilution was factored in as a natural tracerof syneresis.

During a syneresis process the value of k needs to be determined as early as possible to allow time for endpoint prediction. This is because the endpoint of syneresis occurs at the desired curd moisture content. To achieve this earlydetermination, the first order equation (Eqn. 5 above) was fit to the first 15 minutes of light backscatter data collected after gel cutting to give the kinetic constant k15. Advantageously, this allowed utilizing the method of the presentinvention to provide a prediction of the syneresis endpoint after only 15 minutes into the syneresis process step.

90

Fat losses in the whey, final curd moisture content and final curd yield are important cheese making measurements that significantly impact on final product quality. These measurements were predicted using parameters generated from the lightbackscatter profiles (tmax, R0, R∞, k15), the properties of the milk (P, F, TS, FP), and the operating conditions (T), where: T=temperature (° C.) P=milk protein (%) F=milk fat (%) FP=milk fat to protein ratio,dimensionless TS=milk total solids (%) βi=regression coefficients The best models for prediction of total whey fat losses (WF) final curd yield on a wet basis (CY), final curd moisture content (CM) at the end of the process (t=85 min) and forestimation of the kinetic rate constant for curd moisture changes during syneresis (kCM), using LFV light backscatter parameters, are shown in Table 4.

TABLE-US-00004 TABLE 4 Models for prediction of total whey fat losses, final curd yield, final curd moisture content and the kinetic rate constant for curd moisture changes during syneresis using LFV light backscatter parameters. Model R2SEP I WF = β0 + β1T + β2 T2 + β3P + β4R.sub.∞ 0.93 2.646 g II CY = β0 + β1 T + β2 T2 + β3TS + β4R.sub.0 0.90 0.950% III CM = β0+ β1 T + β2 tmax + β3F + β4FP 0.94 1.456% IV kCM = β0 + β1 T2 + β2 tmax + β3k.sub.15 0.52 0.031 min-1

A curd moisture content prediction model was developed to predict curd moisture during syneresis as a function of time by using a combination of milk temperature, milk composition parameters and LFV dependent variables (tmax, R∞,R0, and k15). The curd moisture prediction model was: CM(t)=CM∞+

(CM0-CM.sub.∞)exp(-kCMt) (7) where CM0=curd moisture content (%) at the beginning of syneresis. This is the moisture content of milk and a knownparameter, CM(t)=curd moisture (%) during syneresis at time t after gel cutting (min), CM∞=curd moisture (%) at an infinite time, kCM=kinetic rate constant (min-1) for curd moisture content changes during syneresis.

The two unknowns in equation 6 are CM∞ and kCM. The value for kCM was determined using Model IV (Table 4). The value of CM∞ was estimated using Model III (Table 4). These substitutions into equation 7 defineda curd moisture content prediction model (Model V) which was: CM(t)=β0+β.sub.1T+β.sub.2t.sub.max+β.sub.3F+.bet-a.4FP+(CM0-(β0+β.sub.1T+β.sub.2t.sub.max+.be-ta.3F+β.sub.4FP))exp((-β5T

2+β6t.sub.max- +

β7k.sub.15)t) (8) The prediction of curd moisture content as a function of time was then possible by fitting this Model V to the curd moisture content data collectedduring the testing. The observed and predicted curd moisture contents are shown in FIG. 5. This model had an R2 of 0.95 and an SEP of 1.72%. The prediction used 540 data points within a wide range of moisture contents from 50 to 90%.

The skilled artisan will readily appreciate that all the predictors used in models I to IV and those used in model V are known as early as 15 min after cutting the gel. Accordingly, the present invention provides a real time model to predictcurd moisture as a function of time after k15 is determined. In this fashion, syneresis endpoint, that is, the desired curd moisture content in accordance with the type of cheese being made, can be accurately predicted and the syneresis phase ofthe cheese making process optimized.

The processes of coagulation and syneresis during cheese making can therefore be monitored, endpoints predicted, and controlled using the present technology, that is, using a single sensor and method. The LFV sensor technology offers potentialfor in-vat control of both the milk coagulation and syneresis steps in cheese making in a stirred cheese vat. Thus, the present method allows precise prediction, using the same optical technology, of both optimal milk coagulum cutting time and curdsyneresis endpoint and therefore optimization of curd moisture content. Using the present method, both optimal cutting time control and the syneresis endpoint control based on desired curd moisture content may be established by in-line monitoring duringthe cheese making process, allowing the process to be substantially automated. That is, by use of the present technology, it is now possible to monitor and optimise processing parameters, using the same monitoring technology, in a mixture that variesfrom a substantially homogenous dispersion (milk) to a biphasic mixture comprising a solid and a liquid (the curd and whey mixture) which is constantly changing in moisture, solid:liquid ratio, and optical parameters. A simple, reliable method isthereby provided for optimizing cheese making parameters during the first, critical stages of the cheese making process. Information gathered during the practice of the process of the present invention, including whey fat concentration and cheese yield,will also allow the cheese making process to be optimized based on economics.

The present method is applicable to the making of low, medium, and high moisture cheeses. Further, the method provides cost savings in that the cheese producer is provided a mechanism to avoid unnecessary syneresis processing in the cheesemaking vat, and also allowing the cheese maker to alter curd size as milk solid content changes during the course of a year. Still further, the method of

91

the present invention allows real-time in-line monitoring of, and on-site application of oradjustment to, necessary process changes in the cheese making process to obtain a predetermined curd moisture content even if starter culture inhibition occurs, such as from bacteriophage infection or agglutination problems. By use of the method of thepresent invention, comprehensive process control of cheese making in the vat, and for predicting curd moisture content, is provided.

The foregoing description of preferred embodiments has been presented for purposes of illustration and description. It is not intended to be exhaustive or limiting to the invention to the precise forms disclosed. Obvious modifications orvariations are possible in light of the above teachings. The embodiments were chosen and described to provide the best illustration of the principles described herein and their practical application to thereby enable one of ordinary skill in the art toutilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated. All such modifications and variations are within the scope of the invention as determined by the appended claims wheninterpreted in accordance with the breadth to which they are fairly, legally and equitably entitled. All patents, patent applications, and non-patent references cited in the present disclosure are incorporated into the present disclosure in theirentirety by reference. DescriptionMilk broadly consists of lipid, lactose and protein. The protein fraction iscomprised of two general classes--soluble lactoalbumins and the dispersed phase micelle of casein. Casein is a remarkable protein in that it readily undergoes coagulative denaturation under acidic conditions or by action of certain proteinasesdesignated as rennets. The resulting curd is then manipulated to form cheeses and other fermented milk foods.

Ads by GoogleParticle Size Measurementwww.Dispersion.com  Concentrated system. No dilution. Zeta potential optional. Titration

Milk is readily fractionated into lipid and nonlipid fractions. The latter fraction can be dried into a shelf-stable powder designated nonfat dry milk (NFDM). Likewise the whey byproduct of cheese manufacture is readily dried into a stablepowder. Both products are used extensively as functional ingredients in many food products. In general milk and derived milk products are bought and sold on the basis of milk solids content. Most processed milk products have standards of identitydefining the moisture and solids content. In this regard milk solids content is highly variable--for example yogurt is approximately 10% solids and romano cheese approximately 77% solids. Hence yield is highly correlated with recovered milk solids andany method that recovers traditionally lost milk solids into the final product could have substantial economic impact. In the case of cheese, whey solids represent unrecovered material.

With the advent of consumer demand for reduced calorie and no fat variants of standardized products, increased moisture incorporation to reduce caloric density and partially replace lipids is an area of considerable interest. For suchnonstandardized dairy products yield is still indexed to recovered milk solids but additionally is leveraged by increased moisture content; every additional pound of moisture incorporated into the finished product results in a net one pound gain ofproduct. Hence yield enhancement for these products is a combination of milk solids recovery and moisture incorporation, provided a product with satisfactory organoleptic quality can be achieved.

For purposes of describing this invention, yield enhancement or improvement refers to the incremental increase in the amount of recovered product versus a control experiment. The incremental increase will result from a combination of additionalincorporated milk solids and moisture.

The dairy industry has long been concerned with yield improvement (see for example "Factors Affecting the Yield of Cheese" published by the International Dairy Federation (Brussels, Belgium) 197p, 1991 and "Cheese Yield and Factors Affecting ItsControl" IDF (Brussels, Belgium) 540p, 1994). With the exception of products such as yogurt and buttermilk where the entire milk base is conserved, substantial losses of milk solids occur in the whey. Whey solids frequently represent a co-productliability as their cost of recovery matches or exceeds their market value. A method of incorporating more whey solids into fermented dairy products would not only enhance recovered product yield, but could materially contribute to a reduction in wheydischarge.

It has now been found that certain forms of cellulose designated structurally expanded celluloses (SEC) which are described below, have the unexpected effect of dramatically increasing curd yield when incorporated into skim or full fat milk. TheSEC appears to become intimately incorporated into the caseinate gel structure early on reducing the rate and extent of syneresis characteristic of caseinate curds. The result

92

is that more whey and whey protein solids are incorporated into the curdstructure and carried into the low pH cooking environment. Depending on the product, it has been found that much more moisture is retained in mechanically dewatered curds. Insofar as is known, it has not previously been proposed to use SEC in the artof making cheese and fermented milk products.

In order to appropriately define and distinguish structurally expanded cellulose, SEC, from other forms of cellulose and hydrocolloidal polymers and gums mentioned herein, it is necessary to briefly examine cellulose structure and methods ofmanipulation. For example powdered cellulose is known in the art of cheese manufacture as an anticaking agent for ground cheese products. Carboxymethyl cellulose and other cellulose ethers have been considered as useful additives to enhance texture oflow-fat skim and processed cheese products. Hence differentiation of SEC from other types of "cellulose" known in the art of cheese manufacture is important for distinguishing SEC from prior art.

In chemical terms cellulose specifically designates a class of plant derived linear, glucose homopolysaccharides with B 1-4 glycosyl linkage. It is the dominant structural polysaccharide found in plants and hence the most abundant polymer known. The function of cellulose is to provide the structural basis for the supramolecular ensemble forming the primary wall of the plant cell. Differentiation and aggregation at the cellular level are highly correlated with cellulose biosynthesis andassembly. In combination with lignin, heteropolysaccharides such as pectin and hemicelluloses and proteins, the cellulosic containing primary cell wall defines the shape and spatial dimensions of the plant cell. Therefore cellulose is intimatelyinvolved in tissue and organelle specialization associated with plant derived matter. Over time the term "cellulose substance" or simply "cellulose" has evolved as a common commercial describer for numerous non-vegetative plant derived substances whoseonly commonality is that they contain large amounts of B 1-4 linked glucan. Commercially, combinations of mechanical, hydrothermal and chemical processing have been employed to enrich or refine the B 1-4 glucan content to various degrees for specificpurposes. However, only highly refined celluloses are useful substrates for structural expansion. Examples of highly refined celluloses are those employed as chemical grade pulps derived from wood or cotton linters. Other refined celluloses are papergrade pulps and products used in food. The latter are typically derived from nonwoody plant tissues such as stems, stalks and seed hulls.

Refined cellulose can be considered a supramolecular structure. At the primary level of structure is the B 1-4 glucan chain. All cellulose is similar at this level. Manipulation at this level would by necessity involve chemical modificationsuch as hydrolysis or substitution on the glycosyl moiety. However, as outlined next this level of structure does not exist as an isolated state in other than special solvent systems which are able to compete with extremely favorable intermolecularenergies formed between self associating B 1-4 glucan chains.

In contrast to primary structure, a stable secondary level of structure is formed from the nascent B 1-4 glucan chains that spontaneously assemble into rodlike arrays or threads, which are designated the microfibril. The number of chainsinvolved is believed to vary from 20 to 100. The dimension of the microfibril is under the control of genetic expression and hence cellulose differentiation begins at this level. Pure mechanical manipulation is not normally practiced at this level oforganization. However, reversible chemical modification is the basis for commercial production of reconstituted forms of cellulose fibers such as rayon. Chemical substitution by alkylation of the glycosyl moiety yields stable ether substituted B 1-4glycans which no longer self assemble. This reaction forms the basis for the production of commercial forms of cellulose ethers such as carboxymethyl (CMC), hydroxyethyl (HEC), hydroxypropyl (HPC) and methyl or ethyl (MC & EC) cellulose. One furthermodification at the secondary structural level involves intensive acid hydrolysis followed by application of high shear to produce colloidal forms of microcrystalline cellulose (MCC). This modification is best deferred to the next level of structure asmost forms of MCC are partially degraded microfibril aggregates.

The third level of cellulose structure is that produced by the assemblage of microfibrils into arrays and ribbon like structures to form the primary cell wall. As in the case of secondary structure, tertiary structure is under genetic controlbut additionally reflects cellular differentiation. It is at this level that other structural polymeric and oligomeric entities such as lignin and proteins are incorporated into the evolving structure. Selective hydrolytic epolymerization and removalof the non-cellulose components combined with application of sufficient shear results in individually dispersed cellular shells consisting of the cellulosic skeletal matrix. With the removal of strong chemically and physically associated polymericmoieties which strengthen the cellulose motif, structural expansion by mechanical translation and translocation of substructural elements of cellulose can begin to occur.

The process by which structural expansion occurs is that of rapid anisotropic application of mechanical

93

shear to a dispersed phase. Particles of refined cellulose, consisting of cellular fragments, individual cells or aggregates of a few cells,are dispersed in a liquid. The continuous liquid phase serves as the energy transduction medium and excess enthalpy reservoir. While the individual forces maintaining secondary and tertiary structure of the refined cellulose particles are largelynoncovalent and hence of relatively low energy, the domains of collective ensembles possess extraordinary configurational stability due to the large number of interactions. Only by application of intense hydraulic gradients across a few microns and on atime scale that precludes or minimizes relaxation to mere translational capture, can sufficient energy be focused on segments of the refined cell wall to achieve disassembly of tertiary and secondary structure. In practice a small fraction of theapplied energy is captured by structural expansion of the dispersed phase. The vast majority of useful energy is lost into enthalpy of the continuous phase and can complicate processing due to high temperature excursions. As disassembly progresses andthe structures become smaller and selectively more internally ordered, disassembly rates diminish rapidly and the process becomes self limiting.

Three general processes are known in the art of cellulose manipulation to provide structurally expanded celluloses useful for practice of this invention. The simplest is structural modification from intense shear resulting from high velocityrotating surfaces such as a disk refiner or specialized colloid mill, as described in U.S. Pat. No. 5,385,640. A second process is that associated with high impact discharge such as that which occurs in high pressure homogenization devices, such asthe Gaulin homogenizer described in U.S. Pat. No. 4,374,702. The third process is that of high speed, wet micromilling whereby intense shear is generated at the collision interface between translationally accelerated particles, as described in U.S. Pat. No. 4,761,203. It would be expected that anyone skilled in the art could apply one or combinations of the above processes to achieve structurally expanded forms of cellulose useful in the practice of this invention.

The entire disclosures of the above-mentioned U.S. Pat. Nos. 4,374,702, 4,761,203 and 5,385,640 are all incorporated by reference in the present specification, as if set forth herein in full.

Two other commercial modifications are commonly employed at this structural level and are mentioned to distinguish the resulting product from SECs. The first involves indiscriminate fragmentation by various dry grinding methods to producepowdered celluloses and is widely practiced. Such processes typically result in production of multimicron dimensional particles as intraparticle fragmentation and interparticle fusion rates become competitive in the low micron powder particle sizeregion. Typical powdered celluloses contain particle size distributions ranging from 5 to 500 microns in major dimension and may be highly asymmetric in shape. These products are employed as anticaking or flow improvement additives for ground andcomminuted forms of cheese. The second process involves strong acid hydrolysis followed by moderate dispersive shear producing colloidal microcrystalline cellulose (MCC). It is believed that certain less ordered regions comprising tertiary structureare more susceptible to hydrolytic depolymerization than highly ordered domains resulting in shear susceptible fracture planes. Dispersed forms of MCC are needlelike structures roughly three orders of magnitude smaller than powdered celluloses and rangefrom 5 to 500 nanometers in width to longitudinal dimension, respectively. On spray drying MCC aggregates to form hard irregular clusters of microcrystals whose particle dimensions range from 1 to 100 microns. The resulting MCC clusters can serve as aprecursor to a unique SEC best described as a microscopic "puff ball" reported in U.S. Pat. No. 5,011,701 and is reported to be a fat mimetic. MCC also finds application as a rheology control agent in processed cheese products.

Finally, the quaternary or final structural level of cellulose is that of the cellular aggregate and is mentioned only for completeness. These substances may be highly lignified such as woody tissue or relatively nonlignified such as thosederived from the structural stalks and seed hulls of cereal grain plants. Commercial types of these materials are basically dried forms of nonvegetative plant tissue. These moderately elastic substances respond to mechanical processing by deformationand ultimate fracture along the principal deformation vector. Consequently, these materials readily undergo macroscopic and microscopic size reduction and are reduced to flowable powders by conventional cutting, grinding or debridement equipment. Because of the cohesive strength of the molecular ensemble comprising quaternary structure, these materials are not candidates for systematic structural expansion at the submicron level without chemical intervention.

Structural expansion as defined herein is a process practiced on refined celluloses involving mechanical manipulation to disassemble secondary and tertiary cellulose structure. The ultimate level of expansion would be to unravel the cell wallinto individual microfibrils. Although plant specific, a typical microfibril is best described as a parallel array of 25 to 100 B 1,4 glucan chains with diameter in the 50 nanometer range and variable length ranging from submicron to micron multiples. In practice generation of a dispersed microfibril population is not a realistic objective and only of academic interest. What is usually achieved because of the relatively indiscriminate application of mechanical energy is a highly heterogeneouspopulation of miniature

94

fibrils, ribbon-like and slab-like structures. These structures display irregular distention of individual microfibrils and aggregates of microfibrils from their surfaces and at internal and external discontinuities. The ensuingcollage consists of an entangled and entwined network of cell wall detritus to form a particle gel. Some of the larger structural features with dimensions in the micron range are discernible with the light microscope; however higher resolutiontechniques such as scanning transmission electron microscopy are necessary for detailed observation of submicron features. This particle gel network exhibits a vast increase in surface area associated with the volumetric expansion and projection of cellwall structure into the continuous phase medium. Lastly, structurally expanded celluloses useful for purposes of this invention may be further characterized by possessing a water retention value greater than 350 and a settled volume of at least 50% fora 5% w/w dispersion of said SEC in aqueous media.

It is contemplated that certain soluble hydrocolloids may be useful in practice of the invention. Dispersive hydrocolloids such as carboxymethylcellulose, CMC, are believed to bind to SECs through interaction of unsubstituted regions on theglucan backbone with the SEC surface, perhaps on the distended microfibril. The presence of carboxymethyl substituents imparts anionic polyelectrolyte character to the CMC backbone and hence on its association with SEC imparts a stationary negativecharge to the SEC surface. This stationary charge is believed to help control flocculative association of SEC and perhaps enhance interaction with colloidal lipid and casein micelles. Other associative hydrocolloids which bind to cellulose such asglucomannans (for example guar gum) help to control water mobility. Colloids, such as MCC, and hydrocolloids, such as xanthan and gellan gums are SEC interactive and assist in fine tuning gel structure for the colloidal-network caseinate system. Locustbean gum, konjac gum, pectin and the like may also be used for this purpose.

The effect of SEC on curd yield is dramatic, particularly when used in the range from about 0.05% to about 0.5%, based on the weight of the milk with which it is admixed. For example the incorporation of SEC at levels of 0.1% w/w based on fluidmilk result in significant yield improvements two orders of magnitude greater than the incremental percent of SEC solids. The incorporation of SEC into fluid milk is readily achieved using both dried and prehydrated paste forms. The following examplesare illustrative for practice of the invention by one normally skilled in the art and are not intended to limit its scope. 

DESCRIPTION OF THE INVENTION AND EXAMPLES

Two methods for characterizing SEC are useful for purposes of practicing this invention. The first is a simple settled volume test. A powdered or prehydrated SEC is fully dispersed at a specified mass into a specified volume of water. Theapparatus usually employed to measure settled volume is the graduated cylinder. The dispersed cellulose phase is allowed to gravity settle to a constant bed volume (usually 24 hr) which to a first approximation reflects the specific dispersed phasevolume or degree of structural expansion. SEC useful for practicing this invention is characterized by gravity settled volumes of at least 50% for a 5% w/w aqueous suspension of cellulose. For example a 5% w/w suspension of powdered cellulosescharacterized as 200 mesh from cottonseed (BVF-200, International Filler Corporation, North Tonawanda, N.Y.), refined wood pulp (BW-200, Fiber Sales & Development Corporation, St. Louis, Mo.) and refined soy hulls (FI-1, Fibred Inc., Cumberland, Md.)yield settled volumes of 31.2%, 23.2% and 22.4%, respectively in 24 hr. These forms of cellulose while potential precursors for SEC are readily distinguished from SEC by this test. A second method of characterization involves viscometry. SEC begins toform volumetrically sustainable, continuous particle gels at concentrations in the vicinity of 0.5% w/w in the absence of other dispersed substances. This critical concentration may be significantly reduced in the presence of other dispersed colloidalmatter. The onset of formation of the particle gel and the gel strength are characteristic of the type of SEC and the degree of structural expansion. Typically, the particle gels exhibit well behaved, reversible pseudoplastic behavior in the 1% to 3%w/w concentration range. This behavior can be modeled by the power law using a rotational viscometer such as the Brookfield DVIII, a programmable rheometer (Brookfield Engineering Laboratories, Inc., Stoughton, Mass.). A log/log plot of the shear rateversus shear stress at a specified concentration gives two characteristic system parameters: the flow index and consistency index. The consistency index is reflective of intrinsic gel strength (resting state extrapolation) and the flow index which isindicative of the degree of pseudoplasticity or dynamic particle/particle shear dependent interactivity. SECs useful for the practice of this invention are preferably characterized by displaying pseudoplastic behavior which is modeled by the power law. In the range of 1-2% w/w at 20 deg. C. the preferred SECs display flow indexes less than unity and typically in the range of 0.2 to 0.7. The preferred consistency indexes typically range from 500 to 10,000 cp.

In the following examples, actually fermented cheese products are made in the usual way with the improvement that SEC is dispersed in milk at the beginning of the process. Thereafter, the appropriate culture is added to the milk which is thenallowed to ferment for the prescribed time, depending on the type of

95

cheese, to establish a robust culture. A coagulant, e.g., rennet, is added or not, as the case may be. The coagulum is cut into pieces and then subjected to conditions causing waterto be expressed from the coagulum, which may be gravity draining, melting/agglomeration or mechanical pressing, it can again depending on the type of cheese.

Example 1

Skim Milk Curd

Four gallons of pasteurized skim milk were equilibrated at room temperature and pooled. The pooled milk contained 8.09% nonvolatile solids (104° C. oven to constant weight, typically 24 hr.). For each of four experiments a 3500 portionwas microwaved to reach a temperature of 88° F. A never dried paste concentrate of SEC from refined cotton seed linters (CS-SEC) was prepared as described in U.S. Pat. No. 5,385,640. The experiments were conducted at CS-SEC concentrations of0.00, 0.11, 0.17, and 0.22% w/w. The solids content of the paste was 6.66% on an "as is" basis and the power law characterization parameters were 0.35 and 4838 cp for the flow index and consistency index, respectively, determined for a 1.5% w/w aqueousdispersion at 20° C. The indicated amounts paste form of the CS-SEC was initially mixed with sufficient milk to give a volume of 500 ml and dispersed into the milk by means of a rotor/stater dispersator (Omni Mixer ES, Omni International,Gainesville, Va.) operating with a 35 mm generator at 6000 rpm for 3 minutes. After dispersing the CS-SEC, it was added to the remainder of the milk plus any additional water and mixed on the dispersator assembly for 3 minutes at 8000 rpm. The activeculture was added two minutes into the mixing process. The culture employed was a freeze dried, mesophilic lactic culture (R707 Chr. Hansen, Inc., Milwaukee, Wis.). It was a direct vat culture (DVC) used at 1 unit/gal of milk. The culture wasprepared by addition of 1.54 g lyophilized powder to 120 g skim milk. After 15 minutes hydration, the culture was dispersed by means of a small hand held dispersator (Omni 1000, Omni International) operating a 10 mm generator for 1 min at 10000 rpm. A25 g aliquot of the culture solution was used for each 3500 g (approximate one gallon) milk experiment. The composition of each experiment is summarized in TABLE 1.

TABLE-US-00001 TABLE 1 skim CS-SEC culture milk paste water mixture #1 3500 g - 0 - 120 g 25 g #2 3500 g 60 g 60 g 25 g #3 3500 g 90 g 30 g 25 g #4 3500 g 120 g - 0 - 25 g

The mixtures were placed in a circulated air oven to incubate at 88 deg. F. (31 deg. C.). After one hour 0.25 ml of microbial chymosin (Chymax II, 50000 MCU/ml, Chr. Hansen, Inc.) was added to each and the incubation continued until the pHreached 4.6 (approximately 6 hours). The curds were cut and allowed to relax for 15 minutes. The following sequence of heating by microwave and gentle mixing was initiated to cook the curds. Each container containing the cut curds was first microwavedto reach a temperature of 107 deg. F. and placed in a circulated air oven at 130 deg F. After one hour the containers and contents were microwaved again to 125 deg F. and reincubated. After another 1.5 hour the containers and contents were microwavedto 130 deg F. and reincubated. Finally, after one hour the containers and contents were microwaved to 147 deg F. This ramped sequence of temperature increases represents a convenient laboratory scale, curd cooking protocol. After one hour the cookedcurd was drained using a cheese cloth lined colander at room temperature for 12 hours. The mass of recovered curd and whey was recorded and the nonvolatile solids of each fraction determined (104 deg C. to constant weight). The mass balance results aresummarized in TABLE 2.

TABLE-US-00002 TABLE 2 Starting whey curd final solids* solids solids solids % recovery #1 283.2 g 189.7 g 113.4 g 303.1 g 107% #2 287.2 g 175.3 g 124.8 g 300.1 g 104% #3 289.2.sup. 172.8 g 126.8 g 299.6 g 104% #4 291.2.sup. 177.2 g 135.4 g312.6 g 107% *milk solids @ 8.09% × 3500 g + CS-SEC solids

The mass balance appears self consistent from the above data. TABLE 3 summarizes the key yield parameters.

TABLE-US-00003 TABLE 3 % recovery of curd solids net yield of curd solids based on starting solids versus control #1 40.0% -- #2 43.4% 8.5% #3 44.1% 10.0% #4 46.5% 16.2%

It is clear that small amounts of CS-SEC impart relatively large systematic yield increases in curd yield as a function of increasing concentration.

Example 2

Cottage Cheese

96

Cottage cheese represents a fermented cheese product with the simplest curd processing. Basically, the cut, cooked curd is washed, salted and at the option of the processor remixed with a cream based dressing. A similar procedure to EXAMPLE 1was used for curd production with the exception that a mixed frozen culture was used. One gram of frozen cultures LB-12 and St-C-5 (Chr. Hansen, Inc., Milwaukee, Wis.) representing thermophilic lactic cultures Lactobacillus and Streptococcus,respectively, were dispersed into 105 g of skim milk according to the protocol of EXAMPLE 1. The skim milk was not pooled, but each gallon possessed the same production time stamp and the average solids content was 8.25%. The composition of eachexperiment is summarized in TABLE 4.

TABLE-US-00004 TABLE 4 Skim CS-SEC milk Water paste #1 3836 g 80 g - 0 - #2 3845 g 40 g 40 g #3 3842 g 20 g 60 g #4 3851 g - 0 - 80 g

After final cooking of the curd was complete, the curds were then suspended in two liters of cold water and gravity drained in a cheesecloth lined colander for 16 hours under refrigerated conditions. The drained curds were salted at 1% w/w. Theresults are summarized below in TABLE 5.

TABLE-US-00005 TABLE 5 First Wash Final Curd salt % % weight weiqht yield addn solids yield #1 663.4 g 588.0 g 100% 5.9 g 15.8 100 #2 783.3 g 684.8 g 117% 6.8 g 14.9 110 #3 1111.0 721.5 g 123% 7.2 g 14.7 114 #4 1233.8 733.0 g 124% 7.3 g 14.9 117

It is seen that the curd yield which represents both additional water and solids capture slightly exceeds the recovered solids yield of the right hand column. A major yield improvement arises from the first increment of CS-SEC representing 0.1%w/w CS-SEC solids.

Example 3

Mozzarella Cheese

Mozzarella cheese represents a form of cheese in which the cooked curd is thermally melted and dewatered in situ. The coalesced curd mass is formed into a ball and incubated in a saturated brine solution. A 3700 g aliquot of pasteurized skimmilk at 8.14% nonvolatile solids was equilibrated to room temperature (66 deg. F.). The control contained 60 g water plus 25 g of mixed culture and the test contained 60 g of the CS-SEC paste plus 25 g mixed culture solution described in EXAMPLE 2. The mixing, incubation and coagulation protocols were the same as in EXAMPLE 1 except the temperature was 92 deg. F. (33.5 deg C.). After cutting the curd the cut curd mixture was heated to 110 deg. F. (33.5 deg. C.) using a microwave oven. After 1hour the whey was drained to the level of the curd and the incubation continued at 110 deg F. until the pH reached 5.2. The curd was then drained and washed once with 1 liter of water. Salt was added at 0.75% w/w based on curd weight and the curd wasimmersed in 2 liters of water at 160 deg. F. The melting and coalescing curds were pressed into a coherent mass by means of a large wooden spoon. The curd mass was formed into a ball within a cheese cloth shroud and incubated in a saturated salt brinefor 2 hours. The results of the experiment are summarized in TABLE 6.

TABLE-US-00006 TABLE 6 Skim CS-SEC Water Final Cheese % % solids yield weight weight weight yield solids recovered #1 3700 g - 0 - 60 g 239.8 g 100% 46.4 36.9 #2 3700 g 60 g - 0 - 275.2 g 115 39.6 36.2

The results indicate that the yield of skim milk solids remained about the same and that the yield increase was largely due to additional water incorporation.

Example 4

Cheddar Cheese

Cheddar cheese represents a mechanically dewatered curd which is press formed into a wheel or plug shape, peripherally sealed and subsequently aged. During the latter process it undergoes an aging and fermentative development to develop a uniqueflavor profile. The yield of the cheese however is set prior to the aging process.

For the experiment described below a specialized pneumatic press was constructed to run four simultaneous experiments. It consisted of four parallel mounted pneumatic air cylinders each possessing an internal drive cylinder diameter of 2.5inches. The drive rod was connected to a Clevis adaptor attached to a 4.5 inch diameter plastic driver enclosed within a 4.6 inch diameter cylindrical press housing. Holes in the

97

sides of the housing were drilled to allow vertical drainage of theexpressed whey. The bottom segment of the cylinder contained an elevated but structurally supported coarse lattice platform for bottom drainage. The assembly was pressurized by means of a nitrogen gas tank and the pressure regulated with a two stagediaphragm regulator. Typically the press cylinder was lined with nylon cheese cloth. A 4.25 inch circular 60 mesh stainless steel screen was employed as a retaining barrier and for support of the liner against the lattice base. The curd mass to bepressed was packed into the lined cylinder and the cheese cloth liner carefully folded over the top of the packed curd. A second 60 mesh stainless steel circular screen segment was placed on top and the drive assembly manually positioned in place. Thevolumetric compression of cheeses in the experiments to be described were not limited by mold design stops as are commercial presses. This allows unrestricted compression which is limited only by the compressibility or intrinsic water holding capacityof the curds in question. This provides a measure of the true cheese yield at equivalent compressive equilibrium conditions for an experimental set in which one or more parameters are systematically varied. Commercial yields would be in excess of thosereported here due to much greater water retention associated with controlled volumetric compression.

Pasteurized skim milk with a nonvolatile solids content of 8.40% w/w was used. CS-SEC past and BVF-200 (a powdered cotton seed cellulose) were identified and sourced previously. The culture used was the lyophilized lactic acid preparation R707identified previously and used at 1.5 g per 3800 g skim milk. It was suspended in 100 ml of the skim milk and allowed to hydrate for 15 min. at which time it was dispersed by use of the Omni 1000 operating at 10000 rpm, 10 mm generator for 1 min. Thepredispersion of CS-SEC and BVF-200 prior to incorporation into the skim milk base was similar to that described in EXAMPLE 1. The skim milk base was preheated to 90 deg F. prior to admixing with the other components. The culture was added in sequencealso described in EXAMPLE 1. The composition of the experimental set is summarized in TABLE 7.

TABLE-US-00007 TABLE 7 Skim CS-SEC BVF-200 Culture milk Water paste fiber solution #1 3800 g 120 g - 0 - - 0 - 100 g #2 3800 g - 0 - 120 g - 0 - 100 g #3 3800 g 112 g - 0 - 8 g 100 g #4 3800 g 104 g - 0 - 16 g 100 g

The primary fermentation was run for 1 hr at 90° F. A 0.7 ml aliquot of Chymax II was added and the coagulation allowed to occur for 1 hr. The curd was cut and allowed to heal for 15 min. at which time the temperature was raised to100° F. by microwave treatment. The whey was drained by decantation and cheddaring started in a 100° F. circulating air oven. The curds were turned approximately every 15 minutes. After two hours the curd mass was shredded and salted(8 g) and incubated 15 min before moving to the press stage. The pressing sequence was 10 min @ 10 psi, rotate the press cake, 10 min @ 10 psi and rotate the press cake and 8 hr @ 40 psi. Note: the pressure reflects primary cylinder pressure wherebythe actual pressure at the press cake is 0.55 of the cylinder discharge pressure. The pressed cake was unloaded from the press assembly and encompassing cheese cloth, blotted and weighed. The pressed cheese cakes were then air dried for 48 hr on acutting board, turning the cheese piece approximately every 12 hr. After drying the individual cheese pieces were enrobed with wax and stored at 34-40° F. to age. At the time of this disclosure the cheeses were 5 months into their agingprocess. No organoleptic or moisture analyses have been performed on these cheeses to date and await the 12 month aging stage anniversary. The results of the experiment are summarized in TABLE 8.

TABLE-US-00008 TABLE 8 Curd Pressed Yield CS-SEC BVF-200 weight weight % DB wt DB wt #1 290.8 g 232.9 g 100% - 0 - - 0 - #2 517.0 g 312.4 g 133% 8 g - 0 - #3 325.6 g 254.8 g 109% - 0 - 8 g #4 353.5 g 249.2 g 107% - 0 - 16 g

The results show a substantial improvement in the exhaustively pressed cheese product for the CS-SEC at 0.2% w/w. The increased yields for the powdered cellulose were marginal at twice the concentration. Lastly, the pressed cheese based on SECwas uniform while the powdered cellulose containing cheeses were mottled and indicative of clumped aggregates of cellulose. These clumps presumably were the result of settling of the powdered cellulose particles to the bottom of the container duringcoagulation and continued segregation during shredding, subsequent mixing and pressing.

Example 5

Cheddar Cheese

In this example another form of cellulose is compared to SEC. Microcrystalline cellulose (MCC) has been described earlier and a commercially redispersible form CL-611 (FMC Corp., Philadelphia, Pa.) was used as a comparison. MCC is not consideredan SEC but is a colloidally dispersible form of cellulose that forms

98

particle gels in the presence of CMC, albeit at higher concentrations than SEC. The purpose of this experiment was to show that SEC is much more effective than MCC in the production ofenhanced yields of cheddar cheese. The protocol of EXAMPLE 5 was employed with the same skim milk solids. MCC Cl-611 was used at the same concentrations as BVF-200 of the prior example. TABLE 9 summarizes the results.

TABLE-US-00009 TABLE 9 Curd Pressed Yield CS-SEC MCC weight weight % DB wt DB wt #1 322.6 g 254.9 g 100% - 0 - - 0 - #2 468.4 g 304.5 g 119% 8 g - 0 - #3 340.9 g 271.0 g 106% - 0 - 8 g #4 366.6 g 264.0 g 104% - 0 - 16 g

The results show that MCC at twice the concentration of SEC does not substantially improve pressed weight yield of cheddar.

Example 6

Processed Cheese

It is anticipated that SEC's will find extensive use in processed cheeses in addition to their use in naturally fermented cheeses. The same interactions of SEC with the caseinate microcell that have been demonstrated to occur when premixed withmilk and subsequently coagulated are expected to be found in the case of admixture with precoagulated caseinates such as regular cheese melts and isolated sodium or calcium caesinates. The present invention relates to the making of cheese, and particularly to the making of cheese ripened for two or more months such as Cheddar and Colby cheese.

Milk from many different mammals is used to make cheese, though cow's milk is the most common milk for cheese. Generally, cheese is made by developing acidity in milk and setting the milk with a clotting agent, such as rennet. The set milk iscut and whey is separated from the resulting curd. The curd may be pressed to provide a cheese block. The cheese-making process is essentially a concentration process that captures a portion of the protein, minerals, fat, water, and other minorcomponents present in the original milk component. Rennet-based cheeses include cheeses such as mozzarella, Cheddar, Swiss, and Colby cheese. In a typical Cheddar cheese, the concentration factor is about ten times, i.e., approximately 10 lbs ofnatural Cheddar cheese are produced from 100 lbs of milk, with the remaining (90 lbs or so per 100 lbs milk) of material removed in the whey byproduct. Typical Cheddar cheese has 1.4 g lactate per 100 g and contains 37.5% water.

Curing typically takes place over a lengthy period of time under controlled conditions. Cheddar cheese, for example, is cured for a period of at least four months and may be cured for a period in excess of one year to obtain the full flavordesired in cheddar cheese.

In contrast to the natural cheese-making process, process cheese is not manufactured directly from milk and process cheese manufacture does not produce any byproducts. Process cheese is produced by combining natural cheese, other dairy basedingredients, water and emulsifying salts into a blend that is subsequently heated (typically to at least 65.5° C. for not less than 30 seconds, see 21 C.F.R. 133.169) and mixed to produce a homogeneous product.

Recently, use of concentrated milk as the base ingredient for making cheese has become more popular. Milk can be concentrated prior to cheese making using a variety of techniques including ultra-filtration, micro-filtration, vacuum condensation,or the addition of dry milk solids such as nonfat dry milk. The use of concentrated milk provides increased efficiency to the cheese-making process. Use of concentrated milk also reduces the amount of whey produced for a given amount of cheese,facilitates standardization of formulation and production, and promotes more consistent quality and yields of the resultant cheese. The use of concentrated milk thus lowers cost and processing times for making cheese, particularly beneficial forsemi-continuous cheese manufacturing processes such as utilized in typical large-scale cheese plants. The semi-continuous cheese manufacturing includes numerous cheese vats that sequentially feed a draining/conveying belt and a salting belt. Thissemicontinuous cheese making system requires consistent and rapid production of acid by starter cultures used in the cheese manufacturing process. The efficiency of semi-continuous cheese manufacturing is substantially improved if the milk isconcentrated prior to cheese-making.

During the aging process, calcium lactate crystals can grow within and on the surface of cheese. These crystals are small white spots that can be seen, often without magnification, upon close inspection of the cheese. The crystals are notpresent in the cheese immediately after manufacture, but typically start to

99

appear between two and six months of aging. While the calcium lactate crystals are not harmful to consumers, they can be perceived in mouthfeel as adding a slight amount ofgrittiness to the cheese. More importantly for affecting cheese sales, consumers often believe the crystals are mold. The growth of calcium lactate crystals is thus viewed as a defect representing substantial financial loss for cheese manufacturers.

For reasons that are not entirely clear, the use of concentrated milk and a semi-continuous cheese making process in making an aged cheese seems to worsen the calcium lactate crystal problem. Consequently cheese manufacturers have an unenviablechoice: they can either use a less efficient cheese-making process or they can use a more efficient manufacturing process that more likely results in calcium lactate crystals defects.

Factors influencing the formation of calcium lactate crystals have been extensively studied. Concentrations of calcium and lactate ions existing in cheese serum are very close to saturation, and small increases in the concentration of eithercomponent could result in super saturation and crystallization. It has also been theorized that milk citrate levels and the subsequent utilization of citrate by microorganisms may play a role in calcium lactate formation. Curd washing, curing, andstorage temperature may further contribute to calcium lactate crystal formation. Other studies report that calcium lactate is formed when L (+)-lactate is converted into a racemic mixture of L(+)- and D(-)-lactate, the latter being much more prone tocrystallization. The conversion of L(+)-lactate to D(-)-lactate is thought to be carried out by certain strains of bacteria.

Prior art methods for limiting calcium lactate crystal formation in cheese include: 1) reducing the concentration of lactic acid in the final curd, 2) reducing or eliminating undesirable non-starter lactic acid bacteria ("NSLAB") from thecheese-making process, 3) controlling storage temperature, and 4) vacuum packaging cheese to minimize the airspace around the outer cheese surface. The use of certain starter culture strains may also increase or decrease the presence of calcium lactatecrystals, due to post manufacture fermentation by the selected starter culture.

Although progress has been made in developing strategies for prevention of calcium lactate crystals, the defect is still prevalent. Better methods of minimizing calcium lactate crystal formation in aged cheeses are needed.

BRIEF SUMMARY OF THE INVENTION

The present invention is a method of adding one or more ingredients to the typical cheese-making recipe to inhibit the growth of calcium lactate crystals as the cheese ages, and the cheese composition made by such a method and recipe. Thepreferred method of adding the calcium lactate crystal inhibitor is during the salting stage of the cheese-making process, and the calcium lactate crystal inhibitor may be provided in a salt carrier. The preferred added calcium lactate crystal inhibitoris gluconate provided by sodium gluconate, but other ingredients such as the sodium salts of organic acids sodium malate and sodium lactobionate and similar ingredients, are also beneficial. A method for modeling the beneficial prospects of the calciumlactate crystal inhibitor includes observing crystal formation on sand paper after storage in a calcium lactate solution containing the calcium lactate crystal inhibitor and performing calcium and lactate analyses on such stored solutions.

DETAILED DESCRIPTION

The present invention modifies conventional cheese-making and begins, as all cheeses do, with milk. Preferably the milk is whole cow's milk having 3 to 4% butterfat and in excess of 7% solids non-fat. However, it is believed that cheeses formedfrom milk of other mammals will similarly benefit from the present invention, as will cheeses formed from milks with different fat (including non-fat) and/or different solids non-fat concentrations.

The preferred milk starting ingredient is preferably concentrated to achieve efficiencies in the cheese-making process. Preferably the solids content of the milk is increased to have total solids within the range of 13 to 50%, more preferablywithin the range of 13 to 18%, and most preferably to have total solids within the range of 14 to 15%. While the concentrated milk could be formed merely by adding condensed skim milk, ultrafiltered skim milk, microfiltered skim milk or non-fat dry milksolids to the starting milk, more preferably the concentrated milk includes an addition of fat as well as non-fat milk solids. The preferred concentrated milk may thus be formed by adding various amounts of condensed skim milk, ultrafiltered skim milk,microfiltered skim milk or non-fat dry milk solids and cream to whole milk, thereby retaining the ratio of casein to fat present in whole milk. Calcium chloride may be added to the milk ingredient to generate firmer curds. Fortifying ingredients orcolorings may also be added to the milk ingredient.

100

The milk ingredient is acidified. If desired, the acidification can be achieved by adding an acidic ingredient, such as citric acid or tartaric acid, or through natural bacterial acidification. More preferably, the acidification is achieved byadding a starter culture, such as a mesophilic (lactococcus lactis ssp cremoris), thermophilic (streptococcus thermophilus) or helvetic (lactobacillus helveticus) bacteria culture. Most preferably (for Cheddar cheese) a mesophilic starter culture isused. If a starter culture is used, the mixture is then incubated between about 10 and 60 minutes, preferably about 30 minutes at a temperature between about 30 and 37° C., preferably about 31 to about 32° C.

After acidification, a coagulating agent, preferably rennet at about 0.02 to about 0.1 percent, is added to act on the casein and cause the milk ingredient to coagulate. The rennet may be animal, microbial or vegetable. The mixture is furtherincubated between about 10 and 60 minutes, preferably about 30 minutes, at a temperature between about 30 and 370° C., preferably about 31 to about 32° C. The addition of a coagulating agent, preferably rennet, causes the milk tocoagulate into a mass.

After coagulation, the mass is cut, stirred, and heated (i.e., from about 30 to about 42° C. and preferably from about 31 to about 39° C.) for between about 10 and about 60 minutes, preferably about 30 minutes. The whey isdrained off and the curd is matted into a cohesive mass in the traditional Cheddaring process or is intermittently stirred when using the stirred curd process. Subsequently in the traditional Cheddar process the mass is cut into pieces and salted,whereas in the stirred curd process the curd is simply salted. About 1 to about 4% salt, and preferably about 1.5 to about 3% salt is added to the curd. The preferred salt is sodium chloride added most preferably (for a Cheddar cheese) at about 2.75%. The salted curd is stirred, further drained and pressed into forms. Approximately 65-90% of the salt added is retained in the cheese, and thus consequently a typical Cheddar cheese has 1.5 to 2.0% salt. The cheese is then aged for a time period inexcess of one week, preferably from one month to one year, and most preferably about 4 months prior to consumption.

Within this conventional cheese-making process, a calcium lactate crystal inhibitor ("CLC inhibitor") is added. The CLC inhibitor decreases the growth of calcium lactate crystals in cheese, such that the volume of calcium lactate crystals aftertwo months or more aging time is reduced by at least 50%. The preferred CLC inhibitor is gluconate. Alternative preferred CLC inhibitors include: malate, acetate, citrate, succinate, propinate, galactonate, and lactobionate. Polyphosphate might alsowork as a CLC inhibitor, such as provided in sodium polyphosphate. Salts of organic acids with a lower molecular weight like gluconate (C6H.sub.11O.sub.7; MW=195) and malate (C4H.sub.4O.sub.5; MW=132) are preferred over higher molecular weightorganic acids like lactobionate (C12H.sub.22O.sub.12; MW=358). This is the case because for a larger molecular weight, a larger amount of the salt of the organic acid is required to have the same molar concentration. Consequently a larger amountof sodium lactobionate would be required as compared to sodium gluconate or sodium malate to be an effective calcium lactate inhibitor.

The beneficial results of the present invention are believed to be primarily achieved by increasing the solubility of calcium, lactate and/or calcium lactate in the water component of the resultant cheese, which is believed to occur through theformation of metastable complexes with the CLC inhibitor and one or both of calcium and lactate. As used herein, the term "metastable complex" means that the compound is a mixture of various crystalline and non-crystalline forms and solid solutions ofthe CLC inhibitor ions and one or both of calcium ions and lactate ions, as well as salts of these ions, which does not reach final equilibrium in the cheese over an aging time period in excess of two weeks. The metastable complexes appear to havecombinations of crystalline and amorphous states. The CLC inhibitor appears to form metastable complexes which effectively remove one or both of the calcium and lactate ions from being available for the formation of calcium lactate crystals within thecheese during the aging process. The preferred CLC inhibitor is added in an effective amount to increase the solubility of lactate by at least 1 g/100 g water when calcium is also present at a concentration of at least 1.06%, taken at cheese agingtemperature. For instance, cheddar cheese is aged under refrigeration, so the CLC inhibitor increases the solubility of lactate in water by at least 1 g/100 water at 4° C. More preferably, the CLC inhibitor is added in an effective amount toincrease the solubility of lactate in water by at least 2.76 g/100 g water, thereby at least doubling the solubility of lactate in water when calcium is also present. Most preferably, the CLC inhibitor provides nearly a four fold increase in thesolubility of lactate in water when calcium is also present.

The solubility of anhydrous calcium lactate has been report to be 3.38, 4.04, and 6.41 g of CaLac2/100 g of water at 4, 10, and 24° C. respectively. Since cheese is often refrigerated during the aging process, the value at 4° C. of 3.38 g of anhydrous CaLac2/100 g of water is viewed as most important for the present invention. The molar ratio of lactate in CaLac2 is 81.6%, so 3.38 g of anhydrous CaLac2/100 g of water provides 2.76 g of lactate/100 g of waterand 0.62 g calcium/100 g of water. Thus, it is believed that calcium

101

lactate crystals only form when greater than 2.76 g of lactate/100 g of water and 0.62 g of calcium/100 g of water are present in the cheese. Cheddar cheese contains approximately0.70% calcium. A portion of this calcium is bound to the protein network present in the cheese, whereas a portion is soluble in the water phase of cheese and is called soluble calcium. This so called soluble calcium is available to interact withlactate and participate in the formation of calcium lactate crystals. After the first week of ripening Cheddar cheese has about 0.4 g of soluble calcium/100 g of cheese. As mentioned previously a typical Cheddar cheese has 37.5% water. Consequentlythe concentration of soluble calcium in the water portion of a typical Cheddar cheese is 1.06 g/100 g of water (0.4/37.5×100). Additionally, typical Cheddar cheese has 1.4 g lactate per 100 g and again contains 37.5% water. Consequently theconcentration of lactate in the water portion of typical Cheddar cheese is 3.73 g per 100 g of water (1.4/37.5×100). Since 3.73 g lactate/100 g water and 0.06 g calcium/100 g water present in Cheddar cheese is larger than the 2.76 g of lactate/100g water and 0.62 g calcium/100 g water that is required to exceed the solubility of 3.38 g of anhydrous CaLac2/100 g at 4° C., it is no surprise that calcium lactate crystals are a major defect in many prior art cheddar cheeses.

The presence of gluconate, for instance, can increase the solubility of calcium lactate. This increase in solubility of calcium lactate is believed to be the result of metastable complexes formed between gluconate and one or both of calcium andlactate. In order to prevent the formation of calcium lactate crystals as a result of formation of metastable complexes, a molecule of gluconate must be present for each molecule of calcium or lactate in excess of the 3.38 g of anhydrous calcium lactatethat is soluble in 100 g of water at 4° C. The concentration of 3.38 g of anhydrous calcium lactate/100 g water represents 0.127 moles of lactate and 0.028 moles of calcium. The typical concentration of 3.73 g of lactate/100 g of water in cheeserepresents 0.210 moles of lactate whereas the 1.06 g of calcium/100 g of water in cheese represents 0.265 moles of calcium. These calculations demonstrate that the molar concentration of calcium in excess of the molar concentration required for calciumlactate crystal formation (0.265-0.028=0.237) is larger than the molar concentration of lactate in excess of the molar concentration required for calcium lactate crystal formation (0.210-0.127=0.0834). Since the excess molar ration of lactate is smallerthan the excess molar ratio of calcium it can be used to determine the concentration of the gluconate required to form metastable complexes between calcium lactate and gluconate that will prevent the formation of calcium lactate crystals. For example,as previously mentioned, in typical Cheddar cheese the excess molar concentration of lactate is 0.0834. Consequently the incorporation of 0.0834 moles of gluconate into the water portion of cheese is required. This corresponds to 0.619 g ofgluconate/100 g of cheese.

If gluconate is used as the calcium lactate crystal inhibitor, the amount of gluconate should provide an amount of free gluconate which results in effective inhibiting of calcium lactate crystal growth. The preferred gluconate addition resultsin the inclusion of greater than zero to 5.8% gluconate in the final cheese products, and more preferably greater than zero to 4.5% gluconate in the final cheese product. Even more preferably, the gluconate is added to result in about 0.26 to 2.8%gluconate in the final cheese product, with the most preferred amount being 0.62% gluconate in the final cheese product.

The beneficial results of the present invention are believed to be secondarily achieved by a combination of additional factors. In particular, the preferred CLC inhibitors are believed to slow the bacterial production of additional lactic acidby the culture in the cheese. The preferred CLC inhibitors are also believed to affect the proteins within the cheese, causing the proteins to better bind water. The preferred cheeses in accordance with the present invention thus exhibit less weepingthan without the addition of the CLC inhibitor. The preferred CLC inhibitors are also believed to result in a change in pH of the cheese during ripening. As an additional secondary benefit, the preferred CLC inhibitors are believed to suppressbitterness in the cheese. The cause and effect relationships and interrelatedness of these various secondary factors (reduced lactic acid production, better water binding in proteins, change pH curve during ripening, decreased bitterness) in relation tothe formation of metastable complexes and changes in calcium, lactate and/or calcium lactate solubility is not known, but further study is being conducted.

The CLC inhibitor needs to be incorporated into the cheese during the manufacturing process, prior to aging. It could, for instance, be added to the starting milk ingredient, to the concentrated milk, to the starter culture or to the rennet. The preferred method for adding the CLC inhibitor, however, is during the salting step. This allows the use of a granulate form of the CLC inhibitor while minimizing the amount of the CLC inhibitor lost during whey separation, and without needlesslyincreasing the processing complexity of the cheese. The preferred CLC inhibitor ingredient is accordingly a salt, at least one of the ions of which increases the solubility of lactate in water. The addition of CLC inhibitor of the present invention isparticularly contemplated as being beneficial in natural, aged cheeses.

Sodium gluconate is the sodium salt of gluconic acid. Once sodium gluconate is incorporated into cheese

102

during the salting step, it is believed to become solubilized in the water phase of the cheese, providing the necessary gluconate to formmetastable complexes of calcium-lactate-gluconate and prevent formation of calcium lactate crystals. Other edible salts of gluconate could alternatively be used, such as potassium gluconate.

The normal range of lactate found in Cheddar cheese is 1.1 to 1.9%. Sodium gluconate added during the salting step of cheese manufacture is believed to be retained at a rate similar to the retention of salt (approximately 65-90%). Accordingly,the preferred sodium gluconate of the present invention is added in a range of about 0.32 to 4.73% sodium gluconate (depending on the lactate content of the cheese and the amount of sodium gluconate retained in the cheese) to prevent the formation ofcalcium lactate crystals.

Although there are numerous alternative ways gluconate could be added (i.e. addition of glucona-delta-lactone to the milk, curd, or whey; development of a gluconate producing starter or adjunct culture), the most efficient, cost effective, andreadily available technique is to add sodium gluconate to the cheese during the salting step of the manufacturing process.

The calcium lactate inhibitor need be present in the cheese product during aging. If added during the salting step, most of the calcium lactate inhibitor remains in the cheese product at the time of purchase and consumption. This provides adouble benefit to cheese manufacturers, in that the calcium lactate inhibitor becomes an edible part of the final cheese product. That is, the addition of the calcium lactate inhibitor results in more cheese being manufactured and sold, so theadditional weight sold adds revenue for the cheese manufacturer.

Example 1

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a conventional milled curd method. A direct vat set, frozen, concentrated starter culture (Marschall.RTM. Superstarto concentrated cultures, Strain M30 and M42, Rhodia, Inc., DairyBusiness, Madison, Wis.) was used to manufacture the cheese. A total of 36 ml of starter culture (18 ml of each strain) and 15.6 ml of color (AFC-WS-1x, Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk, which was maintained at31° C. After a 45-minute ripening period, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) diluted with 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowed toheal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cooked with continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After thecurds and whey reached a pH of 6.25 (30 to 45 minutes) the whey was drained and the curds were ditched and packed. The matted curd was then cut into slabs, flipped and stacked in 20-minute intervals until the curd reach a pH of 5.4. A pH of 5.4 wasreached 1.5 to 2 hour after the whey was drained. The slabs of curd were then milled and approximately 60 lbs of milled curd were obtained. The 60 lbs of milled curd were then divided in half. Two separate salting treatments were then applied to eachportion of the curd. One half of the milled curd (30 lbs) was salted at a rate of about 2.75% with sodium chloride (0.825 lbs). The sodium chloride was applied in three equal portions (0.275 lbs each) and the curd was mixed for 10 minutes between eachsodium chloride application. The remained curd (30 lbs) was salted at a rate of about 2.75% sodium chloride (0.825 lbs) and 2.4% sodium gluconate (0.72 lbs, PMP Fermentation Products, Peoria, Ill.), such that the total sodium chloride/sodium gluconateaddition was about 5.15% (1.545 lbs). The sodium chloride and sodium gluconate were applied in three equal portions (0.275 lbs and 0.24 lbs for the sodium chloride and sodium gluconate respectively) and the curd was mixed for 10 minutes between eachsodium chloride/sodium gluconate application. Subsequently the curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separateblocks weighing approximately 24-26 lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-25 1 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.13, 1.87%, and 38.84% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.44, 1.51%, 1.29% and 40.32% respectively. It is recognized that the maximum moisture content allowed in Cheddar cheese is 39% and that minor adjustments in the cheese making procedure for the cheese containing sodium gluconatewill be required to reduce the moisture content to less than 39%.

103

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The resultant cheese from the sodium gluconate treatment tasted smooth and smelledpleasant, with no perceptible taste, mouthfeel or odor added due to the sodium gluconate addition.

Example 2

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a stirred curd method. A bulk starter culture was prepared by inoculating steamed reconstituted NFDM with a direct vat set, frozen, concentrated starter culture (Marschall.RTM. Superstart.RTM. concentrated cultures, Strain M46, Rhodia, Inc., Dairy Business, Madison, Wis.) and incubating overnight. The concentrated cheese milk was then inoculated with the bulk culture at a rate of 2%. Additionally 15.6 ml of color (AFC-WS-1x,Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk. The concentrated milk was then maintained at 31° C. for a 45-minute ripening period. Subsequently, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) dilutedwith 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowed to heal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cookedwith continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After the curds and whey reached a pH of 6.30 (30 to 45 minutes) the whey was drained and the curds were intermittently stirred untilthe curd reach a pH of 5.4. A pH of 5.4 was reached 1.5 to 2 hour after the whey was drained. Approximately 60 lbs of curd were obtained and subsequently divided in half. Two separate salting treatments were then applied to each portion of the curd. One half of the curd (30 lbs) was salted at a rate of about 2.75% with sodium chloride (0.825 lbs). The sodium chloride was applied in three equal portions (0.275 lbs each) and the curd was mixed for 10 minutes between each sodium chloride application. The remained curd (30 lbs) was salted at a rate of about 2.75% sodium chloride (0.825 lbs) and 2.4% sodium gluconate (0.72 lbs, PMP Fermentation Products, Peoria, Ill.), such that the total sodium chloride/sodium gluconate addition was about 5.15% (1.545lbs). The sodium chloride and sodium gluconate were applied in three equal portions (0.275 lbs and 0.24 lbs for the sodium chloride and sodium gluconate respectively) and the curd was mixed for 10 minutes between each sodium chloride/sodium gluconateapplication. Subsequently the curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separate blocks weighing approximately 24-26lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-251 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.35, 1.08%, and 39.0% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.42, 1.01%, 0.79% and 42.51% respectively. It is recognized that the maximum moisture content allowed in Cheddar cheese is 39% and that minor adjustments in the cheese making procedure for the cheese containing sodium gluconatewill be required to reduce the moisture content to less than 39%.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The resultant cheese from the sodium gluconate treatment tasted smooth and smelledpleasant, with no perceptible taste, mouthfeel or odor added due to the sodium gluconate addition.

Solubility Model

Example 3

A test was run to determine the ability of ionic gluconate provided by sodium gluconate in an aqueous solution to bind with lactate over time, to thereby model the believed primary phenomenon resulting in reduced formation of calcium lactatecrystal. In each sample of the model, 14.1 g of calcium lactate pentahydrate (CH3CHOHCOO)2 Ca.5H2O) was used to provide 10 g of calcium lactate (1.83 g calcium ion, 8.17 g lactate ion). Different amounts of sodium gluconate(NaC6H.sub.11O.sub.7), amounts shown in Table I below) were

104

combined with the calcium lactate pentahydrate and diluted to 100 ml with water. The samples were prepared at room temperature and each mixed well. The samples were then refrigerated atabout 40° F. for 48 hours, with each sample being mixed several times during the 48 hour holding period. After the holding period, the samples were cold filtered (40° F.) and the filtrate analyzed for lactate, gluconate and calciumconcentrations. The results are shown in the table below:

TABLE-US-00001 TABLE I g of FILTRATE RESULTS NaC6H.sub.11O.sub.7 CH3CHOHCOO added (%) C6H.sub.11O.sub.7(%) Ca (%) 0 2.82 -- .64 5 4.16 2.97 .98 10 4.47 7.55 1.12 15 4.96 11.15 1.20 20 5.67 14.21 1.18 25 5.69 16.61 1.18

The results demonstrate that the presence of ionic gluconate does in fact increase the solubility of lactate and calcium. However, the increase in solubility plateaus when the amount of gluconate added reached about 15 g/100 ml, which isdifferent than the calcium solubility results reported for beverage applications of sodium gluconate. These results indicate that the prevention of calcium lactate crystal formation in cheese by the addition of gluconate is not obvious or completelyunderstood.

Solubility Model

Example 4

A control solution was prepared by adding 7.5 g of calcium L-lactate pentahydrate powder (C(CH3CHOHCOO)2.5H.sub.2O, USP grade, FisherChemicals, Fair Lawn, N.J.--which provides 5.31 g of calcium lactate) and 0.3 g of potassium sorbate(99%, Alfa Aesart.RTM., Shore Road, Heysham, Lancs--which prevents mold formation during storage) to a 250 ml flask. Demineralized water (60° C.) was then added to the flask to obtain a final weight of 100 g and the flask was stirred to dissolvethe calcium lactate powder. Subsequently a piece of 1.5×3 cm sand paper was added to the flask to provide a nucleation site for calcium lactate crystal formation and the flask was sealed with a rubber stopper.

Experimental solutions were prepared in the same manner as the control except that 1.5% of an additive ingredient was also added to the flask. The additive ingredients for this solubility model were: a) sodium gluconate powder (PMP FermentationProducts, Inc., Chicago, Ill.); b) malic acid disodium salt (C4H.sub.4O.sub.5Na.sub.2; Sigma-Aldrich, Inc., St. Louis, Mo.); c) acetic acid sodium salt (CH3COONa; Anhydrous; Sigma-Aldrich, Inc., St. Louis, Mo.); d) lactobionic acid(C12H.sub.22O.sub.12; Sigma-Aldrich, Inc., St. Louis, Mo.); and e) propionic acid sodium salt (CH3CH.sub.2COONa; Sigma-Aldrich, Inc., St. Louis, Mo.). All of the experimental solutions were adjusted to pH 6.6 using sodium hydroxide after aportion (approximately 80 ml) of the demineralized water was added and the calcium lactate had been dissolved. After preparation a sample of each solution was collected.

Subsequently all solutions were stored at 7° C. for 14 days. After 14 days the flasks were visually inspected for the presence of crystals on the sand paper and the solutions were filtered at 7° C. through filter paper (Whatman4; Whatman International Ltd., Maidstone, England). Crystal formation was visually observed on the sand paper in the control, sodium propionate, and sodium acetate solutions, whereas no crystals were visually observed in the sodium gluconate, sodiummalate, and sodium lactobionate solutions.

The supernatant and the sample collected prior to storage were analyzed for lactic acid using High Performance Liquid Chromatography (HPLC) and for calcium content by Atomic Absorption Spectroscopy (AAS), providing the results reported below inTables II and III.

TABLE-US-00002 TABLE II Calcium analysis Sample Initial Concentration After Storage % Reduction Control 1.12% .90% 19.64% 1.5% Sodium 1.09% 1.08% .92% gluconate 1.5% Sodium 1.07% 1.06% .93% malate 1.5% Sodium 1.12% 1.00% 10.71% acetate 1.5%Sodium 1.05% 1.04% .95% lactobionate 1.5% Sodium 1.09% .97% 11.01% proprionate

TABLE-US-00003 TABLE III Lactate analysis Sample Initial Concentration After Storage % Reduction Control 4.37% 3.82% 12.59% 1.5% Sodium 4.41% 4.41% 0.0% gluconate 1.5% Sodium 4.43% 4.47% +.92% malate 1.5% Sodium 4.56% 4.03% 11.62% acetate 1.5%Sodium 4.33% 4.33% 0.0% lactobionate 1.5% Sodium 4.33% 4.06% 6.24% proprionate

As shown in Table II and III the solutions with sodium gluconate, sodium malate, or sodium lactobionate had a minimal (10%) and lactate content (>6%). Consequently, in this model system the tested sodium salts of organic acids which qualify as CLCinhibitors are sodium gluconate, sodium malate and sodium lactobionate. CLC inhibitors are effective in preventing calcium lactate crystal formation will have no or essentially no

105

visually observable crystals and a minimal reduction (less than 5.0%, andmore preferably less than 1.0%) in the calcium and lactate content of the solution after 14 days of storage at 7° C. Accordingly, sodium propionate and sodium acetate are not CLC inhibitors.

Although the present invention has been described with reference to preferred embodiments, workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention. 1. Field of the Invention

The invention relates to the field of cheese products and methods for making the same.

2. Related Art

Cream cheese and similar products are ubiquitous in modern diets. These cheese products generally have a creamy texture and a bland, unremarkable flavor. Spreadability makes cream cheese convenient to use, which is the primary basis for itschoice by consumers over other firmer cheeses and the reason for its high volume consumption as a topping, for example on breads including bagels. In the classic method for making cream cheese, a pasteurized milkfat fluid such as cream, having abutterfat concentration generally within a range of between about 34.5% by weight and 52% by weight, is the primary raw material. This milkfat fluid is subjected to thorough digestion by lactic acid-producing bacteria, homogenized, and clotted byenzymes or direct acidification. The milkfat fluid is thus transformed into a solid phase referred to as the curd, and a liquid phase referred to as the whey. Most of the butterfat from the milkfat fluid is retained in the curd; and significant proteincontent, having substantial nutritional value and much of the appealing potential flavor in the milkfat fluid, remains in the whey. The curd is then processed into the cream cheese product, and the whey is discarded, along with its nutrients and flavor. As a result, cream cheese typically has a bland, dull, virtually unnoticeable taste. The retention of some of the liquid whey in the curd is a problem in itself, as the liquid gradually leaks out of the curd in an unappealing and ongoing separation thatis called syneresis. In addition, large scale cream cheese production generates corresponding quantities of often unusable whey, which thus becomes a waste expense and environmental detraction unless some other use can be found for it. Syneresis cansimilarly be a problem in many other cheese products.

The minimum fat content for cream cheese is 33% by weight. It is a pervasive goal in the human diet to consume less fat; and the relatively high butterfat content of a typical cream cheese is not helpful in achieving this goal. Cream cheese mayalso include high concentrations of cholesterol and sodium. High fat concentrations are also a problem in many other cheese products.

The maximum fat content for low-fat cream cheese is 16.5% by weight. Countless attempts have been made to make low-fat cream cheese products, but the resulting cheese products have typically failed due to unacceptable taste and poor texture. Asan example, some so-called low-fat cream cheese products have exhibited a bitter aftertaste, a glossy appearance, and a somewhat dry, plastic texture. Hence, despite the broad popularity of cream cheese, its use typically entails consumer acceptance ofa minimum butterfat content of 33% by weight, along with high concentrations of cholesterol and sodium, and a bland, unremarkable taste.

Yogurt, which is another highly prevalent milk-derived product, has an entirely different consistency than cream cheese, as well as a fundamentally different flavor. In illustration, yogurt is considered to be a food, whereas cream cheese isconsidered to be a condiment. For example, cream cheese is a popular topping for bread products such as bagels, but yogurt is not. On the other hand, yogurt has a robust, appealing flavor. Yogurt also typically has lower concentrations of butterfat,cholesterol and sodium than cream cheese as well as a higher concentration of protein.

A health-conscious consumer might well make the simple observation that nonfat yogurt has a robust, appealing flavor, find the concept of combining yogurt and cream cheese to be appealing, and thus attempt to combine these products together. However, due to the disparate properties of cream cheese and yogurt, including for example their differing consistencies, water content, and food chemistries, combining cream cheese and yogurt in mutually appreciable proportions may only generate a runnymess or an unstable composition exhibiting marked syneresis over a reasonable storage period. A consumer might instead attempt to drain the liquid from the solid phase of the yogurt before combining in the cream cheese, thereby discarding whey includingprotein from the yogurt. Similar problems can be expected where other types of cheeses are substituted for cream cheese, if an attempt is made to combine such cheeses with yogurt.

Accordingly there is a continuing need for low-fat cheese products including a milkfat fluid, having the

106

appealing texture and flavor of high-milkfat cheeses.

SUMMARY

In one implementation, a process is provided for making a Low-Fat Yogurt-Cheese Composition, including: providing a composition including a milkfat fluid; combining yogurt with the composition including a milkfat fluid to form a compositionincluding yogurt and a milkfat fluid; combining milk protein with the composition including yogurt and a milkfat fluid; and forming a blend including the milk protein and the composition including yogurt and a milkfat fluid.

In another example, a Low-Fat Yogurt-Cheese Composition is provided, including: cream cheese at a concentration within a range of between about 75% by weight and about 15% by weight; yogurt at a concentration within a range of between about 40%by weight and about 10% by weight; and milk protein at a concentration within a range of between about 45% by weight and about 15% by weight.

Other systems, methods, features and advantages of the invention will be or will become apparent to one with skill in the art upon examination of the following figures and detailed description. It is intended that all such additional systems,methods, features and advantages be included within this description, be within the scope of the invention, and be protected by the accompanying claims. 

BRIEF DESCRIPTION OF THE FIGURES

The invention may be better understood with reference to the following figures. The components in the figures are not necessarily to scale, emphasis instead being placed upon illustrating the principles of the invention. Moreover, in thefigures, like reference numerals designate corresponding parts throughout the different views.

FIG. 1 is a flow chart showing an example of an implementation of a process 100 for making a Low-Fat Yogurt-Cheese Composition ("Low-Fat Yogurt-Cheese Composition").

FIG. 2 is a flow chart showing an implementation of an example of a process 200 for preparing a yogurt to be utilized in step 118 of FIG. 1.

FIG. 3 is a flow chart showing an example of an implementation of a process 300 for preparing a whipped Low-Fat Yogurt-Cheese Composition.

DETAILED DESCRIPTION

FIG. 1 is a flow chart showing an example of an implementation of a process 100 for making a Low-Fat Yogurt-Cheese Composition ("Low-Fat Yogurt-Cheese Composition"). The process starts at step 102. In step 104, a composition including a milkfatfluid is provided or prepared. Throughout this specification, the term "milkfat" refers to the fatty components of edible milk, for example, cow milk. These fatty components, commonly referred to collectively as butterfat, may include, as examples,triacylglycerols, diglycerides, monoacylglycerols, other lipids, and mixtures.

Throughout this specification, the term "milkfat fluid" refers to a liquefied composition including milkfat, which may as examples be directly derived from milk or reconstituted by hydrating a dehydrated milk product. In an implementation, themilkfat fluid may include cream. As examples, a milkfat fluid may be formulated from one or more sources, including for example, whole milk, cream, skim milk, and dry milk.

In an implementation, the milkfat fluid utilized in the composition including a milkfat fluid may have a butterfat content within a range of between about 10% and about 52% by weight. As another example, the milkfat fluid may have a butterfatcontent within a range of between about 34.5% and about 52% by weight. In a further implementation, the milkfat fluid may have a butterfat content within a range of between about 33% and about 50% by weight. As an additional example, the milkfat fluidmay have a butterfat content within a range of between about 39% and about 50% by weight. In another example, the milkfat fluid may have a butterfat content within a range of between about 40% and about 44% by weight. In yet another implementation, themilkfat fluid may have a butterfat content within a range of between about 17% and about 33% by weight. In an implementation, the milkfat fluid may have a water content within a range of between about 40% and about 70% by weight. As a further example,the milkfat fluid may include milk protein at a concentration of about 2% by weight. In an additional implementation, the milkfat fluid may be cream including butterfat at a concentration within a range of between about 52% by weight and about 10%

107

byweight; protein at a concentration of about 2% by weight; and water at a concentration within a range of between about 40% by weight and about 70% by weight. As an example, heavy cream may have a butterfat content of about 37% by weight, a proteincontent of about 2% by weight, and a water content of about 58% by weight, with the balance made up by other milk solids. Butterfat may be a major ingredient in cheese, as butterfat may be coagulated together with proteins and other ingredients into acurd and further processed to produce cheese. The term "cheese" as utilized throughout this specification is broadly defined as a milkfat fluid that has been at least partially digested by culture bacteria, or otherwise coagulated.

In an implementation, a stabilizer may be combined with the composition including a milkfat fluid at step 104. Combining a stabilizer with the composition including a milkfat fluid may thicken the composition including a milkfat fluid, as anexample by binding water. The stabilizer may also contribute to binding together of the ingredients of the composition including a milkfat fluid. This thickening may result in increased retention of whey protein in the composition including a milkfatfluid during subsequent steps of the process 100. Combining into the composition including a milkfat fluid of a selected stabilizer having a water binding capability that effectively facilitates inclusion of a higher concentration of water may alsoyield a Low-Fat Yogurt-Cheese Composition having a more creamy texture. In another example (not shown), a stabilizer may be combined with the composition including a milkfat fluid following completion of bacteria culture in steps 108-112 discussedbelow. As another implementation, a stabilizer may be combined with the composition including a milkfat fluid at a different point in the process 100 that is prior to combination of yogurt with the composition including a milkfat fluid in step 118discussed below. In a further implementation, a stabilizer may be combined with the composition including a milkfat fluid at a later point in the process 100. As an example, a stabilizer may be combined with the composition including a milkfat fluidprior to homogenization at step 120 discussed below, so that any lumpy texture in the composition including a milkfat fluid resulting from combining the composition including a milkfat fluid and stabilizer may be minimized by homogenization at step 120. In another implementation, a stabilizer may be combined with a composition including yogurt, milkfat fluid and milk protein at step 122 discussed below.

The stabilizer may be selected from, as examples, guns, salts, emulsifiers, and their mixtures. Gums that may be suitable include, as examples, locust bean gum, xanthan gum, guar gum, gum arabic, and carageenan. In an implementation, salts thatmay be suitable include sodium chloride and potassium chloride. These salts may, as an example, be introduced in suitable concentrations as flavorings for the Low-Fat Yogurt-Cheese Composition. Emulsifiers that may be suitable include, as examples,sodium citrate, potassium citrate, mono-, di-, and tri-sodium phosphate, sodium aluminum phosphate, sodium tripolyphosphate, sodium hexametaphosphate, dipotassium phosphate, and sodium acid pyrophosphate. In an implementation, the stabilizer may includeK6B493. The stabilizer K6B493 may be in the form of a milled, dry product commercially available from CP Kelco US, Inc., 1313 North Market Street, Wilmington, Del. 19894-0001. As another example, the stabilizer that is utilized may include a distilledglyceride produced by the distillation of mono-glycerides themselves produced by esterification of a triglyceride and glycerol. In an implementation, a variety of stabilizers may be obtained through choices of triglycerides and a selected concentrationof monoglyceride. Distilled glycerides that may be suitable include those commercially available from Danisco USA Inc. under the trade name, DIMODAN.RTM.. Gum arabic may be commercially available from TIC Gums Inc., Belcamp, Md. As an example, astabilizer blend including xanthan gum, locust bean gum and guar gum may be commercially available from TIC Gums Inc. Gum-based stabilizers may contain sodium. In an implementation, this sodium may be taken into account in selecting ingredients formaking a Low-Fat Yogurt-Cheese Composition in order to avoid an excessively high overall sodium concentration. As an example, a stabilizer composition that does not include sodium may be selected. In another implementation, the incorporation of asignificant proportion of yogurt into the Low-Fat Yogurt-Cheese Composition may reduce the overall sodium concentration, as the yogurt may itself have a low sodium concentration.

In an example, a concentration of a stabilizer may be selected that is effective to cause a moderate thickening of the composition including a milkfat fluid. In an implementation, a stabilizer may be combined with the composition including amilkfat fluid in an amount to constitute a concentration within a range of between about 0.2% by weight and about 0.5% by weight of the Low-Fat Yogurt-Cheese Composition. In another implementation, a stabilizer may be introduced in an amount toconstitute a concentration of about 0.45% by weight of the Low-Fat Yogurt-Cheese Composition. As an example, as the butterfat content of a selected composition including a milkfat fluid may be relatively reduced, a concentration of a stabilizer to beutilized may be proportionally increased.

In an implementation, a milk protein may be combined in a small concentration with the composition including a milkfat fluid at step 104. As examples, the milk protein may include: milk protein concentrate, whole milk protein, whey proteinconcentrate, casein, Baker's cheese, yogurt powder, dry cottage cheese

108

curd, milk protein curd, or a mixture. In an implementation, the milk protein may help increase the thickness of the composition including a milkfat fluid in order to reduce anytendency for separation of the composition including a milkfat fluid into butterfat and milk protein phases to occur. Milk protein concentrate may be produced, as an example, by ultrafiltration of milk. Whey protein compositions having proteinconcentrations of about 30% by weight, about 50% by weight, and about 85% by weight, as examples, may be commercially available. In an implementation, a milk protein may be combined into the composition including a milkfat fluid at a resultingconcentration within a range of between about 1% by weight and about 15% by weight. As a further example, a milk protein may be combined into the composition including a milkfat fluid at a resulting concentration within a range of between about 5% byweight and about 9% by weight. In an additional implementation, a milk protein may be combined into the composition including a milkfat fluid at a resulting concentration of about 7% by weight.

In an implementation, an edible oil may be combined with the milkfat fluid in forming the composition including a milkfat fluid. As another example, the edible oil may be omitted. Throughout this specification, the term "oil" refers to anedible oil of vegetable or animal origin or of both vegetable and animal origin. In an implementation, a vegetable oil derived from seeds or fruit of one or more of the following may be utilized: soy, corn, canola, sunflower, safflower, olive, peanut,cottonseed, sesame, almond, apricot, avocado, coconut, flax, grapeseed, hazelnut, palm, pine, poppy, pumpkin, rice bran, tea, walnut, and wheat. As another example, an animal oil including one or more of the following may be utilized: lard, shortening,suet, and tallow. As an example, an edible oil that may reduce a serum cholesterol level in a consumer may be utilized. In an implementation, palm oil may so reduce a serum cholesterol level. In another example, an edible oil may be useful forpreparing a Low-Fat Yogurt-Cheese Composition having a creamy texture. Edible oils, however, may be substantially 100% fat. Hence, the combination of an edible oil with a milkfat fluid at step 104 may generate a composition including a milkfat fluidhaving a higher fat concentration than that of the milkfat fluid itself. As an example, the composition including a milkfat fluid may include a concentration of an edible oil (weight/weight as a fraction of the composition including a milkfat fluid)within a range of between about 3% and about 70%; and a weight/weight concentration of a milkfat fluid within a range of between about 97% by weight and about 30% by weight. In another implementation, the composition including a milkfat fluid mayinclude a weight/weight concentration of an edible oil within a range of between about 3% and about 40%, the balance being milkfat fluid. As a further example, the composition including a milkfat fluid may include a weight/weight concentration of anedible oil within a range of between about 5% and about 27%, the balance being milkfat fluid. In an additional implementation, the composition including a milkfat fluid may include a weight/weight concentration of an edible oil within a range of betweenabout 8% and about 11%, the balance being milkfat fluid. In an alternative implementation, an edible oil may be combined with the milkfat fluid at a later point in the process 100. As an example, an edible oil may be combined with the milkfat fluidprior to initiation of blending at step 124 discussed below, so that blending may result in a Low-Fat Yogurt-Cheese Composition having a substantially uniform texture. As an implementation, the Low-Fat Yogurt-Cheese Composition may include an oil at aconcentration within a range of between about 20% and about 5% by weight. In another example, the Low-Fat Yogurt-Cheese Composition may include an oil at a concentration within a range of between about 12% and about 9% by weight.

In an implementation, the composition including a milkfat fluid may be pasteurized at step 106. Prior to this step, the composition including a milkfat fluid may carry a wild bacteria load as is normally present in raw milk products. Pasteurization of the composition including a milkfat fluid is required at some point in order to kill these wild bacteria, as well as other wild microbes, to an extent reasonably feasible. Furthermore, if the composition including a milkfat fluid is tobe subjected to culture bacteria in steps 108-112 or steps 128-132 discussed below, pasteurization needs to be completed in advance of those steps or the wild bacteria in the raw milkfat fluid will typically digest and thereby spoil the composition. Where a source of pre-pasteurized milkfat fluid is employed, further pasteurization at this point may be unnecessary.

Pasteurization causes irreversible heat-induced denaturation and deactivation of bacteria. Effective pasteurization is a function of both time and temperature; pasteurization may be completed at higher temperatures in correspondingly shortertimes. In one implementation, pasteurization of the composition including a milkfat fluid in step 106 may be carried out in a vat process at a temperature of about 150° Fahrenheit ("F") for about 30 minutes; or about 165° F. for about 15minutes; or if a more strenuous process is selected, about 170° F. for about 30 minutes. Other time and temperature treatment parameters that may be effective are known; and substitution of high surface area contact methods for the vat processmay permit shorter effective treatment times. High temperature short time pasteurization for example, in which the composition including a milkfat fluid may be pumped through an in-line tube within a temperature-controlled shell, may be used. Milkfatfluids having relatively high butterfat content may require more heat exposure than low butterfat fluids in order to obtain effective pasteurization. Further background information on

109

pasteurization of milk is provided in the Grade "A" Pasteurized MilkOrdinance published on May 15, 2002 by the U.S. Food & Drug Administration, particularly at pages 62 and 63; the entirety of which is hereby incorporated herein by reference.

Agitation may be provided and may be initiated prior to the heating process during pasteurization to facilitate more even heating throughout the composition including a milkfat fluid and to avoid localized overheating. The force applied by theagitation may be moderated to avoid strong shearing, which may degrade proteins and butterfat in the composition including a milkfat fluid. In an example, pasteurization may be carried out in a tank equipped with a heater and agitator. Any such vesselmay generally be used, such as, for example, a Groen kettle. In another example, step 106 may be omitted.

In an implementation, the temperature of the composition including a milkfat fluid may be adjusted at step 108 to a bacteria culture temperature. As an example, the temperature of the composition including a milkfat fluid may be adjusted towithin a range of between about 65° F. and about 92° F. In an additional implementation, the temperature of the composition including a milkfat fluid may be adjusted to within a range of between about 70° F. and about 85° F. As a further example, the temperature of the composition including a milkfat fluid may be adjusted to within a range of between about 79° F. and about 85° F. In another implementation, the temperature of the composition including amilkfat fluid may be adjusted to within a range of between about 80° F. and about 81° F. In yet a further example, the temperature of the composition including a milkfat fluid may be adjusted to about 82° F. In another example,step 108 may be omitted.

As an example, culture bacteria may be combined with the composition including a milkfat fluid at step 110, and then cultured at step 112. These steps may generate robust culture-induced flavor in the composition including a milkfat fluid. Milkcontains lactose sugars that may be digested by selected bacteria, producing lactic acid, glucose and galactose as metabolites. Hence, the culture bacteria generally may be selected from among those that can digest lactose. In an example, a strain ofmesophilic bacteria suitable for culturing cheese may be used. Such bacteria strains may be chosen, as an example, to produce diacetyl flavor. Bacteria strains may require ongoing rotational use, to prevent background bacteriophage populations frombecoming resistant to a particular strain of bacteria, which may result in shutdown of the culture process and contamination of the Low-Fat Yogurt-Cheese Composition during its production. For example, the culture bacteria may be selected from varyingcombinations of strains, which may be rotated on an ongoing basis, of (1) lactic acid-producing Lactococcus lactis subspecies lactis or subspecies cremoris; and (2) diacetyl flavor-producing Lactococcus lactis subspecies diacetylactis or Leuconostocstrains. Bacteria strains that may be suitable are commercially available under the trade name pHage Control™ from Chr. Hansen, Boge Alle 10-12, DK-2970 Horsholm, Denmark. Grades 604, 608, 2000-10, 2000-30 and 2000-90, as examples, may beeffective. These particular bacteria strain blends may be used continuously without rotation, provided that proper sanitation is maintained. Further bacteria strains that may be suitable are commercially available under the trade names Flav Direct™ and DG™ Cultures from Degussa BioActives, 620 Progress Avenue, P.O. Box 1609, Waukesha, Wis. 53187-1609.

Once a culture bacteria strain or strain mixture is selected, an amount may be combined with a given batch of composition including a milkfat fluid that may be effective to propagate live cultures throughout the batch in a reasonable time at thechosen culture temperature. For example, 500 grams of bacteria may be effective to inoculate up to 7,500 pounds of composition including a milkfat fluid using an inoculation proportion of about 0.015% by weight. As an example, an inoculation proportionwithin the range of between about 0.013% by weight and about 0.026% by weight may be used. In general, greater proportional inclusions of culture bacteria in a batch of the composition including a milkfat fluid may lead to somewhat reduced processingtime, at the expense of increased costs for the bacteria.

In an implementation, the composition including a milkfat fluid may be agitated during or following the introduction of the culture bacteria. The culture bacteria may be combined in a small proportion compared with the composition including amilkfat fluid, and hence may need to be dispersed so that they may act throughout the composition including a milkfat fluid. Agitation may begin, as an example, prior to introduction of the culture bacteria, and may be continued after dispersion of theculture bacteria. The shear force applied by the agitation may be selected to be sufficient to disperse the culture bacteria in a reasonable time, but not so strong as to substantially shear and thus degrade the culture bacteria or the proteins andbutterfat in the composition including a milkfat fluid. As an example, moderate agitation of the composition including a milkfat fluid containing the culture bacteria may be continued for a time period within a range of between about 10 minutes andabout 25 minutes. In another implementation, moderate agitation may be continued for about 15 minutes.

110

In step 112, the culture bacteria, if introduced at step 110, may be cultured in the composition including a milkfat fluid. In an implementation, the composition including a milkfat fluid may be held at a suitable temperature long enough forcultures of the selected bacteria to begin development, resulting in a slight thickening of the composition including a milkfat fluid. The necessary duration of such bacteria culturing depends on a variety of factors including, as examples, the level ofbacteria activity, the selected culture temperature, the initial bacteria concentration, and the ingredients in the composition including a milkfat fluid. The culture bacteria may digest lactose sugars in the milk. High culture temperatures and highinitial bacteria concentrations may generally shorten the culture time needed. The culture temperature employed, however, must be within a range tolerable to the survival and growth of the selected culture bacteria. In an example, the compositionincluding a milkfat fluid may be cultured with the selected bacteria for a time period within a range of between about 60 minutes and about 90 minutes. A bacteria culture step of such a limited duration may generate a mild thickening of the compositionincluding a milkfat fluid. In another example, steps 108-112 may be omitted.

In an implementation, the composition including a milkfat fluid may be pasteurized at step 114. As an example, pasteurization step 114 may be carried out as discussed above in connection with step 106. In an implementation, the compositionincluding a milkfat fluid may be pasteurized at step 114 before the bacteria culture of step 112 has caused any substantial thickening of the composition including a milkfat fluid to occur. This pasteurization at step 114 may thus terminate bacteriaculture step 112. Very little change in the pH of the composition including a milkfat fluid may occur in such a mild bacteria culture step. As an example, limiting the bacteria culture of step 112 to a mild thickening of the composition including amilkfat fluid in this manner may be a fundamental and major departure from a typical process for the production of cream cheese. In a typical process for the production of cream cheese, bacteria culture may be permitted to run its course until a pH of amilkfat fluid may be reduced to within a range of between about 5.0 and about 4.1.

In a further implementation, a temperature of the composition including a milkfat fluid may be gradually raised during steps 104-114, so that pasteurization may be initiated at step 114 in due course when the composition including a milkfat fluidreaches an effective pasteurization temperature. In another example, step 114 may be omitted.

In another implementation, bacteria culture at step 112 may be continued for a sufficient time to partially or substantially digest the composition including a milkfat fluid, as may be limited by an attendant reduction of the pH toward anendpoint where bacteria activity may markedly decrease. Lactic acid may be formed as a byproduct of metabolism of lactose by the bacteria in step 112. Hence, a measured pH of the composition including a milkfat fluid, which may gradually decline withlactic acid buildup, may be an indication of the progress of the bacteria culture. In an example, bacteria culture at step 112 may be continued until the pH of the composition including a milkfat fluid may be within a range of between about 5.0 andabout 4.1. As another implementation, bacteria culture at step 112 may be continued until the pH of the composition including a milkfat fluid may be within a range of between about 4.6 and about 4.4. The bacteria activity may become substantiallydormant within either of these pH ranges.

In an implementation, the composition including a milkfat fluid resulting from some or all of the process steps 104-114 may be a cream cheese. Throughout this specification, "cream cheese" designates a composition including cream that has beencultured using the bacteria discussed above in connection with step 110 or the bacteria discussed below in connection with step 130, or both. The bacteria culture may as an example be continued until a pH within a range of between about 4.7 and about4.5 is reached. In another example, the bacteria culture may be terminated at a pH greater than about 5.0, and a pH within a range of between about 4.7 and about 4.5 may be reached in step 134 discussed below, by a direct set process including additionof an edible acid to the milkfat fluid. As an example, the bacteria culture may be terminated at a pH within a range of between about 6.5 and about 6.8, followed by a direct set at step 134. In a further implementation, any ingredient satisfying thestandard of identity for cream cheese, including cream cheese, Neufchatel cheese, reduced fat cream cheese, or a cream cheese designated as low-fat or light, as codified by federal regulations of the U.S. government or as defined in specifications forcream cheese of the U.S. Department of Agriculture, may be utilized as an ingredient at step 118 instead of carrying out steps 104-114. Cream cheese includes not more than 55% by weight moisture and not less than 33% by weight milkfat. Neufchatelcheese includes not more than 65% by weight moisture and not less than 20% by weight milkfat, but also includes less than 33% by weight milkfat. Reduced fat cream cheese includes not more than 70% by weight moisture and not less than 16.5% by weightmilkfat, but also less than 20% by weight milkfat. Low-fat or light cream cheese includes not more than 70% by weight moisture and not more than 16.5% by weight milkfat.

111

In an implementation, the temperature of the composition including a milkfat fluid may be adjusted at step 116 to a temperature suitable for subsequent combination of yogurt together with the composition including a milkfat fluid at step 118. Inan example, the temperature of the composition including a milkfat fluid may promptly be lowered, following completion of pasteurization at step 114, to a more moderate level in order to minimize ongoing heat damage to butterfat and milk proteins as wellas any other components of the composition including a milkfat fluid. As another implementation, the temperature of the composition including a milkfat fluid may be lowered to a more moderate level following completion of pasteurization at step 114 soas not to unduly shock or kill beneficial culture bacteria present in the yogurt during combination of the yogurt with the composition including a milkfat fluid at step 118 as discussed below. If the yogurt is exposed to a temperature suitable forpasteurization, the beneficial yogurt bacteria may be killed.

As a further example, the composition including a milkfat fluid may be cooled at step 116 to a temperature suitable for carrying out further steps of the process 100. In an implementation, the composition including a milkfat fluid may be cooledat step 116 to a temperature within a range of between about 110° F. and about 128° F. As another example, the composition including a milkfat fluid may be cooled at step 116 to a temperature within a range of between about 115° F. and about 128° F. The composition including a milkfat fluid may be cooled at step 116 in an additional implementation to a temperature within a range of between about 120° F. and about 125° F. As a further example, thecomposition including a milkfat fluid may be cooled at step 116 to a temperature of about 125° F. In another implementation, the composition including a milkfat fluid may be cooled at step 116 to a refrigeration temperature such as a temperaturewithin a range of between about 34° F. and about 38° F., and may then be temporarily stored prior to further processing.

Following the completion of some or all of steps 104-116 as discussed above, the composition including a milkfat fluid may be combined together with yogurt at step 118 to form a composition including yogurt and a milkfat fluid. As an example,the composition including a milkfat fluid resulting from some or all of steps 104-116 of the process 100 may be a uniform material that may include butterfat and whey protein among its ingredients. In an implementation, steps 104-116 of the process 100may not include a direct acidification step. Direct acidification of the composition including a milkfat fluid prior to its combination with yogurt at step 118 may cause the curd and whey of the composition including a milkfat fluid to separate fromeach other. This separation may inhibit the incorporation of whey protein, such as whey protein from the milkfat fluid, into the Low-Fat Yogurt-Cheese Composition. Whey protein may generally become separated in liquid form from the curd in conventionalcream cheese production, the curd essentially constituting the product. Hence, the composition including a milkfat fluid that may result from completion of some or all of steps 104-116 and that may have not been subjected to direct acidification, is nota cream cheese. As an example, substitution of cream cheese for the composition including a milkfat fluid as an ingredient in step 118 may decrease a maximum concentration of whey protein that may be incorporated into the Low-Fat Yogurt-CheeseComposition. Further, the direct combination together of cream cheese and yogurt in mutually substantial proportions may not yield a homogenous single-phase product. Substitution of other conventional cheeses for the composition including a milkfatfluid may similarly inhibit incorporation of whey protein into the Low-Fat Yogurt-Cheese Composition.

In an implementation (not shown), a conventional cheese such as cream cheese may be combined as an ingredient into the Low-Fat Yogurt-Cheese Composition. As an example, conventional cream cheese may be combined with the composition including amilkfat fluid at step 118 or at another point in the process 100, in a selected concentration. As the concentration of conventional cheese in the Low-Fat Yogurt-Cheese Composition is increased, the overall fat concentration of the Low-Fat Yogurt-CheeseComposition may accordingly increase as well.

In an implementation, a yogurt and the composition including a milkfat fluid may be combined together at step 118 to form a composition including yogurt and a milkfat fluid. As an example, any yogurt may be utilized. Yogurt may be broadlydefined as a milkfat fluid that has been cultured by at least one bacteria strain that is suitable for production of yogurt. In an implementation, a yogurt may be utilized that includes: butterfat at a concentration within a range of between about 0%and about 3.25% by weight; milk protein at a concentration within a range of between about 3% and about 15% by weight; and water at a concentration within a range of between about 82% and about 97% by weight. In another example, a yogurt may be utilizedthat includes: butterfat at a concentration within a range of between about 0.5% and about 3.25% by weight; milk protein at a concentration within a range of between about 6% and about 12% by weight; and water at a concentration within a range of betweenabout 85% and about 94% by weight. As a further implementation, a yogurt may be utilized that includes: butterfat at a concentration within a range of between about 0.5% and about 2.0% by weight; milk protein at a concentration of about 9% by weight;and water at a concentration within a range of between about 89% and about 91% by weight. A yogurt may be utilized in another example that includes: butterfat at a concentration of about 0.16% by weight; milk protein at a

112

concentration of about 9% byweight; and water at a concentration of about 91% by weight. In an implementation, a yogurt may be utilized having a total solids content of at least about 8% by weight.

FIG. 2 is a flow chart showing an implementation of an example of a process 200 for preparing a yogurt to be utilized in step 118 of FIG. 1. Referring to FIG. 2, the process 200 starts at step 210, and milk for preparing the yogurt may beprovided at step 220. The milk selected for preparing the yogurt may be, as examples, whole milk, reduced fat milk, or skim milk. Butterfat present in the milk may facilitate the process 200, as butterfat may contribute to the feasibility of thickeningthe yogurt to a selected consistency. However, butterfat present in the milk that is utilized to prepare the yogurt also contributes to the overall fat concentration in the Low-Fat Yogurt-Cheese Composition. In an implementation, skim milk may beutilized in step 220, in order to reduce the overall fat concentration of the Low-Fat Yogurt-Cheese Composition. As another example, milk having a butterfat content of less than about 1% by weight may be utilized. In a further implementation, theselected milk may be liquid milk such as cow milk, or the milk may be reconstituted from dry milk.

In an implementation, a solids concentration of the milk to be utilized in preparing the yogurt may be standardized to within a range of between about 18% and about 22% by weight. In another implementation, the solids concentration of the milkmay be standardized to about 22% by weight. As an example, if the solids concentration of the milk is substantially in excess of 22% by weight, the bacteria culture utilized to prepare the yogurt may digest the milk too slowly for completion of theprocess 200 within a reasonable time period. In a further example, a robust bacteria strain may be selected or the milk may be inoculated with an extra high bacteria load, to facilitate utilization of milk having a relatively high solids concentration. In another implementation, the solids concentration of the milk may be standardized to within a range of between about 10% and about 12% by weight, as may be selected in a conventional process for the preparation of yogurt. As an example, however, sucha relatively low solids concentration may hinder production of a Low-Fat Yogurt-Cheese Composition having an acceptably thick texture. In an implementation, an initial solids concentration of milk selected for utilization at step 220 may be increased toa selected higher concentration by any process suitable to yield a condensed milk. As an example, a condensation process that does not involve heating the milk, such as an ultrafiltration process, may be utilized in order to minimize resultingdegradation of the milk.

At step 230, the milk may be pasteurized. In an implementation, this pasteurization may be carried out as earlier discussed with regard to step 106. As an example, pasteurization of the milk may be carried out by maintaining the milk at atemperature of at least about 165° F. for at least about 15 minutes. In another implementation, pasteurization of the milk may be carried out by maintaining the milk at a temperature of about 170° F. for about 30 minutes. As a furtherexample, the milk may be agitated during the pasteurization, which may facilitate more uniform heating of the milk and may avoid its localized overheating.

At step 240, the milk may be cooled to a bacteria culture temperature. As an example, the temperature of the milk may be promptly reduced to a moderate level following completion of its pasteurization in order to reduce ongoing heat damage ofthe milk. In another example, the milk may not be maintained at the high temperatures necessary for pasteurization when bacteria may be cultured in the milk at steps 250-260 discussed below, or the bacteria may not survive. In an implementation, themilk may be cooled at step 240 to a temperature within a range of between about 90° F. and about 115° F. In another example, the milk may be cooled at step 240 to a temperature within a range of between about 106° F. and about110° F. As an additional implementation, the milk may be cooled at step 240 to a temperature of about 108° F.

At step 250, culture bacteria may be combined with the milk. In an implementation, bacteria strains that may be suitable for the preparation of yogurt may be utilized. As examples, Lactobacillus delbrueckii subspecies bulgaricus, Streptococcusthermophilus, Lactobacillus acidophilus, Bifidobacterium, and Lactobacillus paracasei subspecies casei may be utilized. As another implementation, other lactic acid-producing bacteria strains that may be suitable for preparing yogurt may be utilized. Yogurt culture bacteria strains that may be suitable are commercially available under the trade name Yo-Fast.RTM. from Chr. Hansen, Boge Alle 10-12, DK-2970 Horsholm, Denmark. The bacteria strain F-DVS YoFast.RTM.-10 as an example, which may containblended strains of Streptococcus thermophilus, Lactobacillus delbrueckii subspecies bulgaricus, Lactobacillus acidophilus, Bifidobacterium, and Lactobacillus paracasei subspecies casei, may be utilized. In another implementation, DVS YoFast.RTM.-2211may be utilized. As an additional implementation, a yogurt culture including Lactobacillus acidophilus, Bifidobacterium, and L. casei may be utilized. In an example, Yo-Fast.RTM. 20 cultures that may include mixtures of Lactobacillus acidophilus,Bifidobacterium, and L. casei, may be utilized. Such yogurt cultures may develop a very mild flavor and may contribute to an appealing texture in the Low-Fat Yogurt-Cheese Composition. These yogurt cultures may also make possible a reduction in aneeded concentration of or possibly an elimination of stabilizers that may otherwise be needed

113

for increasing the thickness of the composition to an adequate, appealing level. These yogurt cultures may require minimal direct acidification, which mayresult in a longer shelf life for the Low-Fat Yogurt-Cheese Composition. Such yogurt cultures may also lend an appealing mouth feel and creaminess to the Low-Fat Yogurt-Cheese Composition. In another implementation, further bacteria strains that may besuitable are commercially available under the trade names Ultra-Gro.RTM. and Sbifidus.RTM. from Degussa BioActives, 620 Progress Avenue, P.O. Box 1609, Waukesha, Wis. 53187-1609.

In an implementation, step 250 may include combining a selected culture bacteria strain with the milk at a bacteria concentration that is effective to propagate live bacteria cultures throughout a given batch of milk in a reasonable time at aselected culture temperature. As an example, a relatively higher concentration of culture bacteria may correspondingly reduce the time period needed to complete step 250, but at the expense of increased costs for the bacteria.

In an implementation, the milk may be agitated during all or part of step 250, as the concentration of the culture bacteria may be small compared with that of the milk. As an example, the culture bacteria may be actively dispersed throughout themilk. In another implementation, agitation may be initiated before the culture bacteria are combined with the milk, and agitation may also be continued after the culture bacteria have been dispersed in the milk. In an example, a shear force of theagitation may be sufficient to disperse the culture bacteria in a reasonable time, but may not be so strong as to degrade the culture bacteria, or the proteins and butterfat in the milk. In an implementation, the milk and culture bacteria may besubjected to moderate agitation for a time period within a range of between about 10 minutes and about 25 minutes. As another example, the milk and culture bacteria may be subjected to moderate agitation for a time period of about 15 minutes.

In step 260, bacteria introduced at step 250 may be cultured in the milk. In an implementation, the milk may be maintained at a temperature suitable for cultures of the selected bacteria to develop, over a time period sufficient so that avisible curd may form throughout the milk. The visible curd may be accompanied by a substantial thickening of the milk. As an example, the milk may be maintained for a selected time period at a temperature within a range of between about 95° F.and about 112° F. In another implementation, the milk may be maintained for a selected time period at a temperature within a range of between about 100° F. and about 110° F. As a further example, the milk may be maintained for aselected time period at a temperature within a range of between about 106° F. and about 110° F. In an additional implementation, the milk may be maintained for a selected time period at a temperature of about 108° F. In anexample, an optimum duration of the bacteria culturing may depend on the level of bacteria activity, the selected culture temperature, the initial bacteria concentration, and the composition of the milk. In an implementation, the milk may be culturedwith selected bacteria for a time period within a range of between about 4 hours and about 6 hours. As another example, the milk may be cultured with selected bacteria at a temperature of about 108° F. for about 6 hours.

Lactic acid may be formed as a byproduct of metabolism of lactose by the bacteria in step 260. Hence, a measured pH of the milk, which may gradually decrease with lactic acid buildup, may be an indication of the progress of the bacteria culturetoward completion. In an implementation, when a pH of the milk reaches about 4.4, the level of bacteria activity may begin to markedly decrease. As an example, the bacteria culture in step 260 may be continued until a pH of the milk is within a rangeof between about 5.0 and about 4.1. In another implementation, the bacteria culture step 260 may be continued until a pH of the milk is within a range of between about 4.6 and about 4.4. As a further example, the bacteria culture step 260 may becontinued until a pH of the milk is about 4.5.

When the milk reaches a selected pH, the process 200 may end at step 270. The resulting product is yogurt that may contain live culture bacteria. As an example, the yogurt may have a uniform consistency and a solids content of at least about 8%by weight.

Returning to step 118 of FIG. 1, yogurt and the composition including a milkfat fluid may be combined together to form a composition including yogurt and a milkfat fluid. In an implementation, the yogurt and the composition including a milkfatfluid may be simultaneously prepared so that some or all of steps 118-138 of the process 100 discussed below may then immediately be carried out. As an example, yogurt prepared according to the process 200 discussed above may already be at a suitabletemperature for its combination with the composition including a milkfat fluid at step 118. In an implementation, the composition including a milkfat fluid may have already been cooled at step 116 to that same temperature or to another compatibletemperature.

In an implementation, yogurt may be prepared in advance of carrying out any or all of steps 104-116 of the

114

process 100. As an example, yogurt may be prepared prior to preparing a composition including a milkfat fluid in step 104, and may then becooled to a refrigeration temperature to retard continuation of bacteria activity in the yogurt until selected steps from among steps 104-116 of the process 100 have been executed. In an implementation, the yogurt may be so cooled to a temperaturewithin a range of between about 34° F. and about 38° F., and then may be reheated. As an example, the yogurt may be so reheated to a temperature within a range of between about 95° F. and about 112° F. In anotherimplementation, the yogurt may be so reheated to a temperature within a range of between about 100° F. and about 110° F. As a further example, the yogurt may be reheated to a temperature within a range of between about 106° F. andabout 110° F. In an additional implementation, the yogurt may be reheated to a temperature of about 108° F. As an example, yogurt may be prepared while or after some or all of steps 104-116 are carried out, so that the yogurt may bedirectly combined with the composition including a milkfat fluid at step 118 without reheating. Directly combining yogurt and the composition including a milkfat fluid at step 118 without reheating the yogurt may minimize degradation of the yogurt thatmay be caused by such reheating, including precipitation of the curd, attendant syneresis, and a reduction in the concentration of live culture bacteria.

Ambient air may contain bacteria that may be harmful to and cause degradation of the yogurt and the composition including a milkfat fluid. In an implementation, the yogurt and the composition including a milkfat fluid may be handled in a mannerto minimize their exposure both during and after their preparation to ambient air, as well as to minimize the exposure of the composition including yogurt and a milkfat fluid to ambient air.

As an example, the preparations of the yogurt and the composition including a milkfat fluid to be combined together at step 118 may be completed substantially at the same time. In an implementation, the respective temperatures of the yogurt andthe composition including a milkfat fluid may be selected and controlled with attention to preserving live culture bacteria in the yogurt, to minimizing further heating and cooling operations, and to preventing shock to or death of the live yogurtculture bacteria. In another example, live yogurt bacteria cultures, which themselves may provide well-known health benefits to the consumer, may be included in the Low-Fat Yogurt-Cheese Composition. As a further implementation, the temperature of thecomposition including a milkfat fluid and the temperature of the yogurt may each be adjusted if such temperatures are found to be too hot or too cold. In another example, the temperature of the composition including a milkfat fluid and the temperatureof the yogurt may be adjusted, before combining them together, to within a range of between about 110° F. and about 128° F., and to within a range of between about 95° F. and about 112° F., respectively. As an additionalimplementation, the temperature of the composition including a milkfat fluid and the temperature of the yogurt may be adjusted, before combining them together, to within a range of between about 115° F. and about 128° F., and to within arange of between about 100° F. and about 110° F., respectively. In a further example, the temperature of the composition including a milkfat fluid and the temperature of the yogurt may be adjusted, before combining them together, towithin a range of between about 120° F. and about 125° F., and to within a range of between about 100° F. and about 108° F., respectively. As another implementation, the temperature of the composition including a milkfatfluid and the temperature of the yogurt may be adjusted, before combining them together, to temperatures of about 125° F. and about 108° F., respectively.

In an implementation, relative concentrations of yogurt and composition including a milkfat fluid to be combined at step 118 may be selected. As an example, the composition including a milkfat fluid may contain a higher concentration ofbutterfat than does the yogurt. As another example, the yogurt may contain lower concentrations of cholesterol and sodium, and a higher concentration of milk protein, than the composition including a milkfat fluid. In another implementation, combininga substantial concentration of yogurt with the composition including a milkfat fluid may provide a robust flavor, a reduced concentration of cholesterol, and healthful active culture bacteria to the Low-Fat Yogurt-Cheese Composition. In an example, asufficient concentration of yogurt may be combined into a given batch of composition including a milkfat fluid to yield a selected substantial improvement in the flavor and texture of the Low-Fat Yogurt-Cheese Composition and to yield a selectedconcentration of healthful active culture bacteria in the composition.

In an implementation, the composition including yogurt and a milkfat fluid formed at step 118 may include yogurt at a resulting concentration within a range of between about 20% and about 45% by weight, and a composition including a milkfat fluidat a concentration within a range of between about 80% by weight and about 55% by weight. As a further example, the composition including yogurt and a milkfat fluid formed at step 118 may include yogurt at a resulting concentration within a range ofbetween about 30% and about 40% by weight, and a composition including a milkfat fluid at a concentration within a range of between about 70% by weight and about 60% by weight. As an additional example, the composition including yogurt and a milkfatfluid formed at step 118 may include yogurt at a resulting concentration of about 35% by

115

weight, and a composition including a milkfat fluid at a concentration of about 65% by weight.

In an implementation, the yogurt and the composition including a milkfat fluid may be combined together at step 118 within a reasonable time following completion of some or all of steps 104-116 discussed above. As another example, the yogurt andthe composition including a milkfat fluid may be separately prepared and stored, provided that excessive bacteria activity or heat-induced degradation is not permitted to take place in either of these ingredients over an extended time period before theyare combined together in step 118.

In an implementation, step 118 may include thoroughly mixing together the yogurt with the composition including a milkfat fluid. As an example where the concentration of yogurt may be smaller than the concentration of the composition including amilkfat fluid, the yogurt may be combined with the composition including a milkfat fluid in order to carry out step 118. In an implementation, the mixing may be carried out in a vessel having an agitator. As an example, the yogurt and the compositionincluding a milkfat fluid may be combined together with moderate agitation for a selected time period. As another example, care may be taken to select an agitation level that may effectively mix the yogurt and the composition including a milkfat fluidtogether but that may also minimize shearing of milk proteins, butterfat, and live culture bacteria. In an implementation, mixing may be continued over a time period within a range of between about 10 minutes and about 30 minutes. As a further example,mixing may be continued over a time period of about 15 minutes. Thorough mixing together of the yogurt and the composition including a milkfat fluid at step 118, prior to homogenization at step 120 discussed below, may lead to a more uniform consistencyin the Low-Fat Yogurt-Cheese Composition.

In an implementation, a vessel utilized for carrying out step 118 may include heating and cooling exchangers suitable for adjusting and controlling a temperature of the composition including yogurt and a milkfat fluid to a selected temperature. As another example, the composition including yogurt and a milkfat fluid prepared at step 118 may be maintained at a temperature within a range of between about 118° F. and about 125° F. In a further implementation, the compositionincluding yogurt and a milkfat fluid prepared at step 118 may be maintained at a temperature within a range of between about 118° F. and about 120° F.

The arrow A shows that step 120 follows step 118 in FIG. 1. At step 120, the composition including yogurt and a milkfat fluid may be homogenized by subjecting the composition including yogurt and a milkfat fluid to an elevated pressure for aselected period of time, and then rapidly releasing the pressure. In an example, application of such an elevated pressure may break down butterfat globules in the composition including yogurt and a milkfat fluid and substantially reduce their potentialfor subsequent recombination and agglomeration, so that a composition including yogurt and a milkfat fluid having a substantially uniform texture may be prepared. As a further example, application of such an elevated pressure may cause butterfat andmilk protein to be thoroughly interdispersed, so that a composition including yogurt and a milkfat fluid having a substantially reduced potential for syneresis may be prepared. As an implementation, homogenization may be carried out at an elevatedpressure applied to the composition including yogurt and a milkfat fluid by any suitable means, such as, for example, hydraulic or mechanical force. As another example, the composition including yogurt and a milkfat fluid may be compressed to a selectedpressure and then passed through an orifice to quickly reduce the pressure.

In an implementation, the homogenization at step 120 may be carried out at a relatively high temperature. As an example, the fluidity of the composition including yogurt and a milkfat fluid may increase at higher temperatures, which may improvethe efficiency of the homogenization process. In an implementation, live and active yogurt bacteria may not be able to survive at a temperature greater than about 128° F., and temperatures above about 125° F. may result in gradual deathof such bacteria. As an example, the homogenization in step 120 may be carried out at a selected and controlled temperature that is not in excess of about 125° F. In another implementation, homogenization in step 120 may be carried out at aselected and controlled temperature that is within a range of between about 118° F. and about 125° F. As a further example, homogenization in step 120 may be carried out at a selected and controlled temperature that is within a range ofbetween about 118° F. and about 120° F. As an example, a temperature for the homogenization process may be selected that will not kill a substantial proportion of the live culture bacteria in the composition including yogurt and a milkfatfluid prepared at step 118. In an implementation, homogenization may be carried out in a Gaulin homogenizer.

In an implementation, homogenization may be carried out at a pressure within a range of between about 2,000 pounds per square inch (PSI) and about 4,000 PSI. As another example, homogenization may be carried out at a pressure within a range ofbetween about 2,500 PSI and about 3,200 PSI. In a further implementation, a thickness of the Low-Fat Yogurt-Cheese Composition may increase as the pressure applied during homogenization at step 120 increases. As an example, a pressure to be applied tothe

116

composition including yogurt and a milkfat fluid during homogenization may be selected to yield a Low-Fat Yogurt-Cheese Composition having a selected consistency.

As an example, step 120 may be carried out using a homogenizer having a homogenization chamber, an inlet chamber, and an outlet chamber. The inlet chamber may in an example be a vessel suitable for staging a supply of the composition includingyogurt and a milkfat fluid, on a continuous or batch basis, for introduction into the homogenization chamber. In an implementation, the homogenization chamber may be a vessel having controllable orifices for input and output of the composition includingyogurt and a milkfat fluid, and may be reinforced to withstand containment of an elevated pressure suitable for homogenization. As a further example, the outlet chamber may be a vessel suitable for staging a supply of the homogenized compositionincluding yogurt and a milkfat fluid, on a continuous or batch basis, for execution of some or all of steps 122-138 discussed below. In an implementation, the composition including yogurt and a milkfat fluid may be passed through the inlet chamberbefore being pumped into the homogenization chamber. Following homogenization, the composition including yogurt and a milkfat fluid may, as an example, be expelled from the homogenization chamber into the outlet chamber. These flows may, as examples,be carried out on a continuous or batch basis. As a further implementation, the pressure within the homogenization chamber may be adjusted to a selected homogenization pressure and maintained at that pressure during homogenization. In an example, thepressure in the inlet chamber may be within a range of between about 20 PSI and about 40 PSI. The pressure may be generated, as an implementation, by pumping of the composition including yogurt and a milkfat fluid into the inlet chamber. As anotherexample, the pressure in the outlet chamber may be within a range of between about 20 PSI and about 40 PSI. The pressure may be generated, as an implementation, by expelling the composition including yogurt and a milkfat fluid from the homogenizationchamber and then containing it in the outlet chamber. The composition including yogurt and a milkfat fluid may, as an example, undergo a pressure drop by ejection of the composition through a hole upon passing from the homogenization chamber to theoutlet chamber. In an implementation, such a hole may have a diameter of about a centimeter. As an additional example, the pressures within the inlet chamber, the outlet chamber, and the homogenization chamber may be selected and carefully controlledso that air may not be entrained into the homogenization chamber. In an example, such entrained air may cause cavitation, which may degrade the composition including yogurt and a milkfat fluid and may lead to an explosive release of the homogenizationpressure.

In an implementation, milk protein may be combined with the composition including yogurt and a milkfat fluid at step 122 to form a composition including yogurt, milkfat fluid and milk protein. As examples, the milk protein may include: milkprotein concentrate, whole milk protein, whey protein concentrate, casein, Baker's cheese, yogurt powder, dry cottage cheese curd, milk protein curd, or a mixture. A whey protein concentrate having a protein concentration of about 30% by weight, about50% by weight, or about 85% by weight, as examples, may be utilized. As another example, a Hahn's.RTM. Baker's cheese commercially available from Franklin Foods, Inc. may be utilized. As an example, the milk protein may include live and activeculture bacteria. As skim milk, a condensed skim milk or a high protein condensed skim milk dressing, as examples, may be utilized. In an implementation, a milk protein may be combined with the composition including yogurt and a milkfat fluid at aresulting concentration within a range of between about 45% by weight and about 15% by weight. As a further example, a milk protein may be combined with the composition including yogurt and a milkfat fluid at a resulting concentration within a range ofbetween about 35% by weight and about 25% by weight. As another implementation, a milk protein may be combined with the composition including yogurt and a milkfat fluid at a resulting concentration of about 29% by weight. Combining milk protein withthe composition including yogurt and a milkfat fluid at step 122 reduces the overall fat concentration of the Low-Fat Yogurt-Cheese Composition.

Combining a milk protein with the composition including yogurt and a milkfat fluid at step 122 may also, as an example, facilitate incorporation of a higher overall concentration of water into the Low-Fat Yogurt-Cheese Composition. Milk proteinmay, however, have an unappealing flavor and texture. As an example, milk protein may have a strong, unpleasant, astringent flavor. In another example, milk protein may have a lumpy, grainy texture.

In an implementation, combining yogurt with the composition including a milkfat fluid at step 118 of the process 100 may counteract and minimize adverse effects of combining a milk protein with the composition including yogurt and a milkfat fluidat step 122 while making possible the preparation of a Low-Fat Yogurt-Cheese Composition having a reduced overall fat concentration compared with cream cheese. As an example, the yogurt may provide the Low-Fat Yogurt-Cheese Composition with an appealingflavor and a creamy, moist texture in spite of the inclusion of the milk protein. As an example, combination with the milkfat fluid of yogurt at step 118 and a milk protein at step 122 may facilitate production of a Low-Fat Yogurt-Cheese Compositionthat may have attributes including a low overall fat concentration and an

117

appealing taste and texture.

In an implementation, step 122 may include standardizing the composition including yogurt, milkfat fluid and milk protein to a selected overall fat concentration. As another example, the projected fat concentration of the Low-Fat Yogurt-CheeseComposition to be prepared from the composition including yogurt, milkfat fluid and milk protein in further steps of the process 100 may also be determined, based on the selected concentrations of milk protein and the composition including yogurt and amilkfat fluid to be combined together, and based on the overall fat concentration in the composition including yogurt, milkfat fluid and milk protein. In an implementation, low-fat cream cheese may be defined to include a maximum fat concentration of16.5% by weight. Given the variable nature of raw milk, standardization of the fat content in a given batch of the composition including yogurt, milkfat fluid and milk protein may also be useful, as an example, in furtherance of stability of the process100 and of preparation of a uniform Low-Fat Yogurt-Cheese Composition. In an implementation, the overall fat concentration of the composition including yogurt, milkfat fluid and milk protein formed at step 122 may be adjusted to within a range ofbetween about 5% and about 33% by weight. As another example, the overall fat concentration of the composition including yogurt, milkfat fluid and milk protein may be adjusted to within a range of between about 5% and about 16.5% by weight. In afurther implementation, the overall fat concentration of the composition including yogurt, milkfat fluid and milk protein may be adjusted to within a range of between about 9% and about 14% by weight. As an additional example, the overall fatconcentration of the composition including yogurt, milkfat fluid and milk protein may be adjusted to about 11.2% by weight.

As an example, the texture and mouth feel of cheese products may improve with higher overall fat content. The fat content of the composition including yogurt and a milkfat fluid may include butterfat from the milkfat fluid, as an example. In animplementation, a high overall fat content may provide better tolerance of the composition including yogurt, milkfat fluid and milk protein to processing steps, such as agitation shear that may degrade protein and butterfat molecules. However, a highoverall fat concentration in the composition including yogurt, milkfat fluid and milk protein may also lead to a correspondingly higher fat concentration in the Low-Fat Yogurt-Cheese Composition, which may not be optimal from a consumer healthstandpoint. It is understood that standardization may be carried out at other points in the process 100, such as following combination of a milkfat fluid and a stabilizer at step 104 or following combination of yogurt with the composition including amilkfat fluid at step 118, as examples.

In an implementation, a butterfat concentration in a milkfat fluid may be measured using a standard Babcock test. For background, see Baldwin, R. J., "The Babcock Test," Michigan Agricultural College, Extension Division, Bulletin No. 2,Extension Series, March 1916, pp. 1-11; the entirety of which is incorporated herein by reference. Where the butterfat concentration in a milkfat fluid is too high, downward adjustment of the butterfat concentration may be accomplished, as an example,by combining the milkfat fluid with a nonfat ingredient such as skim milk. Introduction of water, as an example, may generally be ineffective because the water concentration of the milkfat fluid may directly affect the texture of the Low-FatYogurt-Cheese Composition. As an example, there may accordingly be a limited feasibility of directly combining water with the composition including yogurt, milkfat fluid and milk protein to reduce the overall fat concentration in the Low-FatYogurt-Cheese Composition. In an implementation, the overall fat concentration of a milkfat fluid may be downwardly adjusted by combining an appropriate amount of nonfat dry milk with the milkfat fluid, together with adequate water to rehydrate thenonfat dry milk. This combination of the milkfat fluid with nonfat dry milk has the advantage of not contributing excess water to the milkfat fluid. In the event that the initial butterfat concentration present in a given milkfat fluid needs to beupwardly adjusted, this may be accomplished by combining in an ingredient containing a higher concentration of butterfat, such as, for example, cream.

In an implementation, the relative concentrations of butterfat, milk protein and water to be provided in the Low-Fat Yogurt-Cheese Composition may all be selected. As an example, the overall fat concentration of the Low-Fat Yogurt-CheeseComposition may be selected. In an implementation, the overall fat concentration of the Low-Fat Yogurt-Cheese Composition may be selected to be less than about 16.5% by weight. In another example, the overall milk protein concentration of the Low-FatYogurt-Cheese Composition may be maximized due to the nutritional benefits, provided that a good texture and "mouth feel" may be retained. As an additional implementation, a sufficient concentration of yogurt may be included in the Low-Fat Yogurt-CheeseComposition to contribute to a flavor and texture appealing to the consumer. Milk protein inclusion increases the overall protein concentration of the Low-Fat Yogurt-Cheese Composition. Milk protein may be hygroscopic, and its capability to absorbwater may tend to degrade the texture of the Low-Fat Yogurt-Cheese Composition, making the composition somewhat grainy. The yogurt may counteract this texture degradation and graininess, and may facilitate the preparation of a Low-Fat Yogurt-CheeseComposition having a texture appealing to the consumer. Water is a secondary ingredient that may

118

be needed both to facilitate processing, as well as to provide an appealing, moist texture in the Low-Fat Yogurt-Cheese Composition. However, excessivewater may not be retained in the Low-Fat Yogurt-Cheese Composition and hence may become a processing hindrance, an expense, and a disposal issue.

As another implementation, the milk protein and the composition including yogurt and a milkfat fluid as combined together at step 122 may be blended at step 124 to form a blend. As an example, milk protein may be hygroscopic, and may accordinglyhave a somewhat crumbly, grainy, sticky, agglomerative texture. The hygroscopicity and crumbly, sticky texture of the milk protein may hinder the formation of a uniform composition at step 122. As an example, blending may accordingly be carried out bysubjecting the composition including yogurt, milkfat fluid and milk protein to high shear in a suitable vessel equipped with a bladed agitator. In an implementation, the composition including yogurt, milkfat fluid and milk protein may be blended by abladed agitator for a time period within a range of between about 10 minutes and about 20 minutes. In a further implementation, a Breddo Lor liquefier having a 300 gallon capacity and a 75 horsepower motor driving the bladed agitator, or a Breddo Lorliquefier having a 500 gallon capacity and a 110 horsepower motor driving the bladed agitator, may be utilized.

In a further implementation, the yogurt may be combined with the composition including a milkfat fluid at step 118 as discussed above and the resulting composition including yogurt and a milkfat fluid may then be homogenized at step 120, prior tocombining the milk protein with the composition including yogurt and a milkfat fluid at step 122. This order of process steps 118-122 may facilitate a breakdown of the crumbly, grainy, agglomerative texture of the milk protein during subsequent blendingin step 124. This facilitated breakdown of the milk protein texture and a resulting dispersion of the milk protein throughout the composition including yogurt and a milkfat fluid may make possible the combination of higher concentrations of milk proteintogether with the composition including yogurt and a milkfat fluid. In another implementation, step 118 may be executed after step 124 so that the yogurt may be combined together with the composition including a milkfat fluid after the combination andblending in of the milk protein. In this latter implementation the absence of the yogurt when step 124 is carried out may lead to poor blending in of the milk protein, possibly necessitating a longer blending cycle as well as imposing a lower ceiling ona maximum concentration of milk protein that may be effectively incorporated into the composition including a milkfat fluid in steps 122 and 124.

In another implementation, combination of the milkfat fluid with the milk protein as discussed above in connection with step 122 may instead or additionally be carried out in step 104. As an example, the composition including a milkfat fluid maybe homogenized following step 104 in the same manner as discussed above in connection with step 120, and next blended as discussed above in connection with step 124.

As an additional implementation, the blend may be pasteurized at step 126. This pasteurization may, as an example, be carried out in a manner as discussed above in connection with step 106. In a further implementation, the pasteurization may becarried out partially or completely at the same time as the blending in step 124. In an example, a Breddo Lor liquefier or a similar apparatus capable of heating and bladed agitation of the composition including yogurt, milkfat fluid and milk proteinmay be utilized to carry out both steps 124 and 126. As an implementation, preparation of a Low-Fat Yogurt-Cheese Composition may be complete following blending and pasteurization at steps 124 and 126. In another example, one or more further steps ofthe process 100, discussed below, may be carried out.

In an example, the blend may be cooled to a bacteria culture temperature at step 128, the blend may then be combined with live culture bacteria in step 130, and the bacteria may be cultured in step 132. As an implementation, these steps 128-132may be selected to be carried out when, in an execution of the process 100, the yogurt that was combined with the composition including a milkfat fluid at step 118 did not contain live culture bacteria.

In another example, the blend may be cooled to a yogurt bacteria culture temperature at step 128 in a manner as discussed above in connection with step 240 of the process 200. As a further implementation, live yogurt culture bacteria may becombined with the blend in step 130 in a manner as discussed above in connection with step 250 of the process 200. In an additional example, the bacteria may be cultured in step 132 in a manner as discussed above in connection with step 260 of theprocess 200. In an implementation, live yogurt bacteria cultures that may themselves provide well-known health benefits to the consumer may be included in the Low-Fat Yogurt-Cheese Composition.

In another example, the blend may be cooled to a cream cheese bacteria culture temperature at step 128 in a manner as discussed above in connection with step 108 of the process 100. As a further implementation,

119

live cream cheese culture bacteriamay be combined with the blend in step 130 in a manner as discussed above in connection with step 110 of the process 100. In an additional example, the bacteria may be cultured in step 132 in a manner as discussed above in connection with step 112 ofthe process 100. In an implementation, the cream cheese bacteria may not provide the same health benefits that may be provided to the consumer by live yogurt bacteria.

In an implementation, the bacteria culture step 132 may be continued until the pH of the blend is within a range of between about 5.0 and about 4.1. As another example, the bacteria culture step 132 may be continued until the pH of the blend iswithin a range of between about 4.6 and about 4.4. In a further implementation, the bacteria culture step 132 may be continued until the pH of the blend is about 4.5.

In an implementation, step 132 may include thickening the blend by combining the composition with a coagulating enzyme, in substitution for or in addition to directly acidifying the composition. As an example, a coagulating enzyme may causecasein protein in milk to form a gel. As another implementation, the action of a coagulating enzyme may require much more time for completion than direct acidification, meanwhile allowing far more culture bacteria activity to occur and delaying thecompletion of acidification. In a further example, the enzyme coagulation process may also be accompanied by syneresis and a resulting loss of albumin protein from the gelled curd. As an implementation, enzyme coagulation may yield an inferior Low-FatYogurt-Cheese Composition having a reduced thickness and a reduced protein concentration. In an example, enzymatic coagulation may take about 12 hours for completion. As an additional implementation, any casein protein coagulating enzyme of animal-,plant-, microbe, or other origin may be used. In another example, the coagulating enzyme may include chymosin, which is also referred to as rennin and is the active component of rennet. Rennet may be purified from calf stomachs. Chymosin may breakdown casein protein to paracasein. Paracasein may combine with calcium to form calcium paracaseinate, which may then precipitate and form a solid mass. Milkfat and water may become incorporated into the mass, forming curds. One part rennin maycoagulate about 10,000 to about 15,000 parts milkfat fluid. In another example, pepsin, which may be purified from the stomachs of grown calves, heifers, or pigs, may be used.

As an example, the pH of the blend may be tested at step 134. In an implementation, the pH of the blend may be measured using a pH meter. As an example, a Fisher Scientific pH meter may be utilized. In an implementation, step 134 may alsoinclude adjusting the pH of the blend to a selected value. As another example, the pH of the blend may be adjusted to within a range of between about 5.0 and about 4.1. In a further implementation, the pH of the blend may be adjusted to within a rangeof between about 4.6 and about 4.4. As an additional example, the pH of the blend may be adjusted to about 4.5. In an implementation, the pH of the blend for preparing a plain flavor Low-Fat Yogurt-Cheese Composition, meaning one that does not containor that contains minimal concentrations of fruits, vegetables, nuts, flavorings, condiments or other food additives, may be adjusted to within a range of between about 4.40 and about 4.50. As another example, the pH of the blend for a flavored Low-FatYogurt-Cheese Composition, meaning one that does contain a significant concentration of fruits, vegetables, nuts, flavorings, condiments or other food additives, may be adjusted to within a range of between about 4.38 and about 4.48. In animplementation, the taste to the palate of plain and flavored Low-Fat Yogurt-Cheese Compositions may begin to become sharp at a pH lower than about 4.40 or 4.38, respectively. In another example, the taste to the palate of either a plain or flavoredLow-Fat Yogurt-Cheese Composition may be too tart at a pH of about 4.2 or lower. In a further implementation, the thicknesses of plain and flavored Low-Fat Yogurt-Cheese Compositions may decline to a poor body or runniness at a pH higher than about 4.50or 4.48, respectively.

In an implementation, the pH adjustment of step 134 may be carried out by combining the blend with an appropriate amount of an edible acid. As examples, edible acids may include lactic acid, phosphoric acid, acetic acid, citric acid, andmixtures. In another implementation, an aqueous mixture of edible acids having a pH within a range of between about 0.08 and about 1.4 may be available under the trade name Stabilac.RTM. 112 Natural from the Sensient Technologies Corporation, 777 EastWisconsin Avenue, Milwaukee, Wis. 53202-5304. As a further example, similar edible acid mixtures may also be available from Degussa Corporation, 379 Interpace Parkway, P.O. Box 677, Parsippany, N.J. 07054-0677. As an additional implementation, theedible acid selected for use may include lactic acid. Lactic acid is a metabolite that may be naturally produced by lactose-consuming bacteria that may be utilized in preparing the yogurt and the composition including a milkfat fluid.

In an implementation, an edible acid may be combined with the blend to rapidly reduce the pH of the blend to a selected value, which may serve to control the thickness of the Low-Fat Yogurt-Cheese Composition. As an additional example, thisdirect acidification of the blend may slow down further propagation of culture bacteria in the composition, as culture bacteria present in the composition may become substantially dormant at a pH substantially below about 4.38. In an implementation,yogurt culture bacteria may

120

substantially survive direct acidification at step 134 and thus may still provide the health benefits of active yogurt cultures to a consumer. As another example, the edible acid present in the Low-Fat Yogurt-CheeseComposition may contribute a good-tasting bite to the flavor of the composition.

In an implementation, the pH of the blend may be tested at step 134 following culture of the blend at steps 128-132, and any direct pH adjustment of the blend that is needed may then be promptly completed. As another example, the pH testing andany needed direct acidification may be completed within less than about three (3) hours following combination of the blend with culture bacteria at step 130. In another implementation, pH testing and any needed direct acidification may be completedwithin less than about two (2) hours following combination of the blend with culture bacteria at step 130. As a further implementation, the pH testing and any needed direct acidification may be completed within less than about one (1) hour followingcombination of the blend with culture bacteria at step 130. In an example where direct acidification of the blend may be delayed substantially beyond three hours following combination of the blend with culture bacteria at step 130, the thickness of theLow-Fat Yogurt-Cheese Composition may be correspondingly reduced, and the consistency of the composition may tend to break down with attendant syneresis. In an implementation, excessive culture bacteria activity in the composition including yogurt and amilkfat fluid may be a substantial contributing cause of these adverse effects.

In another implementation, the pH of the composition including yogurt and a milkfat fluid may be tested at step 118 where yogurt is utilized including live culture bacteria, and any direct pH adjustment that is needed may then be promptlycompleted. As another example, the pH testing and any needed direct acidification may be completed within less than about three (3) hours following preparation of the composition including yogurt and a milkfat fluid, utilizing yogurt including liveculture bacteria at step 118. In another implementation, pH testing and any needed direct acidification may be completed within less than about two (2) hours following preparation of the composition including yogurt and a milkfat fluid at step 118. Asa further implementation, the pH testing and any needed direct acidification may be completed within less than about one (1) hour following preparation of the composition including yogurt and a milkfat fluid, utilizing yogurt including live culturebacteria at step 118.

In an implementation, a first point in time T1 when the yogurt and the composition including a milkfat fluid and the live culture bacteria are combined together at step 118 to produce the composition including yogurt and a milkfat fluid, and asecond point in time T2 when the blend may be directly acidified at step 134, may be selected and controlled. In another implementation, a first point in time T1 when the blend may be combined together with culture bacteria at step 130 and a secondpoint in time T2 when the blend may be directly acidified at step 134, may be selected and controlled. As another example, T2 may be a time that is within about three (3) hours or less following T1. In an additional implementation, T2 may be withinabout two (2) hours or less following T1. As another example, T2 may be within about one (1) hour or less following T1.

In an implementation where the time delay between the first and second points in time T1 and T2 may be selected, monitored and controlled, the time delay may be managed between the point in time of preparation of a given portion of blend orcomposition including yogurt and a milkfat fluid including live culture bacteria and the point in time of direct acidification of that same portion. The term "monitored" means that the first and second points in time T1 and T2 may be registered in asuitable manner, which may for example be automated or manual. The term "controlled" means that the time delay between the first and second points in time T1 and T2 may be regulated in a suitable manner, which may for example be automated or manual. Asan example, controlling the time delay between T1 and T2 may ensure that a Low-Fat Yogurt-Cheese Composition prepared from a given portion of blend or composition including yogurt and a milkfat fluid including live culture bacteria will have a selectedtexture and shelf life. In an implementation, execution of the process 100 in a continuous manner may facilitate production of a Low-Fat Yogurt-Cheese Composition having a consistently satisfactory quality, without pockets of thin consistency or ofpropensity to accelerated spoilage. As another example, execution of the process 100 in a batch manner may facilitate production of a Low-Fat Yogurt-Cheese Composition batch having a consistently satisfactory quality, rather than resulting in pockets ofpoor quality or in sub-batches of varying quality. As an example, processing a large batch of blend through step 134 as a series of sub-batches may ensure that no portion of the batch including live culture bacteria awaits direct acidification for morethan about three hours.

In an implementation, step 134 may include measures for retarding culture bacteria activity other than or in addition to direct acidification. As an example, the temperature of the blend may be reduced following completion of step 122 to belowan optimum temperature zone for rapid bacteria growth. In an implementation, an optimum temperature zone for bacteria growth may be within a range of between about 75° F. and about 115° F. As an example, the process 100 may be carriedout to minimize a time period

121

during which the blend and the Low-Fat Yogurt-Cheese Composition may be exposed to temperatures within this range. In an implementation, such temperature control may permit acidification in step 134 to be delayed for up toabout seven (7) hours following preparation of a composition including yogurt with live bacteria cultures and milkfat fluid at step 118 or combination of culture bacteria with the blend at step 130.

In an implementation, the pH testing and direct acidification of step 134 may both be carried out together with blending at step 124 and pasteurization at step 126. As an example, a Breddo Lor liquefier may be utilized to blend and pasteurizethe composition including yogurt, milkfat fluid and milk protein, as well as to directly acidify the composition. In this manner, step 134 may be carried out during step 124 or as soon as blending in step 124 has been completed. As a further example,steps 124, 126 and 134 may be carried out on a continuous and simultaneous basis. As an example, blending may be discontinued upon reaching a selected pH for the composition including yogurt, milkfat fluid and milk protein, in order to avoid excessiveshearing and possible breakdown of the texture of the blend. In an implementation, direct acidification may be carried out at the same temperature range or temperature employed for pasteurization. As a further example, direct acidification may becarried out at a lower temperature than that employed for pasteurization in step 126, although the composition thickness and attendant difficulty of mixing in the direct acidification agent may increase as the temperature is reduced. In animplementation, the temperature of the blend may be reduced to a temperature no greater than a temperature within a range of between about 112° F. and about 114° F. during or after direct acidification in step 134. As an additionalexample, the temperature of the blend may be reduced to a temperature of less than about 100° F. during or after direct acidification in step 134. In a further implementation, the temperature of the blend may be reduced to a temperature of lessthan about 75° F. at a point during or after direct acidification in step 134.

As an example, carrying out direct acidification may become gradually more difficult as the temperature of the blend is lowered, due to a steadily increasing composition thickness. In another implementation, direct acidification of the blend ata temperature below about 60° F. may result in a lumpy composition texture. In an example, cooling of the composition may be effected by holding the composition in a jacketed tank containing a glycol refrigerant maintained at a selectedtemperature to withdraw heat from the blend in the tank. In an additional implementation, the blend may be deemed to be a finished Low-Fat Yogurt-Cheese Composition after completion of step 134, and may as examples be hot-packed, or cooled and packed,at a selected temperature.

In an implementation, direct acidification of the composition including yogurt, milkfat fluid and milk protein as discussed in connection with step 134 may be carried out before blending the composition in step 124. However, direct acidificationmay cause a substantial thickening of the composition including yogurt, milkfat fluid and milk protein, which may hinder the blending step. As another example, step 134 may include lowering the temperature of the blend to a temperature suitable forrefrigeration, to further reduce ongoing bacteria activity. In an implementation, the temperature may be lowered to within a range of between about 34° F. and about 38° F.

In another implementation, step 134 may include combining a suitable preservative with the blend to retard bacteria, yeast and mold growth. As examples, potassium sorbate, sodium benzoate, sorbic acid, ascorbic acid or nisin may be utilized. Inan implementation, the preservative may be combined with the composition before direct acidification and consequent thickening, to facilitate dispersion of the preservative at a minor concentration throughout the blend. Nisin, as an example, is aprotein preservative that may be expressed by Lactococcus lactis. In an additional implementation, flavorings, condiments and the like may be combined with the blend. As an example, a butter flavoring may be combined with the blend. Butter flavoringsmay be commercially available, as examples, from Spice Barn Inc., 499 Village Park Drive, Powell, Ohio 43065; and from Kernel Pops of Minnesota, 3311 West 166th Street, Jordan, Minn. 55352, an affiliate of R.D. Hanson & Associates, Inc. Inanother implementation, a coloring may be combined with the blend. As an example, beta carotene may be utilized as a yellow coloring, which may give the blend a buttery appearance. Adjuvants that may be vulnerable to attack by bacteria, includingfruits and vegetables as examples, may in an implementation be combined with the blend after the temperature of the composition has been reduced below about 75° F. In an implementation, such adjuvants may themselves be treated for increasedresistance to such bacteria.

In an implementation, live yogurt culture bacteria may be combined with the blend in step 136, provided that the temperature of the blend is low enough at and following such introduction to avoid killing or unduly shocking the live culturebacteria. Step 136 may, as an example, be carried out in a manner as discussed in connection with step 130. As an example, the live yogurt bacteria may reinforce the health-related benefits of live and active yogurt culture bacteria that may alreadythen be present in the blend. In an implementation, a need for inclusion of such live culture bacteria at step 136 as well as a concentration of such bacteria to be

122

combined with a given blend may be determined by carrying out a bacteria activity test. As an example a Man, Rogosa and Sharpe ("MRS") broth test may be carried out.

In an implementation, the blend may be passed through a heat exchanger at one or a plurality of selected and controlled temperatures or temperature ranges in step 138. In a further implementation, a heat exchanger may be used that maycontinuously move the blend in contact with a heat exchange surface area in a confined space. As an example, this heat exchange step may yield a blend having a creamier, more uniform texture, with a reduced tendency to exhibit syneresis. In anotherimplementation, this heat exchange step may facilitate incorporation of a higher overall concentration of water into the blend than would otherwise remain stably incorporated. As an example, the heat exchange step may be accompanied by agitation. Inanother implementation, the blend may be passed through a confined space including a heat exchange surface and having an agitator, and then ejected from the confined space through a opening such as a nozzle. As an implementation, the blend may be passedthrough a scraped surface heat exchanger, such as a Waukesha Cherry-Burrell Thermutator.RTM. or Votator.RTM. with agitation while simultaneously controlling the temperature. In another example, a Terlotherm.RTM. vertical scraped surface heatexchanger may be employed. Terlotherm.RTM. machinery is commercially available from Terlet USA, 6981 North Park Drive, East Bldg., Suite 201, Pennsauken, N.J. 08109. In another implementation, a scraped surface heat exchanger may be equipped towithdraw heat from the blend in order to facilitate reduction of the temperature of the composition in the course of the composition's passage through the heat exchanger. As an additional example, the blend may pass through two scraped surface heatexchangers in series. In an implementation, the two scraped surface heat exchangers may be maintained at two or more different temperatures or temperature ranges.

As an example, the blend may be passed with agitation through a heat exchanger at a temperature within a range of between about 58° F. and about 70° F. In a further implementation, the blend may be passed with agitation through aheat exchanger at a temperature within a range of between about 58° F. and about 68° F. As an additional example, the blend may be passed with agitation through a heat exchanger at a temperature within a range of between about 58° F. and about 62° F. As a further implementation, step 138 may include multiple cooling steps that may reduce the temperature of the blend in a staged, controlled manner. As examples, this cooling may be carried out with a smooth and gradualtemperature reduction or in discrete steps. In an implementation, the blend may be cooled to a temperature no higher than about 90° F. before being packed into containers. As an example, the blend may be too sticky at a temperature higher thanabout 100° F. in order to be efficiently packed.

In an implementation, the agitation of the blend in a scraped surface heat exchanger may be controlled to a selected level in order to subject the blend to a selected amount of shear. As an example, the normal operating speed of the agitator ina Waukesha Cherry-Burrell Thermutator.RTM. or Votator.RTM. may need to be reduced, for example to within a range of between about 800 and 1,000 revolutions per minute, in order to avoid excessive shear. As an example, the process 100 may end at step140 after completion of some or all of steps 104-138. In another implementation (not shown), the blend may be cooled in step 138 to a temperature suitable for culture bacteria survival, before combining live bacteria with the blend in the same manner asdiscussed above in connection with step 136.

In an implementation, the Low-Fat Yogurt-Cheese Composition prepared by the process 100 may have the appearance, consistency, and texture of a cheese or butter product. As an example, the texture of the Low-Fat Yogurt-Cheese Composition may besimilar to that of cream cheese, or of another soft cheese. In another implementation, the texture of the Low-Fat Yogurt-Cheese Composition may be similar to that of butter or margarine, in brick or spread form. As an additional example, the Low-FatYogurt-Cheese Composition may have the robust, appealing flavor of yogurt. In a further implementation, the Low-Fat Yogurt-Cheese Composition may include whey protein retained from the milkfat fluid discussed above in connection with step 104. As afurther example, retained whey protein may amplify the flavor of the Low-Fat Yogurt-Cheese Composition and provide a robust taste. In an implementation, facilitating retention of the whey in the Low-Fat Yogurt-Cheese Composition prepared by the process100 may introduce natural flavor while eliminating the pollution and economic loss that may result from separating and discarding whey protein as in conventional cheese production. As an additional example, the Low-Fat Yogurt-Cheese Composition mayinclude a concentration of yogurt selected to counteract graininess and dryness of the milk protein introduced at step 122, thus improving the spreadability of and providing a creamy texture to the composition.

In an implementation, the Low-Fat Yogurt-Cheese Composition may include yogurt at a concentration within a range of between about 40% and about 10% by weight. As a further example, the Low-Fat Yogurt-Cheese Composition may include yogurt at aconcentration within a range of between about 30% and about 20% by

123

weight. As an additional example, the Low-Fat Yogurt-Cheese Composition may include yogurt at a concentration of about 25% by weight. In an implementation, the yogurt itself may besubstantially fat-free or may have a low concentration of fat, so that the yogurt reduces the overall fat concentration of the Low-Fat Yogurt-Cheese Composition.

As an implementation, the Low-Fat Yogurt-Cheese Composition may include butterfat at a concentration within a range of between about 33% and about 5% by weight. In another example, the Low-Fat Yogurt-Cheese Composition may include butterfat at aconcentration within a range of between about 16.5% and about 5% by weight. In a further example, the Low-Fat Yogurt-Cheese Composition may include butterfat at a concentration within a range of between about 14% and about 9% by weight. In yet anotherimplementation, the Low-Fat Yogurt-Cheese Composition may include butterfat at a concentration of about 11.2% by weight.

As an implementation, the Low-Fat Yogurt-Cheese Composition may include milk protein at a concentration within a range of between about 40% and about 5% by weight. In another example, the Low-Fat Yogurt-Cheese Composition may include milkprotein at a concentration within a range of between about 20% and about 10% by weight. As an additional implementation, the Low-Fat Yogurt-Cheese Composition may include milk protein at a concentration of about 13% by weight.

As an example, the Low-Fat Yogurt-Cheese Composition may include cream cheese at a concentration within a range of between about 75% by weight and about 15% by weight; yogurt at a concentration within a range of between about 40% by weight andabout 10% by weight; and milk protein at a concentration within a range of between about 45% by weight and about 15% by weight. As another implementation, the Low-Fat Yogurt-Cheese Composition may include cream cheese at a concentration within a rangeof between about 55% by weight and about 35% by weight; yogurt at a concentration within a range of between about 30% by weight and about 20% by weight; and milk protein at a concentration within a range of between about 35% by weight and about 25% byweight. As a further example, the Low-Fat Yogurt-Cheese Composition may include cream cheese at a concentration of about 46% by weight; yogurt at a concentration of about 25% by weight; and milk protein at a concentration of about 29% by weight.

In an implementation, a proportion of the overall protein content in the Low-Fat Yogurt-Cheese Composition, within a range of between about 10% and about 50% by weight may be contributed by milk protein combined with other ingredients during step104, and a proportion within a range of between about 40% and about 50% by weight may be contributed by milk protein combined with other ingredients during step 122, and a proportion within a range of between about 5% and about 40% by weight may becontributed by yogurt combined with other ingredients during step 118. As another example, a proportion of the overall protein content in the Low-Fat Yogurt-Cheese Composition, within a range of between about 25% and about 40% by weight may becontributed by milk protein combined with other ingredients during step 104, and a proportion within a range of between about 40% and about 50% by weight may be contributed by milk protein combined with other ingredients during step 122, and a proportionwithin a range of between about 12% and about 25% by weight may be contributed by yogurt combined with other ingredients during step 118. In an additional implementation, about 34.8% by weight of the overall protein content in the Low-Fat Yogurt-CheeseComposition, may be contributed by milk protein combined with other ingredients during step 104, and about 47% by weight may be contributed by milk protein combined with other ingredients during step 122, and about 17% by weight may be contributed byyogurt combined with other ingredients during step 118. As another example, a selected proportion of milk protein in the Low-Fat Yogurt-Cheese Composition contributed by milk protein combined at step 122 may be greater than a selected proportion of milkprotein in the Low-Fat Yogurt-Cheese Composition contributed by milk protein combined at step 104.

In an example, the Low-Fat Yogurt-Cheese Composition may include cholesterol at a concentration of less than about 0.05%. In an additional example, the Low-Fat Yogurt-Cheese Composition may include cholesterol at a concentration of less thanabout 0.034%. As a further implementation, the Low-Fat Yogurt-Cheese Composition may include sodium at a concentration within a range of between about 0.2% and 0.4% by weight. In another example, the Low-Fat Yogurt-Cheese Composition may include waterat a concentration within a range of between about 58% and about 63% by weight.

In an implementation, the Low-Fat Yogurt-Cheese Composition may include inulin. Inulin is a polysaccharide that may naturally be found in many plants. Inulin has a mildly sweet taste and is filling like starchy foods, but may not normally beabsorbed in human metabolism and therefore may not affect the sugar cycle. Inulin may reduce the human body's need to produce insulin, which may help to restore a normal insulin level. In addition to being thus potentially beneficial for diabetics,inulin may increase the thickness of the Low-Fat Yogurt-Cheese Composition, which may facilitate the incorporation of as much as between about 2% and

124

about 4% by weight more yogurt into a given Low-Fat Yogurt-Cheese Composition. Inulin also is aprebiotic that may extend the viability of yogurt bacteria in the digestive tract of the consumer, so that the beneficial effects of such bacteria in the body may be increased. Inulin may, however, be implicated in food allergies, and may induceanaphylactic shock in some people. In an implementation, other non-digestible oligosaccharides, and oligosaccharides that may be resistant to human metabolism, collectively referred to herein as "digestion-resistant polysaccharides", such as lactuloseand lactitol, may be utilized instead of or together with inulin. As an example, a minor concentration of a digestion-resistant polysaccharide may be combined with the composition including yogurt and a milkfat fluid at or before blending step 124.

Syneresis may lead to an unattractive and wasteful phase separation between curds and whey when milk is directly coagulated. In an implementation, the Low-Fat Yogurt-Cheese Composition may exhibit substantially no syneresis, or less than about1% syneresis by weight, after being maintained at a temperature within a range of between about 74° F. to about 75° F. for about 15 hours.

As an implementation, the texture and consistency of the Low-Fat Yogurt-Cheese Composition may be the same as that of ordinary cream cheese. In another example, the Low-Fat Yogurt-Cheese Composition may have a consistency similar to that ofbrick butter.

FIG. 3 is a flow chart showing an example of an implementation of a process 300 for preparing a whipped Low-Fat Yogurt-Cheese Composition. In an implementation, the process 300 may be carried out in place of step 138 discussed above. Theprocess 300 starts at step 310, and at step 320 a composition including yogurt, milkfat fluid and milk protein (a "blend") may be prepared by carrying out some or all of steps 104-136 of the process 100. In step 330, the blend may be agitated in thepresence of an inert gas at an elevated pressure. As an example, the blend may be passed through a confined space having an agitator, while being simultaneously subjected to an inert gas at an elevated pressure.

In an implementation, an inert gas may be provided in the confined space at an initial pressure within a range of between about 150 PSI and about 240 PSI. As another example, the inert gas may be provided in the confined space at an initialpressure within a range of between about 220 PSI and about 240 PSI. As a further implementation, the pressure of the inert gas may be controlled throughout the confined space in order to expose the blend to a selected pressure for a defined time as thecomposition travels through the confined space. In an additional example, the inert gas may be injected into the confined space at a selected initial pressure, which may then be permitted to dissipate in the confined space. As an implementation, theblend may be exposed to a selected pressure for a time period within a range of between about 3 seconds and about 6 seconds. As another example, the blend may be exposed to a selected pressure for a time period within a range of between about 4 secondsand about 5 seconds. Although as examples any inert gas may be used, nitrogen may in an implementation be a typical and practical choice. The term "inert" means that the gas substantially does not cause or at least minimizes harmful effects on theblend, its preparation, and the consumer.

In an implementation, injection of a gas into the blend under high pressure may be problematic due to an extreme density mismatch between the gas and the blend. As an example, the blend may resist diffusion of the gas into the composition. Inan implementation, diffusion of the gas throughout the blend may not be instantaneous or rapid even under agitation. As an example, dispersion of the gas throughout the blend in a reasonable time may require a gas delivery pressure that is substantiallyabove a pressure that would be sufficient for equilibration with the prevailing pressure within the blend. This resistance to gas dispersion in the blend may be ameliorated, as an example, by employing an in-line gas injection system providingcontrollable gas injection pressure. In an implementation, such an in-line gas injection system may have a relatively large bore gas delivery orifice. A mass flow controller such as, for example, a GFC-171S mass flow controller commercially availablefrom Aalborg Instruments & Controls, Inc., 20 Corporate Drive, Orangeburg, N.Y. 10962, may be used.

In an implementation, the temperature of the blend may be reduced by cooling the blend at step 340 in advance of step 330, and so maintained or further cooled during step 330. As an example, a scraped surface heat exchanger as earlier discussedmay be used to provide the needed agitation during step 330 while simultaneously reducing the temperature. As another implementation, the temperature of the blend may be reduced to a suitable inert gas injection temperature at step 340, and may then beso maintained or further reduced during step 330. The temperature reduction at step 340 may, as an example, increase the retention of the inert gas in the blend during subsequent step 330. In the absence of such a temperature reduction at step 340before injection of the inert gas at step 330, excessive escape of the inert gas from the blend prior to or during step 330 may as an example retard the whipping process and result in a Low-Fat Yogurt-Cheese Composition having an inadequately whippedtexture. In an implementation, the blend may

125

be cooled at step 340 to an inert gas injection temperature within a range of between about 65° F. and about 68° F., and agitation in the presence of the inert gas at an elevated pressure maythen be carried out at a temperature within a range of between about 58° F. and about 62° F. within a confined space at step 330. In another implementation, the blend may be cooled at step 340 to a whipping temperature within a range ofbetween about 65° F. and about 90° F. As an example, using a temperature above about 90° F. at step 340 may counteract the effect of the pressurized gas in causing the blend to expand into a whipped form. As another example, theblend may be cooled to a whipping temperature of no higher than about 80° F. at step 340. In an implementation, a temperature within a range of between about 58° F. and about 70° F. may then be employed within the confined spaceat step 330. In another example, a temperature within a range of between about 58° F. and about 68° F. may be employed within the confined space at step 330. Either or both of steps 340 and 330 may as examples include multiple coolingsteps that may reduce the temperature of the blend in a staged, controlled manner. This cooling may be carried out, as examples, with a smooth and gradual temperature reduction or in discrete steps. In an implementation, the agitation within a confinedspace such as a scraped surface heat exchanger may be controlled to a selected level in order to maintain the blend within the scraped surface heat exchanger for an adequate time for the pressurized inert gas to act on the composition. As anotherexample, the blend may pass through two scraped surface heat exchangers in series as earlier discussed. The process 300 may then end at step 350.

The resulting product may be a whipped Low-Fat Yogurt-Cheese Composition. The texture and consistency of the Low-Fat Yogurt-Cheese Composition may be, as an example, the same as that of ordinary cream cheese. In another implementation, thetexture and consistency of the Low-Fat Yogurt-Cheese Composition may be the same as that of whipped butter. As another implementation, solid adjuvants such as fruits, vegetables and nuts may be combined with the Low-Fat Yogurt-Cheese Composition afterthe whipping process 300 has been completed.

It is understood that the orders of some of the steps in the processes 100, 200 and 300 may be changed, and that some steps may be omitted. As examples, bacteria culture steps 108-112 and pasteurization step 106, bacteria culture steps 128-132,and bacteria introduction step 136 may be omitted. In another implementation, pasteurization step 114 may be omitted provided that pasteurization step 126 is executed. As a further example, milk protein combination step 122 may be carried out prior tohomogenization step 120 or prior to yogurt combination step 118 or both, although these modifications may increase the difficulty of completing the milk protein combination step and may yield a Low-Fat Yogurt-Cheese Composition having a thin texturelacking in body. As a further implementation, the milkfat fluid may not be homogenized until after its combination with yogurt at step 118, as shown in FIG. 1. In another example, temperature adjustment step 116 may be omitted. Homogenization of themilkfat fluid at an earlier point in the process 100 may be unnecessary and may merely subject the milkfat fluid to extra processing damage, time and expense while not substantially contributing to the quality of the Low-Fat Yogurt-Cheese Composition. In another implementation, stabilizer combination may alternatively be carried out following step 104 but prior to pasteurization at step 114, or at a later point in the process 100. Carrying out stabilizer combination after yogurt combination step 118may result in greater difficulty in handling the composition including yogurt and a milkfat fluid, which may accordingly have a thinner consistency. As an additional example, pH testing and adjustment step 134 may be omitted. As a further example,pre-prepared yogurt not necessarily made according to the process 200 may be utilized. It is further understood that whipping of a blend according to the process 300 may be omitted.

EXAMPLE 1

A batch of 1,500 pounds of pre-pasteurized heavy cream having a butterfat content of 44% by weight is pumped into a kettle equipped with a heater and an agitator. After 15 minutes of agitation, 21.75 pounds of K6B493 stabilizer, 333.26 pounds ofnonfat dry milk and 534 pounds of water are added to the cream with agitation to thicken the mixture. In addition, 169.95 pounds of a milk protein-whey protein composition and 56 pounds of inulin are added to the mixture. The composition includes 57%by weight of Simplesse.RTM.100 microparticulated whey protein concentrate having about 53.2% plus or minus 2% by weight of protein, commercially available from CP Kelco; and 43% by weight of a skim milk protein concentrate having about 42% by weight ofprotein. Sodium chloride in an amount of 24.75 pounds is added to the heavy cream. The cream is then pasteurized by heating it with agitation to 165° F. and holding at that temperature for 15 minutes. The cream is then cooled with agitation to85° F., whereupon 500 milligrams of pHage Control™ 604 cream cheese culture bacteria are added to the cream with agitation for 15 minutes. The cream is then maintained at 85° F. for 75 minutes. The cream is then pasteurized again byheating it with agitation to 165° F. and holding at that temperature for 15 minutes. The temperature of the resulting composition including a milkfat fluid is adjusted down to 130° F. Approximately 12.2% by weight of the protein contentin this composition including a milkfat fluid is derived from the cream.

126

Meanwhile, yogurt is separately and simultaneously prepared. A batch of 935 pounds of condensed nonfat milk having a solids content of 33% by weight is provided. The solids content is adjusted to about 22% by weight, by addition of 481 poundsof water. The condensed milk is then pasteurized by heating it with agitation to 165° F. and holding at that temperature for 15 minutes. The temperature of the condensed milk is then adjusted to 108° F., whereupon 250 milligrams ofF-DVS YoFast.RTM.-10 yogurt culture bacteria are added to the condensed milk with agitation for 15 minutes. The condensed milk is then maintained at 108° F. for 6 hours. The resulting yogurt is then ready for combination with the compositionincluding a milkfat fluid.

Next, 1,416 pounds of the prepared yogurt are mixed into 2,639 pounds of the composition including a milkfat fluid with agitation. The resulting composition including yogurt and a milkfat fluid is cooled to a temperature of 125° F., andthen homogenized by subjecting the mixture to a pressure of about 3,000 PSI at a temperature of 125° F. for about 5 seconds. Next, 1,657 pounds of a milk protein composition including about 20% by weight of protein are then blended for about 10to about 20 minutes with the composition including yogurt and a milkfat fluid in a Breddo Lor Heavy Duty 2200 RPM Likwifier.RTM. apparatus having a 500 gallon tank with a bladed agitator driven by a 110 horsepower motor. The temperature of the blend isgradually raised in the Breddo Lor agitator tank to about 165° F. and maintained at that temperature for 15 minutes to pasteurize the composition. The temperature of the blend is then adjusted to 108° F., whereupon 250 milligrams ofF-DVS YoFast.RTM.-10 yogurt culture bacteria are added to the blend with agitation for 15 minutes. The blend is then maintained at 108° F. for 6 hours. The pH of the blend is then tested, and the composition is acidified to a pH of about 4.5 byaddition of 57.5 pounds of Stabilac.RTM. 12 Natural acid. The blend is then passed through a Waukesha Cherry-Burrell Thermutator.RTM. scraped surface heat exchanger with agitation for a residence time of about 5 seconds at a temperature within a rangeof between about 58° F. and about 62° F.

The resulting Low-Fat Yogurt-Cheese Composition may include about 11.1% by weight of butterfat; about 11% by weight of milk protein; about 0.0359% by weight of cholesterol; about 0.211% by weight of sodium; about 57% by weight of water; and about43% by weight of solids. The protein content of this Low-Fat Yogurt-Cheese Composition may include approximately: 30.5% by weight derived from the nonfat dry milk together with the whey protein and the stabilizer; 4.3% by weight derived from the cream;47% by weight derived from the milk protein composition, and 18.2% by weight derived from the yogurt. The Low-Fat Yogurt-Cheese Composition may yield substantially no syneresis after 15 hours at about 74° F. to about 75° F.

EXAMPLE 2

A batch of 1,335 pounds of pre-pasteurized heavy cream having a butterfat content of 44% by weight is pumped into a kettle equipped with a heater and an agitator. Sodium chloride in an amount of 214 pounds is added to the heavy cream. After 15minutes of agitation, 19.3 pounds of K6B493 stabilizer, 296 pounds of nonfat dry milk and 475 pounds of water are added to the cream with agitation to thicken the mixture. In addition, 151 pounds of a milk protein-whey protein composition are added tothe mixture. The composition includes 57% by weight of Simplesse.RTM.100 microparticulated whey protein concentrate having about 54% by weight of protein, commercially available from CP Kelco; and 43% by weight of a skim milk protein concentrate havingabout 42% by weight of protein. The cream is then pasteurized by heating it with agitation to 165° F. and holding at that temperature for 15 minutes. The cream is then cooled with agitation to 85° F., whereupon 500 milligrams of pHageControl™ 604 cream cheese culture bacteria are added to the cream with agitation for 15 minutes. The cream is then maintained at 85° F. for 75 minutes. The cream is then pasteurized again by heating it with agitation to 165° F. andholding at that temperature for 15 minutes. The temperature of the resulting composition including a milkfat fluid is adjusted down to 128° F. Approximately 12.3% by weight of the protein content in this composition including a milkfat fluid isderived from the cream; the balance being derived from the nonfat dry milk and the milk protein-whey protein composition.

Meanwhile, yogurt is separately and simultaneously prepared in the same manner as discussed in connection with Example 1. Next, 1,260 pounds of the prepared yogurt is mixed into 2,298 pounds of the composition including a milkfat fluid withagitation. The resulting composition including yogurt and a milkfat fluid is cooled to a temperature of 125° F., and then homogenized by subjecting the mixture to a pressure of about 3,000 PSI at a temperature of 125° F. for about 5seconds. Next, 1,474 pounds of a milk protein composition including about 20% by weight of protein are then blended for about 10 to about 20 minutes with the composition including yogurt and a milkfat fluid in a Breddo Lor Heavy Duty 2200 RPMLikwifier.RTM. apparatus having a 500 gallon tank with a bladed agitator driven by a 110 horsepower motor. The temperature of the blend is gradually raised in the Breddo Lor agitator tank to about 165° F. and

127

maintained at that temperature for15 minutes to pasteurize the composition. The temperature of the blend is then adjusted to 108° F., whereupon 250 milligrams of F-DVS YoFast.RTM.-10 yogurt culture bacteria are added to the blend with agitation for 15 minutes. The blend is thenmaintained at 108° F. for 6 hours. The pH of the blend is then tested, and the composition is acidified to a pH of about 4.5 by addition of 25 pounds of Stabilac.RTM. 12 Natural acid. The blend is then passed through a Waukesha Cherry-BurrellThermutator.RTM. scraped surface heat exchanger with agitation for a residence time of about 5 seconds at a temperature within a range of between about 58° F. and about 62° F.

The resulting Low-Fat Yogurt-Cheese Composition may include about 11% by weight of butterfat; about 10% by weight of milk protein; about 0.0359% by weight of cholesterol; about 0.211% by weight of sodium; about 57% by weight of water; and about43% by weight of solids. The protein content of this Low-Fat Yogurt-Cheese Composition may include approximately: 30.8% by weight derived from the nonfat dry milk together with the stabilizer; 4.2% by weight derived from the cream; 47% by weight derivedfrom the milk protein composition, and 18% by weight derived from the yogurt. The Low-Fat Yogurt-Cheese Composition may yield substantially no syneresis after 15 hours at about 74° F. to about 75° F.

Although the invention has been described with reference to particular examples of implementations, it will be apparent to those skilled in the art that various changes and modifications can be made without departing from the scope of theinvention. Such changes and modification are intended to be covered by the appended claims.

3.The present application is the U.S. National phase of international application number PCT/NZ03/000027, filed Feb. 18, 2003, and claims priority under 35 U.S.C. .sctn.119 to New Zealand application number 517293, filed Feb. 19, 2002 and NewZealand application number 521690, filed Sep. 30, 2002.

FIELD OF THE INVENTION

The present invention relates to a novel process of making cheese and to a cheese product made by said process.

BACKGROUND OF THE INVENTION

Traditional cheesemaking processes typically form a coagulum by the addition of an enzyme that sets a vat of cheesemilk. The coagulum is then mechanically cut to form curd particles which allow syneresis to occur.

In this traditional vat setting and cutting process considerable variability in the curd characteristics can occur resulting in impaired product consistency such that compositional and functional characteristics of the final cheese may not fallwithin the standards acceptable by the industry or consumer.

In particular, texture, melt and flavour characteristics are important cheese characteristics. Any method of cheese making that can reduce the variability and criticality of one of the traditional cheese making steps, yet maintain flexibility inthe functional characteristics of the end cheese product, gives the cheese making industry a way of producing a cheese having the required functional characteristics in a consistent manner. This is beneficial to the cheese making industry, largeconsumers such as the pizza industry, as well as individual consumers.

It is an object of the present invention to provide such a process and/or at least to provide the public with a useful choice.

SUMMARY OF THE INVENTION

The present invention provides a process of manufacturing cheese whereby the traditional step of producing a solid coagulated mass of protein or a coagulum from a protein containing starting milk, which requires cutting to aid separation of thecurd from the whey, is replaced with a step whereby such a coagulated mass is caused to disaggregate into small curd particles without mechanical cutting and whereby the curd particles are separated from the whey by simple screen sieving or mechanicalseparation. The production of such curd particles provides a more reliable and consistent curd for cheese making in general. The curd produced by the present invention is then heated and mechanically worked (stretched) such as in traditional mozzarellacheese making

128

processes by either immersing the curd in hot water or heating and working in a substantially liquid-free environment. Moreover, a range of cheeses may be made by this method including but not limited to cheddar, cheddar-like, gouda,gouda-like, as well as mozzarella and mozzarella-like (pizza) cheeses. The term mozzarella in this document includes the generic range of mozzarella cheese types including standard fat and moisture mozzarella, part-skimmed mozzarella and low-moisturemozzarella.

Other GRAS (Generally Regarded As Safe) ingredients common to cheese making process may be added at any suitable stage of the above mentioned processes to alter any functional characteristic or improve flavour, texture, colour and the like, aswould be understood by a person of skill in the art.

The present invention is also directed to a cheese including a soft, semi-soft, hard and extra hard cheese produced by a process according to the invention. Preferred cheeses include cheddar, cheddar-like, gouda, gouda-like, mozzarella andmozzarella-like cheeses. By mozzarella and mozzarella-like (pizza) cheese is meant a cheese made using a process of the present invention, which has stringy characteristics on melting. 

DESCRIPTION OF THE FIGURES

The present invention will now be described with reference to the figures of the accompanying drawings in which:

FIG. 1 shows a schematic drawing of the process of a preferred embodiment of the invention.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides an alternative process of making a cheese having consistent compositional and functional characteristics, such as melt and sensory characteristics.

In particular it is an advantage of the present invention that the formation of the coagulum and its subsequent disaggregation into curds and whey is conducted as an in-line, continuous flow process that does not require vat setting or mechanicalcutting of the coagulum.

Specifically, the novel process of the present invention comprises the continuous production of small curd particles in place of the vats of coagulated cheesemilk produced in traditional cheese making processes, in combination with a mechanicalprocessing step whereby the curd particles are heated and worked into a cheese mass in accordance with the traditional mozzarella-type cheese making process.

Surprisingly, cheeses of all types, including soft, semi-soft, hard and extra hard such as cheddar, cheddar-like, gouda, gouda-like, as well as mozzarella and mozzarella-like cheeses may be made by this novel process.

The advantages of the novel process of the present invention include the ability to closely control the functional and compositional characteristics of the end cheese products to enable the consistent production of cheeses having enhancedfunctional and compositional characteristics. In particular, this process allows for the production of cheeses having a higher moisture and lower calcium content than may be achieved using traditional processes.

The continuous production of a liquid stream containing small curd particles is taught in NZ 199366 in relation to the manufacture of milk based foodstuffs including cheese and cheese-like products for incorporation as a raw material intoprocessed foodstuffs.

The present invention uses the curd particles produced by the method of NZ 199366 in combination with a heating and mechanical processing step to produce natural cheeses including cheddar, cheddar-like, gouda, gouda-like mozzarella andmozzarella-like (pizza) cheese for the first time. In addition, the novel process allows for the control of the characteristics of the curd particles so that such cheeses have higher moisture and lower calcium content that the product produced by themethod of NZ 199366 alone.

The present invention provides a method of making cheese comprising adding a coagulating agent

129

to a pasteurised and standardised starting milk and reacting at a temperature which suppresses the formation of a coagulum, passing the reacted mixturealong a flow path while adjusting the pH within a range between 4.0 to 6.0, and cooking said mixture at a temperature of up to 55° C. while inducing controlled turbulence in the mixture to cause rapid coagulation and then disaggregation intosmall curd particles within the flow, separating the curd particles from the whey liquid, heating and mechanically working the curd into a cheese mass at a curd temperature of 50 to 90° C., shaping and cooling the cheese mass.

The curd may be made into a final cheese product immediately while still fresh, or may be frozen and/or dried, and thawed and/or reconstituted before making into cheese.

Preferably, the invention provides a process of making cheese comprising steps of: a. providing a starting milk composition having a fat content of at least 0.05%; b. optionally pasteurising and/or acidifying the milk composition of step (a) topH 6.0 to 6.5; c. adding a coagulating agent to the starting milk composition and reacting preferably for up to 20 hours at a temperature which suppresses the formation of a coagulum; d. optionally adjusting the pH of the reacted milk between pH 4.0 and6.0; e. cooking the milk composition under conditions which allows the formation of coagulated curd particles; f. separating the whey from the curd particles; g. optionally washing the curd particles of step (f) h. optionally freezing and/or drying thecurd particles; i. heating and mechanically working the fresh curd particles of steps (f) or (g) or thawed and/or reconstituted curd particles of step (h), at a curd temperature of 50° C. to 90° C.; and j. shaping and cooling the cheesemass.

The general steps of this preferred process are set out in FIG. 1 and may be carried out in any suitable order as would be appreciated by a skilled worker. Preferably steps (a) to (j) of the process are performed in the recited order.

The cheese made by this process may comprise a soft, semi-soft, hard or extra hard cheese including cheddar, cheddar-like cheese, gouda, gouda-like cheese, mozzarella and mozzarella-like cheese.

The starting milk may be selected from one or more of the group comprising whole fat milk; whole milk retentate/concentrate; semi skimmed milk; skimmed milk; skimmed retentate/concentrate; butter milk; butter milk retentate/concentrate and wheyprotein retentate/concentrate or from products made from milk as would be appreciated by a person skilled in the art. One or more powders, such as whole milk powder, skimmed milk powder, milk protein concentrate powder, whey protein concentrate powder,whey protein isolate powder and buttermilk powder or other powders made from milk, reconstituted or dry, singularly or in combination may also be selected as the starting milk or be added to the starting milk.

The starting milk may be sourced from any milk producing animal.

The protein and fat composition of the starting milk composition may be altered by a process known as standardisation. The process of standardisation involves removing the variability in the fat and protein composition of the starting milk toachieve a particular end cheese composition. Traditionally, standardisation of milk has been achieved by removing nearly all the fat (cream) from the starting milk (separation) and adding back a known amount of cream thereto to achieve a predeterminedprotein/fat ratio in the starting milk. The amount of fat (cream) required to be removed will depend upon the fat content of the starting milk and the required end cheese composition. Preferably, the starting milk has a fat content of at least 0.05%. If higher fat contents are required a separate side stream of cream may be added to raise the fat content of the starting milk or the final cheese product as would be appreciated by a skilled worker. Additionally or alternatively, the proteinconcentration may be altered by adding a protein concentrate such as a UF retentate or powder concentrate to a starting milk composition, or by any other method as would be appreciated by a person skilled in the art.

Pasteurisation may be carried out on any liquid stream at any stage of the process and in particular the starting milk and cream streams under standard condition as is known in the art. Optionally the cream is homogenised.

Optionally the starting milk may be preacidified using any food approved acidulent to preferably a pH of 6.0 and 6.5.

130

The coagulating agent is added to the standardised starting milk and the mixture agitated to distribute the agent. The starting milk composition, containing coagulating agent is reacted under conditions which will not allow the formation of acoagulum, typically at a temperature of <22° C., preferably 8 to 10° C., at a suitable concentration of enzyme for sufficient time to react with the kappa casein. Typically, this reaction period is for 3 to 20 hours. This process isknown as "cold setting" or "cold rennetting". In particular, the coagulating agent is held in the starting milk for a sufficient time to allow the enzyme to cleave the bond of kappa-casein and expose the casein micelle. This starting milk wouldcoagulate but for the temperature control of the reaction mixture.

Preferably the coagulating agent is an enzyme, and preferably the enzyme is chymosin (rennet). Sufficient coagulating agent is added to the starting milk so that the cheese milk will coagulate at the cooking step. For chymosin (rennet), thisconcentration ranges from 1 part rennet to 5,000 parts starting milk and 1 part rennet to 50,000 parts starting milk. A more preferred rennet concentration is between 1 part to 15,000 starting milk and 1 part to 20,000 starting milk.

At this stage the milk composition is pumped through a plant and subjected to in-line treatment.

After reacting with the coagulating agent, the pH of the milk composition (the "reacted milk") is adjusted, if necessary, to pH 4.0 to 6.0 preferably 5.2 to 6.0 by the addition of an acidulent.

Preferably the acidulent is a food grade acid such as lactic acid, acetic acid, hydrochloric acid, citric acid or sulphuric acid and is diluted with water to approximately 1 to 20% w/w and then added to the reacted milk. More preferably, strongacids such as hydrochloric acid, are diluted to 2 to 5% w/w and weak acids such as lactic acid diluted to 10 to 15% w/w before adding to the reacted milk. The acidulent may be dosed in-line, directly into the reacted milk to reduce the pH to the desiredpH.

Alternatively, the acidulent may comprise a growth medium which has been inoculated with a starter culture and reacted to form a fermentate.

Pasteurised skimmilk is a preferred growth medium. Fermentation may be induced by adding a starter culture to the growth medium and holding at a suitable temperature for a suitable time for the generation of acid to lower the pH to a level ofbetween pH 4.0 and pH 6.0, preferably pH 4.6.

The starter culture to be added to the pasteurised growth medium stream can be mesophilic or thermophilic or a mix and added at 0.0005 to 5%, preferably 0.01 to 0.2%, most preferably 0.1% of the milk volume. Examples of starter cultures are:Streptococcus thermophilus, Lactobacillus bulgaricus, Lactobacillus helveticus, Lactococcus lactis subspecies cremoris, Lactococcus lactis subspecies lactis.

Once the fermentate stream has reached the target pH, the fermentate can be mixed in-line with the reacted milk. Where the two streams are combined, a further step of mixing and holding the two streams is required, typically for 1 to 20 minutesto ensure that, where the fermentate comprises a milk based medium, such as skimmilk, the coagulating agent in the reacted milk has time to act on the kappa casein in the fermentate. Optionally, the fermentate may be cooled and held for subsequent use.

Optionally a combination of food grade acid and fermentate may be used to acidify the reacted milk.

Once the fermentate and/or food grade acid (if required) have been added and mixed by the liquid flow or using mechanical mixers such as an in-line static mixer, and held at the target pH, the milk composition is heated/cooked preferably to atemperature of 30 to 55° C. by using direct or indirect heating means to coagulate the protein and form coagulated curd particles. In the case of direct heating, steam can be injected into the liquid milk composition flow and in the case ofindirect heating, a jacketed heater or heat exchanger is associated with the pipe along which the liquid is being pumped. The final temperature reached by the curd mixture is determined by the properties required in the final cheese curd. For exampleto decrease the moisture retained in the curd the cook temperature is raised. In a preferred embodiment the flow velocity during cooling is high enough to ensure turbulence in the liquid mixture being passed there along. This enables the proteincoagulum to fragment into small relatively uniform curd particles and syneresis commences. Preferably, the resulting curd particles are between 0.5 cm and 2 cm.

131

It is necessary to allow time for the syneresis to proceed. Preferably the holding time in the cooking tube is 10 to 50 seconds at the desired final cooking temperature and the flow is laminar. The cooked mixture is passed to a separator toseparate the curds from the whey. The separation may be achieved by any physical means, preferably by sieve or decanter. Optionally, after separation of the curd, the curd may be washed in water. In a preferred embodiment the pH of the water may beadjusted and the washing system may consist of a set of holding tubes. At the end of the holding tubes the washed curd may be separated by any physical means, preferably by sieve or decanter.

A reduction of the pH in the wash water results in solubilisation and removal of calcium from the curd. A preferred embodiment is washing under turbulent conditions with heated water at between 30 and 90° C. at pH 3.0 to 5.4.

Mineral adjustment, and particularly calcium adjustment, is a critical step in the cheesemaking process as the calcium content of the end cheese product affects its functionality and compositional characteristics. The pH of the acidulent, the pHtarget of the acidulated enzyme treated mixture, the cooking temperature and the pH of the wash water (if used) are all steps in this process where calcium solubilisation can be controlled. Surprisingly, the present invention allows a cheese product tobe produced with a significantly lower calcium content than can be achieved using a traditional cheese making process.

The removal of whey and subsequent wash water is referred to in the art as dewheying and dewatering. Optionally the dewheyed/dewatered curd may be frozen and held for future use. In a further option the dewheyed/dewatered curd may be dried. Ina further option the dewheyed/dewatered curd may be allowed to cheddar into a cohesive mass of curd. Cheddaring is known in the art of cheesemaking. The cheddared curd is subsequently milled into particles and optionally salted.

In more traditional cheese making processes all the salt or a portion of the salt is added at this point or none at all. If salt is added after milling, time is allowed for the salt to penetrate the curd (mellowing).

In the next stage of the process the curd particles are converted into a cheese mass by fusing them together by mechanically working and heating at a suitable temperature. In a preferred embodiment a heated mixing device is used to fuse the curdparticles. A time of 1 to 30 minutes is required to conduct the mixing and heating procedure to attain a homogenous cheese mass. About 8 to 12 minutes are preferred.

The heating and mechanical working (stretching) step takes place at a curd temperature of between about 50° C. and 90° C. and may occur by immersing the curd in hot water or hot whey as in a traditional mozzarella cheese makingmethod, or this step may take place in a dry environment as described in U.S. Pat. No. 5,925,398 and U.S. Pat. No. 6,319,526. In either method, the curd is heated and worked into a homogenous, plastic mass. Preferably the curd is heated to a curdtemperature of between about 50° C. to 75° C. using equipment common in the art, such as a single or twin screw stretcher/extruder type device or steam jacketed and/or infusion vessels equipped with mechanical agitators (waterlesscookers).

Optionally cream, high fat cream or milk fat, water, whey protein retentate or whey protein concentrate or salt may be added to the curd during this mixing step. When cream is added, the cream is preferably homogenised.

The hot cheese mass may be immediately extruded into moulds or hoops and the cheese cooled by spraying chilled water/brine onto the surface of the hoops as in traditional mozzarella cheese making processes. This initial cooling step hardens theoutside surface of the block providing some rigidity. Following this initial cooling the cheese is removed from the moulds and placed in a salt brine (partially or completely saturated) bath for a period of time to completely cool the cheese and enableuptake of the salt to the required level. Once cooled the cheese is placed in plastic liners, air removed and the bag is sealed Alternatively, the hot cheese mass may be extruded into sheet-like or ribbon-like form and directly cooled without moulding.

An alternative process sometimes used in commercial practice is to completely dry salt the cheese curd, mellow, heat work and pack directly into plastic liners contained in hoops and the liners

132

sealed. The hoops plus cheese are then immersed inchilled water.

Cooled cheese is stored at between 2° C. to 10° C. Once ready for use the cheese may be used directly or the block frozen or the block shredded and the shreds frozen.

Where the hot cheese mass is extruded as a ribbon or sheet, which provides rapid cooling, shredding and freezing of the shreds may take place in-line, immediately following cooling.

Other GRAS (generally accepted as safe) ingredients common to the cheese making process may be added at any suitable step in the process as would be appreciated by a person skilled in the art. GRAS ingredients include non-dairy ingredients suchas stabilisers, emulsifiers, natural or artificial flavours, colours, starches, water, gums, lipases, proteases, mineral and organic acid, structural protein (soy protein or wheat protein), and anti microbial agents as well as dairy ingredients which mayenhance flavour and change the protein to fat ratio of the final cheese. In particular, flavour ingredients may comprise various fermentation and/or enzyme derived products or mixtures thereof as would be appreciated by a skilled worker. Preferably,such GRAS ingredients may be added after the curd has been milled and/or during the "dry" mechanical working step; and/or to the extruded sheet-like or ribbon-like hot stretched curd; and mixed or worked into the curd to disperse evenly. Alternatively,GRAS ingredients may be added to the starting milk, during in-line acidification, or to the separated coagulated curd particles as would be understood by a skilled worker. The flexibility of allowing any combination of additives to be added at any stepin the process allows the final composition of the cheese to be precisely controlled, including the functionality characteristics.

In a further embodiment, the present invention provides a soft, semi-soft, hard or extra hard cheese product produced by the processes of the invention.

In a further embodiment, the present invention provides a mozzarella or mozzarella-like (pizza) cheese product produced by the processes of the invention.

The present invention also provides a food product comprising the mozzarella or mozzarella-like (pizza) cheese of the present invention, such as a pizza.

Any ranges mentioned in this patent specification are intended to inherently include all of the possible values within the stated range.

This invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, and any or all combinations of any two or more of said parts,elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which this invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.

The invention consists in the foregoing and also envisages constructions of which the following gives examples.

EXAMPLE 1

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight for approximately 16 hours at 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking, to reduce the pH to pH 5.4. The mixture was heated by direct steam injection at 42 to 44° C. and held for 50 seconds in holding tube. The coagulated cooked curd particleswere separated from the whey using a screen, washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd) and separated from the wash water using a decanter. After dewatering the curd was frozen for later use.

On thawing the aggregated curd was milled and partially dried using a ring drier to 48% moisture. Salt (0.2 kg), high fat cream (7 kg), 0.272 kg of lactic acid (16% solution) and flavours were added to 7 kg of milled and partially dried curd.

The flavours comprised a mixture of pre-prepared concentrated fermentation and enzyme-derived flavour ingredients [1.5% Alaco EMC (DairyConcepts, USA), 350 ppm Butyric acid and 16 mM

133

acetate in final product (Bronson & Jacobs Ltd, NZ)].

The curd and added ingredients were blended in a twin screw auger blender/cooker (Blentech Kettle, model CL0045, Twin screwcooker 1994, Rohnert Park, Calif., United States of America) for approximately 30 seconds at 50 rpm. Speed of mixing wasincreased to 90 rpm and direct steam injection applied to bring the temperature of the mixture to 50° C. Mixing speed was then further increased to 150 rpm and the temperature raised to approximately 68° C. Once at approximately68° C. the now molten curd mixture was worked at 150 rpm for a further 1 minute.

The molten curd was held for 1 to 3 minutes and then packaged into 0.5 kg pottles and the pottles were air cooled for >12 hours to approximately 5° C.

After 1 month storage this cheese had a firm texture and exhibited a cheesy-cheddar-like flavour.

The final cheese composition was 35.0% fat, 38.5% moisture, 1.84% salt, pH 5.44 and a calcium level of 101 mmol Ca/kg cheese.

EXAMPLE 2

Approximately 1800 L of skimmilk was pasteurized and then cooled to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 10° C. Dilute sulphuric acid was then added tothe cold renneted milk, in-line immediately prior to cooking, to reduce the pH to pH 5.4, and the mixture heated by direct steam injection at 42 to 44° C. and held for 50 seconds in a holding tube. The coagulated curd particles were separatedfrom the whey using a screen, washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd) and separated from the wash water using a decanter. After dewatering the curd was frozen for later use.

On thawing the coagulated curd was milled and partially dried using a ring drier to 49% moisture. Salt (0.265 kg), high fat cream (6.25 kg), 0.272 kg of lactic acid (16% solution) and flavours were added to 7 kg of milled and partially driedcurd.

The flavours comprised prepared concentrated fermentation and enzyme-derived flavour ingredients [50 ppm Butyric acid, 8 mM acetate and 2.5 ppm diacetyl in final product (Bronson and Jacobs Ltd, NZ) and 1 ppm Lactone].

The curd and added ingredients were blended and heated according to the procedure given in Example 1.

The molten curd was packaged into 0.5 kg pottles and the pottles were air cooled for >12 hours.

Following cooling the curd was analysed for moisture, fat, salt and pH.

After 1 month storage this cheese had a firm texture and exhibited a sweet Gouda-like flavour.

The final cheese composition was 35.5% fat, 39.1% moisture, 1.81% salt, pH 5.51 and a calcium level of 54 mmol Ca/kg cheese.

EXAMPLE 3

Approximately 1800 L of skimmilk was pasteurised and then cooled to 8 to 10° C. before rennet was added (100 ml, i.e. 55 ml/1000 L). The renneted milk was left to stand for approximately 16 hours at 8 to 10° C. After 16 hoursdilute sulphuric acid was added to the cold renneted milk, in-line immediately prior to cooking, to reduce the pH to pH 5.3 and the mixture heated by direct steam injection at 42° C. and held for 50 seconds in a holding tube.

The coagulated curd particles were separated from the whey using a screen and washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd). The washed coagulated curd particles, with a moisture content of about 52%, wereseparated from the wash water using a decanter. After dewatering the curd was milled. Salt (0.2 kg), water (2.0 kg) and high fat cream (4.0 kg) were added to 7 kg of milled curd.

134

The curd and ingredients were blended according to the procedure given in Example 1, with the exception that the final temperature was 72° C.

The molten curd was packaged into 0.5 kg pottles and the pottles were air (12 hours.

Following cooling the curd was analysed for moisture, fat, salt and pH.

The final cheese composition was 21.0% fat, 53.7% moisture, 1.42% salt, pH 5.42 and a calcium level of 61 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days following manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms ofblister size, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 4

Approximately 1200 L of reconstituted skimmilk powder (8.3% solids) was pasteurized and then cooled to 8 to 10° C. before rennet was added (66 ml). The renneted milk was subsequently acidified with diluted sulphuric acid (2.5% w/w),cooked (42 to 45° C.) and the coagulated curd separated and washed as outlined in Example 3

Salt (0.2 kg), water (1.8 kg), lactic acid (0.272 kg of a 16% solution) and high fat cream (4.0 kg) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅72° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.5% fat, 52.9% moisture, 1.40% salt, pH 5.80 and a calcium level of 106 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days following manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms ofblister size, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 5

Approximately 2250 L of skimmilk was pasteurised and then cooled to 15° C. before a microbial enzyme Fromase 45TL (DMS Food Specialities, NSW, Australia) was added (200 ml). The Fromase treated milk was left to stand for approximately 3hours at 15° C. After 3 hours dilute sulphuric acid was added to the cold renneted milk, in-line immediately prior to cooking at 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

The coagulated curd particles with a moisture content of about 53% were separated from the wash water using a decanter. After dewatering separation the curd was milled. Salt (0.2 kg), water (2.0 kg) and high fat cream (4.0 kg) were added to 7kg of milled curd. The curd and ingredients were blended in a twin screw auger blender/cooker, heated to ≅72° C. and packed and stored under chilled conditions as outlined in Example 3. The final cheese composition was 20.5% fat, 55.6%moisture, 1.42% salt, pH. 5.97 and a calcium level of 93 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days following manufacture pizzas made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 6

Approximately 450 L of skimmilk was pasteurised and then cooled to 7° C. before a microbial

135

enzyme Fromase 45TL (DMS Food Specialities, NSW, Australia) was added (40 ml). The Fromase treated milk was left to stand for approximately 3hours at 7° C. After 3 hours dilute sulphuric acid was added to the cold renneted milk, in-line immediately prior to cooking at 50° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

The coagulated curd particles with a moisture content of about 53% were separated from the wash water using a decanter. After dewatering separation the curd was milled.

Salt (0.2 kg), water (2.0 kg) and high fat cream (4.0 kg) were added to 7 kg of milled curd. The curd and ingredients were blended in a twin screw auger blender/cooker, heated to ≅72° C. and packed and stored under chilledconditions as outlined in Example 3.

The final cheese composition was 21% fat, 55.0% moisture, 1.44% salt, pH. 5.98 and a calcium level of 92 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blister size, coverageand colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 7

Approximately 450 L of skimmilk was pasteurised and then cooled to 7° C. before a microbial enzyme Fromase 45TL (DMS Food Specialities, NSW, Australia) was added (40 ml). The Fromase treated milk was left to stand for approximately 3hours at 7° C. After 3 hours dilute sulphuric acid was added to the cold renneted milk, in-line immediately prior to cooking at 38° C., to reduce the pH to pH 5.35. The cooking process used was as outlined in Example 3. Washing was notcarried out.

The coagulated curd particles with a moisture content of about 54% were separated from the whey using a decanter. After whey separation the curd was milled. Salt (0.2 kg), water (2.0 kg) and high fat cream (4.0 kg) were added to 7 kg of milledcurd. The curd and ingredients were blended in a twin screw auger blender/cooker, heated to ≅72° C. and packed and stored under chilled conditions as outlined in Example 3. The final cheese composition was 23% fat, 50% moisture, 1.61%salt, pH. 5.87 and a calcium level of 115 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 8

Approximately 2250 L of skimmilk was pasteurized and cooled to 8 to 10° C. and rennet was added (125 ml, i.e. 55 ml/1000 L). The renneted milk was left to stand overnight for approximately 16 hours at 8 to 10° C. A second milkstream comprising 900 L of skimmilk and a lactic acid culture (Lactococcus lactis subspecies cremoris) was prepared and also left to stand overnight for approximately 16 hours at 26° C. to reduce the pH of the milk to pH 4.6. The second milkstream was then added to the cold renneted milk and mixed. The pH of the mixture was 5.3. The mixture was then cooked using direct steam injection at 48° C. and held for 50 seconds in a holding tube. The coagulated curd particles wereseparated from the whey using a screen and washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd). The washed, coagulated curd with a moisture content of about 53% was separated from the wash water using a decanter, milledand salted. Salt (0.2 kg), water (1.4 kg) and high fat cream (4 kg) were added to 7 kg of milled curd. The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅62° C. and packed and stored underchilled conditions as outlined in Example 3.

The final cheese composition was 22.2% fat, 54.3% moisture, 1.50% salt, pH 5.09, and a calcium level of 53 mmol/kg cheese.

136

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

In the ensuing examples, the coagulated curd particles were separated from the whey using a screen and washed using acidified water (8.3 L water, pH 2.6, dilute sulphuric acid/1 kg curd). The washed, coagulated curd was separated from the washwater using a decanter and typically had a moisture content of between 52 and 54% w/w.

EXAMPLE 9

Approximately 600 L of skimmilk was pasteurised and then cooled to 8 to 10° C. before rennet was added (33 ml). The renneted milk was left to stand for approximately 16 hours at 8 to 10° C. After 16 hours dilute lactic acid (0.25M) was added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled and salted. Salt (0.2 kg), water (1.9 kg) and high fat cream (4.0 kg) and Lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd. The curd and ingredients were blended in a twin screwauger blender/cooker, heated to ≅60° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 20.5% fat, 54.3% moisture, 1.37% salt, pH. 5.64 and a calcium level of 93 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process similar functional properties in terms of blister size,coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 10

Approximately 600 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (33 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute acetic acid (0.25 M) wasthen added to the cold renneted milk, in-line immediately prior to cooling at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled and salted. Salt (0.2 kg), water (1.9 kg), high fat cream (4.0 kg), lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated and to ≅65° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 20.5% fat, 54.1% moisture, 1.39% salt, pH 5.64 and a calcium level of 101 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 11

Approximately 600 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (33 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute hydrochloric acid (0.25 M)was then added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used

137

was as outlined in Example 3.

After dewatering the curd was milled. Salt (0.2 kg), water (1.9 kg), high fat cream (4.0 kg), lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅65° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.0% fat, 53.3% moisture, 1.41% salt, pH 5.64 and a calcium level of 99 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 12

Approximately 600 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (33 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid (0.25 M)was then added to the cold renneted milk, in-line immediately prior to cooling at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled. Salt (0.2 kg), high fat cream (4.0 kg) and lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅65° C. and worked as outlined in Example 3

Once at approximately 65° C. water (0.95 kg) was added and the now molten curd mixture was worked at 150 rpm for a further 1 minute.

The molten curd was then packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.0% fat, 54.0% moisture, 1.39% salt, pH 5.52 and a calcium level of 91 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 13

Approximately 2250 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (125 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid (0.25 M)was then added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3

After dewatering the curd was milled. Salt (0.18 kg), emulsification salts (0.035 kg trisodium citrate), water (2.4 kg), high fat cream (4.15 kg) and lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅65° C. and packed and stored under chilled conditions as outline in Example 3.

The final cheese composition was 21.0% fat, 54.5% moisture, 1.24% salt, pH 5.84 and a calcium level of 91 mmol/kg cheese.

138

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 14

Approximately 2250 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (125 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid (0.25 m)was then added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled. Salt (0.22 kg), gums (1.4 kg of an aqueous 10% kappa carrageenan solution), water (1.3 kg), high fat cream (4.0 kg) and lactic acid (0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅65° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.5% fat, 53.3% moisture, 1.61% salt and pH 5.78 and a calcium level of 98 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 15

Approximately 2250 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (125 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid (0.25 m)was then added to the cold renneted milk, in-line immediately prior to cooking at 42 to 45° C., to reduce the pH to pH 5.35. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was milled. Salt (0.21 kg), whey protein concentrate (cheese whey derived with 80% protein) derived from cheese whey (0.385 kg of an aqueous 20% solution), water (2.15 kg), high fat cream (4.15 kg) and lactic acid(0.272 kg of a 16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated at ≅65° C. and packed at stored under chilled conditions as outlined in Example 3.

The final cheese composition was 20.0% fat, 55.1% moisture, 1.40% salt, pH 5.82 and a calcium level of 92 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blister size,coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 16

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 42 to 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as

139

outlined in Example 3.

After dewatering the curd was frozen for later use. On thawing the aggregated curd was milled. Water (1.8/kg), salt (0.2 kg), high fat cream (4 kg) and 0.272 kg of lactic acid (16% solution) were added to 7 kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅68° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 22.0% fat, 54.0% moisture, 1.41% salt, pH 5.38 and a calcium level of 73 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 17

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 42 to 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was allowed to cheddar and frozen for later use. On thawing the cheddared curd was milled. Water (1.45 kg), salt (0.2 kg), high fat cream (3.5 kg) and 0.272 kg of lactic acid (16% solution) were added to 7 kg of milledcurd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅68° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 21.0% fat, 53.6% moisture, 1.49% salt, pH 5.31 and a calcium level of 63 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 18

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 42 to 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was allowed to cheddar and frozen for later use. On thawing the cheddared curd was milled. Water (1.1 kg), salt (0.2 kg), high fat cream (3.0 kg) and 0.272 kg of lactic acid (16% solution) were added to 7 kg of milledcurd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅68° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 19.5% fat, 53.3% moisture, 1.61% salt, pH 5.33, and a calcium level of 61 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made by this process

140

showed similar functional properties in terms of blistersize, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 19

Approximately 1800 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (100 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 42 to 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was allowed to cheddar and frozen for later use. On thawing the cheddared curd was milled. Water (0.75 kg), salt (0.165 kg), high fat cream (2.5 kg) and 0.272 kg of lactic acid (16% solution) were added to 7 kg ofmilled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to 68° C. and packed and stored under chilled conditions as outlined in Example 3.

The final cheese composition was 17.0% fat, 53.5% moisture, 1.42% salt, pH 5.33 and a calcium level of 68 mmol/kg cheese.

The cheese made by this process was a mozzarella or mozzarella-like cheese. Within 10 days of manufacture pizzas were made to evaluate cheese functionality. Cheese made made by this process showed similar functional properties in terms ofblister size, coverage and colour, background colour, melt appearance, oil off, stretch characteristics and in-mouth tenderness as a conventionally made mozzarella cheese.

EXAMPLE 20

Approximately 2200 L of skimmilk was pasteurized and then cooled to 8 to 10° C. before rennet was added (120 ml). The renneted milk was left to stand overnight approximately 16 hours at 8 to 10° C. Dilute sulphuric acid was thenadded to the cold renneted milk, in-line immediately prior to cooking at 44° C., to reduce the pH to pH 5.3. The cooking and washing process used was as outlined in Example 3.

After dewatering the curd was allowed to cheddar and was then chilled for use 5 days later. When required the cheddared curd was milled. Water (3.1 kg), salt (0.69 kg), high fat cream (7.0 kg) and (0.035 kg) Tri Sodium Citrate were added to 12kg of milled curd.

The curd and added ingredients were blended in a twin screw auger blender/cooker, heated to ≅68° C. as outlined in Example 3.

The 68° C. homogenous mass of curd was then placed in a dry, twin screw Mozzarella pilot plant cooker/stretcher (in-house design) and pumped through a (60 to 65° C.) jacketed, 10 barreled (16 mm×200 mm) String cheeseextrusion head. The Mozzarella cooker/stretcher was used as a pump to push the molten curd through the extrusion head.

Strings were cut into approximately 300 to 400 mm lengths and cooled in chilled water for approximately 10 to 15 minutes. On removal from the chilled water bath the lengths of String cheese were trimmed to 200 mm, laid on trays and blast frozen(-32° C.) for at least 1 hour.

The final String cheese composition was 20.5% fat, 54.1% moisture, 2.28% salt, pH 6.03 and a calcium level of 87 mmol/kg cheese.

The String cheese made by this process showed similar fibrous texture and flavour characteristics as those obtained in commercial String cheese made from Mozzarella curd.

INDUSTRIAL APPLICATION

The processes of the present invention and cheese made using the processes have commercial application in the cheese industry. In particular, mozzarella cheese made by this process has

141

application in the pizza making industry that utilisesmozzarella and mozzarella-like (pizza) cheese in significant quantities.

It will be appreciated that it is not intended to limit the invention to the above examples only, many variations, such as might readily occur to a person skilled in the art being possible without departing from the scope as defined in theappended claims. The present invention relates generally to cheese flavor compositions, fresh cheese products, and particularly, low-fat fresh cheese products, having desired flavor profiles. Processes for making and using the cheese flavor compositions also areprovided.

BACKGROUND

Natural cheese traditionally is made by developing acidity in milk and setting the milk with a clotting agent, such as rennet, or by developing acidity to the isoelectric point of the protein. The set milk is cut and whey is separated from thecurd. The curd may be pressed to provide a cheese block. Curing typically takes place over a lengthy period of time under controlled conditions. Cheddar cheese, for example, is often cured for a number of months or even longer, to obtain the fullflavor desired.

Numerous reports have been published implicating several compounds to be important in the development of cheese flavor in cheese products. The main classes of compounds thought to contribute to flavor generation in cheese include amino acids,peptides, carbonyl compounds, fatty acids, and sulfur compounds. Urbach, G., "Contribution of Lactic Acid Bacteria to Flavor Compound Formation in Dairy Products," Int'l Dairy J., 1995, 3:389-422. Several volatile compounds including fatty acids,esters, aldehydes, alcohols, ketones, and sulfur compounds are included in lists describing the aroma of various cheeses. Production of several of these aroma and flavor compounds have been attributed to multiple enzymatic reactions and/or chemicalreactions that take place in a sequential manner in ripening cheese.

Various microorganisms have been identified and selected for their ability to produce particular flavors in a cheese-ripening environment. These flavors arise through a series of enzymatic steps. For example, in cheese, degradation of proteinsby proteases and peptidases can lead to the production of peptides and free amino acids. These precursors are shuttled through subsequent enzymatic reactions resulting in the formation of flavor compounds. An understanding of these reactions helps inthe creation of flavors of a desired cheese type. Fox, P., Cheese: Chemistry, Physics and Microbiology, pp. 389-483, 1993.

The role of amino acid catabolism in the development of cheese aroma and flavor has been identified to be a rate limiting step in the development of cheese flavors. Yvon et al., "Cheese flavour formation by amino acid catabolism," Int. Dairy J.11 (2001) 185-201. α-Keto acids are generally recognized as a key intermediate in the metabolism and interconversion of amino acids. Some of the main pathways identified in lactic acid bacteria include transamination reactions catalyzed byaminotransferases. They are responsible for the deamination of amino acids and formation of keto acids. A disadvantage with the aminotransferase enzyme is that it requires the presence of an amino group acceptor, which is limiting in the cheese matrixand needs to be supplemented to enhance transamination. According to the literature, the creation of aroma compounds and cheese flavor is greatly enhanced with the addition of α-ketoglutarate, an amino group acceptor. Yvon et al., "Addingα-Ketoglutarate to Semi-hard Cheese Curd Highly Enhances the Conversion of Amino Acids to Aroma Compounds," Int. Dairy J. 8 (1998) 889-898.

The literature also describes acceleration of the development of flavor compounds by the exogenous addition of enzymes and cell extracts (e.g., U.S. Pat. No. 6,649,199), and by the supplementation of a cheese matrix with intermediates of aminoacid catabolism (e.g., U.S. Pat. No. 6,586,025; Banks et al., "Enhancement of amino acid catabolism in Cheddar cheese using α-ketoglutarate . . . ," Int. Dairy J. 11 (2001) 235-243).

According to at least one literature reference, D-amino acid oxidase is a flavoprotein which deaminates D-amino acids to the corresponding α-keto acids, ammonia, and hydrogen peroxide (H2O.sub.2) in the presence of molecular oxygen;the resulting hydrogen peroxide is degraded into water and molecular oxygen in the presence of catalase whereby keto acids remain as the final product. Upadhya et al., "D-Amino Acid oxidase and catalase of detergent permeabilized Rhodotorula graciluscells and its potential use for the synthesis of α-keto acids," Process Biochem.,

142

35 (1999) 7-13. U.S. Pat. No. 6,461,841 describes an isolated L-amino acid oxidase from Rhodococcus species encoded by a DNA molecule hybridizing to a particularnucleic acid sequence, which can be used for contacting an L-amino acid for the production of a keto acid. Neither of these last two-mentioned literature references refer to cheese microorganisms or a cheese-making environment involving such organisms. It has been reported that, although deamination of amino acids to α-keto acids might be catalyzed by either dehydrogenases or oxidases, such activities towards aromatic and branched-chain amino acids and methionine have never previously beendetected in cheese microorganisms. Yvonet al., "Cheese flavour formation by amino acid catabolism," Int. Dairy J. 11 (2001) 185-201, 189-190.

Cheese manufacturers are interested in developing cheese products requiring less storage time before they are ripe enough for commercial distribution. Cheese makers have used a wide variety of different techniques in efforts to accelerate thecheese curing or ripening process. U.S. Pat. No. 6,649,200 provides a summary of a number of these techniques used for accelerating ripening of hard block cheeses.

Another approach used to avoid lengthy cheese ripening periods has been to make a cultured cheese concentrate ("CCC") having more intense cheese flavor, and then use it as a cheese flavoring agent in another bulk material. CCC's have beenmanufactured that attain full cheese flavor development within a number of days instead of months. These CCC's are added to other bulk foods, such as process cheeses or snack foods, to impart or intensify a cheese flavor. Methods for the manufacture ofsuch cheese-flavored concentrates have been described in U.S. Pat. No. 4,708,876. Typically the process involves a dairy substrate that is cultured with a lactic culture followed by addition of various proteases, peptidases, and lipases. U.S. Pat. No. 4,708,876 describes cheese flavored concentrates that can be obtained from milk as a starting material, instead of cheese curds, or without formation of whey by-product. U.S. Pat. No. 6,214,586 describes use of live cultures having high levels ofproteolytic enzymes and peptidolytic enzymes to debitter enzymatic modified cultures (EMC's).

Methods of cream cheese manufacture have been previously described in publications such as by Kosikowski and Mistry in Cheese and Fermented Milk Foods, 3rd Ed.

Although these prior processes may produce an accelerated development, or an enhancement, of cheese flavor, they do not produce enhancements that target specific cheese flavor components. More recently a technology has been developed to producea natural biogenerated cheese flavoring system that can be used to prepare different cheese products/derivatives, targeted at various cheese flavor profiles using a modular approach to flavor creation, which is described in, for example, U.S. Pat. No.6,406,724. The cheese flavoring system described in this patent is derived from different components, wherein the individual components are combined in different ratios to provide specific flavor profiles in the cultured cheese concentrate products.

Despite the developments described in the above publications, a need still exists for alternative routes for making cheese flavoring systems, especially those produced via natural processes.

SUMMARY

The invention relates generally to biogenerated flavor compounds, cream cheese compositions containing biogenerated flavor compounds and processes of making such compounds.

In one embodiment, a process is provided for making a flavor compound, comprising heating a dairy product to a temperature in the range of 60 degrees Celsius (C.) to 140 degrees C. for an amount of time between 15 minutes and 24 hours to inducein-situ production of lactones. More specifically, the heating temperature may be about 84 to about 92 degrees C. and the heating time is about 55 to about 65 minutes, and more particularly, the heating temperature may be about 86 to about 90 degrees C.and the heating time is about 58 to about 62 minutes. The lactones produced may be any of g-hexalactone, g-octalactone, g-decalactone, g-dodecalactone, 6-dodecene-g-lactone, delta-hexalactone, delta-octalactone, delta-decalactone, delta-dodecalactone,and delta-tetradecalactone. In one embodiment the dairy product is a cream composition comprising concentrated milk fat and cream. Following the heating step, the heated dairy product is mixed with a salt citrate and a nitrogen source, providing afermentation premix. In one embodiment the salt citrate is sodium citrate and the nitrogen source is yeast extract. The resulting premix is then fermented in the presence of lactose fermenting bacteria and flavor producing bacteria in a two

143

phasefermentation cycle, wherein phase one is conducted without aeration and phase 2 is conducted with aeration. The lactose fermenting bacteria may be any of Lactococcus cremoris and Lactococcus lactis, and the like as well as combinations thereof. Theflavor producing bacteria may be any of Lactococcus lactis spp. diacetylactis and Leuconostoc cremoris, and the like as well as combinations thereof.

In another embodiment of the invention, a milk concentrate having a lactose concentration less than about 2 percent is also added to the fermentation premix otherwise as generally described above, as part of the process of making the cream cheeseproduct. The milk concentrate ingredient of the fermentation premix may be derived from any of skim milk and whole milk, or similar milk substrates. Preferably, the milk concentrate is a UF/DF retentate of skim or whole milk. The fermentation premixthat includes the milk concentrate is then fermented in a manner as generally described above, i.e., in the presence of the lactose fermenting bacteria and the flavor producing bacteria in a two phase fermentation cycle, wherein phase one is conductedwithout aeration and phase two is conducted with aeration.

The invention additionally provides the low-fat cream cheese-like fermentation products obtained using the processes of the invention. The low-fat cream cheese-like fermentation products of the process embodiments are ready for immediatepackaging and/or use, and do not require a separate curing or aging step for flavor development. The relatively low-fat cream cheese products of embodiments herein have flavor characteristics and profiles comparable to traditional higher fat contentfresh cheese and cream cheese products. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 provides a schematic flow diagram for a method of making a biogenerated flavor composition in accordance with an embodiment of the invention;

FIG. 2 provides a schematic flow diagram for a one day method for making a cream cheese base and incorporating a biogenerated flavor composition therein in an embodiment of the invention; and

FIG. 3 provides a schematic flow diagram for a two day method for making a cream cheese base and incorporating a biogenerated flavor composition therein in an embodiment of the invention.

DETAILED DESCRIPTION

The invention provides for the manufacture of cheese products enhanced with a natural flavoring system. The natural flavoring system described herein may be used with various types of cheese and dairy products. In one embodiment, the system maybe used in the production of flavor enhanced fresh cheese or cream cheese. In another embodiment, the system may be used in the production of low-fat cheese products, such as low-fat cream cheese. Fat generally aids in retention of flavor in foodproducts; therefore, in products where fat content has been reduced, flavor may be reduced. In one embodiment, to offset the potentially bland or mild flavor of low fat cream cheese products, biogenerated flavor compositions described herein may beadded to a low fat cream cheese base to enhance the flavor therein.

Turning to FIG. 1, an exemplary schematic flow diagram for a method of making a biogenerated flavor composition incorporating skim milk is provided. As shown in FIG. 1, at step 101 concentrated milk fat and cream are added to a heating tank, andtheir combination represents a dairy product. Inside the heating tank the concentrated milk fat and cream are heated to at least 60 degrees C. for at least 15 minutes, particularly about 84 to 92 degrees C. for about 55 to 65 minutes. In a preferredembodiment, the milk fat and cream are heated to about 88 degrees C. for about 60 minutes. This step is useful for producing thermally induced flavor compounds, such as, for example, various lactones, acetyls, and furans. A lactone is any cyclic esterwhich is the condensation product of an alcohol group and a carboxylic group in the same molecule. Lactones generally elicit a creamy flavor. Examples of lactones which may be produced include, but are not limited to, g-hexalactone, g-octalactone,g-decalactone, g-dodecalactone, 6-dodecene-g-lactone, delta-hexalactone, delta-octalactone, delta-decalactone, delta-dodecalactone, and delta-tetradecalactone. Examples of acetyls which may be produced include, but are not limited to, 2-acetylthiazoline. Examples of furans which may be produced include, but are not limited to, 2-methyl-3-methyl thiolfurane. Depending on how many thermally induced flavor compounds are preferred, the heating temperature and time may be adjusted. For example,the range of useful

144

temperatures is from about 60 degrees C. to about 140 degrees C. The range of useful heating time ranges from about 15 minutes to about 24 hours. There may also be additional factors considered when determining the optimal heatingtemperature and time such as types of manufacturing equipment used, desired processing time, and the like. In any case, any temperature or time useful for producing flavor compounds, such as lactones, is desired. The dairy product used a startingmaterial in this process step may be a cream composition comprising a milk fat source (e.g., concentrated milk fat) and natural cream combined in respective amounts to provide a mixture containing about 40 to 60 percent fat, 30 to 60 percent moisture, 1to 4 percent protein, and 1 to 5 percent lactose.

At step 103 skim milk is subjected to a membrane process, and preferably ultrafiltration and diafiltration, to separate milk fat, proteins, and other large biocomponents, as a retentate, from water and other smaller biocomponents (e.g., lactose,salts), as a permeate. In another embodiment, whole milk may be used in step 103. In yet another embodiment, any type of milk with any percent fat may be used such. For example, two percent milk may be used in step 103. Ultrafiltration anddiafiltration are also particularly useful for controlling the amount of small biocomponents separated from the skim milk colloid. More specifically, lactose retention may be controlled through ultrafiltration and diafiltration (UF/DF). By controllingthe amount of lactose retained in the retentate, the subsequent fermentation cycle can be controlled. It is desirable to control fermentation so microorganisms are directed to make desired flavor compounds such as diacetyl and acetoin. Although a UF/DFmembrane process is preferred, it will be appreciated that various membrane techniques and equipment can be applied for providing the desired level of constituents in the retentate. The retentate optionally can be dried and reconstituted with waterprior to further use in the inventive process. Drying may be effected by various means, such as spray drying, provided that reconstitutability is not affected.

In one example, the starting concentration of lactose in skim milk is about 5 percent. The concentrating process is generally performed at a temperature of about 100 to 140 degrees Fahrenheit (F.), and more typically 120 to 130 degrees F. Thebaseline pressure of the filtering system is generally 6 to 60 pounds per square inch gauge (psig), and more typically 20 to 30 psig. The concentration process will run for a period of time dependent on a number of factors including volume of milk to beprocessed, size of the filter or membrane used, and design of the filtering system. Following controlled ultrafiltration and diafiltration, or similar concentration system, the lactose concentration is reduced to approximately 1.0 to 1.5 percent. Wholemilk may be processed similar to skim milk as described above. The starting concentration of lactose in whole milk ranges from about 4 to 6 percent and is reduced to approximately 1.0 to 1.5 percent. In any case, regardless of the amount of milk fatcontained in the milk subjected to ultrafiltration and diafiltration (e.g. 0 percent, 2 percent, 5 percent, etc.), the amount of lactose contained in the retentate should be between about 0.5 percent and about 2.0 percent. Other factors in determiningultrafiltration and diafiltration time include retention of various minerals and vitamins such as magnesium, manganese, and iron. In one embodiment, the skim milk or other milk substrate is treated by ultrafiltration and diafiltration to provide aretentate having about 15 to 30 percent solids, about 70 to 85 percent moisture, about 0.5 to 4 percent lactose, about 0.1 to 1.0 percent milk fat, about 10 to 20 percent protein, about 0.1 to 2.0 percent salts, and about 0.1 to 2.0 percent ash. The pHof the retentate generally may range from about 6.0 to about 7.0. In one embodiment, the milk substrate is subjected to UF/DF techniques to produce an about 3× to about 8× (preferably about 5× to 6×) milk concentrate retentateproduct.

The resultant retentate from step 103, including, for example, milk fat, protein, a controlled amount of lactose, minerals, and vitamins, is directed to a mix tank at step 105. The retentate from step 103 is mixed with the concentrated milk fatand cream processed in step 101. Additionally, several ingredients are added to the products from steps 101 and 103 including, in one example, sodium citrate and yeast extract, providing a fermentation premix. In another example, salt and water may beadded in addition to sodium citrate and yeast extract. Sodium citrate is added as a substrate for microorganisms to convert into flavor compounds. Yeast extract is added to provide a source of molecular nitrogen, amino acids, and co-factors. Salt maybe added as a flavor ingredient. Water may be added to control the pH and/or moisture level of the mixture. In one embodiment wherein skim milk is utilized, the mixture may comprise the following composition: cream 15 to 35 percent, water 10 to 30percent, salt 0.1 to 2.0 percent, sodium citrate 0.1 to 1.0 percent, yeast extract 0.01 to 0.20 percent, concentrated milk fat 5 to 15 percent, and concentrated skim milk 35 to 55 percent. In another embodiment wherein whole milk is utilized, themixture may comprise the following composition: cream 5 to 25 percent, water 10 to 30 percent, salt 0.5 to 2.0 percent, yeast extract

145

0.01 to 0.20 percent, and concentrated whole milk 55 to 75 percent.

Varying amounts of sodium citrate, yeast extract, salt, and water may be added depending on the desired fermentation products. Also, there are ingredients that may be used interchangeably with sodium citrate, such as, for example citric acid andedible salts thereof (e.g., sodium citrate, ammonium citrate, etc.). Similarly, other compounds which contain molecular nitrogen and/or amino acids and/or co-factors may be used in lieu of yeast extract, such as, for example, corn steep liquor andprotein hydrosylates. Also, salt as a flavor additive may not be added to the mixture at all. This may particularly be the case in the production of low sodium foods. In one example, all of the ingredients are mixed together for approximately 5 to 15minutes. However, any amount of time sufficient to mix the ingredients together may also be used. Other additives known or useful in the cheese-making arts optionally can be added as desired, especially to the extent that they do not adversely affectdevelopment and retention of the unique flavoring system described herein. Such optional additives include, for example, preservatives, colorings, flavorings, emulsifiers, stabilizers, or mixtures thereof. Also, if desired, vegetable oil or othernon-dairy fat may be added to form a portion of the fat content of the cream cheese product that is prepared by the process. Product texture modifiers, such as functionalized whey protein, also optionally may be included.

In another embodiment, step 103 may be excluded from the process. In this case, sodium citrate, yeast extract, salt, and water are mixed directly with the product of step 101 in the mix tank at step 105. This embodiment may be useful in theproduction of a fresh cheese composition containing an average amount of fat with a high flavor profile. Processes incorporating step 103 may be useful for the production of lower fat fresh cheese products with an enhanced flavor profile.

At step 107 the mixture is heated to approximately 50 degrees C. for approximately 16 seconds to melt the milk fat contained in the mixture. However, varying temperatures and times useful for liquefying the milk fat may be used. The heatedmixture from step 107 is homogenized at step 109. Following homogenization, the mixture is pasteurized at step 111. In one example, the mixture is pasteurized by heating the mixture to 74 degrees C., holding the mixture at 74 degrees C. for 16 secondsand, finally, cooled to less than 30 degrees C. However, any pasteurization process may be substituted for the pasteurization process detailed here. After pasteurization, the mixture is directed into a fermentor at step 113. The fermentation vesselpreferentially includes mixing capabilities to ensure contract between the cultures and substrate materials. A bacterial culture cocktail is added to the mixture inside the vessel to start fermentation. The culture cocktail is a mixture of lactosefermenting and flavor producing bacteria. These cultures may be provided in a frozen concentrated form known as Direct Vat Set (DVS) or as an active pre-culture grown the previous day which is known as Bulk Set (BS). The preferred method is to utilizethe DVS culture system. The lactose fermenting cultures are generally of the species Lactococcus cremoris and Lactococcus lactis, and the like as well as combinations thereof. The lactose fermenting cultures produce lactic acid, as well as otherorganic acids and flavor compounds, to lower the pH from about 6.5 to about 4.7. The flavor producing bacterial are generally of the species Lactococcus lactis ssp. diacetylactis and Leuconostoc cremoris, and the like as well as combinations thereof. The flavor producing cultures have the ability to produce diacetyl, acetoin, and other flavor compounds from citrate, citric acid, or derivatives thereof. Additionally, the fermentation process increases the amount of lactones produced in the initialheating step by 30 to 85 percent. Any suitable culture of these types may be used, but they are preferably pre-tested and selected on the basis of producing high levels of flavor. Most preferentially they contain a mutation in the gene for acetolactatedecarboxylase. These cultures are each added at about 0.1 to 0.01 percent.

The fermenting mixture is maintained under a pressure of about 1 to 5 psig. The fermentation temperature is controlled to about 26 degrees C. In one embodiment, fermentation may be divided into two phases. Phase 1 is conducted without aerationfor about 12 hours until the pH is about 4.7. In another embodiment, phase 1 is conducted without aeration until the pH is about 5.4 or higher, regardless of elapsed time. Phase 2 begins with sterile air added at about 1 to 5 scfm (square cubic feetper minute). In another embodiment, fermentation is a single phase process wherein the mixture is aerated for approximately 40 hours. Aeration can be effected chemically or mechanically. Catalase can be introduced which liberates oxygen from hydrogenperoxide. Air or oxygen gas also may be introduced into the reaction mixture, such via a diffusion plate or an in-line sparger. The dissolved oxygen (DO) is continuously monitored throughout the fermentation cycle. DO is typically about 100 percent atthe beginning of the fermentation cycle, but decreases as the flavor producing reactions consume oxygen. Phase 2 of the fermentation is continued for about 28 hours. The total fermentation time is about 40 hours, or until the flavor reactions arecomplete. Sorbic acid or

146

potassium sorbate may be added as a preservative.

Following fermentation, the mixture is directed to a heat exchanger at step 115 for deactivation of the cultures. The mixture is first heated to a high temperature, such as 74 degrees C., and held for 16 seconds to inactivate bacteria survivingfrom the fermentation step. Following deactivation, the mixture is cooled to 20 degrees C. Variations of the deactivation step may be substituted. Generally the mixture should be subjected to a high enough temperature for enough time to inactivatesurviving bacteria and then cooled to a reasonable working temperature.

Following deactivation at step 115 the mixture is directed to a storage container at step 117 to be further cooled, such as for example to about 5 degrees C. Finally, in step 119 the mixture is held at approximately 4 degrees C. The processillustrated in FIG. 1 can be employed as a batch, semi-continuous, or continuous process.

The biogenerated flavor composition described herein may be added to any food product for the purpose of enhancing flavor and/or organoleptic properties. However, in one embodiment, the biogenerated flavor composition may be added to freshcheese or cream cheese products. In yet another embodiment, the biogenerated flavor composition may be added to low fat fresh cheese or cream cheese products. In another embodiment, the biogenerated flavor composition may be added to any dairy product.

Following processing as described hereinabove, the final mixture may contain the following flavor compounds diacetyl, acetoin, ethanol, 2-heptanone, 2-nonanone, 2-pentanone, acetone, 2-acetyl thiazoline, 2-methyl-3-methyl thiolfurane,g-hexalactone, g-octalactone, g-decalactone, g-dodecalactone, 6-dodecene-g-lactone, delta-hexalactone, delta-octalactone, delta-decalactone, delta-dodecalactone, and delta-tetradecalactone.

The flavor level of the cream cheese product can be judged organoleptically and/or can be estimated through analytical measurements (e.g., via gas chromatography), such as pH, titratable acidity, and concentration of lactones, free fatty acids,amino acids, or other metabolites known to be associated with a given cheese flavor profile.

Turning now to FIG. 2, a schematic flow diagram for a one day method for making a cream cheese base and incorporating a biogenerated flavor composition therein is provided. This method of making cream cheese is performed without a culture stepor a separation step.

At step 201 a mix is prepared by adding water, milk fat and either modified whey protein or other milk proteins. At step 203, the mixture prepared in step 201 is standardized to a pH of 4.9. Then, at step 205, the mixture is heated to 140degrees F. At step 207 the mixture is homogenized at 5000/500 psi. The homogenized mixture is then heated to 200 degrees F. and held for approximately 10 minutes at step 209. At step 211 dry ingredients such as, but not limited to, salt, gums,vitamins, calcium, and maltodextrin are added to the cream cheese mixture. The mixture is then heated to 180 degree F. and held for 10 minutes at step 213. Then, at step 215 about 1 to 10 percent, and preferably 4 percent, of the biogenerated flavorcomposition is added to the cream cheese mixture. The cream cheese mixture and biogenerated flavor composition are homogenized at 5000/500 psi step 217, packaged at step 219, and cooled at step 221. The final fat concentration of the cream cheeseproduct containing the biogenerated flavor composition may be less than about 20 percent, particularly about 1 to about 10 percent fat, and more particularly about 4 percent to about 7 percent fat. However, in alternate embodiments, the flavorcomposition may be added to full fat dairy bases yielding a higher fat concentration.

Turning now to FIG. 3, a schematic flow diagram for a two day method for making a cream cheese base and incorporating a biogenerated flavor composition therein is provided.

At step 301 a mix is prepared by adding milk and cream adjusted to a specified fat content, preferably between about 1.5 to 2.5 percent fat. Then, the mixture is homogenized at step 303, pasteurized at step 305, and cooled at step 307. At step309, a portion of the mixture, preferably about 15 percent, is placed in a cooler for standardization. The remaining mixture is inoculated with DVS lactic cultures at step 311. Next, at step 313, the mixture ferments in the presence of the lacticcultures for approximately 18 to 24 hours at a temperature of about 70 to 75 degrees F. until the pH of about 4.35 to 4.60 is reached. At step 315, the fermented mixture prepared in step 313 is standardized with the mixture set aside in step 309 to a pHof about 4.70 to 4.80. The standardized

147

mixture is then heated to about 115 degrees F. at step 317. Next, at step 319 the mixture is subjected to a membrane process, preferably ultrafiltration, to concentrate the retentate to approximately 23 percentsolids. In another embodiment, a centrifugal separator may be used to concentrate the curd. The separated curd is then cooled to a temperature less than 60 degrees F. at step 321. Then, at step 323 biogenerated flavor composition may be added to thecream cheese mixture and homogenized at step 325. The mixture of step 323 (with or without biogenerated flavor composition) is combined with modified whey proteins or other milk proteins at step 327. The cream cheese composition is then heated to 125degrees F. for 5 to 10 minutes at step 329. At step 331 dry ingredients such as, but not limited to, salt, gums, vitamins, calcium, and maltodextrin are added to the cream cheese mixture. At step 333 the composition is then heated to 125 F. for 30minutes followed by an increase in temperature of 155 degrees F. and homogenization at 5075/725 psi at step 335. Next, at step 337, the cream cheese is heated to 180 degrees F. and recirculated for 30 minutes to build texture. At step 339 abiogenerated flavor composition may be partially or wholly added to the cream cheese mixture, depending on whether a biogenerated flavor composition was added at step 323. The cream cheese mixture and biogenerated flavor composition are packaged at step341 and cooled at step 343. The final fat concentration of the cream cheese product containing the biogenerated flavor composition may be less than about 20 percent, particularly about 1 to about 10 percent fat, and more particularly about 4 percent toabout 7 percent fat. However, in alternate embodiments, the flavor composition may be added to full fat dairy bases yielding a higher fat concentration.

Further descriptions of the production of cream cheese products, and in particular low-fat cream cheese products with enhanced texture may be found in a co-pending application filed on the same date, Sep. 30, 2005 identified by Attorney DocketNo. 77361, which is incorporated herein by reference.

The following examples describe and illustrate certain processes and products of the invention. These examples are intended to be merely illustrative of the invention, and not limiting thereof in either scope or spirit. Variations of thematerials, conditions, and processes described in these examples can be used. Unless otherwise noted, all percentages are by weight.

EXAMPLE 1

1.0--Preparation of Low-Fat Cream Cheese Using Biogenerated Flavor System.

1.0--Preparation of Low Fat Cream Cheese Base: A 7% fat cream cheese composition was produced by mixing 38.96 lbs. WPC 80 (Leprino Cheese), 33.9 lbs. dry whey and 327.14 lbs. water (acidified to pH 3.35 with an 18% concentration of phosphoricacid), heated to 200 degrees Fahrenheit (F.) and held for 6 minutes to form a whey mix. Next, 78.34 lbs. whey mix was blended with 18.16 lbs. cream and the pH was adjusted to 4.9 using sodium hydroxide to yield a cream cheese mix. The cream cheesemix was heated to 140 degrees F. and homogenized at 5000/500 psi. The homogenized mix was heated to 200 degrees F. and held for 10 minutes. Then, 64.334 lbs. cream cheese mix was blended with 0.035 lbs. sorbic acid, 0.049 lbs. xanthan gum, 0.267lbs. carob gum, 1.469 lbs. maltodextrin, 0.629 lbs. tricalcium phosphate, and 0.417 lbs. salt. The mix was heated to 180 degrees F. and held for 10 minutes.

1.2--Preparation of Lactones: A cream composition comprising 194.21 lbs. of cream and 31.94 lbs. of concentrated milk fat having a composition of 42.00% fat, 53.80% moisture, 1.80% protein, and 3.1% lactose was heated to 88 degrees C. and heldfor 60 minutes. Following the initial heating step, the heated composition was found to have the following flavor compounds:

TABLE-US-00001 Creamy Flavor Compounds g-hexalactone 5 PPB g-decalactone 33 PPB g-dodecalactone 321 PPB 6-dodecene-g-lactone 119 PPB Delta-hexalactone 114 PPB Delta-octalactone 134 PPB Delta-decalactone 1114 PPB Delta-dodecalactone 2445 PPBDelta-tetradecalactone 2808 PPB

1.3--Further Processing of Biogenerated Flavor Composition: 332.86 lbs. of concentrated skim milk was subjected to ultrafiltration and diafiltration such that the resulting retentate contained 0.20% fat, 18.50% protein, 76.65% moisture, 0.30%salt, and 1.20% lactose. The heated cream composition and the skim milk retentate were mixed in a Breddo mixer with 2.25 lbs. sodium citrate, 0.75 lbs. yeast extract, 6.1 lbs. salt, and 140.4 lbs. water. The mixture was heated to 50 degrees C.,homogenized, and pasteurized. Pasteurization included heating the mixture to 74 degrees C.,

148

holding the mixture at 74 degrees C. for 16 seconds, and cooling to 30 degrees C. The pasteurized mixture was then fermented for 40 hours in a two phase process. A DVS culture containing Lactococcus cremoris, Lactococcus lactis, Lactococcus lactis spp. diacetylactis, and Leuconostoc cremoris (Chr Hansen Laboratories) was added to the fermentation vessel, where the initial concentration of the DVS culture was0.01% of the total mixture volume. Phase 1 of the fermentation was conducted without aeration for 12 hours. Phase 2 was conducted with sterile air aeration for 28 hours. The temperature of the fermentation vessel was kept at approximately 26 degreesC. through out phase 1 and phase 2 of the fermentation cycle. The mixture was then directed to a heat exchanger and heat treated to 74 degrees C., held for 16 seconds, and cooled to 20 degrees C. The mixture was then directed to a barrel and furthercooled to 5 degrees C. The final product was held at 4 degrees C. until use.

The final mixture had a composition profile as shown below:

TABLE-US-00002 Citric acid <0.01% Fat 18.12% Moisture 68.30% Protein 7.90% Lactose <0.01% Salt 0.90% pH 5.31

The final mixture contained the following flavor compounds:

TABLE-US-00003 Cultured-Fermented Flavor Compounds Diacetyl 16 PPM Acetoin 328 PPM Ethanol 96 PPM 2-Heptanone 1 PPM 2-Nonanone 1 PPM 2-Pentanone <1 PPM Acetone 1 PPM Creamy Flavor Compounds g-hexalactone <5 PPB g-octalactone 13 PPBg-decalactone 75 PPB g-dodecalactone 496 PPB 6-dodecene-g-lactone 273 PPB Delta-hexalactone 177 PPB Delta-octalactone 189 PPB Delta-decalactone 1755 PPB Delta-dodecalactone 3604 PPB Delta-tetradecalactone 6522 PPB

2.3--Incorporation of Biogenerated flavor with 7% Fat Cream Cheese. Finally, 2.8 lbs. of the biogenerated flavor as produced in step 1.2 and 1.3 above was mixed with the cream cheese as produced in step 1.1 above.

EXAMPLE 2

2.0--Preparation of Low-Fat Cream Cheese Using Biogenerated Flavor System.

2.1--Preparation of Low Fat Cream Cheese Base: A 7% fat cream cheese composition was produced by mixing 38.96 lbs. WPC 80 (Leprino Cheese), 33.9 lbs. dry whey and 327.14 lbs. water (acidified to pH 3.35 with an 18% concentration of phosphoricacid), heated to 200 degrees Fahrenheit (F.) and held for 6 minutes to form a whey mix. Next, 78.34 lbs. whey mix was blended with 18.16 lbs. cream and the pH was adjusted to 4.9 using sodium hydroxide to yield a cream cheese mix. The cream cheesemix was heated to 140 degrees F. and homogenized at 5000/500 psi. The homogenized mix was heated to 200 degrees F. and held for 10 minutes. Then, 64.334 lbs. cream cheese mix was blended with 0.035 lbs. sorbic acid, 0.049 lbs. xanthan gum, 0.267lbs. carob gum, 1.469 lbs. maltodextrin, 0.629 lbs. tricalcium phosphate, and 0.417 lbs. salt. The mix was heated to 180 degrees F. and held for 10 minutes.

2.2--Preparation of Biogenerated Flavor Composition: 102 lbs. of a cream composition containing 42.00% fat, 53.80% moisture, 1.80% protein, and 3.1% lactose was heated to 88 degrees C. and held for 60 minutes. 482.25 lbs. of whole milk wassubjected to ultrafiltration and diafiltration such that the resulting retentate contained 18.50% fat, 13.00% protein, 65.00% moisture, 0.30% salt, and 1.20% lactose. The heated cream composition and the whole milk retentate were mixed together in aBreddo mixer with 2.25 lbs. sodium citrate, 0.75 lbs. yeast extract, 6.75 lbs. salt, and 156 lbs. water. The mixture was heated to 50 degrees C., homogenized, and pasteurized. Pasteurization included heating the mixture to 74 degrees C., holdingthe mixture at 74 degrees C. for 16 seconds, and cooling to 30 degrees C. The pasteurized mixture was then fermented for 40 hours in a two phase fermentation process. A DVS culture containing Lactococcus cremoris, Lactococcus lactis, Lactococcus lactisspp. diacetylactis, and Leuconostoc cremois (Chr Hansen Laboratories) was added to the fermentation vessel, where the initial concentration of the DVS culture was 0.01% of the total mixture volume. Phase 1 of the fermentation was conducted withoutaeration for 12 hours. Phase 2 was conducted with sterile air aeration for 28 hours. The temperature of the fermentation vessel was kept at approximately 26 degrees C. through out phase 1 and phase 2 of the fermentation cycle. The mixture was thendirected to a heat exchanger and heat treated to 74 degrees C., held for 16 seconds, and cooled to 20 degrees C. The mixture was

149

then directed to a barrel and further cooled to 5 degrees C. The final flavor product was held at 4 degrees C. until use.

The biogenerated flavor composition had a composition profile as shown below:

TABLE-US-00004 Citric acid <0.01% Fat 16.59% Moisture 70.60% Protein 10.40% Lactose <0.01% Salt 0.90% pH 5.44

The final biogenerated flavor composition contained the following flavor compounds:

TABLE-US-00005 Cultured-Fermented Flavor Compounds Diacetyl 30 PPM Acetoin 612 PPM Ethanol 17 PPM 2-Heptanone <1 PPM 2-Nonanone <1 PPM 2-Pentanone 1 PPM Acetone 1 PPM Creamy Flavor Compounds g-octalactone 4 PPB g-decalactone 28 PPBg-dodecalactone 302 PPB 6-dodecene-g-lactone 176 PPB delta-octalactone 161 PPB delta-decalactone 1344 PPB delta-dodecalactone 2778 PPB

2.3--Incorporation of Biogenerated flavor with 7% Fat Cream Cheese. Finally, 2.8 lbs. of the biogenerated flavor as produced in step 2.2 above was mixed with the 7% cream cheese as produced in step 2.1 above.

EXAMPLE 3

Preparation of Cream Cheese Base. A 7% fat cream cheese was prepared by mixing 59.5 lbs. WPC50 (First District Association), 10.40 lbs. dry whey and 330.10 lbs. water was acidified to pH 3.35 with 18% concentration phosphoric acid, heated to200 degrees F. and held for 6 minutes to form a whey mix. After heating, the 62.28 lbs. whey mix was blended with 11.11 lbs. cream and the pH was adjusted to 4.9 using sodium hydroxide to yield a cream cheese mix. The cream cheese mix was heated to140 degrees F. and homogenized at 5000/500 psi. The homogenized mix was heated to 200 degrees F. and held for 10 minutes. Then, 64.334 lbs. cream cheese mix was blended with 0.035 lbs. sorbic acid, 0.049 lbs. xanthan gum, 0.267 lbs. carob gum,1.469 lbs. maltodextrin, 0.629 lbs. tricalcium phosphate, and 0.417 lbs. salt. The mix was heated to 180 degrees F. and held for 10 minutes. Finally, 2.0 lbs. of the biogenerated flavor was added to 48.0 lbs of the cream cheese mix. The creamcheese mix was homogenized at 5000/500 psi and packaged.

EXAMPLE 4

Preparation of Cream Cheese Base. A 5% fat cream cheese was prepared by mixing skim milk and cream to yield approximately 3000 lbs. of mix at 1.7% fat. The mix was then homogenized, pasteurized and cooled. Approximately 400 lbs. of mix wasset aside for day 2 pH standardization. Direct set lactic acid cultures were added to 2600 lbs. of the mix and incubated for 18 hours at 70 degrees F. The pH of the incubated mix was 4.53 on day 2. The pH was standardized to 4.73 with the addition ofthe 400 lbs. unfermented mix. The mix was then concentrated using UF and the retentate was collected at 23.1 percent solids. Next, 48.6 lbs. retentate was mixed with 40 lbs. of functionalized whey protein (made in accordance with patent applicationNo. EP 04027965.5), 0.8 lbs. salt, 0.45 lbs. carob gum, and 0.15 lbs. carrageenan gum to form cream cheese. The cream cheese was heat to 131 degrees F. and homogenized at 5000/100 psi. The cream cheese was then heated to 183 degrees F. andrecirculated for 45 minutes to build texture. 10 lbs. of biogenerated flavor was added to the cream cheese.

EXAMPLE 5

Preparation of Cream Cheese Base. A 5% fat cream cheese was prepared by mixing skim milk and cream to yield approximately 1500 Kg. of mix at 1.6% fat. The mix was then homogenized, pasteurized and cooled. Approximately 225 Kg of the mix wasset aside for day 2 pH standardization. Direct set lactic acid cultures were added to 1275 Kg of the mix and incubated for 18 hours at 24 degrees C. The pH of the incubated mix was 4.39 on day 2. The pH was standardized to 4.62 with the addition of the225 Kg unfermented mix. The mix was then concentrated using a UF and the retentate was collected at 23.8 percent solids. The retentate was then cooled to 9 degrees C. and homogenized at 400/80 bar. Next, 40 Kg of functionalized whey protein (made inaccordance with patent application No. EP 04027965.5) was homogenized at 390/70 bar and mixed with 51.7 Kg retentate form cream cheese. The cream cheese was heated to

150

52 degrees C. and held for 10 minutes. Ingredients such as 0.8 Kg salt, 0.35 Kg carobgum and 0.15 Kg carrageenan gum were added to the cream cheese. The cream cheese was then held at 52 degrees C. for 30 minutes, heated to 70 degrees C., homogenized at 350/50 bar and recirculated at 81 degrees C. for approximately 30 minutes to buildtexture. Finally, 7 Kg of biogenerated flavor was added to the cream cheese and packaged.

EXAMPLE 6

Preparation of Cream Cheese Base. A 7% fat cream cheese was prepared by mixing 10.42 lbs. MPC 70 (Fonterra), 1.6 lbs. dry whey, 12.32 lbs. cream and 48.21 lbs. in a tank and the pH was adjusted to 4.9 using lactic acid to yield a creamcheese mix. The cream cheese mix was heated to 140 degrees F. and homogenized at 5000/500 psi. Then, 45.34 lbs. of the cream cheese mix was blended with 0.025 lbs. sorbic acid, 0.035 lbs. xanthan gum, 0.190 lbs. carob gum, 1.5 lbs. maltodextrin,0.450 lbs. tricalcium phosphate, and 0.460 lbs. salt. The mix was heated to 180 degrees F. and held for 10 minutes. Finally, 2.0 lbs. of the biogenerated flavor was added to the cream cheese mix. The cream cheese mix was homogenized at 5000/500 psiand packaged.

All references cited herein are incorporated by reference. The present invention relates to a novel method for the production of spun-curd cheeses.

More specifically, the invention relates to a novel method for the production of spun-curd cheeses, according to which a pasteurized milk is used, which is acidified before or after pasteurization in a controlled manner by means of an acidogenicagent.

In the context of the present invention, the term "spun-curd cheeses" is intended to mean, in accordance with the classification given in the work "Le Fromage" ["Cheese"], by Andre E C K, Technique et Documentation (Lavoisier, Paris, 1984), page245, plastic-curd cheeses in which said curd, once the serum has been drained, is immersed either in hot water or in hot serum, and worked, pulled, before being molded when it is in the plastic state. The main cheeses that fall within this category arein particular cheeses of the type: Mozzarella, Provolone, Sarde, Metton, and pizza cheeses.

Conventionally, spun-curd cheeses are produced from whole or partially skimmed milk, which is renneted and acidified. The renneting consists in adding coagulating enzymes to the matured milk.

The curd formed is cut into slices (curd-cutting) until grains having a desired size are obtained, and drained, then heated, so as to accentuate, inter alia, the departure of the serum from the curd grains. When the desired acidification isobtained, the curd is vigorously mixed, pulled, modeled and smoothed, either manually, or with a machine, in water or warm serum, and then rapidly cooled, dried and salted.

The starting raw milk can be subjected to operations consisting of thermal treatment and of maturation, by means of the addition of lactic ferments which result in acidification of the milk to a pH value corresponding to the demands required forthe subsequent renneting step, generally between approximately 6.5 and 6.

It is known that increasing the pasteurization temperature of cheese-making milks can make it possible to increase the cheese yield, and that it is advantageous for hygiene reasons to be able to treat milks at temperatures above 72° C. Itis also known that such thermal treatments reduce the ability of the milk to convert to cheese. The applicant has therefore provided, in its patent EP 347.308 B1, a solution for overcoming all the difficulties inherent in the use of milks treated athigh temperatures. This solution consists of the addition to the these milks of an acidogenic agent chosen from gluconolactones or glucoheptonolactones, making it possible to restore the cheese-producing capacities without resorting to noveltechnologies. Thus, it has become possible to produce renneted cheeses, such as in particular soft cheeses, from milks heated to more than 78° C.

However, the applicant has noted that this overheating method does not make it possible to produce spun-curd cheeses according to conventional technology. This is because, and as will be demonstrated later, the treatment of milks at certaintemperatures is incompatible with satisfactory curd-spinning properties. The spinning ability is the determining criterion of this type of cheese. The spinning is a type of fibration by pulling, and it is important to promote sliding of the fibers

151

overthemselves in order to obtain maximum spinning. Now, spinning is not possible, or else is mediocre, when a milk pasteurized at high temperature and acidified with glucono-delta-lactone (hereinafter defined by the abbreviation "GDL") is used.

There was therefore an unsatisfied need for a method for the production of spun curds from milks pasteurized at high temperature and acidified with an acidogenic agent.

Seeking to find a solution to this problem, the applicant noted that a gradual increase in the milk treatment time/temperature couple sizably decreased the spinning ability. The curds obtained became increasingly less cohesive, dispersing at thehighest temperatures, and giving an increasingly shorter curd texture. The milk pasteurization temperature and time are therefore critical parameters in the production of spun curds.

Moreover, the spinning ability of curds derived from heated milks is improved by increasing amounts of acidogenic agent. However, the spun curds obtained still exhibit mediocre technological abilities.

Furthermore, it has always been necessary to correct thermally treated milks by adding calcium salts, and in particular calcium chloride, after treatment, so as to decrease the solidifying time and to increase the rate of firming of the coagulum,and also to improve the rheological properties of the curd. It may in fact be noted that all the cheeses described in the abovementioned patent EP 347.308 B1 are produced using a milk treated at a high temperature, to which calcium chloride is thenadded so as to correct the technological abilities of the curd and to obtain the same solidifying time as with raw milk. Now, in the case of spun curds prepared from milk treated at high temperature, the applicant has noted, in the course of manytrials, that the addition of calcium chloride to the milk runs counter to the spinning abilities.

To the applicant's credit, it has noted that, surprisingly, by combining the effect of a selected pasteurization time/temperature couple, an optimized dose of acidogenic agent, and a depletion of the milk in terms of exogenous calcium salts, itis possible to aspire to the production of spun curds of quality comparable, and even superior, to spun curds obtained according to conventional techniques.

Without wishing to be bound to any theory, it appears that the acidogenic agent plays a predominant role in terms of calcium balances during the coagulation of the milk. Thus, the presence of a certain dose of acidogenic agent would act as acalcium store, thus regulating the mineralization of the curd and allowing suitable, or even improved, spinning when the cheese-forming conditions or the conditions of thermal treatment of the milk are unfavorable. Calcium chloride cannot in itselfconstitute a store since adding it alone immediately increases the portion of ionized calcium and abruptly modifies the micellar equilibrium.

A subject of the invention is therefore a method for the production of spun-curd cheeses from pasteurized milk, comprising the successive steps of preparation of the milk, renneting, coagulation, curd-cutting, draining and spinning, characterizedin that, during the phase consisting of preparation of the milk, which has a low exogenous calcium salt content, said milk is thermally treated at a temperature of between 80 and 85° C., and an effective amount of acidogenic agent is added beforeor after said thermal treatment.

For the purpose of the present invention, the term "exogenous calcium salts" is intended to mean the non-micellar calcium salts intentionally introduced into the milk in order to correct its technological abilities, and in particular calciumchloride. The term "low content" is intended to mean the fact that the milk used in the method according to the invention contains little or no added calcium salts. Since the composition of milks is very variable according to their origin, a lowexogenous calcium salt content allowing the implementation of the present invention is reflected by a milk preferably comprising less than 0.4 g of calcium salts per liter of milk, more preferably less than 0.2 g/l, and even better still less than 0.1g/l. According to a preferred variant of the method according to the invention, the milk is free of exogenous calcium salts.

The milk used according to the invention is a non-reconstituted milk of any origin, that is raw or has undergone prior thermal treatment at a temperature of less than 78° C., that has optionally undergone standardization in terms of fattycontent, and/or that has undergone adjustment in terms of protein content by ultrafiltration. It is also possible to use a reconstituted milk (mixture of

152

powdered milk and water) or a recombined milk (mixture of powdered milk, water and milk fat).

The term "acidogenic agent" is understood to mean any substance capable of gradually generating an acid in milk, either by solubilization or by release. Among the substances capable of gradually generating an acid in milk by solubilization arein particular lactones such as glucono-delta-lactones and glucoheptonolactones, and the like, and/or mixtures thereof, which, in an aqueous medium, gradually hydrolyze to the corresponding acid. Among the substances capable of gradually generating anacid in milk by release, are, for example, acids attached to a delayed-solubilization or delayed-disintegration support.

The introduction of acidogenic agent can be carried out, without implied distinction, in the form of a powder or in the form of a solution.

When the preference is to provide this acidogenic agent in the form of a solution, i.e. a solution in water or milk, said solution is advantageously prepared at the time of use in order to preserve the acidogenic nature of the agent as definedabove.

By way of indication, the acidogenic agent may be introduced into raw milk, before or after a first optional pasteurization treatment, before or after the thermal treatment for the purpose of the invention, i.e. at between 80 and 85° C.

It appears, however, that it is preferable to introduce the acidogenic agent into the milk after the thermal treatment according to the invention.

Preferably, the thermal treatment of the milk is carried out at a temperature of between 80 and 82° C. Very good results have been obtained when the treatment is carried out at 80° for 20 to 60 seconds, and preferably for 20seconds. The spinning is also very good after treatment at 82° C.; however, a few grains of serum proteins appear in the curd. Beyond 82° C., spinning is no longer possible.

As regards the acidogenic agent, glucono-delta-lactone (GDL) is preferably used. Advantageously, the latter is added at a rate of 0.5 to 1.5 g/l, preferably of 0.7 to 1 g/l of milk, and even more preferably at a rate of 1 g/liter of milk. Sucha dose of GDL makes it possible to obtain a pH at spinning of a minimum of 5.4, and preferably 5.1, based on which pH the applicant has demonstrated the best chances of spinning.

All the steps subsequent to the milk preparation phase are characteristic of spun-curd technology and will be chosen according to the general knowledge of those skilled in the art.

The method in accordance with the invention has many advantages compared with the prior art, besides that of allowing the spinning of curds obtained by acidification of a pasteurized milk with GDL. It sizably increases production yields byallowing a gain in recovered nitrogenous substances that is greater than that of the conventional methods, which is an obvious economical advantage, and it makes it possible, through reducing the ionized calcium contents, to combat the proliferation ofbacteriophages that are responsible for the attack and lysis of lactic ferments and that disturb the acidification of the milk, the formation of the curd and its organoleptic quality.

In addition, it is highly possible that the doses of ferments and of coagulants to be added may be decreased, which is another economical advantage.

The invention will be understood more clearly on reading the examples which follow and which contain the description of advantageous embodiments. All these examples were carried out by the Ecole Nationale d'Industrie Laitiere [National DairyIndustry School] in MAMIROLLE-BESANCON (France) in connection with the company Chr. HANSEN France (ARPAJON-France). 

EXAMPLE 1

A raw milk 12/24 h old when collected, stored raw at 4° C. for 24 h, with a standardized fat content of 36 g/l, is prepared according to the following characteristics: Pasteurization: 75° C./30 s and 60 s, 80° C./60 s,85° C./60 s and 90° C./60 s; CaCl2 supplement: 90 ml/hl of a solution containing 470 g/l of CaCl2, i.e. a content of 0.42 g/l of milk; Addition of GLD: 0 for the control, 0.7 g/l for the trials.

153

This milk is heated to 38° C. (maturation temperature), ferments are added (STM5-2%) and subjected to a maturation time of 30 minutes. The renneting pH is 6.35. The renneting is then carried out, at 38° C., using CHYMAX PLUS ata dose of 16.3 ml/hl. The ferments and the coagulant, and also the glucono-delta-lactone, were provided by the company Chr. HANSEN France (ARPAJON-France).

The solidification time is 10 minutes, the hardening time is 30 minutes. The gel obtained is cut up, stirred and acidified under serum in a closed tank for 2 h to 2 h 30 min until a minimum spinning pH of 5.4 is obtained. The spinning iscarried out by hand, in water at 85° C.

The results obtained are given in the table below:

TABLE-US-00001 Control 1 Control 2 Trial 1 Trial 3 Trial 4 Thermal 73° C. 73° C. 80° C. 85° C. 90° C. treatment 30 sec 60 sec 60 sec 60 sec 60 sec CaCl2 dose 20 90 90 90 90 (ml/hl) GDL dose 0 0.7 0.70.7 0.7 (g/l) SPINNING (marked 10 8 6 1 0 from 1 to 10) SPINNING >100 >100 30 0 0 (length of strand in cm)

Conclusions of the Trials and Observations:

The gradual increase in the thermal treatment temperature/time couples of the milk brings about a different behavior in terms of the milk coagulation and draining, but which is recovered by means of the CaCl2 and GDL corrections. However,despite the corrections introduced, any treatment greater than 80° C./60 s makes manual spinning very difficult. The curd is not cohesive, or even disperses at the highest temperatures, it dries, and the strand is shorter as the coupleincreases. The limiting couple is that at 80° C./60 s, where spinning was nevertheless possible, although relatively weak. The choice of an appropriate pasteurization temperature is not sufficient on its own to confer satisfactory spinningabilities.

EXAMPLE 2

The same milk as in example 1 is prepared according to the following characteristics. Pasteurization: 72° C./20 sec for the control, and 80° C./20 sec, 82° C./20 sec; CaCl2supplement: 20 ml/hl or 90 ml/hl of asolution containing 470 g/l of CaCl2, i.e. a content of 0.09 g/l or of 0.42 g/l of milk. GLD supplement: none or 0.3 to 1 g/l.

This milk is heated to 36° C. (maturation temperature), ferments are added (STM5-8 g/hl), and a maturation time of 60 minutes is observed. The renneting pH is 6.55-6.6 for the control and 6.45-6.50 for the trials. The renneting is thencarried out, at 36° C., using CHYMAX PLUS at a dose of 17 ml/hl for the control and 13 ml/hl for the trials.

The solidifying time is 20 minutes, the hardening time is 50 minutes. The gel obtained is cut up, heated at 40° C. for 4 minutes, stirred, and acidified under serum in a closed tank for 2 h to 2 h 30 min until a minimum spinning pH of5.4 is obtained. The spinning is carried out by hand, in water at 85° C., or with a machine when this is possible.

The results are given in the table below:

TABLE-US-00002 Control 1 Trial 5 Trial 6 Trial 7 Trial 8 Trial 9 Trial 10 THERMAL 72° C. 80° C. 80° C. 80° C. 82° C. 82° C. 82° C. TREATMENT 20 sec 20 sec 20 sec 20 sec 20 sec 20 sec 20 secCaCl2 dose 20 90 90 90 90 90 90 (ml/hl) GDL dose 0 0.3 0.5 0.7 0.5 0.7 1 (g/l) SPINNING (marked 10 2 2 8 2 5 7 from 1 to 10) machine manual manual machine manual machine machine SPINNING >100 8 52 57 62.5 31.3 50 (length of strand in cm)

Conclusions and Observations of the Trials: Trials 5 and 6: a strand difficult to obtain is observed, it is not possible to use it in a machine; Trial 7: the spinning is inferior to the control and the curd obtained is too firm.

The thermal treatment temperatures are correct, but the GDL corrections of less than 0.7 g/l do not allow satisfactory spinning.

Trial 8: only manual spinning is possible, but the curd remains very hard.

154

Trial 9: a medium spinning ability is observed, which allows machine spinning, but the curd remains hard, brittle, and not smooth enough.

Trial 10: this trial is the best of the series; the texturing can be done by machine, but the curd is still harder than the control, and exhibits medium smoothing, with the presence of grains in the fibers produced.

The choice of appropriate dose of GDL is not sufficient on its own, or combined with a selected pasteurization, to improve the spinning properties of the curd.

EXAMPLE 3

The same milk as in example 1 is prepared according to the following characteristics: Pasteurization: 72° C./20 sec for the control, and 80° C./20 sec, 82° C./20 sec, 85° C./20 sec; CaCl2 supplement: 20 ml/hlor 90 ml/hl or nothing; GDL supplement: none or 1 g/l.

This milk is heated to 41° C. (maturation temperature), ferments are added (STM5-8 g/hl) and a maturation time of 60 minutes is observed. The renneting pH is 6.55-6.6 for the control and 6.45-6.50 for the trials. The renneting is thencarried out, at 36° C., with CHYMAX PLUS at a dose of 25 ml/hl.

The solidifying time is 8-10 minutes, the hardening time is 24-30 minutes. The gel obtained is cut up, heated at 40° C. for 4 minutes, stirred, and acidified under serum in a closed tank for 2 h to 2 h 30 min until a minimum spinning pHof 5.4 is obtained. The spinning is carried out by hand, in water at 85° C.

The results are given in the table below:

TABLE-US-00003 Trial Trial Trial Trial Control 1 11 12 13 14 Thermal 72° C. 85° C. 85° C. 82° C. 80° C. treatment 20 sec 20 sec 20 sec 20 sec 20 sec CaCl2 dose 20 90 0 0 0 (ml/hl) GDL dose 0 0 1 1 1(g/l) SPINNING (marked 9 3 2 9 10 from 1 to 10)

The spinning ability limit lies at a thermal treatment of 82° C./20 sec and 1 g/l of GDL.

With this scheme, the spinning is good but the curd exhibits a few grains.

Trials 11 and 12 give a curd that it would not be possible to use in a machine.

The best results are obtained for trial 14, without calcium chloride, with a treatment at 80° C./20 sec and 1 g/l of GDL. This trial gives better results than the control. The choice of a specific thermal treatment, combined with anoptimal dose of GDL and an absence of calcium correction, makes it possible not only to improve the spinning properties of the curd, but also to confer on it a superiority compared to the control which corresponds to the conventional technology of theprior art. BACKGROUND OF THE INVENTION

The present invention relates to the making of cheese, and particularly to the making of cheese ripened for two or more months such as Cheddar and Colby cheese.

Milk from many different mammals is used to make cheese, though cow's milk is the most common milk for cheese. Generally, cheese is made by developing acidity in milk and setting the milk with a clotting agent, such as rennet. The set milk iscut and whey is separated from the resulting curd. The curd may be pressed to provide a cheese block. Rennet-based cheeses include cheeses such as mozzarella, Cheddar, Swiss, and Colby cheese. Typical Cheddar cheese has 1.4 g lactate per 100 g andcontains 37.5% water.

Curing typically takes place over a lengthy period of time under controlled conditions. Cheddar cheese, for example, is cured for a period of at least four months and may be cured for a period in excess of one year to obtain the full flavordesired in cheddar cheese.

Recently, use of concentrated milk as the base ingredient for making cheese has become more popular. Milk can be concentrated prior to cheese making using a variety of techniques including ultra-filtration, micro-filtration, vacuum condensation,or the addition of dry milk solids such as nonfat

155

dry milk. The use of concentrated milk provides increased efficiency to the cheese-making process. Use of concentrated milk also reduces the amount of whey produced for a given amount of cheese,facilitates standardization of formulation and production, and promotes more consistent quality and yields of the resultant cheese. The use of concentrated milk thus lowers cost and processing times for making cheese, particularly beneficial forsemi-continuous cheese manufacturing processes such as utilized in typical large-scale cheese plants. The semi-continuous cheese manufacturing includes numerous cheese vats that sequentially feed a draining/conveying belt and a salting belt. Thissemi-continuous cheese making system requires consistent and rapid production of acid by starter cultures used in the cheese manufacturing process. The efficiency of semi-continuous cheese manufacturing is substantially improved if the milk isconcentrated prior to cheese-making.

During the aging process, calcium lactate crystals can grow within and on the surface of cheese. These crystals are small white spots that can be seen, often without magnification, upon close inspection of the cheese. The crystals are notpresent in the cheese immediately after manufacture, but typically start to appear between two and six months of aging. While the calcium lactate crystals are not harmful to consumers, they can be perceived in mouthfeel as adding a slight amount ofgrittiness to the cheese. More importantly for affecting cheese sales, consumers often believe the crystals are mold. The growth of calcium lactate crystals is thus viewed as a defect representing substantial financial loss for cheese manufacturers.

For reasons that are not entirely clear, the use of concentrated milk and a semi-continuous cheese making process in making an aged cheese seems to worsen the calcium lactate crystal problem. Consequently cheese manufacturers have an unenviablechoice: they can either use a less efficient cheese-making process, or they can use a more efficient manufacturing process that more likely results in calcium lactate crystals defects.

Factors influencing the formation of calcium lactate crystals have been extensively studied. Concentrations of calcium and lactate ions existing in cheese serum are very close to saturation, and small increases in the concentration of eithercomponent could result in super saturation and crystallization. It has also been theorized that milk citrate levels and the subsequent utilization of citrate by microorganisms may play a role in calcium lactate formation. Curd washing, curing, andstorage temperature may further contribute to calcium lactate crystal formation. Other studies report that calcium lactate is formed when L(+)-lactate is converted into a racemic mixture of L(+)- and D(-)-lactate, the latter being much more prone tocrystallization. The conversion of L(+)-lactate to D(-)-lactate is thought to be carried out by certain strains of bacteria.

Prior art methods for limiting calcium lactate crystal formation in cheese include: 1) reducing the concentration of lactic acid in the final curd, 2) reducing or eliminating undesirable non-starter lactic acid bacteria ("NSLAB") from thecheese-making process, 3) controlling storage temperature, and 4) vacuum packaging cheese to minimize the airspace around the outer cheese surface. The use of certain starter culture strains may also increase or decrease the presence of calcium lactatecrystals, due to post manufacture fermentation by the selected starter culture.

Although progress has been made in developing strategies for prevention of calcium lactate crystals, the defect is still prevalent. Better methods of minimizing calcium lactate crystal formation in aged cheeses are needed.

BRIEF SUMMARY OF THE INVENTION

The present invention is a method of adding sodium gluconate to the typical cheese-making recipe to inhibit the growth of calcium lactate crystals as the cheese ages, and the cheese composition made by the addition of sodium gluconate. Thepreferred method of adding the sodium gluconate is during or immediately after the salting stage of the cheese-making process. 

DETAILED DESCRIPTION

The present invention modifies conventional cheese-making and begins, as all cheeses do, with milk. Preferably the milk is whole cow's milk having 3 to 4% butterfat and in excess of 7% solids non-fat. However, it is believed that cheeses formedfrom milk of other mammals will similarly benefit from the present invention, as will cheeses formed from milks with different fat (including non-fat) and/or different solids non-fat concentrations.

156

The preferred milk starting ingredient is preferably concentrated to achieve efficiencies in the cheese-making process. Preferably the solids content of the milk is increased to have total solids within the range of 13 to 50%, more preferablywithin the range of 13 to 18%, and most preferably to have total solids within the range of 14 to 15%. While the concentrated milk could be formed merely by adding condensed skim milk, ultra-filtered skim milk, micro-filtered skim milk or non-fat drymilk solids to the starting milk, more preferably the concentrated milk includes an addition of fat as well as non-fat milk solids. The preferred concentrated milk may thus be formed by adding various amounts of condensed skim milk, ultra-filtered skimmilk, micro-filtered skim milk or non-fat dry milk solids and cream to whole milk, thereby retaining the ratio of casein to fat present in whole milk. Calcium chloride may be added to the milk ingredient to generate firmer curds. Fortifying ingredientsor colorings may also be added to the milk ingredient.

The milk ingredient is acidified. If desired, the acidification can be achieved by adding an acidic ingredient, such as citric acid or tartaric acid, or through natural bacterial acidification. More preferably, the acidification is achieved byadding a starter culture, such as a mesophilic (lactococcus lactis ssp cremoris), thermophilic (streptococcus thermophilus) or helvetic (lactobacillus helveticus) bacteria culture. Most preferably (for Cheddar cheese) a mesophilic starter culture isused. If a starter culture is used, the mixture is then incubated between about 10 and 60 minutes, preferably about 30 minutes at a temperature between about 30 and 37° C., preferably about 31 to about 32° C.

After incubation, a coagulating agent, preferably rennet at about 0.02 to about 0.1 percent, is added to act on the casein and cause the milk ingredient to coagulate. The rennet may be animal, microbial or vegetable. The mixture is furtherincubated between about 10 and 60 minutes, preferably about 30 minutes, at a temperature between about 30 and 37° C., preferably about 31 to about 32° C. The addition of a coagulating agent, preferably rennet, causes the milk to coagulateinto a mass.

After coagulation, the mass is cut, stirred, and heated (i.e., from about 30 to about 42° C. and preferably from about 31 to about 39° C.) for between about 10 and about 60 minutes, preferably about 30 minutes. The whey isdrained off and the curd is matted into a cohesive mass in the traditional Cheddaring process or is intermittently stirred when using the stirred curd process. Subsequently in the traditional Cheddar process the mass is cut into pieces and salted,whereas in the stirred curd process the curd is simply salted. About 1 to about 4% salt, and preferably about 1.5 to about 3% salt is added to the curd. The preferred salt is sodium chloride added most preferably (for a Cheddar cheese) at about 2.75%. The salted curd is stirred, further drained and pressed into forms. Approximately 65-90% of the salt added is retained in the cheese, and thus consequently a typical Cheddar cheese has 1.5 to 2.0% salt. The cheese is then aged for a time period inexcess of one week, preferably from one month to one year, and most preferably about 4 months prior to consumption.

Within this conventional cheese-making process and prior to aging, sodium gluconate is added. The sodium gluconate could, for instance, be added to the starting milk ingredient, to the concentrated milk, to the starter culture or to the rennet. The preferred method for adding sodium gluconate, however, is during or immediately after the salting step. This allows the use of a granulate form of sodium gluconate while minimizing the amount of sodium gluconate lost during whey separation, andwithout needlessly increasing the processing complexity of the cheese. The sodium gluconate appears to decrease the growth of calcium lactate crystals in cheese.

The sodium gluconate of the present invention is added in a range of greater than zero to 10% by weight, and more preferably within a range of greater than zero to 5% by weight. The sodium gluconate added results in the inclusion of greater thanzero to 5.8% gluconate in the final cheese product, and more preferably greater than zero to 4.5% gluconate in the final cheese product. Even more preferably, sodium gluconate is added within the range of about 0.32 to 4.73% by weight and results inabout 0.26 to 2.8% gluconate in the final cheese product.

Most preferably, the amount of sodium gluconate added is gauged based upon the lactate content of the cheese and the amount of sodium gluconate retained in the cheese to remain in the final cheese product in a sufficient amount to prevent theformation of calcium lactate crystals. For instance, the normal range of lactate found in Cheddar cheese is 1.1 to 1.9%, and preferably the sodium gluconate is added so the gluconate content of the cheese is within the range of about 1/4

157

to 5/3 thelactate content of the cheese. Sodium gluconate added during or immediately after the salting step of cheese manufacture is believed to be retained at a rate similar to the retention of the sodium chloride salt, approximately 65-90%. For a Cheddarcheese containing 1.1% lactate in the final product, if the salt retention is found to be 90%, sodium gluconate is added within the range of about 0.32 to 2.0% by weight. The sodium gluconate added in the salting process is believed to be retained at asimilar rate to the sodium chloride, and this 0.32 to 2.0% addition results in about 0.29 to 1.8% sodium gluconate to combat against calcium lactate crystal formation from the 1.1% lactate. Sodium gluconate is about 89% gluconate by weight, so the 0.29to 1.8% sodium gluconate results in the inclusion of about 0.26 to 1.6% gluconate in the final cheese product. On the other end of the spectrum, for a Cheddar cheese containing 1.9% lactate in the final product, if the salt retention is found to be 65%,sodium gluconate is added within the range of about 0.77 to 4.7% by weight, resulting in about 0.50 to 3.1% sodium gluconate to combat against calcium lactate crystal formation from the 1.9% lactate. The 0.5 to 3.1% sodium gluconate results in theinclusion of about 0.45 to 2.8% gluconate in the final cheese product.

Different amounts of sodium gluconate would be added if the addition occurred at a different stage of the cheese-making process other than the salting step or immediately after the salting step. By adding the sodium gluconate during the saltingstep or immediately after the salting step, most of the sodium gluconate remains in the cheese product at the time of purchase and consumption. This provides a double benefit to cheese manufacturers, in that the sodium gluconate becomes an edible partof the final cheese product. That is, the addition of 0.32 to 4.73% sodium gluconate results in 0.29 to 3.1% more cheese being manufactured and sold, and the additional weight sold adds revenue for the cheese manufacturer.

Example 1

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a conventional milled curd method. A direct vat set, frozen, concentrated starter culture (Marschall.RTM. Superstart.RTM. concentrated cultures, Strain M30 and M42, Rhodia, Inc.,Dairy Business, Madison, Wis.) was used to manufacture the cheese. A total of 36 ml of starter culture (18 ml of each strain) and 15.6 ml of color (AFC-WS-1x, Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk, which was maintainedat 31° C. After a 45-minute ripening period, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) diluted with 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowedto heal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cooked with continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After thecurds and whey reached a pH of 6.25 (30 to 45 minutes) the whey was drained and the curds were ditched and packed. The matted curd was then cut into slabs, flipped and stacked in 20-minute intervals until the curd reach a pH of 5.4. A pH of 5.4 wasreached 1.5 to 2 hour after the whey was drained. The slabs of curd were then milled and approximately 60 lbs of milled curd were obtained. The 60 lbs of milled curd were then divided in half. Two separate salting treatments were then applied to eachportion of the curd. One half of the milled curd (30 lbs) was salted at a rate of about 2.75% with sodium chloride (0.825 lbs). The sodium chloride was applied in three equal portions (0.275 lbs each) and the curd was mixed for 10 minutes between eachsodium chloride application. The remaining curd (30 lbs) was salted at a rate of about 2.75% sodium chloride (0.825 lbs) and 2.4% sodium gluconate (0.72 lbs, PMP Fermentation Products, Peoria, Ill.), such that the total sodium chloride/sodium gluconateaddition was about 5.15% (1.545 lbs). The sodium chloride and sodium gluconate were applied in three equal portions (0.275 lbs and 0.24 lbs for the sodium chloride and sodium gluconate respectively) and the curd was mixed for 10 minutes between eachsodium chloride/sodium gluconate application. Subsequently the curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separateblocks weighing approximately 24-26 lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-25 1 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.13, 1.87%, and 38.84% respectively, whereas the pH, lactic acid content, gluconate content and moisture content

158

of the sodiumgluconate cheese was 5.44, 1.51%, 1.29% and 40.32% respectively. It is recognized that the maximum moisture content allowed in Cheddar cheese is 39% and that minor adjustments in the cheese making procedure for the cheese containing sodium gluconatewill be required to reduce the moisture content to less than 39%.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The cheese blocks from the sodium gluconate treatment exhibited less weeping than thestandard cheese.

The resultant cheese from the sodium gluconate treatment tasted smooth and smelled pleasant, with no perceptible offtaste, mouthfeel or odor added due to the sodium gluconate addition. As an additional secondary benefit, the sodium gluconatetreatment slightly suppressed bitterness in the cheese.

Example 2

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a stirred curd method. A bulk starter culture was prepared by inoculating steamed reconstituted NFDM with a direct vat set, frozen, concentrated starter culture (Marschall.RTM. Superstart.RTM. concentrated cultures, Strain M46, Rhodia, Inc., Dairy Business, Madison, Wis.) and incubating overnight. The concentrated cheese milk was then inoculated with the bulk culture at a rate of 2%. Additionally 15.6 ml of color (AFC-WS-1x,Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk. The concentrated milk was then maintained at 31° C. for a 45-minute ripening period. Subsequently, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) dilutedwith 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowed to heal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cookedwith continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After the curds and whey reached a pH of 6.30 (30 to 45 minutes) the whey was drained and the curds were intermittently stirred untilthe curd reach a pH of 5.4. A pH of 5.4 was reached 1.5 to 2 hour after the whey was drained. Approximately 60 lbs of curd were obtained and subsequently divided in half. Two separate salting treatments were then applied to each portion of the curd. One half of the curd (30 lbs) was salted at a rate of about 2.75% with sodium chloride (0.825 lbs). The sodium chloride was applied in three equal portions (0.275 lbs each) and the curd was mixed for 10 minutes between each sodium chloride application. The remaining curd (30 lbs) was salted at a rate of about 2.75% sodium chloride (0.825 lbs) and 2.4% sodium gluconate (0.72 lbs, PMP Fermentation Products, Peoria, Ill.), such that the total sodium chloride/sodium gluconate addition was about 5.15%(1.545 lbs). The sodium chloride and sodium gluconate were applied in three equal portions (0.275 lbs and 0.24 lbs for the sodium chloride and sodium gluconate respectively) and the curd was mixed for 10 minutes between each sodium chloride/sodiumgluconate application. Subsequently the curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separate blocks weighingapproximately 24-26 lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-25 1 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.35, 1.08%, and 39.0% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.42, 1.01%, 0.79% and 42.51% respectively. It is recognized that the maximum moisture content allowed in Cheddar cheese is 39% and that minor adjustments in the cheese making procedure for the cheese containing sodium gluconatewill be required to reduce the moisture content to less than 39%.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior.

159

None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The resultant cheese from the sodium gluconate treatment tasted smooth and smelledpleasant, with no perceptible offtaste, mouthfeel or odor added due to the sodium gluconate addition.

Example 3

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a stirred curd method. A direct to vat set frozen, concentrated starter culture (Marschall.RTM. Superstart.RTM. concentrated cultures, Strain M62, Rhodia, Inc., Dairy Business,Madison, Wis.) was added to the concentrated cheese milk in an amount of 64 ml. Additionally 15.6 ml of color (AFC-WS-1x, Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk. The concentrated milk was then maintained at 31° C. for a 45-minute ripening period. Subsequently, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) diluted with 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowed toheal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cooked with continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After thecurds and whey reached a pH of 6.30 (30 to 45 minutes), the whey was drained and the curds were intermittently stirred until the curd reach a pH of 5.4. A pH of 5.4 was reached 1.5 to 2 hours after the whey was drained. Approximately 60 lbs of curdwere obtained and subsequently divided in half. Two separate salting treatments were then applied to each portion of the curd. One half of the curd (30 lbs) was salted at a rate of about 2.5% with sodium chloride (0.75 lbs). The sodium chloride wasapplied in three equal portions (0.25 lbs each) and the curd was mixed for 10 minutes between each sodium chloride application. The remaining curd (30 lbs) was salted at a rate of about 1.70% sodium chloride (0.51 lbs) in two equal portions (0.255 lb)and the curd was mixed for 10 minutes between each sodium chloride application. Subsequently 3.0% sodium gluconate (0.90 lbs, PMP Fermentation Products, Peoria, Ill.) was applied in one application and the curd was mixed for 10 minutes. Subsequentlythe curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separate blocks weighing approximately 24-26 lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-25 1 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.25, 1.24%, and 33.05% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.41, 1.03%, 1.40% and 34.5% respectively.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The resultant cheese from the sodium gluconate treatment tasted smooth and smelledpleasant, with no perceptible offtaste, mouthfeel or odor added due to the sodium gluconate addition.

Although the present invention has been described with reference to preferred embodiments, workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention. The present invention relates generally to cheese flavor compositions, fresh cheese products, and particularly, low-fat fresh cheese products, having desired flavor profiles. Processes for making and using the cheese flavor compositions also areprovided.

BACKGROUND

Natural cheese traditionally is made by developing acidity in milk and setting the milk with a clotting agent, such as rennet, or by developing acidity to the isoelectric point of the protein. The set milk is cut and whey is separated from thecurd. The curd may be pressed to provide a cheese block. Curing typically takes place over a lengthy period of time under controlled conditions. Cheddar

160

cheese, for example, is often cured for a number of months or even longer, to obtain the fullflavor desired.

Numerous reports have been published implicating several compounds to be important in the development of cheese flavor in cheese products. The main classes of compounds thought to contribute to flavor generation in cheese include amino acids,peptides, carbonyl compounds, fatty acids, and sulfur compounds. Urbach, G., "Contribution of Lactic Acid Bacteria to Flavor Compound Formation in Dairy Products," Int'l Dairy J., 1995, 3:389-422. Several volatile compounds including fatty acids,esters, aldehydes, alcohols, ketones, and sulfur compounds are included in lists describing the aroma of various cheeses. Production of several of these aroma and flavor compounds have been attributed to multiple enzymatic reactions and/or chemicalreactions that take place in a sequential manner in ripening cheese.

Various microorganisms have been identified and selected for their ability to produce particular flavors in a cheese-ripening environment. These flavors arise through a series of enzymatic steps. For example, in cheese, degradation of proteinsby proteases and peptidases can lead to the production of peptides and free amino acids. These precursors are shuttled through subsequent enzymatic reactions resulting in the formation of flavor compounds. An understanding of these reactions helps inthe creation of flavors of a desired cheese type. Fox, P., Cheese: Chemistry, Physics and Microbiology, pp. 389-483, 1993.

The role of amino acid catabolism in the development of cheese aroma and flavor has been identified to be a rate limiting step in the development of cheese flavors. Yvon et al., "Cheese flavour formation by amino acid catabolism," Int. Dairy J.11 (2001) 185-201. α-Keto acids are generally recognized as a key intermediate in the metabolism and interconversion of amino acids. Some of the main pathways identified in lactic acid bacteria include transamination reactions catalyzed byaminotransferases. They are responsible for the deamination of amino acids and formation of keto acids. A disadvantage with the aminotransferase enzyme is that it requires the presence of an amino group acceptor, which is limiting in the cheese matrixand needs to be supplemented to enhance transamination. According to the literature, the creation of aroma compounds and cheese flavor is greatly enhanced with the addition of α-ketoglutarate, an amino group acceptor. Yvon et al., "Addingα-Ketoglutarate to Semi-hard Cheese Curd Highly Enhances the Conversion of Amino Acids to Aroma Compounds," Int. Dairy J. 8 (1998) 889-898.

The literature also describes acceleration of the development of flavor compounds by the exogenous addition of enzymes and cell extracts (e.g., U.S. Pat. No. 6,649,199), and by the supplementation of a cheese matrix with intermediates of aminoacid catabolism (e.g., U.S. Pat. No. 6,586,025; Banks et al., "Enhancement of amino acid catabolism in Cheddar cheese using α-ketoglutarate . . . ," Int. Dairy J. 11 (2001) 235-243).

According to at least one literature reference, D-amino acid oxidase is a flavoprotein which deaminates D-amino acids to the corresponding α-keto acids, ammonia, and hydrogen peroxide (H2O.sub.2) in the presence of molecular oxygen;the resulting hydrogen peroxide is degraded into water and molecular oxygen in the presence of catalase whereby keto acids remain as the final product. Upadhya et al., "D-Amino Acid oxidase and catalase of detergent permeabilized Rhodotorula graciluscells and its potential use for the synthesis of α-keto acids," Process Biochem., 35 (1999) 7-13. U.S. Pat. No. 6,461,841 describes an isolated L-amino acid oxidase from Rhodococcus species encoded by a DNA molecule hybridizing to a particularnucleic acid sequence, which can be used for contacting an L-amino acid for the production of a keto acid. Neither of these last two-mentioned literature references refer to cheese microorganisms or a cheese-making environment involving such organisms. It has been reported that, although deamination of amino acids to α-keto acids might be catalyzed by either dehydrogenases or oxidases, such activities towards aromatic and branched-chain amino acids and methionine have never previously beendetected in cheese microorganisms. Yvonet al., "Cheese flavour formation by amino acid catabolism," Int. Dairy J. 11 (2001) 185-201, 189-190.

Cheese manufacturers are interested in developing cheese products requiring less storage time before they are ripe enough for commercial distribution. Cheese makers have used a wide variety of different techniques in efforts to accelerate thecheese curing or ripening process. U.S. Pat. No. 6,649,200 provides a summary of a number of these techniques used for accelerating ripening of hard block cheeses.

161

Another approach used to avoid lengthy cheese ripening periods has been to make a cultured cheese concentrate ("CCC") having more intense cheese flavor, and then use it as a cheese flavoring agent in another bulk material. CCC's have beenmanufactured that attain full cheese flavor development within a number of days instead of months. These CCC's are added to other bulk foods, such as process cheeses or snack foods, to impart or intensify a cheese flavor. Methods for the manufacture ofsuch cheese-flavored concentrates have been described in U.S. Pat. No. 4,708,876. Typically the process involves a dairy substrate that is cultured with a lactic culture followed by addition of various proteases, peptidases, and lipases. U.S. Pat. No. 4,708,876 describes cheese flavored concentrates that can be obtained from milk as a starting material, instead of cheese curds, or without formation of whey by-product. U.S. Pat. No. 6,214,586 describes use of live cultures having high levels ofproteolytic enzymes and peptidolytic enzymes to debitter enzymatic modified cultures (EMC's).

Methods of cream cheese manufacture have been previously described in publications such as by Kosikowski and Mistry in Cheese and Fermented Milk Foods, 3rd Ed.

Although these prior processes may produce an accelerated development, or an enhancement, of cheese flavor, they do not produce enhancements that target specific cheese flavor components. More recently a technology has been developed to producea natural biogenerated cheese flavoring system that can be used to prepare different cheese products/derivatives, targeted at various cheese flavor profiles using a modular approach to flavor creation, which is described in, for example, U.S. Pat. No.6,406,724. The cheese flavoring system described in this patent is derived from different components, wherein the individual components are combined in different ratios to provide specific flavor profiles in the cultured cheese concentrate products.

Despite the developments described in the above publications, a need still exists for alternative routes for making cheese flavoring systems, especially those produced via natural processes.

SUMMARY

The invention relates generally to biogenerated flavor compounds, cream cheese compositions containing biogenerated flavor compounds and processes of making such compounds.

In one embodiment, a process is provided for making a flavor compound, comprising heating a dairy product to a temperature in the range of 60 degrees Celsius (C.) to 140 degrees C. for an amount of time between 15 minutes and 24 hours to inducein-situ production of lactones. More specifically, the heating temperature may be about 84 to about 92 degrees C. and the heating time is about 55 to about 65 minutes, and more particularly, the heating temperature may be about 86 to about 90 degrees C.and the heating time is about 58 to about 62 minutes. The lactones produced may be any of g-hexalactone, g-octalactone, g-decalactone, g-dodecalactone, 6-dodecene-g-lactone, delta-hexalactone, delta-octalactone, delta-decalactone, delta-dodecalactone,and delta-tetradecalactone. In one embodiment the dairy product is a cream composition comprising concentrated milk fat and cream. Following the heating step, the heated dairy product is mixed with a salt citrate and a nitrogen source, providing afermentation premix. In one embodiment the salt citrate is sodium citrate and the nitrogen source is yeast extract. The resulting premix is then fermented in the presence of lactose fermenting bacteria and flavor producing bacteria in a two phasefermentation cycle, wherein phase one is conducted without aeration and phase 2 is conducted with aeration. The lactose fermenting bacteria may be any of Lactococcus cremoris and Lactococcus lactis, and the like as well as combinations thereof. Theflavor producing bacteria may be any of Lactococcus lactis spp. diacetylactis and Leuconostoc cremoris, and the like as well as combinations thereof.

In another embodiment of the invention, a milk concentrate having a lactose concentration less than about 2 percent is also added to the fermentation premix otherwise as generally described above, as part of the process of making the cream cheeseproduct. The milk concentrate ingredient of the fermentation premix may be derived from any of skim milk and whole milk, or similar milk substrates. Preferably, the milk concentrate is a UF/DF retentate of skim or whole milk. The fermentation premixthat includes the milk concentrate is then fermented in a manner as generally described above, i.e., in the presence of the lactose fermenting bacteria and the flavor producing bacteria in a two phase fermentation cycle, wherein phase one is conductedwithout aeration and phase two is conducted with aeration.

162

The invention additionally provides the low-fat cream cheese-like fermentation products obtained using the processes of the invention. The low-fat cream cheese-like fermentation products of the process embodiments are ready for immediatepackaging and/or use, and do not require a separate curing or aging step for flavor development. The relatively low-fat cream cheese products of embodiments herein have flavor characteristics and profiles comparable to traditional higher fat contentfresh cheese and cream cheese products. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 provides a schematic flow diagram for a method of making a biogenerated flavor composition in accordance with an embodiment of the invention;

FIG. 2 provides a schematic flow diagram for a one day method for making a cream cheese base and incorporating a biogenerated flavor composition therein in an embodiment of the invention; and

FIG. 3 provides a schematic flow diagram for a two day method for making a cream cheese base and incorporating a biogenerated flavor composition therein in an embodiment of the invention.

DETAILED DESCRIPTION

The invention provides for the manufacture of cheese products enhanced with a natural flavoring system. The natural flavoring system described herein may be used with various types of cheese and dairy products. In one embodiment, the system maybe used in the production of flavor enhanced fresh cheese or cream cheese. In another embodiment, the system may be used in the production of low-fat cheese products, such as low-fat cream cheese. Fat generally aids in retention of flavor in foodproducts; therefore, in products where fat content has been reduced, flavor may be reduced. In one embodiment, to offset the potentially bland or mild flavor of low fat cream cheese products, biogenerated flavor compositions described herein may beadded to a low fat cream cheese base to enhance the flavor therein.

Turning to FIG. 1, an exemplary schematic flow diagram for a method of making a biogenerated flavor composition incorporating skim milk is provided. As shown in FIG. 1, at step 101 concentrated milk fat and cream are added to a heating tank, andtheir combination represents a dairy product. Inside the heating tank the concentrated milk fat and cream are heated to at least 60 degrees C. for at least 15 minutes, particularly about 84 to 92 degrees C. for about 55 to 65 minutes. In a preferredembodiment, the milk fat and cream are heated to about 88 degrees C. for about 60 minutes. This step is useful for producing thermally induced flavor compounds, such as, for example, various lactones, acetyls, and furans. A lactone is any cyclic esterwhich is the condensation product of an alcohol group and a carboxylic group in the same molecule. Lactones generally elicit a creamy flavor. Examples of lactones which may be produced include, but are not limited to, g-hexalactone, g-octalactone,g-decalactone, g-dodecalactone, 6-dodecene-g-lactone, delta-hexalactone, delta-octalactone, delta-decalactone, delta-dodecalactone, and delta-tetradecalactone. Examples of acetyls which may be produced include, but are not limited to, 2-acetylthiazoline. Examples of furans which may be produced include, but are not limited to, 2-methyl-3-methyl thiolfurane. Depending on how many thermally induced flavor compounds are preferred, the heating temperature and time may be adjusted. For example,the range of useful temperatures is from about 60 degrees C. to about 140 degrees C. The range of useful heating time ranges from about 15 minutes to about 24 hours. There may also be additional factors considered when determining the optimal heatingtemperature and time such as types of manufacturing equipment used, desired processing time, and the like. In any case, any temperature or time useful for producing flavor compounds, such as lactones, is desired. The dairy product used a startingmaterial in this process step may be a cream composition comprising a milk fat source (e.g., concentrated milk fat) and natural cream combined in respective amounts to provide a mixture containing about 40 to 60 percent fat, 30 to 60 percent moisture, 1to 4 percent protein, and 1 to 5 percent lactose.

At step 103 skim milk is subjected to a membrane process, and preferably ultrafiltration and diafiltration, to separate milk fat, proteins, and other large biocomponents, as a retentate, from water and other smaller biocomponents (e.g., lactose,salts), as a permeate. In another embodiment, whole milk may be used in step 103. In yet another embodiment, any type of milk with any percent fat may be used such. For example, two percent milk may be used in step 103. Ultrafiltration anddiafiltration are also particularly useful for controlling the amount of small

163

biocomponents separated from the skim milk colloid. More specifically, lactose retention may be controlled through ultrafiltration and diafiltration (UF/DF). By controllingthe amount of lactose retained in the retentate, the subsequent fermentation cycle can be controlled. It is desirable to control fermentation so microorganisms are directed to make desired flavor compounds such as diacetyl and acetoin. Although a UF/DFmembrane process is preferred, it will be appreciated that various membrane techniques and equipment can be applied for providing the desired level of constituents in the retentate. The retentate optionally can be dried and reconstituted with waterprior to further use in the inventive process. Drying may be effected by various means, such as spray drying, provided that reconstitutability is not affected.

In one example, the starting concentration of lactose in skim milk is about 5 percent. The concentrating process is generally performed at a temperature of about 100 to 140 degrees Fahrenheit (F.), and more typically 120 to 130 degrees F. Thebaseline pressure of the filtering system is generally 6 to 60 pounds per square inch gauge (psig), and more typically 20 to 30 psig. The concentration process will run for a period of time dependent on a number of factors including volume of milk to beprocessed, size of the filter or membrane used, and design of the filtering system. Following controlled ultrafiltration and diafiltration, or similar concentration system, the lactose concentration is reduced to approximately 1.0 to 1.5 percent. Wholemilk may be processed similar to skim milk as described above. The starting concentration of lactose in whole milk ranges from about 4 to 6 percent and is reduced to approximately 1.0 to 1.5 percent. In any case, regardless of the amount of milk fatcontained in the milk subjected to ultrafiltration and diafiltration (e.g. 0 percent, 2 percent, 5 percent, etc.), the amount of lactose contained in the retentate should be between about 0.5 percent and about 2.0 percent. Other factors in determiningultrafiltration and diafiltration time include retention of various minerals and vitamins such as magnesium, manganese, and iron. In one embodiment, the skim milk or other milk substrate is treated by ultrafiltration and diafiltration to provide aretentate having about 15 to 30 percent solids, about 70 to 85 percent moisture, about 0.5 to 4 percent lactose, about 0.1 to 1.0 percent milk fat, about 10 to 20 percent protein, about 0.1 to 2.0 percent salts, and about 0.1 to 2.0 percent ash. The pHof the retentate generally may range from about 6.0 to about 7.0. In one embodiment, the milk substrate is subjected to UF/DF techniques to produce an about 3× to about 8× (preferably about 5× to 6×) milk concentrate retentateproduct.

The resultant retentate from step 103, including, for example, milk fat, protein, a controlled amount of lactose, minerals, and vitamins, is directed to a mix tank at step 105. The retentate from step 103 is mixed with the concentrated milk fatand cream processed in step 101. Additionally, several ingredients are added to the products from steps 101 and 103 including, in one example, sodium citrate and yeast extract, providing a fermentation premix. In another example, salt and water may beadded in addition to sodium citrate and yeast extract. Sodium citrate is added as a substrate for microorganisms to convert into flavor compounds. Yeast extract is added to provide a source of molecular nitrogen, amino acids, and co-factors. Salt maybe added as a flavor ingredient. Water may be added to control the pH and/or moisture level of the mixture. In one embodiment wherein skim milk is utilized, the mixture may comprise the following composition: cream 15 to 35 percent, water 10 to 30percent, salt 0.1 to 2.0 percent, sodium citrate 0.1 to 1.0 percent, yeast extract 0.01 to 0.20 percent, concentrated milk fat 5 to 15 percent, and concentrated skim milk 35 to 55 percent. In another embodiment wherein whole milk is utilized, themixture may comprise the following composition: cream 5 to 25 percent, water 10 to 30 percent, salt 0.5 to 2.0 percent, yeast extract 0.01 to 0.20 percent, and concentrated whole milk 55 to 75 percent.

Varying amounts of sodium citrate, yeast extract, salt, and water may be added depending on the desired fermentation products. Also, there are ingredients that may be used interchangeably with sodium citrate, such as, for example citric acid andedible salts thereof (e.g., sodium citrate, ammonium citrate, etc.). Similarly, other compounds which contain molecular nitrogen and/or amino acids and/or co-factors may be used in lieu of yeast extract, such as, for example, corn steep liquor andprotein hydrosylates. Also, salt as a flavor additive may not be added to the mixture at all. This may particularly be the case in the production of low sodium foods. In one example, all of the ingredients are mixed together for approximately 5 to 15minutes. However, any amount of time sufficient to mix the ingredients together may also be used. Other additives known or useful in the cheese-making arts optionally can be added as desired, especially to the extent that they do not adversely affectdevelopment and retention of the unique flavoring system described herein. Such optional additives include, for example, preservatives, colorings, flavorings, emulsifiers, stabilizers, or mixtures thereof. Also, if desired, vegetable oil or othernon-dairy fat may be added to form a portion of the fat content of the cream cheese product that is prepared by the process.

164

Product texture modifiers, such as functionalized whey protein, also optionally may be included.

In another embodiment, step 103 may be excluded from the process. In this case, sodium citrate, yeast extract, salt, and water are mixed directly with the product of step 101 in the mix tank at step 105. This embodiment may be useful in theproduction of a fresh cheese composition containing an average amount of fat with a high flavor profile. Processes incorporating step 103 may be useful for the production of lower fat fresh cheese products with an enhanced flavor profile.

At step 107 the mixture is heated to approximately 50 degrees C. for approximately 16 seconds to melt the milk fat contained in the mixture. However, varying temperatures and times useful for liquefying the milk fat may be used. The heatedmixture from step 107 is homogenized at step 109. Following homogenization, the mixture is pasteurized at step 111. In one example, the mixture is pasteurized by heating the mixture to 74 degrees C., holding the mixture at 74 degrees C. for 16 secondsand, finally, cooled to less than 30 degrees C. However, any pasteurization process may be substituted for the pasteurization process detailed here. After pasteurization, the mixture is directed into a fermentor at step 113. The fermentation vesselpreferentially includes mixing capabilities to ensure contract between the cultures and substrate materials. A bacterial culture cocktail is added to the mixture inside the vessel to start fermentation. The culture cocktail is a mixture of lactosefermenting and flavor producing bacteria. These cultures may be provided in a frozen concentrated form known as Direct Vat Set (DVS) or as an active pre-culture grown the previous day which is known as Bulk Set (BS). The preferred method is to utilizethe DVS culture system. The lactose fermenting cultures are generally of the species Lactococcus cremoris and Lactococcus lactis, and the like as well as combinations thereof. The lactose fermenting cultures produce lactic acid, as well as otherorganic acids and flavor compounds, to lower the pH from about 6.5 to about 4.7. The flavor producing bacterial are generally of the species Lactococcus lactis ssp. diacetylactis and Leuconostoc cremoris, and the like as well as combinations thereof. The flavor producing cultures have the ability to produce diacetyl, acetoin, and other flavor compounds from citrate, citric acid, or derivatives thereof. Additionally, the fermentation process increases the amount of lactones produced in the initialheating step by 30 to 85 percent. Any suitable culture of these types may be used, but they are preferably pre-tested and selected on the basis of producing high levels of flavor. Most preferentially they contain a mutation in the gene for acetolactatedecarboxylase. These cultures are each added at about 0.1 to 0.01 percent.

The fermenting mixture is maintained under a pressure of about 1 to 5 psig. The fermentation temperature is controlled to about 26 degrees C. In one embodiment, fermentation may be divided into two phases. Phase 1 is conducted without aerationfor about 12 hours until the pH is about 4.7. In another embodiment, phase 1 is conducted without aeration until the pH is about 5.4 or higher, regardless of elapsed time. Phase 2 begins with sterile air added at about 1 to 5 scfm (square cubic feetper minute). In another embodiment, fermentation is a single phase process wherein the mixture is aerated for approximately 40 hours. Aeration can be effected chemically or mechanically. Catalase can be introduced which liberates oxygen from hydrogenperoxide. Air or oxygen gas also may be introduced into the reaction mixture, such via a diffusion plate or an in-line sparger. The dissolved oxygen (DO) is continuously monitored throughout the fermentation cycle. DO is typically about 100 percent atthe beginning of the fermentation cycle, but decreases as the flavor producing reactions consume oxygen. Phase 2 of the fermentation is continued for about 28 hours. The total fermentation time is about 40 hours, or until the flavor reactions arecomplete. Sorbic acid or potassium sorbate may be added as a preservative.

Following fermentation, the mixture is directed to a heat exchanger at step 115 for deactivation of the cultures. The mixture is first heated to a high temperature, such as 74 degrees C., and held for 16 seconds to inactivate bacteria survivingfrom the fermentation step. Following deactivation, the mixture is cooled to 20 degrees C. Variations of the deactivation step may be substituted. Generally the mixture should be subjected to a high enough temperature for enough time to inactivatesurviving bacteria and then cooled to a reasonable working temperature.

Following deactivation at step 115 the mixture is directed to a storage container at step 117 to be further cooled, such as for example to about 5 degrees C. Finally, in step 119 the mixture is held at approximately 4 degrees C. The processillustrated in FIG. 1 can be employed as a batch, semi-continuous, or continuous process.

The biogenerated flavor composition described herein may be added to any food product for the purpose of enhancing flavor and/or organoleptic properties. However, in one embodiment, the

165

biogenerated flavor composition may be added to freshcheese or cream cheese products. In yet another embodiment, the biogenerated flavor composition may be added to low fat fresh cheese or cream cheese products. In another embodiment, the biogenerated flavor composition may be added to any dairy product.

Following processing as described hereinabove, the final mixture may contain the following flavor compounds diacetyl, acetoin, ethanol, 2-heptanone, 2-nonanone, 2-pentanone, acetone, 2-acetyl thiazoline, 2-methyl-3-methyl thiolfurane,g-hexalactone, g-octalactone, g-decalactone, g-dodecalactone, 6-dodecene-g-lactone, delta-hexalactone, delta-octalactone, delta-decalactone, delta-dodecalactone, and delta-tetradecalactone.

The flavor level of the cream cheese product can be judged organoleptically and/or can be estimated through analytical measurements (e.g., via gas chromatography), such as pH, titratable acidity, and concentration of lactones, free fatty acids,amino acids, or other metabolites known to be associated with a given cheese flavor profile.

Turning now to FIG. 2, a schematic flow diagram for a one day method for making a cream cheese base and incorporating a biogenerated flavor composition therein is provided. This method of making cream cheese is performed without a culture stepor a separation step.

At step 201 a mix is prepared by adding water, milk fat and either modified whey protein or other milk proteins. At step 203, the mixture prepared in step 201 is standardized to a pH of 4.9. Then, at step 205, the mixture is heated to 140degrees F. At step 207 the mixture is homogenized at 5000/500 psi. The homogenized mixture is then heated to 200 degrees F. and held for approximately 10 minutes at step 209. At step 211 dry ingredients such as, but not limited to, salt, gums,vitamins, calcium, and maltodextrin are added to the cream cheese mixture. The mixture is then heated to 180 degree F. and held for 10 minutes at step 213. Then, at step 215 about 1 to 10 percent, and preferably 4 percent, of the biogenerated flavorcomposition is added to the cream cheese mixture. The cream cheese mixture and biogenerated flavor composition are homogenized at 5000/500 psi step 217, packaged at step 219, and cooled at step 221. The final fat concentration of the cream cheeseproduct containing the biogenerated flavor composition may be less than about 20 percent, particularly about 1 to about 10 percent fat, and more particularly about 4 percent to about 7 percent fat. However, in alternate embodiments, the flavorcomposition may be added to full fat dairy bases yielding a higher fat concentration.

Turning now to FIG. 3, a schematic flow diagram for a two day method for making a cream cheese base and incorporating a biogenerated flavor composition therein is provided.

At step 301 a mix is prepared by adding milk and cream adjusted to a specified fat content, preferably between about 1.5 to 2.5 percent fat. Then, the mixture is homogenized at step 303, pasteurized at step 305, and cooled at step 307. At step309, a portion of the mixture, preferably about 15 percent, is placed in a cooler for standardization. The remaining mixture is inoculated with DVS lactic cultures at step 311. Next, at step 313, the mixture ferments in the presence of the lacticcultures for approximately 18 to 24 hours at a temperature of about 70 to 75 degrees F. until the pH of about 4.35 to 4.60 is reached. At step 315, the fermented mixture prepared in step 313 is standardized with the mixture set aside in step 309 to a pHof about 4.70 to 4.80. The standardized mixture is then heated to about 115 degrees F. at step 317. Next, at step 319 the mixture is subjected to a membrane process, preferably ultrafiltration, to concentrate the retentate to approximately 23 percentsolids. In another embodiment, a centrifugal separator may be used to concentrate the curd. The separated curd is then cooled to a temperature less than 60 degrees F. at step 321. Then, at step 323 biogenerated flavor composition may be added to thecream cheese mixture and homogenized at step 325. The mixture of step 323 (with or without biogenerated flavor composition) is combined with modified whey proteins or other milk proteins at step 327. The cream cheese composition is then heated to 125degrees F. for 5 to 10 minutes at step 329. At step 331 dry ingredients such as, but not limited to, salt, gums, vitamins, calcium, and maltodextrin are added to the cream cheese mixture. At step 333 the composition is then heated to 125 F. for 30minutes followed by an increase in temperature of 155 degrees F. and homogenization at 5075/725 psi at step 335. Next, at step 337, the cream cheese is heated to 180 degrees F. and recirculated for 30 minutes to build texture. At step 339 abiogenerated flavor composition may be partially or wholly added to the cream cheese mixture, depending on whether a biogenerated flavor composition was added at step 323. The cream cheese mixture and biogenerated flavor composition are packaged at step341 and cooled at step 343. The final fat concentration of the

166

cream cheese product containing the biogenerated flavor composition may be less than about 20 percent, particularly about 1 to about 10 percent fat, and more particularly about 4 percent toabout 7 percent fat. However, in alternate embodiments, the flavor composition may be added to full fat dairy bases yielding a higher fat concentration.

Further descriptions of the production of cream cheese products, and in particular low-fat cream cheese products with enhanced texture may be found in a co-pending application filed on the same date, Sep. 30, 2005 identified by Attorney DocketNo. 77361, which is incorporated herein by reference.

The following examples describe and illustrate certain processes and products of the invention. These examples are intended to be merely illustrative of the invention, and not limiting thereof in either scope or spirit. Variations of thematerials, conditions, and processes described in these examples can be used. Unless otherwise noted, all percentages are by weight.

EXAMPLE 1

1.0--Preparation of Low-Fat Cream Cheese Using Biogenerated Flavor System.

1.0--Preparation of Low Fat Cream Cheese Base: A 7% fat cream cheese composition was produced by mixing 38.96 lbs. WPC 80 (Leprino Cheese), 33.9 lbs. dry whey and 327.14 lbs. water (acidified to pH 3.35 with an 18% concentration of phosphoricacid), heated to 200 degrees Fahrenheit (F.) and held for 6 minutes to form a whey mix. Next, 78.34 lbs. whey mix was blended with 18.16 lbs. cream and the pH was adjusted to 4.9 using sodium hydroxide to yield a cream cheese mix. The cream cheesemix was heated to 140 degrees F. and homogenized at 5000/500 psi. The homogenized mix was heated to 200 degrees F. and held for 10 minutes. Then, 64.334 lbs. cream cheese mix was blended with 0.035 lbs. sorbic acid, 0.049 lbs. xanthan gum, 0.267lbs. carob gum, 1.469 lbs. maltodextrin, 0.629 lbs. tricalcium phosphate, and 0.417 lbs. salt. The mix was heated to 180 degrees F. and held for 10 minutes.

1.2--Preparation of Lactones: A cream composition comprising 194.21 lbs. of cream and 31.94 lbs. of concentrated milk fat having a composition of 42.00% fat, 53.80% moisture, 1.80% protein, and 3.1% lactose was heated to 88 degrees C. and heldfor 60 minutes. Following the initial heating step, the heated composition was found to have the following flavor compounds:

TABLE-US-00001 Creamy Flavor Compounds g-hexalactone 5 PPB g-decalactone 33 PPB g-dodecalactone 321 PPB 6-dodecene-g-lactone 119 PPB Delta-hexalactone 114 PPB Delta-octalactone 134 PPB Delta-decalactone 1114 PPB Delta-dodecalactone 2445 PPBDelta-tetradecalactone 2808 PPB

1.3--Further Processing of Biogenerated Flavor Composition: 332.86 lbs. of concentrated skim milk was subjected to ultrafiltration and diafiltration such that the resulting retentate contained 0.20% fat, 18.50% protein, 76.65% moisture, 0.30%salt, and 1.20% lactose. The heated cream composition and the skim milk retentate were mixed in a Breddo mixer with 2.25 lbs. sodium citrate, 0.75 lbs. yeast extract, 6.1 lbs. salt, and 140.4 lbs. water. The mixture was heated to 50 degrees C.,homogenized, and pasteurized. Pasteurization included heating the mixture to 74 degrees C., holding the mixture at 74 degrees C. for 16 seconds, and cooling to 30 degrees C. The pasteurized mixture was then fermented for 40 hours in a two phase process. A DVS culture containing Lactococcus cremoris, Lactococcus lactis, Lactococcus lactis spp. diacetylactis, and Leuconostoc cremoris (Chr Hansen Laboratories) was added to the fermentation vessel, where the initial concentration of the DVS culture was0.01% of the total mixture volume. Phase 1 of the fermentation was conducted without aeration for 12 hours. Phase 2 was conducted with sterile air aeration for 28 hours. The temperature of the fermentation vessel was kept at approximately 26 degreesC. through out phase 1 and phase 2 of the fermentation cycle. The mixture was then directed to a heat exchanger and heat treated to 74 degrees C., held for 16 seconds, and cooled to 20 degrees C. The mixture was then directed to a barrel and furthercooled to 5 degrees C. The final product was held at 4 degrees C. until use.

The final mixture had a composition profile as shown below:

TABLE-US-00002 Citric acid <0.01% Fat 18.12% Moisture 68.30% Protein 7.90% Lactose <0.01% Salt 0.90% pH 5.31

167

The final mixture contained the following flavor compounds:

TABLE-US-00003 Cultured-Fermented Flavor Compounds Diacetyl 16 PPM Acetoin 328 PPM Ethanol 96 PPM 2-Heptanone 1 PPM 2-Nonanone 1 PPM 2-Pentanone <1 PPM Acetone 1 PPM Creamy Flavor Compounds g-hexalactone <5 PPB g-octalactone 13 PPBg-decalactone 75 PPB g-dodecalactone 496 PPB 6-dodecene-g-lactone 273 PPB Delta-hexalactone 177 PPB Delta-octalactone 189 PPB Delta-decalactone 1755 PPB Delta-dodecalactone 3604 PPB Delta-tetradecalactone 6522 PPB

2.3--Incorporation of Biogenerated flavor with 7% Fat Cream Cheese. Finally, 2.8 lbs. of the biogenerated flavor as produced in step 1.2 and 1.3 above was mixed with the cream cheese as produced in step 1.1 above.

EXAMPLE 2

2.0--Preparation of Low-Fat Cream Cheese Using Biogenerated Flavor System.

2.1--Preparation of Low Fat Cream Cheese Base: A 7% fat cream cheese composition was produced by mixing 38.96 lbs. WPC 80 (Leprino Cheese), 33.9 lbs. dry whey and 327.14 lbs. water (acidified to pH 3.35 with an 18% concentration of phosphoricacid), heated to 200 degrees Fahrenheit (F.) and held for 6 minutes to form a whey mix. Next, 78.34 lbs. whey mix was blended with 18.16 lbs. cream and the pH was adjusted to 4.9 using sodium hydroxide to yield a cream cheese mix. The cream cheesemix was heated to 140 degrees F. and homogenized at 5000/500 psi. The homogenized mix was heated to 200 degrees F. and held for 10 minutes. Then, 64.334 lbs. cream cheese mix was blended with 0.035 lbs. sorbic acid, 0.049 lbs. xanthan gum, 0.267lbs. carob gum, 1.469 lbs. maltodextrin, 0.629 lbs. tricalcium phosphate, and 0.417 lbs. salt. The mix was heated to 180 degrees F. and held for 10 minutes.

2.2--Preparation of Biogenerated Flavor Composition: 102 lbs. of a cream composition containing 42.00% fat, 53.80% moisture, 1.80% protein, and 3.1% lactose was heated to 88 degrees C. and held for 60 minutes. 482.25 lbs. of whole milk wassubjected to ultrafiltration and diafiltration such that the resulting retentate contained 18.50% fat, 13.00% protein, 65.00% moisture, 0.30% salt, and 1.20% lactose. The heated cream composition and the whole milk retentate were mixed together in aBreddo mixer with 2.25 lbs. sodium citrate, 0.75 lbs. yeast extract, 6.75 lbs. salt, and 156 lbs. water. The mixture was heated to 50 degrees C., homogenized, and pasteurized. Pasteurization included heating the mixture to 74 degrees C., holdingthe mixture at 74 degrees C. for 16 seconds, and cooling to 30 degrees C. The pasteurized mixture was then fermented for 40 hours in a two phase fermentation process. A DVS culture containing Lactococcus cremoris, Lactococcus lactis, Lactococcus lactisspp. diacetylactis, and Leuconostoc cremois (Chr Hansen Laboratories) was added to the fermentation vessel, where the initial concentration of the DVS culture was 0.01% of the total mixture volume. Phase 1 of the fermentation was conducted withoutaeration for 12 hours. Phase 2 was conducted with sterile air aeration for 28 hours. The temperature of the fermentation vessel was kept at approximately 26 degrees C. through out phase 1 and phase 2 of the fermentation cycle. The mixture was thendirected to a heat exchanger and heat treated to 74 degrees C., held for 16 seconds, and cooled to 20 degrees C. The mixture was then directed to a barrel and further cooled to 5 degrees C. The final flavor product was held at 4 degrees C. until use.

The biogenerated flavor composition had a composition profile as shown below:

TABLE-US-00004 Citric acid <0.01% Fat 16.59% Moisture 70.60% Protein 10.40% Lactose <0.01% Salt 0.90% pH 5.44

The final biogenerated flavor composition contained the following flavor compounds:

TABLE-US-00005 Cultured-Fermented Flavor Compounds Diacetyl 30 PPM Acetoin 612 PPM Ethanol 17 PPM 2-Heptanone <1 PPM 2-Nonanone <1 PPM 2-Pentanone 1 PPM Acetone 1 PPM Creamy Flavor Compounds g-octalactone 4 PPB g-decalactone 28 PPBg-dodecalactone 302 PPB 6-dodecene-g-lactone 176 PPB delta-octalactone 161 PPB delta-decalactone 1344 PPB delta-dodecalactone 2778 PPB

168

2.3--Incorporation of Biogenerated flavor with 7% Fat Cream Cheese. Finally, 2.8 lbs. of the biogenerated flavor as produced in step 2.2 above was mixed with the 7% cream cheese as produced in step 2.1 above.

EXAMPLE 3

Preparation of Cream Cheese Base. A 7% fat cream cheese was prepared by mixing 59.5 lbs. WPC50 (First District Association), 10.40 lbs. dry whey and 330.10 lbs. water was acidified to pH 3.35 with 18% concentration phosphoric acid, heated to200 degrees F. and held for 6 minutes to form a whey mix. After heating, the 62.28 lbs. whey mix was blended with 11.11 lbs. cream and the pH was adjusted to 4.9 using sodium hydroxide to yield a cream cheese mix. The cream cheese mix was heated to140 degrees F. and homogenized at 5000/500 psi. The homogenized mix was heated to 200 degrees F. and held for 10 minutes. Then, 64.334 lbs. cream cheese mix was blended with 0.035 lbs. sorbic acid, 0.049 lbs. xanthan gum, 0.267 lbs. carob gum,1.469 lbs. maltodextrin, 0.629 lbs. tricalcium phosphate, and 0.417 lbs. salt. The mix was heated to 180 degrees F. and held for 10 minutes. Finally, 2.0 lbs. of the biogenerated flavor was added to 48.0 lbs of the cream cheese mix. The creamcheese mix was homogenized at 5000/500 psi and packaged.

EXAMPLE 4

Preparation of Cream Cheese Base. A 5% fat cream cheese was prepared by mixing skim milk and cream to yield approximately 3000 lbs. of mix at 1.7% fat. The mix was then homogenized, pasteurized and cooled. Approximately 400 lbs. of mix wasset aside for day 2 pH standardization. Direct set lactic acid cultures were added to 2600 lbs. of the mix and incubated for 18 hours at 70 degrees F. The pH of the incubated mix was 4.53 on day 2. The pH was standardized to 4.73 with the addition ofthe 400 lbs. unfermented mix. The mix was then concentrated using UF and the retentate was collected at 23.1 percent solids. Next, 48.6 lbs. retentate was mixed with 40 lbs. of functionalized whey protein (made in accordance with patent applicationNo. EP 04027965.5), 0.8 lbs. salt, 0.45 lbs. carob gum, and 0.15 lbs. carrageenan gum to form cream cheese. The cream cheese was heat to 131 degrees F. and homogenized at 5000/100 psi. The cream cheese was then heated to 183 degrees F. andrecirculated for 45 minutes to build texture. 10 lbs. of biogenerated flavor was added to the cream cheese.

EXAMPLE 5

Preparation of Cream Cheese Base. A 5% fat cream cheese was prepared by mixing skim milk and cream to yield approximately 1500 Kg. of mix at 1.6% fat. The mix was then homogenized, pasteurized and cooled. Approximately 225 Kg of the mix wasset aside for day 2 pH standardization. Direct set lactic acid cultures were added to 1275 Kg of the mix and incubated for 18 hours at 24 degrees C. The pH of the incubated mix was 4.39 on day 2. The pH was standardized to 4.62 with the addition of the225 Kg unfermented mix. The mix was then concentrated using a UF and the retentate was collected at 23.8 percent solids. The retentate was then cooled to 9 degrees C. and homogenized at 400/80 bar. Next, 40 Kg of functionalized whey protein (made inaccordance with patent application No. EP 04027965.5) was homogenized at 390/70 bar and mixed with 51.7 Kg retentate form cream cheese. The cream cheese was heated to 52 degrees C. and held for 10 minutes. Ingredients such as 0.8 Kg salt, 0.35 Kg carobgum and 0.15 Kg carrageenan gum were added to the cream cheese. The cream cheese was then held at 52 degrees C. for 30 minutes, heated to 70 degrees C., homogenized at 350/50 bar and recirculated at 81 degrees C. for approximately 30 minutes to buildtexture. Finally, 7 Kg of biogenerated flavor was added to the cream cheese and packaged.

EXAMPLE 6

Preparation of Cream Cheese Base. A 7% fat cream cheese was prepared by mixing 10.42 lbs. MPC 70 (Fonterra), 1.6 lbs. dry whey, 12.32 lbs. cream and 48.21 lbs. in a tank and the pH was adjusted to 4.9 using lactic acid to yield a creamcheese mix. The cream cheese mix was heated to 140 degrees F. and homogenized at 5000/500 psi. Then, 45.34 lbs. of the cream cheese mix was blended with 0.025 lbs. sorbic acid, 0.035 lbs. xanthan gum, 0.190 lbs. carob gum, 1.5 lbs. maltodextrin,0.450 lbs. tricalcium phosphate, and 0.460 lbs. salt. The mix was heated to 180 degrees F. and held for 10 minutes. Finally, 2.0 lbs. of the biogenerated flavor was added to the cream cheese mix. The cream cheese mix was homogenized at 5000/500 psiand packaged.

169

More specifically, the invention relates to a novel method for the production of spun-curd cheeses, according to which a pasteurized milk is used, which is acidified before or after pasteurization in a controlled manner by means of an acidogenicagent.

In the context of the present invention, the term "spun-curd cheeses" is intended to mean, in accordance with the classification given in the work "Le Fromage" ["Cheese"], by Andre E C K, Technique et Documentation (Lavoisier, Paris, 1984), page245, plastic-curd cheeses in which said curd, once the serum has been drained, is immersed either in hot water or in hot serum, and worked, pulled, before being molded when it is in the plastic state. The main cheeses that fall within this category arein particular cheeses of the type: Mozzarella, Provolone, Sarde, Metton, and pizza cheeses.

Conventionally, spun-curd cheeses are produced from whole or partially skimmed milk, which is renneted and acidified. The renneting consists in adding coagulating enzymes to the matured milk.

The curd formed is cut into slices (curd-cutting) until grains having a desired size are obtained, and drained, then heated, so as to accentuate, inter alia, the departure of the serum from the curd grains. When the desired acidification isobtained, the curd is vigorously mixed, pulled, modeled and smoothed, either manually, or with a machine, in water or warm serum, and then rapidly cooled, dried and salted.

The starting raw milk can be subjected to operations consisting of thermal treatment and of maturation, by means of the addition of lactic ferments which result in acidification of the milk to a pH value corresponding to the demands required forthe subsequent renneting step, generally between approximately 6.5 and 6.

It is known that increasing the pasteurization temperature of cheese-making milks can make it possible to increase the cheese yield, and that it is advantageous for hygiene reasons to be able to treat milks at temperatures above 72° C. Itis also known that such thermal treatments reduce the ability of the milk to convert to cheese. The applicant has therefore provided, in its patent EP 347.308 B1, a solution for overcoming all the difficulties inherent in the use of milks treated athigh temperatures. This solution consists of the addition to the these milks of an acidogenic agent chosen from gluconolactones or glucoheptonolactones, making it possible to restore the cheese-producing capacities without resorting to noveltechnologies. Thus, it has become possible to produce renneted cheeses, such as in particular soft cheeses, from milks heated to more than 78° C.

However, the applicant has noted that this overheating method does not make it possible to produce spun-curd cheeses according to conventional technology. This is because, and as will be demonstrated later, the treatment of milks at certaintemperatures is incompatible with satisfactory curd-spinning properties. The spinning ability is the determining criterion of this type of cheese. The spinning is a type of fibration by pulling, and it is important to promote sliding of the fibers overthemselves in order to obtain maximum spinning. Now, spinning is not possible, or else is mediocre, when a milk pasteurized at high temperature and acidified with glucono-delta-lactone (hereinafter defined by the abbreviation "GDL") is used.

There was therefore an unsatisfied need for a method for the production of spun curds from milks pasteurized at high temperature and acidified with an acidogenic agent.

Seeking to find a solution to this problem, the applicant noted that a gradual increase in the milk treatment time/temperature couple sizably decreased the spinning ability. The curds obtained became increasingly less cohesive, dispersing at thehighest temperatures, and giving an increasingly shorter curd texture. The milk pasteurization temperature and time are therefore critical parameters in the production of spun curds.

Moreover, the spinning ability of curds derived from heated milks is improved by increasing amounts of acidogenic agent. However, the spun curds obtained still exhibit mediocre technological abilities.

Furthermore, it has always been necessary to correct thermally treated milks by adding calcium salts, and in particular calcium chloride, after treatment, so as to decrease the solidifying time and to increase the rate of firming of the coagulum,and also to improve the rheological properties of the

170

curd. It may in fact be noted that all the cheeses described in the abovementioned patent EP 347.308 B1 are produced using a milk treated at a high temperature, to which calcium chloride is thenadded so as to correct the technological abilities of the curd and to obtain the same solidifying time as with raw milk. Now, in the case of spun curds prepared from milk treated at high temperature, the applicant has noted, in the course of manytrials, that the addition of calcium chloride to the milk runs counter to the spinning abilities.

To the applicant's credit, it has noted that, surprisingly, by combining the effect of a selected pasteurization time/temperature couple, an optimized dose of acidogenic agent, and a depletion of the milk in terms of exogenous calcium salts, itis possible to aspire to the production of spun curds of quality comparable, and even superior, to spun curds obtained according to conventional techniques.

Without wishing to be bound to any theory, it appears that the acidogenic agent plays a predominant role in terms of calcium balances during the coagulation of the milk. Thus, the presence of a certain dose of acidogenic agent would act as acalcium store, thus regulating the mineralization of the curd and allowing suitable, or even improved, spinning when the cheese-forming conditions or the conditions of thermal treatment of the milk are unfavorable. Calcium chloride cannot in itselfconstitute a store since adding it alone immediately increases the portion of ionized calcium and abruptly modifies the micellar equilibrium.

A subject of the invention is therefore a method for the production of spun-curd cheeses from pasteurized milk, comprising the successive steps of preparation of the milk, renneting, coagulation, curd-cutting, draining and spinning, characterizedin that, during the phase consisting of preparation of the milk, which has a low exogenous calcium salt content, said milk is thermally treated at a temperature of between 80 and 85° C., and an effective amount of acidogenic agent is added beforeor after said thermal treatment.

For the purpose of the present invention, the term "exogenous calcium salts" is intended to mean the non-micellar calcium salts intentionally introduced into the milk in order to correct its technological abilities, and in particular calciumchloride. The term "low content" is intended to mean the fact that the milk used in the method according to the invention contains little or no added calcium salts. Since the composition of milks is very variable according to their origin, a lowexogenous calcium salt content allowing the implementation of the present invention is reflected by a milk preferably comprising less than 0.4 g of calcium salts per liter of milk, more preferably less than 0.2 g/l, and even better still less than 0.1g/l. According to a preferred variant of the method according to the invention, the milk is free of exogenous calcium salts.

The milk used according to the invention is a non-reconstituted milk of any origin, that is raw or has undergone prior thermal treatment at a temperature of less than 78° C., that has optionally undergone standardization in terms of fattycontent, and/or that has undergone adjustment in terms of protein content by ultrafiltration. It is also possible to use a reconstituted milk (mixture of powdered milk and water) or a recombined milk (mixture of powdered milk, water and milk fat).

The term "acidogenic agent" is understood to mean any substance capable of gradually generating an acid in milk, either by solubilization or by release. Among the substances capable of gradually generating an acid in milk by solubilization arein particular lactones such as glucono-delta-lactones and glucoheptonolactones, and the like, and/or mixtures thereof, which, in an aqueous medium, gradually hydrolyze to the corresponding acid. Among the substances capable of gradually generating anacid in milk by release, are, for example, acids attached to a delayed-solubilization or delayed-disintegration support.

The introduction of acidogenic agent can be carried out, without implied distinction, in the form of a powder or in the form of a solution.

When the preference is to provide this acidogenic agent in the form of a solution, i.e. a solution in water or milk, said solution is advantageously prepared at the time of use in order to preserve the acidogenic nature of the agent as definedabove.

By way of indication, the acidogenic agent may be introduced into raw milk, before or after a first optional pasteurization treatment, before or after the thermal treatment for the purpose of the invention, i.e. at between 80 and 85° C.

171

It appears, however, that it is preferable to introduce the acidogenic agent into the milk after the thermal treatment according to the invention.

Preferably, the thermal treatment of the milk is carried out at a temperature of between 80 and 82° C. Very good results have been obtained when the treatment is carried out at 80° for 20 to 60 seconds, and preferably for 20seconds. The spinning is also very good after treatment at 82° C.; however, a few grains of serum proteins appear in the curd. Beyond 82° C., spinning is no longer possible.

As regards the acidogenic agent, glucono-delta-lactone (GDL) is preferably used. Advantageously, the latter is added at a rate of 0.5 to 1.5 g/l, preferably of 0.7 to 1 g/l of milk, and even more preferably at a rate of 1 g/liter of milk. Sucha dose of GDL makes it possible to obtain a pH at spinning of a minimum of 5.4, and preferably 5.1, based on which pH the applicant has demonstrated the best chances of spinning.

All the steps subsequent to the milk preparation phase are characteristic of spun-curd technology and will be chosen according to the general knowledge of those skilled in the art.

The method in accordance with the invention has many advantages compared with the prior art, besides that of allowing the spinning of curds obtained by acidification of a pasteurized milk with GDL. It sizably increases production yields byallowing a gain in recovered nitrogenous substances that is greater than that of the conventional methods, which is an obvious economical advantage, and it makes it possible, through reducing the ionized calcium contents, to combat the proliferation ofbacteriophages that are responsible for the attack and lysis of lactic ferments and that disturb the acidification of the milk, the formation of the curd and its organoleptic quality.

In addition, it is highly possible that the doses of ferments and of coagulants to be added may be decreased, which is another economical advantage.

The invention will be understood more clearly on reading the examples which follow and which contain the description of advantageous embodiments. All these examples were carried out by the Ecole Nationale d'Industrie Laitiere [National DairyIndustry School] in MAMIROLLE-BESANCON (France) in connection with the company Chr. HANSEN France (ARPAJON-France). 

EXAMPLE 1

A raw milk 12/24 h old when collected, stored raw at 4° C. for 24 h, with a standardized fat content of 36 g/l, is prepared according to the following characteristics: Pasteurization: 75° C./30 s and 60 s, 80° C./60 s,85° C./60 s and 90° C./60 s; CaCl2 supplement: 90 ml/hl of a solution containing 470 g/l of CaCl2, i.e. a content of 0.42 g/l of milk; Addition of GLD: 0 for the control, 0.7 g/l for the trials.

This milk is heated to 38° C. (maturation temperature), ferments are added (STM5-2%) and subjected to a maturation time of 30 minutes. The renneting pH is 6.35. The renneting is then carried out, at 38° C., using CHYMAX PLUS ata dose of 16.3 ml/hl. The ferments and the coagulant, and also the glucono-delta-lactone, were provided by the company Chr. HANSEN France (ARPAJON-France).

The solidification time is 10 minutes, the hardening time is 30 minutes. The gel obtained is cut up, stirred and acidified under serum in a closed tank for 2 h to 2 h 30 min until a minimum spinning pH of 5.4 is obtained. The spinning iscarried out by hand, in water at 85° C.

The results obtained are given in the table below:

TABLE-US-00001 Control 1 Control 2 Trial 1 Trial 3 Trial 4 Thermal 73° C. 73° C. 80° C. 85° C. 90° C. treatment 30 sec 60 sec 60 sec 60 sec 60 sec CaCl2 dose 20 90 90 90 90 (ml/hl) GDL dose 0 0.7 0.70.7 0.7 (g/l) SPINNING (marked 10 8 6 1 0 from 1 to 10) SPINNING >100 >100 30 0 0 (length of strand in cm)

Conclusions of the Trials and Observations:

The gradual increase in the thermal treatment temperature/time couples of the milk brings about a

172

different behavior in terms of the milk coagulation and draining, but which is recovered by means of the CaCl2 and GDL corrections. However,despite the corrections introduced, any treatment greater than 80° C./60 s makes manual spinning very difficult. The curd is not cohesive, or even disperses at the highest temperatures, it dries, and the strand is shorter as the coupleincreases. The limiting couple is that at 80° C./60 s, where spinning was nevertheless possible, although relatively weak. The choice of an appropriate pasteurization temperature is not sufficient on its own to confer satisfactory spinningabilities.

EXAMPLE 2

The same milk as in example 1 is prepared according to the following characteristics. Pasteurization: 72° C./20 sec for the control, and 80° C./20 sec, 82° C./20 sec; CaCl2supplement: 20 ml/hl or 90 ml/hl of asolution containing 470 g/l of CaCl2, i.e. a content of 0.09 g/l or of 0.42 g/l of milk. GLD supplement: none or 0.3 to 1 g/l.

This milk is heated to 36° C. (maturation temperature), ferments are added (STM5-8 g/hl), and a maturation time of 60 minutes is observed. The renneting pH is 6.55-6.6 for the control and 6.45-6.50 for the trials. The renneting is thencarried out, at 36° C., using CHYMAX PLUS at a dose of 17 ml/hl for the control and 13 ml/hl for the trials.

The solidifying time is 20 minutes, the hardening time is 50 minutes. The gel obtained is cut up, heated at 40° C. for 4 minutes, stirred, and acidified under serum in a closed tank for 2 h to 2 h 30 min until a minimum spinning pH of5.4 is obtained. The spinning is carried out by hand, in water at 85° C., or with a machine when this is possible.

The results are given in the table below:

TABLE-US-00002 Control 1 Trial 5 Trial 6 Trial 7 Trial 8 Trial 9 Trial 10 THERMAL 72° C. 80° C. 80° C. 80° C. 82° C. 82° C. 82° C. TREATMENT 20 sec 20 sec 20 sec 20 sec 20 sec 20 sec 20 secCaCl2 dose 20 90 90 90 90 90 90 (ml/hl) GDL dose 0 0.3 0.5 0.7 0.5 0.7 1 (g/l) SPINNING (marked 10 2 2 8 2 5 7 from 1 to 10) machine manual manual machine manual machine machine SPINNING >100 8 52 57 62.5 31.3 50 (length of strand in cm)

Conclusions and Observations of the Trials: Trials 5 and 6: a strand difficult to obtain is observed, it is not possible to use it in a machine; Trial 7: the spinning is inferior to the control and the curd obtained is too firm.

The thermal treatment temperatures are correct, but the GDL corrections of less than 0.7 g/l do not allow satisfactory spinning.

Trial 8: only manual spinning is possible, but the curd remains very hard.

Trial 9: a medium spinning ability is observed, which allows machine spinning, but the curd remains hard, brittle, and not smooth enough.

Trial 10: this trial is the best of the series; the texturing can be done by machine, but the curd is still harder than the control, and exhibits medium smoothing, with the presence of grains in the fibers produced.

The choice of appropriate dose of GDL is not sufficient on its own, or combined with a selected pasteurization, to improve the spinning properties of the curd.

EXAMPLE 3

The same milk as in example 1 is prepared according to the following characteristics: Pasteurization: 72° C./20 sec for the control, and 80° C./20 sec, 82° C./20 sec, 85° C./20 sec; CaCl2 supplement: 20 ml/hlor 90 ml/hl or nothing; GDL supplement: none or 1 g/l.

This milk is heated to 41° C. (maturation temperature), ferments are added (STM5-8 g/hl) and a maturation time of 60 minutes is observed. The renneting pH is 6.55-6.6 for the control and 6.45-6.50 for the trials. The renneting is thencarried out, at 36° C., with CHYMAX PLUS at a dose of 25 ml/hl.

173

The solidifying time is 8-10 minutes, the hardening time is 24-30 minutes. The gel obtained is cut up, heated at 40° C. for 4 minutes, stirred, and acidified under serum in a closed tank for 2 h to 2 h 30 min until a minimum spinning pHof 5.4 is obtained. The spinning is carried out by hand, in water at 85° C.

The results are given in the table below:

TABLE-US-00003 Trial Trial Trial Trial Control 1 11 12 13 14 Thermal 72° C. 85° C. 85° C. 82° C. 80° C. treatment 20 sec 20 sec 20 sec 20 sec 20 sec CaCl2 dose 20 90 0 0 0 (ml/hl) GDL dose 0 0 1 1 1(g/l) SPINNING (marked 9 3 2 9 10 from 1 to 10)

The spinning ability limit lies at a thermal treatment of 82° C./20 sec and 1 g/l of GDL.

With this scheme, the spinning is good but the curd exhibits a few grains.

Trials 11 and 12 give a curd that it would not be possible to use in a machine.

The best results are obtained for trial 14, without calcium chloride, with a treatment at 80° C./20 sec and 1 g/l of GDL. This trial gives better results than the control. The choice of a specific thermal treatment, combined with anoptimal dose of GDL and an absence of calcium correction, makes it possible not only to improve the spinning properties of the curd, but also to confer on it a superiority compared to the control which corresponds to the conventional technology of theprior art. BACKGROUND OF THE INVENTION

The present invention relates to the making of cheese, and particularly to the making of cheese ripened for two or more months such as Cheddar and Colby cheese.

Milk from many different mammals is used to make cheese, though cow's milk is the most common milk for cheese. Generally, cheese is made by developing acidity in milk and setting the milk with a clotting agent, such as rennet. The set milk iscut and whey is separated from the resulting curd. The curd may be pressed to provide a cheese block. Rennet-based cheeses include cheeses such as mozzarella, Cheddar, Swiss, and Colby cheese. Typical Cheddar cheese has 1.4 g lactate per 100 g andcontains 37.5% water.

Curing typically takes place over a lengthy period of time under controlled conditions. Cheddar cheese, for example, is cured for a period of at least four months and may be cured for a period in excess of one year to obtain the full flavordesired in cheddar cheese.

Recently, use of concentrated milk as the base ingredient for making cheese has become more popular. Milk can be concentrated prior to cheese making using a variety of techniques including ultra-filtration, micro-filtration, vacuum condensation,or the addition of dry milk solids such as nonfat dry milk. The use of concentrated milk provides increased efficiency to the cheese-making process. Use of concentrated milk also reduces the amount of whey produced for a given amount of cheese,facilitates standardization of formulation and production, and promotes more consistent quality and yields of the resultant cheese. The use of concentrated milk thus lowers cost and processing times for making cheese, particularly beneficial forsemi-continuous cheese manufacturing processes such as utilized in typical large-scale cheese plants. The semi-continuous cheese manufacturing includes numerous cheese vats that sequentially feed a draining/conveying belt and a salting belt. Thissemi-continuous cheese making system requires consistent and rapid production of acid by starter cultures used in the cheese manufacturing process. The efficiency of semi-continuous cheese manufacturing is substantially improved if the milk isconcentrated prior to cheese-making.

During the aging process, calcium lactate crystals can grow within and on the surface of cheese. These crystals are small white spots that can be seen, often without magnification, upon close inspection of the cheese. The crystals are notpresent in the cheese immediately after manufacture, but typically start to appear between two and six months of aging. While the calcium lactate crystals are not harmful to consumers, they can be perceived in mouthfeel as adding a slight amount ofgrittiness to the cheese. More importantly for affecting cheese sales, consumers often believe the crystals are mold. The growth of calcium lactate crystals is thus viewed as a defect representing substantial financial loss for cheese manufacturers.

174

For reasons that are not entirely clear, the use of concentrated milk and a semi-continuous cheese making process in making an aged cheese seems to worsen the calcium lactate crystal problem. Consequently cheese manufacturers have an unenviablechoice: they can either use a less efficient cheese-making process, or they can use a more efficient manufacturing process that more likely results in calcium lactate crystals defects.

Factors influencing the formation of calcium lactate crystals have been extensively studied. Concentrations of calcium and lactate ions existing in cheese serum are very close to saturation, and small increases in the concentration of eithercomponent could result in super saturation and crystallization. It has also been theorized that milk citrate levels and the subsequent utilization of citrate by microorganisms may play a role in calcium lactate formation. Curd washing, curing, andstorage temperature may further contribute to calcium lactate crystal formation. Other studies report that calcium lactate is formed when L(+)-lactate is converted into a racemic mixture of L(+)- and D(-)-lactate, the latter being much more prone tocrystallization. The conversion of L(+)-lactate to D(-)-lactate is thought to be carried out by certain strains of bacteria.

Prior art methods for limiting calcium lactate crystal formation in cheese include: 1) reducing the concentration of lactic acid in the final curd, 2) reducing or eliminating undesirable non-starter lactic acid bacteria ("NSLAB") from thecheese-making process, 3) controlling storage temperature, and 4) vacuum packaging cheese to minimize the airspace around the outer cheese surface. The use of certain starter culture strains may also increase or decrease the presence of calcium lactatecrystals, due to post manufacture fermentation by the selected starter culture.

Although progress has been made in developing strategies for prevention of calcium lactate crystals, the defect is still prevalent. Better methods of minimizing calcium lactate crystal formation in aged cheeses are needed.

BRIEF SUMMARY OF THE INVENTION

The present invention is a method of adding sodium gluconate to the typical cheese-making recipe to inhibit the growth of calcium lactate crystals as the cheese ages, and the cheese composition made by the addition of sodium gluconate. Thepreferred method of adding the sodium gluconate is during or immediately after the salting stage of the cheese-making process. 

DETAILED DESCRIPTION

The present invention modifies conventional cheese-making and begins, as all cheeses do, with milk. Preferably the milk is whole cow's milk having 3 to 4% butterfat and in excess of 7% solids non-fat. However, it is believed that cheeses formedfrom milk of other mammals will similarly benefit from the present invention, as will cheeses formed from milks with different fat (including non-fat) and/or different solids non-fat concentrations.

The preferred milk starting ingredient is preferably concentrated to achieve efficiencies in the cheese-making process. Preferably the solids content of the milk is increased to have total solids within the range of 13 to 50%, more preferablywithin the range of 13 to 18%, and most preferably to have total solids within the range of 14 to 15%. While the concentrated milk could be formed merely by adding condensed skim milk, ultra-filtered skim milk, micro-filtered skim milk or non-fat drymilk solids to the starting milk, more preferably the concentrated milk includes an addition of fat as well as non-fat milk solids. The preferred concentrated milk may thus be formed by adding various amounts of condensed skim milk, ultra-filtered skimmilk, micro-filtered skim milk or non-fat dry milk solids and cream to whole milk, thereby retaining the ratio of casein to fat present in whole milk. Calcium chloride may be added to the milk ingredient to generate firmer curds. Fortifying ingredientsor colorings may also be added to the milk ingredient.

The milk ingredient is acidified. If desired, the acidification can be achieved by adding an acidic ingredient, such as citric acid or tartaric acid, or through natural bacterial acidification. More preferably, the acidification is achieved byadding a starter culture, such as a mesophilic (lactococcus lactis ssp cremoris), thermophilic (streptococcus thermophilus) or helvetic (lactobacillus helveticus) bacteria culture. Most preferably (for Cheddar cheese) a mesophilic starter culture isused. If a starter culture is used, the mixture is then incubated between about 10 and 60 minutes, preferably about 30 minutes at a temperature between about 30 and 37° C.,

175

preferably about 31 to about 32° C.

After incubation, a coagulating agent, preferably rennet at about 0.02 to about 0.1 percent, is added to act on the casein and cause the milk ingredient to coagulate. The rennet may be animal, microbial or vegetable. The mixture is furtherincubated between about 10 and 60 minutes, preferably about 30 minutes, at a temperature between about 30 and 37° C., preferably about 31 to about 32° C. The addition of a coagulating agent, preferably rennet, causes the milk to coagulateinto a mass.

After coagulation, the mass is cut, stirred, and heated (i.e., from about 30 to about 42° C. and preferably from about 31 to about 39° C.) for between about 10 and about 60 minutes, preferably about 30 minutes. The whey isdrained off and the curd is matted into a cohesive mass in the traditional Cheddaring process or is intermittently stirred when using the stirred curd process. Subsequently in the traditional Cheddar process the mass is cut into pieces and salted,whereas in the stirred curd process the curd is simply salted. About 1 to about 4% salt, and preferably about 1.5 to about 3% salt is added to the curd. The preferred salt is sodium chloride added most preferably (for a Cheddar cheese) at about 2.75%. The salted curd is stirred, further drained and pressed into forms. Approximately 65-90% of the salt added is retained in the cheese, and thus consequently a typical Cheddar cheese has 1.5 to 2.0% salt. The cheese is then aged for a time period inexcess of one week, preferably from one month to one year, and most preferably about 4 months prior to consumption.

Within this conventional cheese-making process and prior to aging, sodium gluconate is added. The sodium gluconate could, for instance, be added to the starting milk ingredient, to the concentrated milk, to the starter culture or to the rennet. The preferred method for adding sodium gluconate, however, is during or immediately after the salting step. This allows the use of a granulate form of sodium gluconate while minimizing the amount of sodium gluconate lost during whey separation, andwithout needlessly increasing the processing complexity of the cheese. The sodium gluconate appears to decrease the growth of calcium lactate crystals in cheese.

The sodium gluconate of the present invention is added in a range of greater than zero to 10% by weight, and more preferably within a range of greater than zero to 5% by weight. The sodium gluconate added results in the inclusion of greater thanzero to 5.8% gluconate in the final cheese product, and more preferably greater than zero to 4.5% gluconate in the final cheese product. Even more preferably, sodium gluconate is added within the range of about 0.32 to 4.73% by weight and results inabout 0.26 to 2.8% gluconate in the final cheese product.

Most preferably, the amount of sodium gluconate added is gauged based upon the lactate content of the cheese and the amount of sodium gluconate retained in the cheese to remain in the final cheese product in a sufficient amount to prevent theformation of calcium lactate crystals. For instance, the normal range of lactate found in Cheddar cheese is 1.1 to 1.9%, and preferably the sodium gluconate is added so the gluconate content of the cheese is within the range of about 1/4 to 5/3 thelactate content of the cheese. Sodium gluconate added during or immediately after the salting step of cheese manufacture is believed to be retained at a rate similar to the retention of the sodium chloride salt, approximately 65-90%. For a Cheddarcheese containing 1.1% lactate in the final product, if the salt retention is found to be 90%, sodium gluconate is added within the range of about 0.32 to 2.0% by weight. The sodium gluconate added in the salting process is believed to be retained at asimilar rate to the sodium chloride, and this 0.32 to 2.0% addition results in about 0.29 to 1.8% sodium gluconate to combat against calcium lactate crystal formation from the 1.1% lactate. Sodium gluconate is about 89% gluconate by weight, so the 0.29to 1.8% sodium gluconate results in the inclusion of about 0.26 to 1.6% gluconate in the final cheese product. On the other end of the spectrum, for a Cheddar cheese containing 1.9% lactate in the final product, if the salt retention is found to be 65%,sodium gluconate is added within the range of about 0.77 to 4.7% by weight, resulting in about 0.50 to 3.1% sodium gluconate to combat against calcium lactate crystal formation from the 1.9% lactate. The 0.5 to 3.1% sodium gluconate results in theinclusion of about 0.45 to 2.8% gluconate in the final cheese product.

Different amounts of sodium gluconate would be added if the addition occurred at a different stage of the cheese-making process other than the salting step or immediately after the salting step. By adding the sodium gluconate during the saltingstep or immediately after the salting step, most of the sodium gluconate remains in the cheese product at the time of purchase and consumption. This provides a double benefit to cheese manufacturers, in that the sodium gluconate becomes an

176

edible partof the final cheese product. That is, the addition of 0.32 to 4.73% sodium gluconate results in 0.29 to 3.1% more cheese being manufactured and sold, and the additional weight sold adds revenue for the cheese manufacturer.

Example 1

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a conventional milled curd method. A direct vat set, frozen, concentrated starter culture (Marschall.RTM. Superstart.RTM. concentrated cultures, Strain M30 and M42, Rhodia, Inc.,Dairy Business, Madison, Wis.) was used to manufacture the cheese. A total of 36 ml of starter culture (18 ml of each strain) and 15.6 ml of color (AFC-WS-1x, Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk, which was maintainedat 31° C. After a 45-minute ripening period, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) diluted with 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowedto heal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cooked with continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After thecurds and whey reached a pH of 6.25 (30 to 45 minutes) the whey was drained and the curds were ditched and packed. The matted curd was then cut into slabs, flipped and stacked in 20-minute intervals until the curd reach a pH of 5.4. A pH of 5.4 wasreached 1.5 to 2 hour after the whey was drained. The slabs of curd were then milled and approximately 60 lbs of milled curd were obtained. The 60 lbs of milled curd were then divided in half. Two separate salting treatments were then applied to eachportion of the curd. One half of the milled curd (30 lbs) was salted at a rate of about 2.75% with sodium chloride (0.825 lbs). The sodium chloride was applied in three equal portions (0.275 lbs each) and the curd was mixed for 10 minutes between eachsodium chloride application. The remaining curd (30 lbs) was salted at a rate of about 2.75% sodium chloride (0.825 lbs) and 2.4% sodium gluconate (0.72 lbs, PMP Fermentation Products, Peoria, Ill.), such that the total sodium chloride/sodium gluconateaddition was about 5.15% (1.545 lbs). The sodium chloride and sodium gluconate were applied in three equal portions (0.275 lbs and 0.24 lbs for the sodium chloride and sodium gluconate respectively) and the curd was mixed for 10 minutes between eachsodium chloride/sodium gluconate application. Subsequently the curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separateblocks weighing approximately 24-26 lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-25 1 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.13, 1.87%, and 38.84% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.44, 1.51%, 1.29% and 40.32% respectively. It is recognized that the maximum moisture content allowed in Cheddar cheese is 39% and that minor adjustments in the cheese making procedure for the cheese containing sodium gluconatewill be required to reduce the moisture content to less than 39%.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The cheese blocks from the sodium gluconate treatment exhibited less weeping than thestandard cheese.

The resultant cheese from the sodium gluconate treatment tasted smooth and smelled pleasant, with no perceptible offtaste, mouthfeel or odor added due to the sodium gluconate addition. As an additional secondary benefit, the sodium gluconatetreatment slightly suppressed bitterness in the cheese.

Example 2

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10

177

pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a stirred curd method. A bulk starter culture was prepared by inoculating steamed reconstituted NFDM with a direct vat set, frozen, concentrated starter culture (Marschall.RTM. Superstart.RTM. concentrated cultures, Strain M46, Rhodia, Inc., Dairy Business, Madison, Wis.) and incubating overnight. The concentrated cheese milk was then inoculated with the bulk culture at a rate of 2%. Additionally 15.6 ml of color (AFC-WS-1x,Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk. The concentrated milk was then maintained at 31° C. for a 45-minute ripening period. Subsequently, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) dilutedwith 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowed to heal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cookedwith continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After the curds and whey reached a pH of 6.30 (30 to 45 minutes) the whey was drained and the curds were intermittently stirred untilthe curd reach a pH of 5.4. A pH of 5.4 was reached 1.5 to 2 hour after the whey was drained. Approximately 60 lbs of curd were obtained and subsequently divided in half. Two separate salting treatments were then applied to each portion of the curd. One half of the curd (30 lbs) was salted at a rate of about 2.75% with sodium chloride (0.825 lbs). The sodium chloride was applied in three equal portions (0.275 lbs each) and the curd was mixed for 10 minutes between each sodium chloride application. The remaining curd (30 lbs) was salted at a rate of about 2.75% sodium chloride (0.825 lbs) and 2.4% sodium gluconate (0.72 lbs, PMP Fermentation Products, Peoria, Ill.), such that the total sodium chloride/sodium gluconate addition was about 5.15%(1.545 lbs). The sodium chloride and sodium gluconate were applied in three equal portions (0.275 lbs and 0.24 lbs for the sodium chloride and sodium gluconate respectively) and the curd was mixed for 10 minutes between each sodium chloride/sodiumgluconate application. Subsequently the curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separate blocks weighingapproximately 24-26 lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-25 1 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.35, 1.08%, and 39.0% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.42, 1.01%, 0.79% and 42.51% respectively. It is recognized that the maximum moisture content allowed in Cheddar cheese is 39% and that minor adjustments in the cheese making procedure for the cheese containing sodium gluconatewill be required to reduce the moisture content to less than 39%.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The resultant cheese from the sodium gluconate treatment tasted smooth and smelledpleasant, with no perceptible offtaste, mouthfeel or odor added due to the sodium gluconate addition.

Example 3

Concentrated milk was prepared by mixing 500 pounds of whole milk (3.8% butterfat) with 10 pounds of non-fat dry milk and 10 pounds of cream (40% butterfat), thereby forming concentrated milk with approximately 14.5% total solids. Theconcentrated milk was then used to manufacture Cheddar cheese using a stirred curd method. A direct to vat set frozen, concentrated starter culture (Marschall.RTM. Superstart.RTM. concentrated cultures, Strain M62, Rhodia, Inc., Dairy Business,Madison, Wis.) was added to the concentrated cheese milk in an amount of 64 ml. Additionally 15.6 ml of color (AFC-WS-1x, Chr. Hansen, Inc., Milwaukee, Wis.) were added to the concentrated milk. The concentrated milk was then maintained at 31° C. for a 45-minute ripening period. Subsequently, 24 ml of rennet (Chy-max, Chr. Hansen, Inc., Milwaukee, Wis.) diluted with 500 ml of deionized water were added to the concentrated milk. After 25-30 minutes the resultant coagulum was cut, allowed toheal for 5 minutes and then gently stirred for an additional five minutes. Subsequently the curds and whey were cooked with continuous stirring to 38° C. in 30 minutes and were then held at 38° C. for an additional 30 min. After thecurds and whey reached a

178

pH of 6.30 (30 to 45 minutes), the whey was drained and the curds were intermittently stirred until the curd reach a pH of 5.4. A pH of 5.4 was reached 1.5 to 2 hours after the whey was drained. Approximately 60 lbs of curdwere obtained and subsequently divided in half. Two separate salting treatments were then applied to each portion of the curd. One half of the curd (30 lbs) was salted at a rate of about 2.5% with sodium chloride (0.75 lbs). The sodium chloride wasapplied in three equal portions (0.25 lbs each) and the curd was mixed for 10 minutes between each sodium chloride application. The remaining curd (30 lbs) was salted at a rate of about 1.70% sodium chloride (0.51 lbs) in two equal portions (0.255 lb)and the curd was mixed for 10 minutes between each sodium chloride application. Subsequently 3.0% sodium gluconate (0.90 lbs, PMP Fermentation Products, Peoria, Ill.) was applied in one application and the curd was mixed for 10 minutes. Subsequentlythe curds from the control cheese with standard salting using only sodium chloride and curd with sodium chloride and sodium gluconate added were hooped and pressed overnight into two separate blocks weighing approximately 24-26 lbs.

Both cheese blocks were ripened under refrigeration for seven days. After one week of ripening the cheese from each cheese block was cut into 20-25 1 lb blocks. Each block was vacuum-sealed in clear wrapping. The vacuum-sealed cheese blockswere aged under refrigeration for two months. The pH, lactic acid content and moisture content of the control cheese was 5.25, 1.24%, and 33.05% respectively, whereas the pH, lactic acid content, gluconate content and moisture content of the sodiumgluconate cheese was 5.41, 1.03%, 1.40% and 34.5% respectively.

After two months of aging, the blocks of both cheeses were inspected for the presence of calcium lactate crystals. Each of the blocks of cheese obtained from the standard salting control treatment had calcium lactate crystals visibly present onthe cheese surface as well as the cheese interior. None of the blocks of cheese from the sodium gluconate treatment had any visible calcium lactate crystals present. The resultant cheese from the sodium gluconate treatment tasted smooth and smelledpleasant, with no perceptible offtaste, mouthfeel or odor added due to the sodium gluconate addition.

Although the present invention has been described with reference to preferred embodiments, workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention. FIELD OF THE INVENTION

The present invention relates to a novel process of making cheese containing gum, specifically although by no means exclusively, to a process of making mozzarella or mozzarella-like (pizza) cheese containing gum, and to a cheese product made bysaid process.

BACKGROUND OF THE INVENTION

Recent cheese making processes have concentrated on the production of low fat, low cholesterol and fat free cheeses which have the texture and flavour of full fat cheese, for the increasing health conscious public and also aimed at the weightreduction and slimming food market.

In particular, a number of substances have been added to the cheese making process as fat replacement agents including starch (U.S. Pat. No. 5,547,513; U.S. Pat. No. 5,679,396; U.S. Pat. No. 5,277,926; U.S. Pat. No. 5,807,601; U.S. Pat. No. 4,552,774; U.S. Pat. No. 5,665,414); gums, such as carrageenan, xanthan, agar, alginate, guar and cellulose gels (U.S. Pat. No. 5,895,671; U.S. Pat. No. 5,395,630; U.S. Pat. No. 5,090,913; WO 86/00786); as well as both starches and gumstogether or in combination with other additives such as emulsifiers, flavours, stabilisers, colourants, dairy solids, cheese powders, and the like, (U.S. Pat. No. 5,902,625; U.S. Pat. No. 5,895,671; NZ 303546; U.S. Pat. No. 5,679,396; U.S. Pat. No. 5,532,018). In particular, the starting milk for these processes is either fat free or contains less than 0.3% fat (U.S. Pat. No. 5,395,630; U.S. Pat. No. 5,090,913).

Carrageenan appears to be a preferred gum in the prior art processes and has been used in a number of instances to enhance production of low fat cottage cheese and soft acid set coagulated cheeses. These methods have involved the use ofcarrageenan to tie up protein material from whey thereby increasing the yield levels (WO 86/00786).

To date, there is no teaching that gums, such as carrageenan may be useful in a process of cheese making wherein the starting milk has a relatively high fat content to produce low, reduced or

179

full fat cheese, including what processing parameterswould be required to produce such cheeses.

In addition, for all cheese making processes it is important to maintain the compositional and functional characteristics of the final cheese product at a standard acceptable by the industry and consumer.

In particular, melt and flavour characteristics are important for mozzarella cheese especially for cheese made for the pizza making industry. Any method of cheese making that can provide flexibility in the functional characteristics of the endcheese product gives the cheese making industry a way of producing a wide variety of cheese having the required functional characteristics in a consistent manner. This is beneficial to the cheese making industry, large consumers such as the pizzaindustry, as well as individual consumers.

It is an object of the present invention to provide such a process and/or at least to provide the public with a useful choice.

SUMMARY OF THE INVENTION

In a first embodiment, the present invention provides a process of manufacturing cheese wherein a gum preparation is added to a milk composition before being pasteurised, the milk is then ripened with a starter culture and/or acid to produce acheese milk and the cheese milk coagulated. The coagulum is cut to separate curd from whey and the whey drained therefrom. The curd is then shaped and cooled.

In a second embodiment, the present invention provides a process of manufacturing cheese wherein a gum preparation is added to a pre-pasteurised milk composition. The milk is then ripened with a starter culture and/or acid to produce a cheesemilk and the cheese milk coagulated. The coagulant is cut to separate curd from whey and the whey drained therefrom. The curd is then shaped and cooled.

Other additives common to cheese making process may be added at any suitable stage of the above mentioned processes to alter any functional characteristic or improve flavour, texture, colour and the like, as would be understood by a person ofskill in the art.

The cheese made by the above processes may comprise soft, semihard, hard and extra hard cheeses including mozzarella whereby the mozzarella is made without a heating and stretching step.

However, more traditional mozzarella cheese making processes may be employed which include a heating and stretching step. Thus, in a third embodiment, the present invention provides a process of manufacturing a mozzarella or mozzarella-like(pizza) cheese wherein a gum preparation is added to a milk composition and the milk composition pasteurised. The milk is then ripened with a starter culture and/or acid to form a cheese milk, and the cheese milk coagulated. The coagulum is cut toseparate curd from whey and the whey drained therefrom. The curd is then heated and stretched, extruded, molded and cooled.

In a fourth embodiment, the present invention provides a process of manufacturing a mozzarella-like cheese wherein a gum preparation is added to a pre-pasteurised cheese milk composition. The milk composition is then ripened with a starterculture and/or acid to form a cheese milk, and a the cheese milk coagulated. The coagulum is cut to separate curds from whey and the whey drained therefrom. The curd is then heated and stretched, extruded, molded and cooled.

Other additives common to cheese making process may be added at any suitable stage of the above mentioned processes to alter any functional characteristic or improve flavour, texture, colour and the like, as would be understood by a person ofskill in the art.

The present invention also provides a cheese produced by the processes of the invention which surprisingly have enhanced functional properties.

In particular, the present invention is directed to a mozzarella or mozzarella-like (pizza) cheese produced by a process according to the invention that surprisingly has enhanced functional properties. By mozzarella and mozzarella-like (pizza)cheese is meant a cheese made using a

180

process of the present invention, which has stringy characteristics on melting. 

DESCRIPTION OF THE FIGURES

The present invention will now be described with reference to the figures of the accompanying drawings in which:

FIG. 1 shows a schematic drawing of the process of a first embodiment of the invention;

FIG. 2 shows a schematic drawing of the process of a second embodiment of the invention; and

FIG. 3 shows a score chart for assessing functionality of the cheese made by the process of the invention.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides an alternative process of making a cheese containing gum, whereby said gum results in an increase in moisture content and improved functional characteristics of said cheese. When the cheese is mozzarella ormozzarella-like (pizza) cheese, such functional characteristics include improved melt and sensory characteristics that are especially desirable in the pizza making industry.

Previously, gums such as carrageenan have been added in cheese making processes as fat replacers in processes for producing fat free or low fat cheese products. It was the aim of such processes to provide a low fat or fat free cheese productwhich had the same texture and flavour as their full fat cheese counterparts. In these prior art processes, the gums were added at various stages of the cheese making process, more usually at the salting stage, and often required further additives tointeract with the gums and the whey proteins. In addition, it was also a requirement of these prior art processes to begin the cheese making process with fat free or low fat (less than 0.3%) starting milk.

The process of the present invention provides for the first time, the processing parameters required to make a low, reduced or full fat cheese, including mozzarella or mozzarella-like (pizza) cheese, containing gum from a starting liquid milkcontaining is relatively normal fat content, as well as the cheeses made by the process of the invention having enhanced functional properties.

In particular gum is not added to the fat containing starting milk composition in the processes of the present invention as a fat replacer, but as a functionality enhancer and provides cheese with an increase in moisture content and enhancedfunctional characteristics. In particular, the molten or cooked mozzarella or mozzarella-like (pizza) cheese made according to the process of the invention has improved melt and flavour characteristics. Without being bound by theory, it is thought thatthe gum, in solution, is activated by heat enabling interaction with the casein before the coagulation step. In the case of the processes whereby gum is added to the starting milk before the pasteurisation step, the heat of pasteurisation is thought toactivate the gum solution. Where gum is added to a pre-pasteurised starting milk composition, a number of heating steps in the process could activate the gum. For example, when a gum solution is pre-heated (for sterilisation purposes) before beingadded to the starting milk or by the temperature of the cheese milk during coagulation or, during the heating and stretching step in embodiments which include such a step.

The description will now be limited to the process of making mozzarella or mozzarella-like cheese, but it will be understood by a skilled person that any other type of cheese may be made by the processes of the present invention.

The present invention provides a process of making mozzarella or mozzarella-like (pizza) cheese comprising the steps: a. providing a starting milk composition having a selected protein and fat composition, wherein said starting milk has a fatcontent of more than 0.3%; b. adding a gum preparation to the milk composition of step a; c. pasteurising the milk composition of step b; d. adding a starter culture and/or acid (mineral and/or organic) to the milk composition to form a cheese milk; e.coagulating the cheese milk composition; f. cutting the coagulum to separate curd and whey; g. draining away the whey from the curd; and h. shaping and cooling the curd.

Preferably, the process further comprises a step of heating and stretching the curd at a curd

181

temperature of between about 50° C. to 80° C. after step g, and before step h.

The general steps of this preferred process are set out in FIG. 1.

The starting milk may be selected from one or more of the group comprising whole fat milk; semi skimmed milk; skimmed milk; butter milk; butter milk retentate/concentrate and whey protein retentate/concentrate or from products made from milk aswould be appreciated by a person skilled in the art. One or more powders, such as whole milk powder, skimmed milk powder, whey protein concentrate powder, whey protein isolate powder and buttermilk powder or other powders made from milk, reconstitutedor dry, singularly or in combination may also be selected as the starting milk or be added to the starting milk.

The starting milk may be sourced from any milk producing animal.

The protein and fat composition of the starting milk composition is altered by a process known as standardisation to give a protein/fat ratio of between 0.5:1 and 6.0:1. The process of standardisation involves removing the variability in the fatand protein composition of the starting milk to achieve a particular end cheese composition. Traditionally, standardisation of milk has been achieved by removing nearly all the fat (cream) from the starting milk (separation) and adding back a knownamount of cream thereto to achieve a predetermined protein/fat ratio in the cheese milk. The amount of fat (cream) required to be removed will depend upon the fat content of the starting milk and the required end cheese composition. However, the cheesemilk has a fat content of at least 0.3%, preferably 0.5-6.0% fat to give concentration in the final cheese product of between about 4-30 wt %. Additionally or alternatively, the protein concentration may be altered by adding a protein concentrate such asa UF retentate or powder concentrate to a milk starting composition, or by any other method as would be appreciated by a person skilled in the art.

The gum is selected from one or more of the group comprising kappa carrageenan, iota carrageenan, lambda carrageenan, locust bean gum, alginate, xanthan, cellulose gum, guar, and any other suitable hydrocolloid.

Preferably the gum is a carrageenan and most preferably the gum is predominantly kappa carrageenan.

The gum preparation may be a dry powder or a solution. The gum preparation is preferably a solution whereby a gum powder is dispersed in either water or milk at concentrations of between about 1 and 25 wt %, preferably between about 8-12 wt %,at temperatures of between 2° C. and 30° C. to prepare a bulk gum solution. Sufficient bulk gum solution is then added to the standardised starting milk before pasteurisation to give a concentration of gum in the starting milk of betweenabout 0.005-0.25 wt %, preferably 0.010-0.2 wt %, most preferably between about 0.015-0.15 wt %. Such concentrations of gum in the staring milk result in a gum concentration in the final starting milk of approximately 1.00-100×10-3 g/g ofprotein, preferably 1.4-60×10-3 g/g of protein, most preferably 4.0-45×10-3 g/g of protein. It is has been demonstrated, surprisingly, that up to 95% of the gum present in the starting milk will be retained in the final cheeseproduct. As the gum preparation is added to the starting milk before pasteurisation in this embodiment it does not require separate pasteurisation.

Pasteurisation of the starting milk takes place under standard conditions, namely, heat treating the milk at a temperature and time sufficient to kill pathogens, (typically 72° C. for 15 seconds).

After pasteurisation, the standardised starting milk is transferred to a fermentation vat at a suitable temperature, generally chosen to prevent localised protein precipitation during acidification.

A bulk starter culture and food grade acid (at approximately 10%) are added to the starting milk in order to lower the pH of the milk to a preferred pH of about ≥5.2 to form a cheese milk. Alternatively, the pH may be lowered by starterculture alone, or by direct acidification alone as would be appreciated by a person skilled in the art.

The starter culture can be mesophilic or thermophilic or a mix and added at 0.1-2.0% (neutralised) or 0.1-6.0% (unneutralised) of the milk volume. Examples of starter cultures are: Streptococcus themophilus, Lactobacillus bulgaricus,Lactobacillus helveticus, Lactococcus lactis subspecies cremoris, Lactococcus lactis subspecies lactis.

182

The starter culture may be added to the starting milk either whilst the milk is en-route to the fermentation vat or once it is in the vat. Likewise acidification may take place either en-route or once the starting milk is in the vat.

Where direct acidification is required, sufficient food grade acid (preferably an organic acid) at an appropriate dilution is added to reduce the pH of the pasteurised standardised milk to between pH 5.2 and normal milk pH.

Once the starter culture and acid (if required) have been added, the milk is heated to its set temperature (30-44° C.) depending on the starter culture used. The starter culture may be allowed to grow and the pH to drop further beforeaddition of a coagulant such as a coagulating enzyme. Coagulating enzyme (eg chymosin in rennet, microbial rennet) may be added to the cheese milk to aid in the cheese milk being converted from a liquid to a gel or semi solid at 30° C. to42° C. as is known by those skilled in the art

After a coagulum has been formed and reached an adequate firmness, the curd is cut to give curd particles suspended in whey. The temperature of the curd and whey mixture is raised to the cook temperature at a rate of approximately 1° C./6 min and the curd and whey are then cooked at a cook temperature of between 36° C. to 44° C. The exact cook temperature will vary depending on the starter culture used and final cheese moisture targets as would be understood by aperson of skill in the art.

During the cooking phase the curd is stirred and can also be washed by draining a portion of the whey from the vat and adding back the same volume of water, or by adding back less or more water than the volume drained, or by adding water withoutdraining any whey. It is also possible to add hot water to wash and cook the curd at the same time.

The curd is cooked until a target pH is reached and the curd is then separated from the whey by allowing the whey to drain from the curd.

Through the action of the residual starter bacteria the pH of the fresh curd is allowed to drop to a target level of between 5.0-6.0. The pH can be adjusted using organic or mineral acid if required or by adding an acidity regulator (eg GluconoDelta Lactone--GDL). The time between cutting and draining is dependent on the starter system used, the cooking temperature and the draining pH target.

The drained curd may be allowed to knit together to form a `chicken-breast` structure, a process that results in a continuous mat of curd. Alternatively the curd may be dry stirred and/or pressed in block form. The time required for the curd toknit together in a solid mass is dependant on the starter system used, the cooking temperature and the milling pH target as would be understood by a skilled artisan.

At a target pH the curd is milled. Milling involves cutting the mat of cheddared curd into finger-sized pieces of curd which can be easily and effectively salted.

In more traditional mozzarella processes only a portion of the salt is added at this point or none at all. In these cases salt is added during stretching and/or brining after stretching.

If salt is added after milling, time is allowed for the salt to penetrate the curd (mellowing).

The heating and stretching step takes place at a curd temperature of between about 50° C. and 80° C. and may occur by immersing the curd in hot water or hot whey as in the traditional method, or may be heated and stretched in adry environment as described in U.S. Pat. No. 5,925,398. In either method, the curd is heated and stretched into a homogenous, plastic mass. Preferably the curd is heated to a curd temperature of between about 50° C. to 71° C. usingequipment common in the art, such as a single or twin screw stretcher/extruder type device or steam jacketed and/or infused vessels equipped with mechanical agitators (waterless cookers).

Traditionally the hot curd is immediately extruded into molds or hoops and the cheese cooled by spraying chilled water/brine onto the surface of the hoops. This initial cooling step hardens the outside surface of the block providing somerigidity. Following this initial cooling the cheese is

183

removed from the molds and placed in a salt brine (partially or completely saturated) bath for a period of time to completely cool the cheese and enable uptake of the salt to the required level. Once cooled the cheese is placed in plastic liners, air removed and the bag is sealed Alternatively, hot stretched curd may be extruded into sheet-like form and directly cooled without molding.

An alternative process sometimes used in commercial practice is to completely dry salt the curd, mellow, stretch and pack directly into plastic liners contained in hoops and the liners sealed. The hoops plus cheese are then immersed in chilledwater. Cooled cheese is stored at between 2° C. to 10° C. Once ready for use the cheese may be used directly or the block frozen or the block shredded and the shred frozen.

It is also possible to produce a mozzarella or mozzarella-like (pizza) cheese by the processes of the present invention which does not include a heat stretch step, as described in U.S. Pat. No. 5,942,263.

Other additives common to the cheese making process may be added, including non-dairy ingredients such as stabilisers, emulsifiers, natural or artificial flavours, colours, starches, water, additional gums, lipases, proteases, mineral and organicacid, structural protein (soy protein or wheat protein), and anti microbial agents as well as dairy ingredients which may enhance flavour and change the protein to fat ratio of the final cheese. Such additives may be added at any suitable step in theprocess as would be understood by a person skilled in the art. For example, salts such as calcium chloride are useful in aiding coagulation and may be added with the starter culture during coagulation. The flexibility of allowing any combination ofadditives to be added at any step in the process allow the final composition of the cheese to be precisely controlled, including the functionality characteristics.

In a further embodiment, the present invention provides a process of making a mozzarella or mozzarella-like (pizza) cheese comprising the steps: a. providing a starting milk composition having a selected protein and fat composition, wherein saidstarting milk has a fat content of more than 0.3%; b. pasteurising the milk composition of step a; c. adding a gum preparation to the milk composition of step b; d. adding a starter culture and/or acid (organic or mineral) to the milk composition to forma cheese milk; e. coagulating the cheese milk composition f. cutting the coagulum to separate curd and whey; g. draining away the whey from the curd; and h. shaping and cooling the curd.

Preferably the process further comprises a step of heating and stretching the curd at a curd temperature of between about 50° C. to 80° C. after step g and before step h.

The general steps of this process are set out in FIG. 2. The starting milk is selected and standardised as described above.

The gum is selected from one or more of the group comprising kappa carrageenan, iota carrageenan, lambda carrageenan, locust bean gum, alginate, xanthan, cellulose gum, guar, and any other suitable hydrocolloid.

Preferably the gum is a carrageenan and most preferably the gum is predominantly kappa carrageenan.

The gum preparation may be a dry powder or a solution. The gum preparation is preferably a solution whereby a gum powder is dispersed in either water or milk at concentrations of between 1 and 25 wt %, preferably 8-12 wt %, to prepare a bulk gumsolution. The bulk gum solution may be heated for sterilization purposes and/or to activate the gum before adding to the cheese milk. Sufficient bulk gum solution is then added to the standardised pre-pasteurised starting milk to give a concentrationof gum in the starting milk of between about 0.005-0.25 wt %, preferably between about 0.010-0.2 wt %, most preferably between about 0.015-0.15 wt %. Such concentrations of gum in the starting milk result in a gum concentration in the milk ofapproximately 1.00-100×10-3 g/g of protein, preferably 1.4-60×10-3 g/g of protein, most preferably 4.0-45×10-3 g/g of protein. It is expected that up to 95% of the gum preparation will be retained in the final cheeseproduct. The gum may be added to the pasteurised starting milk either en-route to the fermentation vat or once the pasteurised starting milk has been transformed in the vat.

The coagulation, cutting, draining, heating, stretching, shaping, packaging, etc steps are carried out

184

as described above. In addition, as discussed above, the cheese may be produced without a heating and stretching step as described in U.S. Pat. No. 5,942,263.

Again, other additives common to the cheese making industry may be added to control the final functionality characteristics of the cheese product. Such additives include non-dairy ingredients such as stabilisers, emulsifiers, natural orartificial flavours, is colours, starches, water, additional gums, lipases, proteases, mineral and organic acid, structural protein (soy protein or wheat protein), and anti microbial agents as well as dairy ingredients which may enhance flavour andchange the protein to fat ratio of the final cheese. Such additives may be added at any suitable step in the process as would be understood by a person skilled in the art. For example, salts such as calcium chloride are useful in aiding coagulation andmay be added with the starter culture during coagulation.

In a further embodiment, the present invention provides a mozzarella or mozzarella-like cheese product produced by the processes of the invention. Such cheese has improved functionality characteristics on cooking including: decreased blistersize increased blister coverage whiter background colour (of the melted cheese) a more tender mouthfeel while retaining good stretch characteristics reduced oiloff reduced transparency

In addition the inclusion of the gum in the process of the present invention: increased cheese yield (total kg cheese) improved shredability/diceability increased the window of functional acceptance.

The present invention also provides a food product comprising the mozzarella or mozzarella-like cheese of the present invention, such as a pizza.

Any ranges mentioned in this patent specification are intended to inherently include all of the possible values within the stated range.

This invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, and any or all combinations of any two or more of said parts,elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which this invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.

The invention consists in the foregoing and also envisages constructions of which the following gives examples.

General Manufacturing Protocol

Starting milk (with varying protein to fat ratios, typically 1.3) was pasteurised (72 C/15 s) and various gums at varying concentrations (eg Gelcarin CH7352, a commercial kappa carrageenan product supplied by FMC, 6-10% dispersed in milk orwater) was added to the milk before or after pasteurisation as set out below for each example. A range of starter milk gum concentrations were evaluated (typically 0.025%).

A culture of lactic acid producing bacteria plus dilute acetic acid was added to the pasteurised milk and gum compositions to bring the pH down to 6.10-6.20 to produce a cheesemilk. The cheesemilk was heated to 36° C. and a coagulant(Chymax or Fromase) was added and the cheesemilk allowed to set. The coagulum was cut and stirred for approximately 35-50 minutes and then the whey was drained from the curd. The curd was then allowed to knit together for approximately 45-60 minutesand then milled. Sufficient salt was added to the milled curd to reach a target of 1.4% in the final cheese. After mellowing the salted curd was stretched at curd temperature of 58-60° C., packaged and molded and cooled in chilled water. Finalcheese was stored at approximately 5° C. until ready for functionality evaluation.

Example 1

Mozzarella/Mozzarella-Type Cheese Made where Gum has been Added Prior to Pasteurisation

In this example 4 cheeses were made according to the protocol described above. Cheeses 1 and 3 were the control cheeses where no gum was added. In cheeses 2 and 4, Gelcarin CH7352 was added to the starter milk (0.025%) before pasteurisation. Composition and functionality results for

185

these cheeses are shown in Tables 1 & 2 respectively.

TABLE-US-00001 TABLE 1 Chemical composition Cheese No. 1 2 3 4 Fat (%) 21.0 20.0 21.5 19.5 Moisture (%) 46.9 48.6 47.3 49.3 Salt (%) 1.27 1.32 1.36 1.39 PH 5.44 5.47 5.48 5.50

TABLE-US-00002 TABLE 2 Functionality* Age of cheese tested 6 weeks 4 weeks Cheese No. 1 2 3 4 Blister 5-10 20-25 10-15 10-15 coverage (%) Blister size 5-10 5-10 5-10 0-5 (on (mm) average smaller than control) Background White/pale Whiter thanWhite/pale Whiter than colour yellow control yellow control, greater yield, less transparency Melt Complete, Complete, Complete Complete sauce colour no sauce showing colour through showing through Oil Off Slight Less that Slight Less than controlcontrol Stretch 300 >400 >400 300-400 length (mm) Stretch Fibrous/ Fibrous Slightly Fine type webby fibrous Tenderness Initially Initially Initially Initially tender, goes tender, tender, goes tender, less slightly breaks down tough, mealy on chewyon in the mouth chewy and chewing and further on further mealy on breaks down chewing chewing and further in the mouth. although more tender chewing some than control breakdown in mouth Flavour Bland Bland Bland Bland *Functionality assessed by pizzatest. Pan base, 140 g sauce, 305 g cheese, baked for 7 min at 250° C.

Example 2

Mozzarella/Mozzarella-Like Cheese Made where Gum was Added Prior to Pasteurisation

Five cheeses (5 Controls and 5 experimental) were made using the manufacturing protocol as described above, and the functionality assessed using the pizza test as above, when the cheeses were 6 weeks old, and again when the cheeses were 9-12weeks old. The description of the functional parameters as set out in Table 2, was replaced by a score system in this and later examples in an attempt to more easily compare control and test cheese batches and also to enable the scores of multipleanalyses to be averaged out. The score sheet used to assess functionality is set out in FIG. 3.

The assessment of functionality for these cheeses is shown below in Table 3. Each score is an average of the functional scores for five cheeses.

TABLE-US-00003 TABLE 3 Functionality Age of cheese tested 6 weeks 9-12 weeks Cheese type Control 0.025% gum* Control 0.025% gum* Blister size 5.64 4.02 6.80 4.02 Background colour 6.78 4.88 7.06 4.88 Oil Off 2.70 2.16 2.94 2.54 Tenderness in3.60 4.72 3.38 5.48 mouth Tenderness on chew 4.16 5.64 3.74 5.94 Moisture content 49.00 50.58 49.00 50.58 (%) *kappa carrageenan

Results

From the results set out in the functionality Tables 2 and 3 above, it will be seen that the mozzarella cheese made according to the process of the present invention, whereby 0.025 wt % kappa carrageenan was added to the standardised cheese milkprior to pasteurisation, having a protein:fat ratio of 1.3 and initial fat content of approximately 2.6%, resulted in a cheese having improved functionality parameters as compared with a control cheese made without added gum. In particular, blistercoverage, blister size, background colour, melt, oil off, stretch length, stretch type and moisture content were all improved in a standard in-house pizza test (details of which are available upon request). The beneficial properties of gum containingcheese increased when tested in mozzarella aged 9-12 weeks compared to 6 week old cheese (Table 3).

Example 3

Mozzarella Cheese Made with Different Types of Gum

The manufacturing protocol was as described above, and the functionality of each single cheese made, tested by the pizza test as above when the cheeses were 9 weeks old. The score results in Table 4, below are the average of 3 evaluators.

TABLE-US-00004 TABLE 4 Functionality Cheese type Control K-C LBG Guar Blister coverage 5.8 4.6 5.2 3.6 Blister size 4.0 2.2 3.8 3.0 Blister colour 4.6 4.8 5.2 5.0 Background colour 6.4 4.8 6.2 5.8 Melt appearance 4.0 3.8 3.4 3.8 Oil Off 2.4 2.23.4 3.0 Stretch length 7.8 7.0 6.2 5.0 Stretch

186

type 4.8 4.8 3.2 4.4 Tenderness in mouth 3.8 4.4 3.0 3.0 Tenderness on chew 4.8 6.2 3.2 3.0 Moisture content (%) 48.8 51.1 49.7 51.9 All gums: K-C = Kappa carrageenan LBG = Locus bean gum Guar = Guar gumadded before pasteurisation at a concentration of 0.025 wt % in the cheese milk.

Results

From the results set out above in Table 4, it will be seen that all of the gums resulted in mozzarella cheese having improved functionality, and particularly a decreased blister size, decreased background colour and increased moisture contentthan the control cheese. K-carageenan overall gave the most pronounced effects.

Example 4

Mozzarella Cheese Made with Different Amounts of Kappa Carrageenan

The manufacturing protocol was as described in Example 1 above, and the functionality of each single cheese made was tested by the pizza test, as described above, when the cheeses were 12 weeks old. The score results in Table 5, below are theaverage of 3 evaluators.

TABLE-US-00005 TABLE 5 Functionality Cheese type Control 0.015 wt % K-C 0.020 wt % K-C 0.025 wt % K-C 0.030 wt % K-C Blister coverage 6.0 5.3 5.3 6.0 6.0 Blister size 6.0 4.7 4.0 4.0 4.0 Blister colour 6.3 6.0 6.0 6.3 3.3 Background colour 7.05.3 5.0 5.0 5.3 Melt appearance 5.7 5.7 5.7 5.7 5.7 Oil off 3.0 3.0 3.0 2.7 2.7 Stretch length 10.0 9.7 9.0 9.3 8.7 Stretch type 5.0 5.3 6.3 6.7 6.3 Tenderness in mouth 4.3 4.7 6.0 7.0 6.7 Tenderness on chew 5.7 6.0 6.3 6.7 7.7 Moisture content (%) 49.049.3 50.1 50.6 51.7

Results

From the results set out above in Table 5, it will be seen that increasing the level of gum added to the starting milk resulted in mozzarella cheese having increasingly improved functionality parameters. In particular, increased moisturecontent, decreased blister size, background colour (whiter), oil off and improved tenderness (initially and on chewing) resulted with increasing amounts of gum.

Example 5

Mozzarella Cheese Made with Mixtures of Gums

The manufacturing protocol was as described above, and the functionality of each single cheese made was tested by the pizza test, as described above, when the cheeses were 9 weeks old. The score results in Table 6, below, are the average of 3evaluators.

TABLE-US-00006 TABLE 6 Functionality K-C/LBG K-C/LBG K-C/Guar K-C (0.017/0.05 (0.017/0.008 (0.017/0.008 Cheese type (0.025%) wt %) wt %) wt %) Blister coverage 4.7 4 4.0 3.7 Blister size 2.3 2.7 4.0 2.7 Blister colour 6.0 6.0 6.0 6.0 Background4.7 4.7 5.0 5.0 colour Melt appearance 4.0 4 4.3 4.3 Oil Off 2.3 2.3 2.7 2.7 Stretch length 9 8.7 9.0 8.0 Stretch type 5.7 5.7 6.3 6.3 Tenderness in 5.3 5.7 5.3 5.3 mouth Tenderness on 6 6.7 6.0 6.3 chew Moisture content 49.5 50.4 49.6 50.4 (%)

Results

From the results set out above in Table 6, it will be seen that the various gum mixtures added to the starting milk resulted in improved functional characteristics in mozzarella cheese, similar in magnitude to those produced with kappacarrageenan alone.

Example 6

Mozzarella Cheese Made with Different Fat Levels in Cheese Milk

The manufacturing protocol was as described above except that the fat in the starting cheese milk varied as set out in Table 7 below. Functionality of each single cheese made was tested by using

187

the pizza test, as described above, on cheesesthat were 9 weeks old. The score results in Table 7, below, are the average of 3-5 evaluators.

TABLE-US-00007 TABLE 7 Functionality Cheese type Control 0.025:K-C Control 0.025:K-C % fat in cheese milk 2.54 2.54 1.63 1.63 Blister coverage 7.0 6.0 9.0 7.7 Blister size 7.0 3.7 9.3 6.0 Blister colour 6.7 5.7 6.7 5.0 Background colour 7 4.77.0 4.7 Melt appearance 5.3 4.0 6.3 4.0 Oil Off 3.0 2.7 1.3 1.3 Stretch length 8.0 8.3 5.3 7.0 Stretch type 3.0 4.3 3.0 4.7 Tenderness in mouth 3.3 5.0 2.7 4.0 Tenderness on chew 3.0 6.3 2.0 4.3 Moisture content (%) 48.2 50.3 51.1 51.5 % fat in cheesemilk 0.53 0.53 3.89 3.89 Blister coverage 0 0 3.6 3.0 Blister size 0 0 3.4 1.8 Blister colour 1.2 1.2 5.8 5.2 Background colour 5.2 4.4 6.0 4.6 Melt appearance 1.6 2.0 6.0 6.4 Oil Off 1.0 1.0 6.2 3.2 Stretch length 3.2 5.8 7.6 6.8 Stretch type 2.0 2.85.8 6.6 Tenderness in mouth 2.0 2.6 4.6 5.4 Tenderness on chew 2.0 2.6 5.4 6.2 Moisture content (%) 54.4 55.6 43.2 46.3

Results

From the results set out above in Table 7, it will be seen that in general within each pair of fat levels where gum was added, there were overall improvements in functionality of the mozzarella cheese. In particular, blister coverage, blistersize, background colour, oil off all decreased whilst tenderness (initially and on chewing) improved. Because of the low fat content of the Mozzarella made from the 0.53% fat containing milk, the surface of the molten cheese was heavily scabbed (noindividual blisters) hence 0 scores for blister size and coverage. However background colour decreased in these cheeses and tenderness (initially and on chewing) improved in the low fat cheese with added gum compared to its Control. In all cases wheregum was added cheese moisture (%) increased.

Example 7

Mozzarella Cheese Made by Adding Gum (0.025 wt % Kappa Carrageenan) Before and After Pasteurisation

The manufacturing protocol was as described above. Functionality of each single cheese made was measured using the pizza test, as described above, on 12 week old cheeses. The score results in Table 8, below, are the average of 3 evaluators.

TABLE-US-00008 TABLE 8 Functionality Gum added before Gum added after Cheese type Control pasteurisation pasteurisation Blister coverage 6.0 5.3 4.7 Blister size 6.6 4.0 3.7 Blister colour 6.3 6.3 5.3 Background colour 7.3 5.0 5.0 Meltappearance 5.6 4.7 4.7 Oil Off 3.6 2.3 3.3 Stretch length 9.6 7.7 8.3 Stretch type 6.0 6.7 5.3 Tenderness in mouth 3.3 6.3 6.7 Tenderness on chew 4.0 6.7 5.7 Moisture content (%) 47.9 49.4 49.8

Results

From the results set out above in Table 8, it will be seen that gum added before and after pasteurisation resulted in mozzarella cheese with reduced blister size, blister cover and oil off and improved tenderness (both initially and on chewing)in the pizza test compared to the control. Background colour was also reduced where the gum was added before or after pasteurisation.

Example 8

Comparison of Mozzarella Cheese Made by Adding Different Levels of Guar Gum Before and After Pasteurisation

The manufacturing protocol was as described above. Functionality was measured using the pizza test on 6 week old cheeses. The score results below in Table 9 are the average of 5 evaluators.

TABLE-US-00009 TABLE 9 Functionality Before pasteurisation After pasteurisation Cheese type Control 0.15% Guar Control 0.15% Guar Blister coverage 4.2 4.4 4.2 6.0 Blister size 4.2 3.2 4.2 5.2 Blister colour 6.4 6.4 6.4 7.0 Background colour 7.65.6 7.6 7.6 Melt appearance 5.2 4.2 5.2 4.6 Oil Off 3.8 3.0 3.8 1.8 Stretch length 9.0 6.4 9.0 7.4 Stretch type 4.6 4.2 4.6 4.2 Tenderness in mouth 3.0 3.0 3.0 3.0 Tenderness on chew 3.8 4.0 3.8 3.4 Moisture content (%) 48.1 50.8 48.1 52.2

Results

188

From the results set out above in Table 9, it will be seen that gum added (0.15% guar) before and after pasteurisation increased the moisture content of the final cheese and reduced oil off. Blister size and background colour was also reducedwhen the gum was added before pasteurisation.

Example 9

Comparison of Mozzarella Cheese Made Using Different Fat Levels and 0.025 wt % Kappa Carrageenan Before and After Pasteurisation

The manufacturing protocol was as described above. Functionality was measured using the pizza test on 6 week old cheeses. The score results below in Table 10, are the average of 5 evaluators.

TABLE-US-00010 TABLE 10 Functionality Before pasteurisation After pasteurisation Cheese type Control 0.5% fat 3.89% fat Control 0.5% fat 3.89% fat Blister coverage 0 0 3.0 3.6 0 3.2 Blister size 0 0 1.8 3.4 0 2.4 Blister colour 1.2 1.2 5.2 5.81.2 5.4 Background colour 5.2 4.4 4.6 6.0 4.4 5.2 Melt appearance 1.6 2.0 6.4 6.0 2 6.8 Oil Off 1.0 1.0 3.2 6.2 1 6.6 Stretch length 3.2 5.8 6.8 7.6 6.2 8 Stretch type 2.0 2.8 6.6 5.8 3.4 6 Tenderness in mouth 2.0 2.6 5.4 4.6 2.6 5.4 Tenderness on chew2.0 2.6 6.2 5.4 3.2 6 Moisture content (%) 54.4 55.6 46.3 43.2 56.3 45.4

Results

From the results set out above in Table 10, it will be seen that, within a fat level and with the exception of oil off in the high fat version, cheese made where the gum was added before or after pasteurisation gave similar improvements infunctional characteristics.

CONCLUSIONS

The present invention provides a process of making mozzarella cheese whereby gum is added to the staring milk before or after pasteurisation. Such a process results in improved functionality characteristics of the gum containing cheeses. Gumadded at various levels, to milks with a range of fat contents, before or after pasteurisation, increases moisture levels in the final cheese and reduces blister size, blister cover, oil off and transparency of the molten cheese on a pizza. Backgroundcolour of the molten cheese is whiter and tenderness (initially and on chewing) is improved. In addition cheese yield (moisture) and the window of functional acceptance is increased and shredability and diceability improved by the addition of gums.

INDUSTRIAL APPLICATION

The processes of the present invention and cheese made using the processes have commercial application in the pizza making industry that utilises mozzarella and mozzarella-like (pizza) cheese in significant quantities.

It will be appreciated that it is not intended to limit the invention to the above examples only, many variations, such as might readily occur to a person skilled in the art being possible without departing from the scope of the appended claims.

4.This invention relates to a cheese-making process.

BACKGROUND ART

In the production of cheese it is necessary to coagulate the cheese-milk to be able to separate the cheese-matters e.g. casein from the whey. Products containing the proteolytic enzyme chymosin, which is a milk-coagulating enzyme isolated fromthe fourth stomach of calf, have for many years been used for this purpose. Shortage of calf stomachs has in the last decades resulted in intense research for other milk-coagulating enzymes. Today also bovine pepsin, porcine pepsin as well as microbialenzymes are used commercially. All these known milk-clotting enzymes are characterized by having specificity for the peptide bond between residues 105 (phenylalanine) and 106 (methionine) or a bond adjacent to that in κ-casein. This means that byemploying these enzymes in cheese-making, the κ-casein is split at the junction between para-κ-casein and the macro-peptide moiety called glyco-macro-peptide (GMP) carrying the negative charges. When this occurs the macro-peptide diffusesinto the whey, its stabilizing effect on the casein micelles is lost, and the casein micelles can start to aggregate once sufficient of their κ-casein has been hydrolysed. For

189

further elaboration on the enzymatic coagulation of milk see e.g. D. G.Dalgleish in Advanced Dairy Chemistry vol 1 ed by P. F. Fox Elsevier, London, 1992.

It is an object of this invention to provide a novel cheese-making process using a different enzyme from known methods. It is also an object of the invention to provide a method having a higher cheese yield.

SUMMARY OF THE INVENTION

In this invention it is surprisingly found that it is not necessary to hydrolyse the peptide bond between residue 105 phenylalanine and residue 106 methionine or a bond adjacent to that in κ-casein to effect clotting of cheese-milk. It wassurprisingly found that a deglycosylation of κ-casein will lead to clotting as it are the sugars associated with κ-casein that carry the negative charge which stabilise the casein micelles. Clotting of the milk in this way results in aprocess in which a larger part of the κ-casein is retained in the cheese and a higher yield can be obtained than using proteolytic activity of chymosin.

Accordingly, the invention provides a novel process for making cheese, comprising: a) adding to milk a carbohydrase selected from the group consisting of α-galactosidase, N-acetyl-galactosaminidase and neuraminidase, b) incubating so as topartially deglycosylate κ-casein in the milk, and c) during or after step b) conditions causing clotting of the milk. The novel method, described in the invention, will also lead to higher cheese yield as compared to the traditional cheese makingprocesses in which the clotting is the result of proteolytic activity of enzymes like chymosin.

DETAILED DISCLOSURE OF THE INVENTION

Cheesemaking

Any type of milk, in particular milk from ruminants such as cows, sheep, goats, buffalos or camels, may be used as the starting material in the process of the invention, e.g. as reconstituted milk, whole milk, concentrated whole milk or low fatmilk. The milk may be concentrated in various ways such as by evaporation or spray-drying, but is preferably concentrated by membrane-filtration, i.e. ultra-filtration in which molecules with a molecular weight of up to 20,000 Dalton are allowed to passthe membrane, optionally with dia-filtration before or after ultra-filtration in which molecules of a molecular weight of up to 500 Dalton are allowed to pass the membrane. For a more detailed description of the ultra-filtration process, see forinstance Quist et al., Beretning fra Statens Meieriforsog, 1986.

A starter culture may be added to the milk before or simultaneously with the addition of the coagulation inducing enzyme described in the present invention. The starter culture is a culture of lactic acid bacteria used, in conventionalcheese-making, to ferment the lactose present in the milk and to cause further decomposition of the clotted casein into smaller peptides and free amino acids as a result of their production of proteases and peptidases. The starter culture may be addedin amounts which are conventional for the present purpose, i.e. typically amounts of about 1 *E4 to 1 *E5 bacteria/g of cheese-milk, and may be added in the form of freeze-dried, frozen or liquid cultures. When the milk employed in the process of theinvention is concentrated milk, it is preferred to add the starter-culture after concentrating the milk, although this is not an absolute requirement, as the starter-culture bacteria will be retained during filtration.

After adding the enzyme giving cause to clotting as described in the present invention the subsequent steps in the cheese-making process, i.e. further salting, pressing, and ripening of the curd, may be conducted in the traditional way ofproducing cheese, e.g. as described by R. Scott, Cheesemaking in Practice, 2nd Ed., Elsevier, London, 1986.

It is at present contemplated that cheese may advantageously be prepared by the process of the invention with increased cheese yield, compared to the traditional processes in which proteolytic enzymes are used. This is of significant economicand industrial interest. The expected increase in cheese yield can be approximated as follows. Caseins are the major protein components that make up the cheese matrix; globular milk proteins like β-lactoglobulin are retained in the whey during thecheese making process. Caseins are present in milk in the following concentrations expressed as grams per 100 g dry protein: αS1 31, αS2 8, β 28, κ 10, γ 2.4 (for reference see: Walstra et al,

190

(1999) Dairytechnology, pages 80-81, Marcel Dekker Inc., New York). Coagulation during cheese making is initiated by proteolytic cleavage of a specific bond in κ-casein (molecular weight 19.5 kDalton), leading to the formation of two smaller proteins:para-κ-casein (MW 12.5 kDalton) that is included in the cheese matrix and the glyco-macro-peptide (GMP, 7 kDalton) that is lost in the whey. When deglycosylation of κ-casein is used to initiate the coagulation process instead of theproteolytic cleavage by e.g. chymosin, the GMP is not cleaved off and is therefore not lost in the whey but is retained in the cheese matrix. This would increase the amount of casein protein included in the cheese matrix by 4.7% for the deglycosylationprocess as compared to the proteolytic process. This, in turn, will lead to an increase in cheese yield. The actual increase in cheese yield will of course depend on factors like processing conditions and composition of the cheese milk and is difficultto predict exactly.

Carbohydrase

The carbohydrase used in the process of the invention is an α-galactosidase, a galactosaminidase or a neuraminidase.

α-galactosidase (EC 3.2.1.22) may be derived from an Aspergillus species like a strain of Aspergillus niger or Aspergillus aculeatus. One example is the commercial product Alpha-Gal (product of Novo Nordisk A/S), another example in thecommercial product Sumizyme ACH (product of Shin Nihon Co., Ltd.)

N-acetyl-galactosaminidase may be α-N-acetylgalactosaminidase (EC 3.2.1.49) or β-N-acetylgalactosaminidase (EC 3.2.1.53). It may be derived from jack beans (Canavalia ensiformis). Neuraminidase (EC 3.2.1.18) may be derived from astrain of Clostridium perfringens.

In a preferred embodiment, two or three of the above enzyme activities are used together to remove more carbohydrate from the κ-casein. Typical reaction conditions are 5-30 minutes at 20-40° C. 

LEGEND TO THE FIGURE

FIG. 1: Overlaid and back ground corrected chromatograms of the clear supernatants of the κ-casein-solutions after incubation with Maxiren, Sumizyme ACH or without enzyme additions. For experimental details, see text of example 5.

EXAMPLE 1

Miniature cheeses were produced as described by Shakeel-Ur-Rehman et al. (Protocol for the manufacture of miniature cheeses in Lait, 78 (1998), 607-620). Raw cows milk was pasteurised by heating for 30 minutes at 63° C. The pasteurisedmilk was transferred to wide mouth plastic centrifuge bottles (200 ml per bottle) and cooled to 31° C. Subsequently, 0.72 ml of starter culture DS 5LT1 (D$M Gist B. V., Delft, The Netherlands) was added to each of the 200 ml of pasteurised milkin the centrifuge bottles and the milk was ripened for 20 minutes. Than, CaCl2(132 μl of a 1 mol.l-1 solution per 200 ml ripened milk) was added, followed by addition of the coagulant (0.04 IMCU per ml). The milk solutions were held for40-50 minutes at 31° C. until a coagulum was formed. The coagulum was cut manually by cutters of stretched wire, spaced 1 cm apart on a frame. Healing was allowed for 2 minutes followed by gently stirring for 10 minutes. After that, thetemperature was increased gradually to 39° C. over 30 minutes under continuous stirring of the curd/whey mixture. Upon reaching a pH of 6.2 the curd/whey mixtures were centrifuged at room temperature for 60 minutes at 1,700 g. The whey wasdrained and the curds were held in a water bath at 36° C. The cheeses were inverted every 15 minutes until the pH had decreased to 5.2-5.3 and were then centrifuged at room temperature at 1,700 g for 20 minutes. After further whey drainage thecheeses were weighed. The cheese yield was calculated as follows: Cheese yield (%)={(cheese weight)/(total milk weight)}*100%.

EXAMPLE 2

The milk clotting activity of the commercial Aspergillus niger derived α-galactosidase preparation Sumizyme ACH, (Shin Nihon Chemical Co., lot nr 91-1221) was determined in IMCU (International Milk Clotting Unit) according to theinternational IDF (International Dairy Federation) standard 157A:1997. The activity of the commercial α-galactosidase preparation was determined at 13.9

191

international milk-clotting units (IMCU) per gram of the product.

EXAMPLE 3

The a-specific proteolytic activity of the commercial α-galactosidase Sumizyme ACH was determined using two independent methods. Sumizyme ACH (lot nr. 91-1221) was dissolved to an end concentration of 25 mg/ml in buffer (20 mM NaPlcontaining 50 mM NaCl, pH7.0). In the first method, proteolytic activity was determined using casein resorufin labelled (obtained from Roche Applied Sciences) as the substrate. Proteolytic activity in 100 μl of the Sumizyme ACH sample was determinedaccording to the method provided by the supplier of the labelled casein at pH7.0. No significant colour formation could be observed after incubation at 37° C. for 30 minutes, demonstrating the absence of any significant proteolytic activity inthe Sumizyme ACH preparation under the assay conditions. In the second method, 8 μl of the Sumizyme ACH solution was spotted on a photographic gelatin film (AGFAPAN APX100, obtained from AGFA). The film was incubated in a moisture regulatedcompartment at 37° C. for 30 minutes. The absence of any clearing zones after rinsing the film with water indicated absence of significant proteolytic activity. Both protease assays failed to show any significant proteolytic activity in theSumizyme ACH preparation.

EXAMPLE 4

Mini cheeses were produced using Sumizyme ACH (lot nr. 91-1221) according to the procedure described in example 1. The commercial rennet Maxiren (DSM Gist B V, Delft, The Netherlands) was used as the control. This rennet is known for itsexcellent cheese making properties showing good taste and high yields. Two independent experiments using different milk batches were performed for each coagulant. Experimental results are shown in table 1:

TABLE-US-00001 TABLE 1 Experimental results of the preparation of mini-cheeses in two independent experiments using Maxiren or Sumizyme ACH as the coagulant. Weight Weight Average Standard Cheese milk Cheese Yield yield deviation nr (grams)(grams) (%) (%) (%) Experiment 1 Maxiren 1 205.67 24.98 12.146 12.14 0.25 2 206.09 25.06 12.160 3 204.72 24.10 11.772 4 207.19 25.84 12.472 Sumizyme 5 204.65 25.04 12.236 12.27 0.23 ACH 6 205.92 25.09 12.184 7 204.76 24.60 12.014 8 204.82 25.90 12.645Experiment 2 Maxiren 8 205.35 27.42 13.353 13.11 0.24 9 205.12 26.39 12.866 Sumizyme 10 206.11 28.29 12.726 13.40 0.32 ACH 11 205.49 26.88 13.081

The numbers in the table above show that cheese can be obtained in excellent yields using α-galactosidase (Sumizyme ACH) instead of chymosin (Maxiren). The cheese yield obtained with α-galactosidase is at least comparable to theyield obtained with the efficient and reknown coagulant chymosin. The cheese yields after deglycosylation tend to be higher than the ones obtained via proteolysis, suggesting improved cheese yield. A yield increase for the deglycosylation-route wouldbe in line with theoretical calculations as described in the text of this invention.

EXAMPLE 5

Purified κ-casein (obtained from Sigma) was dissolved to an end concentration of 3.3 mg/ml in 20 mM Tris.HAc, pH 6.5. Separate solutions were prepared to which either α-galactosidase (Sumizyme ACH) or chymosin (Maxiren) were added,each to an end concentratrion of 0.04 IMCU/ml. In a control experiment no enzyme was added. The samples were incubated at 32° C. for 30 minutes. Precipitate was formed between 1-3 minutes after enzyme addition in all solutions except for thecontrol experiment. Samples of 10 μl of the clear supernatants were subjected to HPLC size exclusion chromatograhy, using a TSK3000 column (obtained from TosoHaas) using a buffer containing 0.1M NaPl and 0.2M NaCl (pH7.0) as the eluent at a flowrate of 1.0 ml/minute and using UV detection (280 nm). Chromatograms were recorded for all three solutions. In case precipitate was formed this was removed from solution by centrifugation. Liquid Chromatography--Mass spectra (LC/MS) analyses wererecorded for the supernatants as follows. LC/MS was performed using an ion trap mass spectrometer (LCQ classic, Thermoquest, Breda, The Netherlands) coupled to a P4000 pump (Thermoquest, Breda, the Netherlands) in characterising the κ-caseinsupernatant solutions. The peptides formed were separated using a PEPMAP C18 300A (MIC-15-03-C18-PM, LC Packings, Amsterdam, The Netherlands) column in combination with a gradient of 0.1% formic acid in Milli Q water (Millipore, Bedford, Mass.,USA; solution A) and 0.1% formic acid in acetonitrile (solution B) for elution. The gradient started at 90% of solution A and increased to 40% of solution B in 45 minutes and was kept at the latter ratio for another 5

192

minutes. The injection volume usedwas 50 μl, the flow rate was 50 μl/min and the column temperature was maintained ambient. The protein concentration of the injected sample was approx. 50 μg/ml.

Detailed information on the individual peptides was obtained by using the "scan dependent" MS/MS algorithm, which is a characteristic algorithm for an ion trap mass spectrometer.

Full scan analysis was followed by zoom scan analysis for the determination of the charge state of the most intense ion in the full scan mass range. Subsequent MS/MS analysis of the latter ion resulted in partial peptide sequence information,which could be used for database searching using the SEQUEST application from Xcalibur Bioworks (Thermoquest, Breda, The Netherlands). Databanks used were extracted from the OWL.fasta databank, available at the NCBI (National Centre for Biotechnologyinformatics), containing bovine caseines only for this particular application.

Mass spectrometrix analysis of the clear supernatant solution after incubation with Maxiren showed a somewhat heterogeneous peak with a lower mass limit at approximately 6700 Dalton, most probably being the κ-casein derived GMP (residuesnr. 106-169), but to large to identify by MS/MS fragmentation and database searching. After digestion of this peptide using the endo-protease endo Asp-N, only three peptides were generated, which could be identified to cover the κ-casein aminoacid sequence 106-169, by using databank searching. This unambiguously identified the GMP in the supernatant solution.

The resulting chromatograms of the clear solutions, corrected for background, are shown in FIG. 1.

The blanc experiment shows a strong peak in the chromatogram for the intact κ-casein. After incubation with chymosin (Maxiren), the κ-casein peak has completely disappeared, indicating its quantitative precipitation. Massspectrometric analysis of the clear supernatant solution after incubation with Maxiren showed a somewhat heterogeneous peak with a lower mass limit at approximately 6700 Dalton, most probably being the κ-casein derived GMP (residues nr. 106-169),but to large to identify by MS/MS fragmentation and database searching. After digestion of this peptide using the endo-protease endo Asp-N, only three peptides were generated, which could be identified to cover the κ-casein amino acid sequence106-169, by using databank searching. This unambiguously identified the GMP in the supernatant solution.

After incubation of κ-casein with α-galactosidase (Sumizyme ACH), the κ-casein peak has completely disappeared, similar to what was observed for chymosin (see FIG. 1). In this case, however, the mass spectrometric analysisshowed complete absence of the GMP in the supernatant, as expected. This example therefore shows that deglycosylation can be used to strongly reduce the solubility of κ-casein in aqueous solutions offering a route for enzyme mediated coagulationof κ-casein containing casein micelles resulting in cheese making (as described in example 4). The deglycosylation of κ-casein will obviously result in a higher amount of casein incorporation in the cheese compared to the chymosin (or otherprotease coagulants) mediated proteolytic process. Therefore, the novel cheese making process will give increased cheese yield with a theoretical maximum increase of 4.7%, the actual cheese yield depending on process parameters during the cheese makingprocess.

ionCROSS REFERENCES TO RELATED APPLICATIONS

Ads by GoogleLevel Chamber Radarwww.mac-weld.com  Made to B31.3 CODE with CRN for Canada

5.This application is a 371 of International Patent Application No. PCT/JP02/10332, filed on Oct. 3, 2002, and claims priority to Japanese Patent Application No. 2001-335571, filed on Oct. 31, 2001.

TECHNICAL FIELD

The present invention relates to a process for producing cheese curd, more specifically, relates to a process for improving a yield of cheese curd by carrying out an enzyme reaction of a milk-clotting enzyme upon raw material milk at a lowtemperature in combination with the enzyme reaction of a

193

transglutaminase (occasionally referred to hereinafter simply as "TG"). In addition, the present invention relates to cheese prepared by using cheese curd obtainable by such a way.

BACKGROUND ART

According to an technical committee of FAO, "cheese" is defined as a fresh product or a matured product obtained by coagulating milk, cream, skimmed milk or partially skimmed milk, butter milk, or a partial or total combination of these products,followed by discharging whey ("Dairy product manufacture I," edited by the Editing Committee for Dairy Technology Series Books, 1st ed.; Oct. 30, 1963, Asakura Syoten, Tokyo).

Cheese is roughly classified into natural cheese and processed cheese. The former refers to a fresh product, which has been produced by adding a lactic acid bacterium or a milk-clotting enzyme for curdling, or the matured products thereof. Onthe other hand, the latter refers to natural cheese which has been processed in such manners wherein the natural cheese is heat-melted and emulsified. Natural cheese is further classified into that produced via a maturing step, such as super hardcheese, hard cheese, semi hard cheese, soft cheese, or the like, and fresh cheese produced without maturing step.

In cheese manufacture, a characteristic step is a curdling step achieved with a milk-clotting enzyme. Naturally, in consideration of the above-described definition of cheese, cheese can be produced by coagulating milk without a milk-clottingenzyme. However, insofar as the present invention is concerned, cheese refers to the one produced by using a milk-clotting enzyme for curdling.

The milk-clotting enzyme is, as known well, called rennet or chymosin which is obtainable by extracting from the abomasum of a calf. In addition, there is rennet derived from other origins such as microorganisms.

A curdling reaction by a milk-clotting enzyme is based on a very fine and sophisticated principle. Milk to be subjected to the curdling reaction (raw material milk) includes bovine milk, goat milk, buffalo milk, reindeer milk, donkey milk, camelmilk, and the like. However, not only these whole milk, but also partially skimmed milk, skimmed milk, or powder milks prepared by drying can be used. In each milk, the main component of the protein constituting raw material milk is casein. Thereaction of casein caused by a milk-clotting enzyme is an important step for curdling.

Casein is roughly classified into α-, β-, and κ-caseins and, in milk, α- and β-caseins are localized inside and κ-casein is localized outside to make a casein micelle structure through calcium. That is,κ-casein is exposed outside the casein micelle. κ-Casein is a protein containing a sugar and having a molecular weight of about 19000, and has the hydrophilic portion and the hydrophobic portion. The hydrophobic portion is located insideand the hydrophilic portion is outside, and therefore, the casein micelle exists stable in milk.

The milk-clotting enzyme is a protease having a very high substrate specificity, and cleaves the bond between phenylalanine which is the 105th amino acid and methionine which is the 106th amino acid, both from the N terminal of κ-casein. This cleaved point is the boundary point between the hydrophilic portion and the hydrophobic portion. Hence, by the enzymatic reaction of the milk-clotting enzyme, the hydrophilic portion is separated from the κ-casein, and the hydrophobic portionis exposed outside the casein micelle. Individual hydrophobic portions aggregate gradually one another by their interaction to become more instable by the presence of calcium ions, and are precipitated when the temperature is raised. This precipitationis curd, and the water-soluble portion which has not been curdled is separated as whey. The whey fraction contains α-lactoalbumin, β-lactoglobulin, lactose and the like as main components. The curdled fraction is casein and can yield theso-called cheese curd. Cheese curd is subsequently subjected to a salting process to produce natural cheese.

As described above, cheese is yielded by precipitating casein fractions from raw material milk, and therefore, increasing yields thereof is a very important subject from the industrial point of view. Of course, yielding cheese curd in furtherlarger amounts from a certain amount of raw material milk provides higher benefits in various points, including reduction of manufacturing cost, an effective use of milk resources, and providing lower priced products for consumers.

194

For these reasons, considerable numbers of techniques have been developed to increase the yield of cheese curd. Solving the problem of increasing such yield is closely related to the technical problem of how to incorporate into curd the proteinand lactose, which are otherwise discharged as whey.

For example, U.S. Pat. No. 4,205,090 discloses a technique for increasing the yield of cheese curd and, in turn, cheese, using highly concentrated milk by concentration through applying ultrafiltration method. JP-T-1982-501810, a PublishedJapanese Translation of a PCT Application, discloses a method for preparing cheese by using raw material milk, wherein said raw material milk has been obtained by concentrating selectively a raw material milk by ultrafiltration to increase the ionstrength of the raw material milk, followed by fermentation and removal step of the water. In addition, in Japanese Patent Application Laid-open (Kokai) No. 1990-308756 is described that whey yielded as a byproduct upon cheese production isconcentrated, and when the resulting concentrated whey protein and a concentrated raw material milk are used to produce cheese, the resulting cheese curd contains the highly concentrated whey protein, which results in the effective use of the wheyprotein as a byproduct.

However, these techniques require a pretreatment such as ultrafiltration or the like, of raw material milk or whey to be reused, and cannot be said to be convenient industrial methods. In addition, methods of cheese preparation by using rawmaterial milk treated by ultrafiltration causes no effects on the product quality of cheese of a short-term maturation type. However, in the case of cheese of a long-term maturation type, decomposition of the protein and flavor generation of cheese maybe inhibited. These defects may be attributable to the facts that, in the case of cheese rich in non-denatured whey protein, the whey protein itself is difficult to decompose, and that the whey protein inhibits decomposition of the casein by a protease(Jameson and Lelierve; Bull. of the IDF, 313: 3-8 (1996), deKoning et al.; Netherlands Milk Dairy J. 35: 35-46 (1981), and Bech; Int. Dairy J. 3: 329-342 (1993)).

In conclusion, the current cheese preparation technique comprising a step of concentrating raw material milk cannot be said to satisfy sufficiently such quality as required by consumers.

On the other hand, in recent years, a cheese preparation technique using a protein-crosslinking enzyme has been reported. The protein-crosslinking enzyme refers herein to a TG. For example, Japanese Patent Application Laid open (Kokai) No.1989-27471 discloses aproduction example of cheese by using a TG. However, in this case, curdling of milk is carried out not with the milk-clotting enzyme, but by acidification with gluconodeltalactone or lactic acid bacteria and, in addition, it lacksthe point "obtainable by discharging whey" described in the definition of cheese made by FAO committee previously mentioned in this description. Therefore, cheese in the case is different from that according to the present invention described in detaillater. In addition, in Japanese Patent Application Laid-open (Kokai) No. 1990-131537, a technique of preparing a cheese food by using a TG has been described. The cheese food stated there indicates a processed cheese by using natural cheese as the rawmaterial, and is a food different from natural cheese of the present invention.

WO93/19610 discloses a method wherein a TG is added to an acidic milk protein solution of which the pH has been lowered. However, this method comprises no coagulation step with a milk-clotting enzyme, and therefore, the resultant cheese isdifferent from the natural cheese of the present invention. Also, in WO94/21129 is described a method which comprises using a TG toward an acidic food gel made of a milk protein. However, this method also comprises using no milk-clotting enzyme, andtherefore, the resultant cheese is different from the natural cheese of the present invention. WO92/22930 discloses a method of preparation of a milk-like product by using the milk-clotting enzyme, and however, no mention is given of production ofcheese itself. In addition, the order in which the milk-clotting enzyme and TG are added to a milk protein solution, which order is one of the essential features of preparation method of cheese curd of the present invention, is never disclosed in thisdocument.

WO94/21130 describes a process for preparing a milk-based non-acidic edible gel, in which a TG is first added to the raw material milk, followed by adding a milk-clotting enzyme, and then the resultant mass is subjected to heating treatment. Theheating treatment in this way is a heating treatment at a temperature ranging from 60 to 140° C. after the TG and the milk-clotting enzyme have been added, and this treatment presumably causes the inactivation of the enzyme and formation of thegel. This process comprises no whey separation, which characterizes the inventive

195

cheese preparation, and is remarkably different from the present invention, in the order in which the milk-clotting enzyme and a TG are added and at the temperature rangeof heating.

On the other hand, WO97/01961 discloses a cheese preparation method in which a TG is added to a raw material milk, followed by adding a milk-clotting enzyme to the resulting mixture, and then the whey is separated. In the description of thisdisclosure, the TG is reacted at a temperature ranging from 5 to 60° C., preferably from 40 to 55° C. The reaction temperature range of the TG in the cheese curd producing process of the present invention overlaps naturally with thattemperature range, because the both temperature ranges are reaction temperature ranges of the same enzyme (TG). According to the present invention, however, it is an essential element to conduct the κ-casein cleaving reaction with a milk-clottingenzyme, prior to the enzyme reaction with a TG. This element characterizes the production process of the present invention, differing evidently from that disclosed in WO97/01961.

Japanese Patent Application Laid-open (Kokai) No. 1996-173032 describes the method in which (1) a TG is added to a raw material milk to carry out the enzyme reaction for a specific time, followed by carrying out a heating treatment to inactivatethe TG, and then, a milk-clotting enzyme is added, (2) a milk-clotting enzyme is added to a raw material milk to carry out the reaction for a specific time, and then, a TG is added, or (3) a milk-clotting enzyme and a TG are added to a raw material milkat the same time. Description is made of conducting the enzymatic reaction with a TG at a temperature ranging from 10 to 40° C. in these steps. However, the method obviously differs from that of the present invention wherein a milk-clottingenzyme is allowed to act at a low temperature.

Further, cheese preparation methods by using a TG include the method disclosed in EP1057411, in which the cheese curd is prepared by adding a TG and a protease which is not rennet (non-rennet protease) to a raw material milk. However, thismethod is characterized by using a non-rennet protease, and therefore, essentially differs from the cheese curd producing method of the present invention. In addition, EP1057412 discloses the cheese preparation method, in which a TG is added to a rawmaterial milk to carry out the reaction for a certain period of time, followed by adding fat, emulsifier, salt and the like, and the resulting mixture is blended with a cheese solution which has already been heat-dissolved separately. However, thismethod is a preparation method for processed cheese, and differs from the producing method of the present invention for natural cheese. Moreover, in the above-mentioned EP1057411, a method is described, in which whey is added to a raw material milk,whereby a TG is reacted under the condition wherein the concentration of the whey protein is relatively raised, and then curd is obtainable with a milk-clotting enzyme. However, this method is also completely different from that of the presentinvention.

Use of a TG in preparing curd for natural cheese may include three methods: (1) a TG is directly added to a raw material milk to carry out the reaction for a certain period of time, and then, a milk-clotting enzyme is added to the reaction mass,(2) a milk-clotting enzyme is added to a raw material milk to carry out the reaction for a certain period of time, and then, a TG is added to the reaction mass, and (3) a milk-clotting enzyme and a TG are added to a raw material milk at the same time.

Among these methods, in the method (1), first, a TG reacts on the protein (casein) in the raw material milk, and next, the milk-clotting enzyme works. The milk-clotting enzyme is, as described above, an enzyme having a very high substratespecificity, and thus, may be decreased in its reactivity to the κ-casein modified with a TG (i.e., the enzymatic reaction is inhibited), in other words, the curdling reaction may be inhibited. Lorenzen (Milchwissenschaft 55 (8): 433-437 (2000))reported a case wherein curdling performance was much decreased for skimmed milk treated actually with a TG.

Next, in the method (2), first, a milk-clotting enzyme is added to a raw material milk. In this case, a TG is absent during the work of the milk-clotting enzyme, and hence, the enzymatic reaction by the milk-clotting enzyme is not inhibited by aTG. However, as the enzymatic reaction by the milk-clotting enzyme proceeds, the K-casein is cleaved to separate a glycomacropeptide being the hydrophilic portion, and simultaneously, the hydrophobicity of the surface of the casein micelle increases. This phenomenon means that the curdling reaction goes at the same time, in other words, milk coagulation occurs. Adding a TG after curdling reaction or curd formation has a problem of difficulty in blending the TG uniformly with curd.

Finally, the method (3) is a method in which a milk-clotting enzyme and a TG are added to a raw

196

material milk at the same time. Also in this case, as in the case of the method (1), there is the problem in which the κ-casein modificationoccurs as the TG reaction proceeds, and then, the curdling reaction by a milk-clotting enzyme is inhibited.

In consideration of the facts as described above, it is not always preferable to use a TG in the curd preparation in natural cheese production in view of inhibition of the curdling reaction (curd formation being inhibited). Inhibition of thecurdling reaction by the TG treatment is actually described in WO92/22930 as described above. However, occurrence of a curdling phenomenon requires a specific temperature (around 30° C.) or higher and relates to the calcium concentration inmilk, and therefore, it is not always the fact that the TG treatment does not allow preparing natural cheese. In other words, a raw material milk which has been even subjected to a TG treatment can yield curd by raising the temperature or addingcalcium.

The techniques of Japanese Patent Application Laid-open (Kokai) No. 1996-173032 and WO97/01961 as described above are techniques using skillfully those techniques, whereby the effect of a TG to inhibit curdling is avoided, and however, thereshould be an essential solution elsewhere also. Consequently, the problem is how to avoid curdling inhibition of a TG in cheese curd preparation and how to develop a method for adding the TG effectively.

DISCLOSURE OF THE INVENTION

As described above, there is the problem, in which when a TG is allowed to react on milk protein to a certain degree or more, the κ-casein is modified to disturb the reaction of the milk-clotting enzyme on the milk protein, finallyresulting in no good formation of curd. Therefore, the problems to be solved by the present invention are how to provide techniques for producing cheese curd, by which curd formation is not disturbed through using a TG, while cheese curd of a goodquality is obtainable in good yields by using a TG.

In order to solve the problems as described above, the present inventors have made intensive and extensive research and development. As the result, they have found that the problems as described above can be solved by utilizing the property, bywhich a raw material milk even subjected to the reaction of a milk-clotting enzyme does not curdle at low temperatures, and combining this with a TG, completed the present invention on the basis of these findings.

Accordingly, the present invention relates to a process for producing cheese curd characterized in that a milk-clotting enzyme is added to a raw material milk or an aqueous solution of a milk protein kept at a low temperature, and the resultingmixture is kept at the same low temperature for a certain period of time, whereby the milk-clotting enzyme is allowed to react or work, a transglutaminase is then added, and the resulting mixture is raised in temperature and kept at the raisedtemperature for a certain period of time, whereby the transglutaminase is allowed to react and the raw material milk or the aqueous solution of a milk protein curdles in turn, and finally the whey is separated, and also relates to a process for producingcheese curd characterized in that a milk-clotting enzyme and a transglutaminase are simultaneously added to a raw material milk or an aqueous solution of a milk protein being kept at a low temperature, and the resulting mixture is kept at the same lowtemperature for a certain period of time, during which the milk-clotting enzyme is mainly allowed to react, and the resulting mixture is raised in temperature and kept at the raised temperature for a certain period of time, during which thetransglutaminase is mainly allowed to react and the raw material milk or the aqueous solution of a milk protein curdles, and finally the whey is separated.

Here, the reaction of a milk-clotting enzyme at a low temperature (hereafter, referred to as "low temperature renneting") means, specifically, the addition of a milk-clotting enzyme to a raw material milk kept at a low temperature ranging from 0to 25° C., preferably from 5 to 15° C., whereby the milk-clotting enzyme is allowed to work. In this connection, the curdling reaction by a milk-clotting enzyme is usually carried out under warmed conditions at about 30° C. Anadvantage of the low temperature renneting method is that a raw material milk can be placed in a standby state for curdling in the state where the reaction to cleave K-casein has been fully progressed by the reaction of an enzyme such as chymosin or thelike, and that the raising of the temperature thereafter makes a substantially instant curdling possible. In this way, continuous cheese curd preparation becomes possible. In fact, as continuous curd preparation systems using this method, theHutin-Stenne system developed in France, the CP system developed for cottage cheese by Crepaco Corporation of USA, and the Nizo system developed in the Netherlands have been

197

practically applied.

TGs are crosslinking enzymes to crosslink proteins and are distributed widely in the nature world. They can crosslink glutamine residues and lysine residues in a protein via the acyl exchange reaction to form a proteinous network structure. Itis presumed that the components otherwise originally to be discharged as whey are taken in the reticular structure of the curd, resulting in increase in yields.

According to the present invention, the curd yield is improved, as a result, in such a manner that, at the first step, a milk-clotting enzyme is allowed to react on a raw material milk at a low temperature while keeping the state in which nocurdling in fact occurs (hereafter, occasionally referred to as "curdling standby state"), and that, at the second step, a TG is added and the temperature is raised, whereby curdling is caused while crosslinking reaction is caused by a TG in a uniformdistribution state of the protein.

The present invention will be described in detail, as flows.

Raw material milk to be used in the process for producing cheese curd of the present invention, is obtainable from animals such as cattles, goats, and the like, and can be in the form of fresh milk, skimmed milk, partially skimmed milk, andprocessed milk. Fresh milk means milk remaining intact after milking, skimmed milk means fresh milk from which almost all the milk fat content has been removed, partially skimmed milk means fresh milk from which the milk fat content has been removed,except for skimmed milk, and processed milk means what is prepared by processing fresh milk, skimmed milk, partially skimmed milk, or the like. In addition, the aqueous solution of a milk protein, which has been prepared by dissolving in water, powdermilk (whole milk powder, skimmed milk powder, instant milk powder, modified milk powder), or the like, can be also used as the raw material for the process for producing cheese curd of the present invention.

For the process for producing cheese curd of the present invention, TGs can be used regardless of the origin thereof, insofar as they can catalyze the acyl exchange reaction between the gamma carboxy-amide group of a glutamine residue and theepsilon amino group of a lysine residue, which are present in the protein. Examples thereof include that derived from Actinomyces bacteria (Japanese Patent No. 2572716), that derived from Bacillus subtillis (Japanese Patent Application Laid-open (Kokai)No. 1999-137254), that derived from guinea pig liver (Japanese Patent No. 1689614), that derived from oyster (U.S. Pat. No. 5,736,356), and the like. In addition, those prepared by gene recombination can be naturally used. Among them, the TG mosteasy to use is the enzyme derived from Actinomyces bacteria (the above-mentioned Japanese Patent No. 2572716) in consideration of relatively heat-stable, low substrate specificity, and possible stable supply.

Concerning the activity of a TG to be used for the production process of the present invention, in the case where benzyl oxycarbonyl-L-glutaminyl-glycine and hydroxylamine are used as the substrate, 1 unit is defined as the activity to produce 1micromole of the reaction product for 1 minute at 37° C. (hydroxamate method). However, as described above, TGs are derived from various origins, and the activity thereof can not be always determined by applying this definition. Even in suchcase, an amount showing substantially the predetermined effect of the present invention falls in a range of TGs to be added according to the present invention, and also falls naturally in the scope of the present invention.

A milk-clotting enzyme to be used for the process for producing cheese-curd of the present invention, is not restricted to a specific origin. Usable examples include calf rennet used most commonly, and also those such as bovine rennet, swinepepsin, fowl rennet, sheep rennet and goat rennet, which are derived from animal origins, those derived from the genus Mucor, originated from microorganisms, those derived from plants, those produced by gene recombination, and the like.

At the first step of the process of the present invention, a raw material milk or an aqueous solution of a milk protein (in the following description, both being represented by a raw material milk) is added with a milk-clotting enzyme at a lowtemperature ranging from 0 to 25° C., preferably from 5 to 15° C., while the mass is being kept at such a low temperature, whereby the reaction of cleaving κ-casein is caused to occur (low temperature renneting). Reaction timedepends on the reaction temperature and ranges from 15 minutes to 6 hours, preferably from 30 minutes to 3 hours. In the inventive low temperature renneting, the reaction mixture may be indeed permitted to stand for a

198

long time (for example, overnight),which is different from ordinary renneting. Further, if required (for example, in the case of such fresh cheese as "quark", fermentation can be conducted by adding a lactic acid bacterial starter at the same time. This is because though the pH of theraw material milk is gradually lowered by the fermentation, the optimum pH for the reaction of a milk-clotting enzyme is located in the acidic condition, and therefore, the enzymatic reaction of the milk-clotting enzyme is not inhibited by suchfermentation.

Subsequently, at the second step, a TG is added to work on the raw material milk on which the milk-clotting enzyme has been allowed to react. The TG is added in an amount ranging, in view of ordinary enzyme-substrate reaction, from 0.1 to 50units, preferably from 0.5 to 20 units per 1 g of the protein present in the raw material milk. The addition amount of less than 0.1 units provides no desired, intended effect by a TG. On the other hand, the addition amount of a TG of more than 50units makes the reaction proceed acutely and excessively, resulting in a possible bad effect on the quality of the resultant curd.

At the stage of this TG addition, as described above, the raw material milk has indeed been reacted by the milk-clotting enzyme but is kept at the low temperature, and therefore, no curdling has occurred, whereby the mass or reaction mixture iskept in a solution state (curdling standby state). Consequently, the TG can be surely uniformly dispersed in the raw material milk.

After a TG has been added and dissolved, the manipulation of raising the temperature is started subsequently. The temperature of the raw material milk, after the temperature has been raised, is naturally an appropriate temperature ordinarilysuitable for the expression of the enzymatic reaction of the TG, whereby the crosslinking reaction starts. A raising rate of the temperature is not particularly restricted, when it is practically possible. The crosslinking reaction by a TG is anenzymatic reaction, and thus, the amount of the reaction depends on the temperature and time. Usually, the intended effect of the present invention can be sufficiently realized by keeping a reaction mixture at a temperature ranging from 25 to 60° C., preferably from 30 to 50° C. for 10 minutes to 3 hours, preferably 20 minutes to 1 hour (time from the temperature raising to the start of the operation of whey separation). These are referred to Example 1 mentioned later.

Incidentally, any curdling does not occur at the first step of the present invention, wherein a milk-clotting enzyme is added to a raw material milk kept at a low temperature. Therefore, when a TG is added at the low temperature, it can bedispersed uniformly in the raw material, as has been described above. Moreover, at low temperatures, the K-casein is modified by the TG to a small degree, whereby the reaction by the milk-clotting enzyme may not be inhibited. In other words, at lowtemperatures, a milk-clotting enzyme and a TG can be added at the same time. And, when the temperature is raised, whereby the enzymatic reaction of the TG is expressed, curdling is caused to occur. These are referred to Example 2 mentioned later.

The operations or manipulations following the crosslinking reaction by a TG are not specially restricted, but ordinary ones can be employed, such as curd cutting and whey separation, followed by producing various kinds of natural cheese from thecheese curd obtained.

According to the present invention, as described above, a raw material milk is subjected to renneting at a low temperature, whereby it keeps a solution state (curdling standby state) in spite of the milk-clotting enzyme having been allowed toreact thereon. If a TG is added to, and is allowed to react on the raw material milk, cheese curd can be prepared without any inhibition of the renneting. And, the target cheese curd is obtainable in higher yields, because the protein is crosslinked bythe TG (reticular structure of the protein having been formed by crosslinking), whereby the components (α-lactoalbumin, β-lactoglobulin, lactose and the like) originally otherwise to be separated as whey are held therein and also, the waterholding capacity is improved.

FIG. 1 will show an outline of the process for producing cheese curd, according to the present invention as described above. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 illustrates the steps of producing cheese curd with the use of a TG, utilizing the low temperature renneting.

FIG. 2 shows the result of quantitative determination of the glycomacropeptide by high speed liquid

199

chromatography (Test Example 2).

BEST MODE FOR CARRYING OUT THE INVENTION

The invention will be further described in detail as follows with reference to Test Examples and Examples. In the following Test Examples and Examples, the amount of a TG (to be) added is abbreviated as unit(s)/g, for the number of units (to be)added per 1 g of the milk protein.

TEST EXAMPLE 1

Inhibition of Renneting by a TG

In the first place, a Test Example is shown to indicate a decrease in curdling performance caused by the TG treatment.

A TG preparation (ex Ajinomoto Co., Inc., specific activity: 1,000 units/g) derived from an Actinomyces was added in an amount of 0, 2, 5, 8, 10, or 20 units/g to a 1 L portion of a raw material milk (sterilized at 63° C. for 30 min.),which had been set at a constant temperature of 25° C. or 37° C., followed by carrying out the enzymatic reaction by the TG for 2 hours. Subsequently, the TG was inactivated by heating once to 75° C., followed by cooling to32° C., and then, rennet ("Standard Plus 900" ex Christian-Hansen Corp.) was added in such amount that it would be in an amount of 0.003 wt. percent of the raw material milk, and the resulting mixture was kept at the temperature for 1 hour. After these steps, the coagulated state was observed, and the coagulated or curdled products were subjected to cutting, centrifugation at 3,000 rpm for 10 min., whereby the curd was separated from the whey. The results are presented in the followingTable 1. In the Table, the curd weight represents a wet weight of the curd after the whey was removed. And, the curd yield represents a relative value to the curd weight in the case of no addition of the TG.

TABLE-US-00001 TABLE 1 Whey Protein in Curd Curd Temp. TG Coagulated amount the whey weight yield (° C.) (U/g) state (mL) (mg) (g) (%) 37 0 Coagulated 479 967 511 100 37 2 Not -- -- 0 0 coagulated 37 5 Not -- -- 0 0 coagulated 37 8 Not-- -- 0 0 coagulated 37 10 Not -- -- 0 0 coagulated 37 20 Not -- -- 0 0 coagulated 25 0 Coagulated 488 973 515 100 25 2 Loosely 463 810 507 98.4 coagulated 25 5 Very loosely 525 2,278 461 89.5 coagulated 25 8 Not -- -- 0 0 coagulated 25 10 Not -- -- 0 0coagulated 25 20 Not -- -- 0 0 coagulated

As shown in Table 1, in respect of the milk portions subjected to the enzymatic reaction by the TG at 37° C., no curdling reaction of the milk by the rennet was observed. On the other hand, in respect of the milk portions subjected tothe reaction at 25° C., coagulation was observed when the TG was added in an amount of 5 or smaller units/g. However, in respect of the mass when it was added in an amount of 5 units/g, the supernatant after centrifugation showed in fact a verywhitely turbid state, suggesting an inhibited curdling reaction. The whitely turbid state may be caused by the casein, which had not been involved in curdling or coagulating, remained in the supernatant in consideration of a very large amount of theprotein in the supernatant. In the case of the 2 units/g addition, curdling was indeed observed, but it was evidently loose in comparison with the case of no addition of the TG. These results show that as the enzymatic reaction of the TG proceeds,coagulation gets difficult to occur, which, in turn, suggests that the κ-casein modification by the TG causes the enzymatic reaction by the milk-clotting enzyme to get difficult to occur.

TEST EXAMPLE 2

Inhibition by the TG Treatment of the Formation of Glycomacropeptide

In the next place, quantitative determination of glycomacropeptide as the reaction product by the milk-clotting enzyme was actually attempted.

First, calcium chloride was added to a 50 mL portion of a raw material milk (sterilized at 63° C. for 30 min.) in such that it would be in an amount of 0.05 wt. percent of the milk, and the mixture was set to a constant temperature of30° C. Subsequently, a TG was added to the raw material milk in such that it would be in an amount of 5 units/g, followed by allowing the enzymatic reaction by the TG for 1 hour. Following this step, rennet was added in such that it would be inan amount of 0.003 wt. percent of the raw material milk. Sampling was made time-wise, and the specimens were subjected to reverse high speed liquid chromatography. The chromatogram obtained was used for

200

quantifying a peak of the glycomacropeptide. Theresult will be shown in FIG. 2 (with TG treatment). The quantification was conducted in the same way, except for no addition of the TG for comparison. The result will be also shown in FIG. 2 (without TG treatment).

As can be understood from FIG. 2, regardless of the presence or absence of the TG, the amount of the glycomacropeptide generated in the raw material milk showed an increasing tendency with the passage of time. In the case of no addition of theTG (without TG treatment), the amount of the glycomacropeptide generated after rennet was added, increased abruptly until about 10 minutes after, and reached an almost maximum amount after about 20 minutes. On the other hand, in the case of addition ofthe TG (with TG treatment), the increase of the glycomacropeptide generated was obviously slow in comparison with the case of no addition of the TG, while tending to be moderate until about 30 minutes after the adding operation. This result showsclearly that the generation of glycomacropeptide was inhibited by the addition of the TG, suggesting that the raw material milk subjected to the TG treatment becomes difficult to be subjected to the reaction of the milk-clotting enzyme.

TEST EXAMPLE 3

Inhibition of Coagulation by a Low Temperature Renneting

In the third place, observation was made for a relationship between temperatures and the coagulated state of milk.

To ten 1 L portions of a raw material milk (sterilized at 63° C. for 30 min.), calcium chloride was not added or added in such that it would be in an amount of 0.05 wt. percent, and the individual mixtures were kept at 10, 15, 25, 32 or37° C. Following this step, rennet was added in such that it would be in an amount of 0.03 wt. percent of the raw material milk, whereby curdling reaction was conducted, and the coagulated state of the milk was observed after 60 minutes. Theresult will be shown in the following Table 2.

TABLE-US-00002 TABLE 2 CaCl2 Temp. Coagulated (%) (° C.) state 0.05 10 Not coagulated 0.05 15 Not coagulated 0.05 25 Coagulated 0.05 32 Coagulated 0.05 37 Coagulated 0 10 Not coagulated 0 15 Not coagulated 0 25 Not coagulated 0 32Coagulated 0 37 Coagulated

As can be understood from Table 2, in the case of addition of the calcium chloride, coagulation of the milk was not observed at a temperature of 15° C. or lower. On the other hand, in the case of no addition of the calcium chloride,coagulation of the milk was not observed at a temperature of 25° C. or lower. From these results, it has been confirmed that addition and action of the rennet, which is a milk-clotting enzyme, inhibited surely milk coagulation at the lowtemperatures, and the masses remained to keep a solution state.

EXAMPLE 1

Improving Yields of Cheese Curd by a TG (Method 1 of FIG. 1)

To four 1 L portions of the raw material milk (sterilized at 63° C. for 30 min.) while kept at 15° C., rennet was added in such that it would be in an amount of 0.003 wt. percent of the raw material milk. At the 60th minute afterthe rennet was added, a TG was added in such that it would be in an amount of 0, 2, 5 or 10 units/g. The resulting mixtures were stirred well, followed by raising the temperature thereof to 32° C., and were kept at the temperature for 60 minutes,whereby the TG was allowed to react. Following this step, the coagulated milk was subjected to cutting and centrifugation at 3,000 rpm for 10 min., whereby the curd was separated from the whey.

The wet weight of the obtained curds was measured, and the relative values to the value in the case of no addition of the TG was calculated (curd yield), whereby the increase thereof was observed. In addition, the water was removed from thecurds by freeze-drying, the dry weight of the curds was measured, and further, the relative values to the value in the case where the TG was not added, were calculated (solid content yield). The result will be presented in the below-mentioned Table 3.

As the result, as can be understood from the table, as the concentration of the TG added, was increased, both the wet weight and the yield of the curds were increased, presenting a 17 percent

201

increase in the case of 10-unit TG/g in comparisonwith the case of no TG addition. In addition, the solid content yields showed an increase. These results show evidently a possibility of improving curd yields by combination of a low temperature renneting with a TG. At this time, the increase in thesolid content yields was also observed and, therefore, it was suggested that not only the water-holding capacity of curd but also components such as lactose otherwise inherently discharged to the whey being taken in the curd, may occur.

TABLE-US-00003 TABLE 3 Wet curd Dried curd Solid content TG weight Curd yield weight yield (U/g) (g) (%) (g) (%) 0 401 100 85.5 100 2 429 107 87.5 102 5 456 114 88.8 104 10 468 117 89.8 105

EXAMPLE 2

Improving Yields of Cheese Curd by a TG (Method 2 of FIG. 1)

To our 1 L portions of a raw material milk (sterilized at 63° for 30 min.) while kept at 15° C., rennet was added in such that it would be in a amount of 0.003 wt. percent of a raw material milk and, at the same time, a TG wasadded in such that it would be in an amount of 0, 2, 5 or 10 units/g, and the individual mixtures were stirred well. Following keeping the temperature thereof at 15° C. for 60 minutes, the temperature thereof was raised to 32° C., andthe mixtures were kept at this temperature for 60 minutes, whereby the TG was allowed to react. Following this step, the coagulated milk was subjected to cutting and centrifugation at 3,000 rpm for 10 min. to separate the curd from the whey.

The wet weight of the obtained curds was measured, and the relative values to the value in the case of no addition of the TG was calculated (curd yield), whereby the increase thereof was observed. In addition, the water was removed from thecurds by freeze-drying, the dry weight of the curds was measured, and further, the relative values to the value in the case where the TG was not added, were calculated (solid content yield). The result will be presented in the below-mentioned Table 4.

As the result, as can be understood from the table, as the concentration of the TG added, was increased both the wet weight and the yield of the curds were increased, presenting a 15 percent increase in the case of 10-unit TG/g in comparison withthe case of no TG addition. In addition, the dry weight showed an increase. Further, the solid content yields showed an increase. These results show that almost the same effect as that of the case of Example 1 (method 1), can be expected. Concerningthe increase in the solid content yields, the improvement in the curd yields suggests, as the same as in the above-described method 1, the increase in the water-holding capacity and taking-in of the lactose and the like in the curd.

TABLE-US-00004 TABLE 4 Wet curd Dried curd Solid content TG weight Curd yield weight yield (U/g) (g) (%) (g) (%) 0 399 100 86.8 100 2 430 108 87.8 101 5 433 109 87.5 101 10 460 115 88.5 102

EXAMPLE 3

Improving Yields of Fresh Cheese by Applying Low Temperature Renneting

Four 5 L portions of a raw material milk (sterilized at 63° for 30 min.) were each treated by heating to about 85° C. for sterilization. The raw material milk portions were cooled to 15° C., followed by adding a lacticacid bacteria starter ("YoFlex Y370" ex Christian-Hansen Corp.), rennet, and calcium chloride in amounts of 0.02 percent, 0.003 percent, and 0.01 percent, respectively. The resulting mixtures were well blended by stirring. Subsequently, the portionswere then added with the TG in such that it would be in amounts of 0, 2, 5 and 10 units/g, respectively, and kept at 21° C. for 26 hours, whereby fermentation was allowed to proceed. Following this step, the coagulated raw material milks werewarmed and kept at 55° C. for 2 minutes for efficient whey discharge. Subsequently, the masses were cooled to 30° C., and subjected to cutting. The four curds were collected with gauze and suspended in a refrigerator overnight, wherebythe whey was discharged. Each resulting curd was added with table salt in such that it would be in an amount of 1 wt. percent of the curd, and kneaded well, whereby fresh cheese was prepared.

In respect of the four kinds of yielded fresh cheese, the following Table 5 shows the weight, the

202

yield (relative value to the value in the case where the TG was not added), water removal and the evaluated taste on the 3rd day after production. As the result, in accordance with the increased TG amount added, the weight of the yielded fresh cheese increased, and addition of 10 units/g of the TG showed an improved 27 percent of the yield. The product, to which the TG had not been added, showedwater removal after preservation for 3 days. However, adding the TG suppressed water removal. Regarding the texture, the product showed a slightly dried crumbling feeling, lacking creamy feeling, in the case where the TG was not added. However, in thecase where the TG was added, the products had a mild mouth feeling and creamy feeling. Addition of 10 units/g of the TG provided a slightly sloppy feeling, but no organoleptic problem.

TABLE-US-00005 TABLE 5 TG Weight Yield Water (U/g) (g) (%) removal Texture 0 1,090 100 Slight Slightly dried crumbling feeling, Lacking creamy feeling 2 1,179 108 None Mild mouth feeling Creamy feeling 5 1,266 116 None Mild mouth feeling Creamyfeeling 10 1,384 127 None Mild mouth feeling, Slightly sloppy feeling

Incidentally, the above-mentioned Japanese Patent Application Laid-open (Kokai) No. 1996-173032 discloses an example of preparation of cheese curd at an ordinary temperature renneting (around 30° C.) and mentions that regarding anevaluation system for a fresh cheese ("Quark"), the addition of 5 units/g of a TG showed 13 percent increase in the yield, and regarding an evaluation system for cheddar cheese, the addition of 10 units/g of a TG showed 19 percent increase in the yield. In comparison with these results, the process of the present invention can provide, as described in the above-mentioned Table 5, the addition of 5 units/g of the TG showed 16 percent increase in the yield, and the addition of 10 units/g of the TG showed27 percent increase, showing evidently high yields.

INDUSTRIAL APPLICABILITY

According to the invention, inhibition of the reaction of a milk-clotting enzyme by the reaction of a transglutaminase to a milk protein can be avoided, whereby a process for producing cheese curd in improved yields is provided. This invention relates to a process for preparing a protein based acid beverage which is smooth, tasteful, palatable and has good storage stability. An aqueous protein is employed as the protein source in place of the typical dry protein.

BACKGROUND OF THE INVENTION

Juices and other acidic juice-like beverages are popular commercial products. Consumer demand for nutritional healthy beverages has led to the development of nutritional juice or juice-like beverages containing protein. The protein providesnutrition in addition to the nutrients provided by the components of the beverage. Recently it has been discovered that certain proteins have specific health benefits beyond providing nutrition. For example, soy protein has been recognized by theUnited States Food and Drug Administration as being effective to lower blood cholesterol concentrations in conjunction with a healthy diet. In response, there has been a growing consumer demand for acidic juice-like beverages containing proteins thatprovide such specific health benefits.

A hurdle to adding protein to acidic beverages, however, is the relative insolubility of proteins in an aqueous acidic environment. Most commonly used proteins, such as soy proteins and casein, have an isoelectric point at an acidic pH. Thus,the proteins are least soluble in an aqueous liquid at or near the pH of acidic beverages. For example, soy protein has an isoelectric point at pH 4.5 and casein has an isoelectric point at a pH of 4.7, while most common juices have a pH in the range of3.7 to 4.0. As a result, protein tends to settle out as a sediment in an acidic protein-containing beverage--an undesirable quality in a beverage.

Protein stabilizing agents that stabilize proteins as a suspension in an aqueous acidic environment are used to overcome the problems presented by protein insolubility. Pectin is a commonly used protein stabilizing agent. Pectin, however, is anexpensive food ingredient, and manufacturers of aqueous acidic beverages containing protein desire less expensive stabilizers, where the amount of required pectin is either reduced or removed in favor of less expensive stabilizing agents.

The majority of protein based juice drinks are made from dry protein sources including casein, whey and soy protein. The advantages of a dry protein source are the small storage volume, the ease of shipment and the ease of handling duringproduction, since the protein is spray dried to

203

obtain a powder. However, dry protein powders undergo high heat treatment during the spray drying process and this in turn leads to a loss of some functionality, especially on solubility in the juicedrink. Solubility is a key element for a stable acid protein juice drink.

Soy milk is an alternative raw material that could be used in juice drinks, however, the low protein content of soy milk coupled with its beany flavor, limit the application of soy milk in juice drinks.

The advantage of this invention is that while a soy protein is employed for acid beverages, the soy protein is not subjected to the spray drying step. Liquid soy protein that is obtained prior to the spray drying process has a high proteinconcentration and full functionality. As such, it can be used in acid beverages that would have a high degree of stability over a long period of storage time at ambient temperature. A liquid soy protein will retain all its functionality, since there isno phase transition generated by the spray drying process. The spray drying step tends to decrease the solubility of the protein in the acid beverage which then generates a large amount of insoluble particles in the acid beverage.

An advantage of using liquid soy protein is that the lower density, in comparison to the dry protein product, makes a more suspension stable acid beverage. The increased cost of transporting a liquid protein will be offset, in part, by theelimination of the spray drying step.

U.S. Pat. No. 3,995,071 (Goodnight, Jr. et al., Nov. 30, 1976) provides a process for the preparation of an improved purified soy protein having a low phytic acid content. A feature of this reference involves direct incorporation of theaqueous protein into special dietary and food products since it has been found that improved nutritional qualities, functionality (physical characteristics) and flavor are achieved when an aqueous protein is incorporated directly into the finalcomposition as a liquid rather than employing an intermediate drying step prior to constitution with other ingredients.

U.S. Pat. No. 5,286,511 (Klavons et al., Feb. 15, 1994) provides a beverage such as orange juice that is clouded by a suspension of soy protein particles, where the protein particles are prevented from aggregating to the point of settling outby pectin. Pectin inhibits the protein from settling by adsorbing to individual protein particles and imparting an overall negative charge to the protein particles, resulting in repulsion of the particles from one another, and thereby preventing theprotein particles from aggregating and settling out of the suspension. Pectin also increases the viscosity of the beverage, which helps stabilize protein particles against gravitational forces.

U.S. Pat. No. 6,221,419 (Gerrish, Apr. 24, 2001) relates to a pectin for stabilizing proteins particularly for use in stabilizing proteins present in aqueous acidified milk drinks. It must be understood that the inclusion of pectin has bothdesirable and undesirable effects on the properties of acidified milk drinks. While pectin can act as a stabilizer against sedimentation of casein particles or whey separation, it can have the disadvantage of increasing the viscosity of the drink due toits cross-linking with naturally co-present calcium cations rendering the drink unpalatable. It will be seen that in the absence of pectin, there is significant sedimentation in the case of both drinks caused by the instability of the casein particleswhich also results in relatively high viscosity. After a certain concentration of pectin has been added, the casein particles become stabilized against sedimentation after which increasing the pectin concentration has little effect on sedimentation. Turning to the viscosity of the drinks, this also significantly drops on stabilization of the casein particles but then almost immediately begins to rise again due to cross-linking of the excess pectin added by the co-present calcium cations. Thisincreased viscosity is undesirable as it leads to the beverage having poor organoleptic properties. This range may be as narrow as only 0.06% by weight of pectin based upon the beverage weight as a whole. Below this working range, sedimentation is asignificant problem, whereas above it, the viscosity of the beverage is undesirably high.

SUMMARY OF THE INVENTION

This invention is directed to an acid beverage composition, comprising;

(A) a hydrated protein stabilizing agent;

(B) at least one flavoring material comprising a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid, glucono delta lactone or phosphoric acid; and

204

(C) a slurry of an aqueous protein material wherein the slurry of the aqueous protein material is prepared by a process, comprising; (1) preparing an aqueous extract from a protein containing material, (2) adjusting the pH of the aqueous extractto a value of from about 4 to about 5 to precipitate the protein material, (3) separating the precipitated protein material and forming a suspension of the precipitated protein material in water, (4) adjusting the pH of the suspension to a value of fromabout 4.0 to about 6.0 to form a slurry of an aqueous protein material, and optionally (5) pasteurizing the slurry of the aqueous protein material; wherein the acid beverage composition has a pH of from 3.0 to 4.5.

Also disclosed are several processes for preparing an acid beverage composition. The first process comprises;

forming a preblend (I) by mixing

(A) a hydrated protein stabilizing agent and

(B) at least one flavoring material comprising a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid, glucono delta lactone or phosphoric acid; and mixing preblend (I) and

(C) a slurry of an aqueous protein material wherein the slurry of the aqueous protein material is prepared by a process, comprising; (1) preparing an aqueous extract from a protein containing material, (2) adjusting the pH of the aqueous extractto a value of from about 4 to about 5 to precipitate the protein material, (3) separating the precipitated protein material and forming a suspension of the precipitated protein material in water, (4) adjusting the pH of the suspension to a value of fromabout 4.0 to about 6.0 to form a slurry of an aqueous protein material, and (5) pasteurizing the slurry of the aqueous protein material; to form a blend and pasteurizing and homogenizing the blend; wherein the acid beverage composition has a pH of from3.0 to 4.5.

The second process for preparing an acid beverage composition comprises; forming a preblend (I) by mixing

(A) a hydrated protein stabilizing agent and

(B) at least one flavoring material comprising a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid, glucono delta lactone or phosphoric acid; and

forming a preblend (II) by mixing

(A) a hydrated protein stabilizing agent; and

(C) a slurry of an aqueous protein material wherein the slurry of the aqueous protein material is prepared by a process, comprising; (1) preparing an aqueous extract from a protein containing material, (2) adjusting the pH of the aqueous extractto a value of from about 4 to about 5 to precipitate the protein material, (3) separating the precipitated protein material and forming a suspension of the precipitated protein material in water, (4) adjusting the pH of the suspension to a value of fromabout 4.0 to about 6.0 to form a slurry of an aqueous protein material, and (5) pasteurizing the slurry of the aqueous protein material; and mixing preblend (I) and preblend (II) to form a blend; and pasteurizing and homogenizing the blend; wherein theacid beverage composition has a pH of from 3.0 to 4.5.

The third process for preparing an acid beverage composition, comprises; forming a preblend (III) by mixing

(A) a hydrated protein stabilizing agent and

(C1) a slurry of an aqueous protein material wherein the slurry of the aqueous protein material is prepared by a process, comprising; (1) preparing an aqueous extract from a protein containing material, (2) adjusting the pH of the aqueousextract to a value of from about 4 to about 5 to precipitate the protein material, (3) separating the precipitated protein material and forming a suspension of the precipitated protein material in water, (4) adjusting the pH of the suspension to a

205

valueof from about 4.0 to about 6.0 to form a slurry of an aqueous protein material; and mixing preblend (III) with

(B) at least one flavoring material comprising a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid, glucono delta lactone or phosphoric acid;

to form a blend; and

pasteurizing and homogenizing the blend;

wherein the acid beverage composition has a pH of from 3.0 to 4.5. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a block flow diagram of an industry wide process for producing a typical protein containing acid beverage wherein a dry protein is hydrated as a protein slurry and a dry stabilizing agent is hydrated as a stabilizing agent slurry andthe two slurries are blended together and the remaining ingredients added followed by pasteurization and homogenization.

FIG. 2 is a block flow diagram of the first process of the invention for producing a protein containing acid beverage wherein a dry stabilizing agent is hydrated as a stabilizing agent slurry and a flavoring material is added to the stabilizingagent slurry to form a preblend (I) slurry. A non-dried, aqueous protein as a protein slurry (Component (C)) is prepared. The preblend (I) slurry and the non-dried, aqueous protein slurry are blended together followed by pasteurization andhomogenization in accordance with the principles of the invention.

FIG. 3 is a block flow diagram of the second process of the invention for producing a protein containing acid beverage wherein a dry stabilizing agent slurry is hydrated as a stabilizing agent slurry and a flavoring material is added to thestabilizing agent slurry to form a preblend (I) slurry. A non-dried, aqueous protein as a protein slurry is prepared and a portion of a dry stabilizing agent slurry is added to form a preblend (II) slurry. The preblend (I) slurry and the preblend (II)slurry are blended together followed by pasteurization and homogenization in accordance with the principles of the invention.

FIG. 4 is a block flow diagram of the third process of the invention for producing a protein containing acid beverage wherein a dry stabilizing agent is hydrated as a stabilizing agent slurry (A) and a non-dried, non-pasteurized aqueous proteinas a protein slurry (C1) is added to the stabilizing agent slurry to form a preblend (III) slurry. The preblend (III) slurry and the flavoring material (B) are blended together followed by pasteurization and homogenization in accordance with theprinciples of the invention.

DETAILED DESCRIPTION OF THE INVENTION

A protein based acid beverage is normally stabilized by a stabilizing agent that provides a stable suspension through possible steric stabilization and electrostatic repulsive mechanism. FIG. 1 refers to the normal processing conditions ofprotein stabilized acid beverages. At 1, a stabilizing agent is either hydrated separately into a 2-3% slurry or blended with sugar to give a stabilizing agent slurry having a pH of 3.5. At 5, dry protein powder is first dispersed in water at ambienttemperature and hydrated at an elevated temperature for a period of time. The pH at 5 is about neutral. The hydrated stabilizing agent slurry from 1 and the hydrated protein slurry from 5 are mixed together at 10 for 10 minutes under agitation. The pHat 10 is about 7. Other ingredients such as additional sugar, fruit juices or vegetable juice, and various acids such as phosphoric acid, ascorbic acid citric acid, etc., are added at 20 to bring the pH to about 3.8. The contents are pasteurized at195° F. for 30 seconds and then homogenized first at 2500 pounds per square inch and then at 500 pounds per square inch at 30. Containers are hot filled and cooled at 40 to give the product at 50 with a pH of 3.8. The problem with this methodis that after the stabilizing agent is mixed with the protein, the pH of the blend is close to neutral, and the stabilizing agent is potentially degraded by beta-elimination, especially under heat. This causes a decrease in the molecular weight of thestabilizing agent and the ability of the stabilizing agent to stabilize the proteins when the pH is later lowered even more is greatly reduced. The stabilizing agent is only stable at room temperature. As the temperature increases, beta eliminationbegins, which results in chain cleavage and a very rapid loss of the ability of the stabilizing agent to provide a stable suspension.

206

In the present invention, a hydrated protein stabilizing agent (A) and a flavoring material (B) are combined as a preblend (I) and combined with either a slurry of a non-dried, aqueous protein material (C) or a preblend (II) of a hydrated proteinstabilizing agent (A) and a slurry of a non-dried, aqueous protein material (C). FIG. 2 and FIG. 3 refer to these processes. In FIG. 4, the hydrated protein stabilizing agent (A) and a non-dried, non-pasteurized aqueous protein slurry (C1) arecombined as preblend (III) and combined with the flavoring material (B).

FIG. 2 outlines the first process of this invention. A stabilizing agent is hydrated into a 0.5-10% dispersion with or without sugar at 101. The pH at 101 is 3.5. At 102, the flavoring material (B) such as additional sugar, fruit juices,vegetable juices, various acids such as phosphoric acid, ascorbic acid, citric acid, etc. are added and the contents mixed at an elevated temperature to form preblend (I). An aqueous protein slurry is prepared at 104. This slurry is not subjected tospray drying conditions. The slurry is pasteurized at 105 to give component (C). The pH at 105 is from about 4 to about 6. The pasteurized slurry from 105 and preblend (I) from 102 are blended together at 110 with additional acid to a pH of 3.8. At130, the contents are pasteurized at a temperature of 180° F. for 30 seconds and homogenized in two stages--a high pressure stage of 2500 pounds per square inch and then a low pressure stage of 500 pounds per square inch Containers are hot filledand cooled at 140 to give the product at 150 with a pH of 3.8.

FIG. 3 outlines the second process of this invention. In FIG. 3, an aqueous protein slurry is prepared at 204. This slurry is not subjected to spray drying conditions. The slurry is pasteurized at 205 to give component (C). The pH at 205 isfrom about 4 to about 6. A portion of the total stabilizing agent, component (A), (about 30%) is hydrated at 203, mixed briefly and then added to component (C) to form preblend (II) at 206. The pH at 206 is about 6.5. The remaining stabilizing agentis hydrated without sugar at 201. The pH at 201 is 3.5. At 202, the flavoring material (B) such as additional sugar, fruit juices, vegetable juices, various acids such as phosphoric acid, ascorbic acid, citric acid, etc. are added and the contentsmixed at an elevated temperature to form preblend (I). The slurry of preblend (I) from 202 and the slurry of preblend (II), from 206 are blended together at 210 with additional acid to a pH of 3.8. At 230, the contents are pasteurized at a temperatureof 195° F. for 30 seconds and homogenized in two stages--the high pressure stage of 2500 pounds per square inch and then the low pressure stage of 500 pounds per square inch. Containers are hot filled and cooled at 240 to give the product at 250with a pH of 3.8.

FIG. 4 outlines the third process of this invention. In FIG. 4, an aqueous protein slurry that is not pasteurized is prepared at 303 to give (C1). This slurry is not subjected to spray drying conditions. The pH at 303 is from about 4 toabout 6. A stabilizing agent is hydrated into a 0.5-10% slurry with or without sugar at 301 to a pH of 3.5 and then added to component (C1) to form preblend (III) at 310. At 320, the flavoring material (B) such as additional sugar, fruit juices,vegetable juices, various acids such as phosphoric acid, ascorbic acid, citric acid, etc. are added and the contents are mixed. At 330, the contents are pasteurized at a temperature of 195° F. for 30 seconds and homogenized in two stages--thehigh pressure stage of 2500 pounds per square inch and then the low pressure stage of 500 pounds per square inch. Containers are hot filled and cooled at 340 to give the product at 350 with a pH of 3.8.

Component (A)

The present invention employs a stabilizing agent and the stabilizing agent is a hydrocolloid comprising alginate, microcrystalline cellulose, jellan gum, tara gum, carrageenan, guar gum, locust bean gum, xanthan gum, cellulose gum and pectin. Apreferred hydrocolloid is pectin. As used herein, the term "pectin" means a neutral hydrocolloid that consists mainly of partly methoxylated polygalacturonic acid. The term "high methoxyl pectin" as used herein means a pectin having a degree ofmethoxyl esterification of fifty percent (50%) or greater. High methoxyl (HM) pectins useful in the present invention are commercially available. One supplier is Copenhagen Pectin A/S, a division of Hercules Incorporated, DK-4623, Lille Skensved,Denmark. Their products are identified as Hercules YM100L, Hercules YM100H, Hercules YM115L, Hercules YM115H and Hercules YM150H. Hercules YM100L contains about 56% galacturonic acid, where about 72% (. -.2%) of the galacturonic acid is methylated. Another supplier is Danisco A/S of Copenhagen, Denmark and they supply AMD783.

It is necessary to hydrate the stabilizing agent (A), prior to preparing the acid beverage. Water is added in sufficient quantity to form a slurry in order to hydrate the stabilizing agent. The slurry is

207

mixed at room temperature under highshear and heated to 140-180° F. for an additional 10 minutes. At this solids concentration, the most complete hydration is obtained in the stabilizing agent. Thus, the water in the slurry is used most efficiently at this concentration. Asweetener may be added at this point or later or a portion of the sweetener added here and also added later. Preferred sweeteners comprise sucrose, corn syrup, and may include dextrose and high fructose corn syrup and artificial sweeteners.

Component (B)

A protein material by itself can have an undesired aftertaste or undesired flavors. The function of the flavoring material (B) is to mask any adverse flavors of the protein material (C) and to give a pleasant taste to the acid beveragecomposition. The flavoring material (B) comprises a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid, glucone delta lactone, phosphoric acid or combinations thereof.

As a juice, the fruit and/or vegetable may be added in whole, as a liquid, a liquid concentrate, a puree or in another modified form. The liquid from the fruit and/or vegetable may be filtered prior to being used in the juice product. The fruitjuice can include juice from tomatoes, berries, citrus fruit, melons and/or tropical fruits. A single fruit juice or fruit juice blends may be used. The vegetable juice can include a number of different vegetable juices. Examples of a few of the manyspecific juices which may be utilized in the present invention include juice from berries of all types, currants, apricots, peaches, nectarines, plums, cherries, apples, pears, oranges, grapefruits, lemons, limes, tangerines, mandarin, tangelo, bananas,pineapples, grapes, tomatoes, rhubarbs, prunes, figs, pomegranates, passion fruit, guava, kiwi, kumquat, mango, avocados, all types of melon, papaya, turnips, rutabagas, carrots, cabbage, cucumbers, squash, celery, radishes, bean sprouts, alfalfasprouts, bamboo shoots, beans and/or seaweed. As can be appreciated, one or more fruits, one or more vegetables, and/or one or more fruits and vegetables, can be included in the acid beverage to obtain the desired flavor of the acid beverage.

Fruit and vegetable flavors can also function as the flavoring material (B). Fruit flavoring has been found to neutralize the aftertaste of protein materials. The fruit flavoring may be a natural and/or artificial flavoring. As can beappreciated, the fruit flavoring is best when used with other flavoring materials such as vegetable flavoring to enhance the characterizing flavor of the acid beverage and also to mask any undesired flavor notes that may derive from the protein material.

Component (C)

The protein material is a slurry of an aqueous protein material wherein the slurry of the aqueous protein material is prepared by a process, comprising; (1) preparing an aqueous extract from a protein containing material, (2) adjusting the pH ofthe aqueous extract to a value of from about 4 to about 5 to precipitate the protein material, (3) separating the precipitated protein material and forming a suspension of the precipitated protein material in water, (4) adjusting the pH of the suspensionto a value of from about 4.0 to about 6.0 to form a slurry of an aqueous protein material, and optionally (5) pasteurizing the slurry of the aqueous protein material.

Within (C)(5), when pasteurization occurs, the component generated is Component (C). When (C)(5) is non-existent, meaning there is no pasteurization step, the component generated is Component (C1).

The protein material may be any vegetable or animal protein that is at least partially insoluble in an aqueous acidic liquid, preferably in an aqueous acidic liquid having a pH of from 3.0 to 5.5, and most preferably in an aqueous acidic liquidhaving a pH of from 3.5 to 4.5. As used herein a "partially insoluble" protein material is a protein material that contains at least 10% insoluble material, by weight of the protein material, at a specified pH. Preferred protein materials useful in thecomposition of the present invention include soy protein materials, casein or caseinates, corn protein materials--particularly zein, and wheat gluten. Preferred proteins also include dairy whey protein (especially sweet dairy whey protein), andnon-dairy-whey proteins such as bovine serum albumin, egg white albumin, and vegetable whey proteins (i.e., non-dairy whey protein) such as soy protein.

It is necessary that the protein material does not undergo a spray drying step. Protein materials for this invention are not dry protein materials, but rather protein materials that are still in an aqueous

208

form. That is, a protein that has beenpasteurized, but not dried. Dry protein powders that have undergone high heat treatment during the spray drying process cause a loss of some functionality, especially on solubility in the juice drink. Solubility is a key element for a stable acidprotein juice drink.

Soybean protein materials which are useful with the present invention are soy flour, soy concentrate, and, most preferably, soy protein isolate. The soy flour, soy concentrate, and soy protein isolate are formed from a soybean starting materialwhich may be soybeans or a soybean derivative. Preferably the soybean starting material is either soybean cake, soybean chips, soybean meal, soybean flakes, or a mixture of these materials. The soybean cake, chips, meal, or flakes may be formed fromsoybeans according to conventional procedures in the art, where soybean cake and soybean chips are formed by extraction of part of the oil in soybeans by pressure or solvents, soybean flakes are formed by cracking, heating, and flaking soybeans andreducing the oil content of the soybeans by solvent extraction, and soybean meal is formed by grinding soybean cake, chips, or flakes.

The soy flour, soy concentrate and soy protein isolate are described below as containing a protein range based upon a "moisture free basis" (mfb), which denotes a drying step. It is not known what the protein range is for a soy flour, soyconcentrate and soy protein isolate in the aqueous state. However, if the soy flour, soy concentrate and soy protein isolate were to be dried, they would have the protein ranges so indicated on a moisture free basis.

Soy flour, as that term is used herein, refers to a comminuted form of defatted soybean material, preferably containing less than 1% oil, formed of particles having a size such that the particles can pass through a No. 100 mesh (U.S. Standard)screen. The soy cake, chips, flakes, meal, or mixture of the materials are comminuted into a soy flour using conventional soy grinding processes. Soy flour has a soy protein content of about 49% to about 65% on a moisture free basis (mfb). Preferablythe flour is very finely ground, most preferably so that less than about 1% of the flour is retained on a 300 mesh (U.S. Standard) screen.

Soy concentrate, as the term is used herein, refers to a soy protein material containing about 65% to about 72% of soy protein (mfb). Soy concentrate is preferably formed from a commercially available defatted soy flake material from which theoil has been removed by solvent extraction. The soy concentrate is produced by an acid leaching process or by an alcohol leaching process. In the acid leaching process, the soy flake material is washed with an aqueous solvent having a pH at about theisoelectric point of soy protein, preferably at a pH of about 4.0 to about 5.0, and most preferably at a pH of about 4.4 to about 4.6. The isoelectric wash removes a large amount of water soluble carbohydrates and other water soluble components from theflakes, but removes little of the protein and fiber, thereby forming a soy concentrate. The soy concentrate is not dried after the isoelectric wash. In the alcohol leaching process, the soy flake material is washed with an aqueous ethyl alcoholsolution wherein ethyl alcohol is present at about 60% by weight. The protein and fiber remain insoluble while the carbohydrate soy sugars of sucrose, stachyose and raffinose are leached from the defatted flakes. The soy soluble sugars in the aqueousalcohol are separated from the insoluble protein and fiber. The insoluble protein and fiber in the aqueous alcohol phase are not dried.

Soy protein isolate, as the term is used herein, refers to a soy protein material containing at least about 90% or greater protein content, and preferably from about 92% or greater protein content (mfb). Soy protein isolate is typically producedfrom a starting material, such as defatted soybean material, in which the oil is extracted to leave soybean meal or flakes. More specifically, the soybeans may be initially crushed or ground and then passed through a conventional oil expeller. It ispreferable, however, to remove the oil contained in the soybeans by solvent extraction with aliphatic hydrocarbons, such as hexane or azeotropes thereof, and these represent conventional techniques employed for the removal of oil. The defatted soyprotein material or soybean flakes are then placed in an aqueous bath to provide a mixture having a pH of at least about 6.5 and preferably between about 7.0 and 10.0 in order to extract the protein. Typically, if it is desired to elevate the pH above6.7, various alkaline reagents such as sodium hydroxide, potassium hydroxide and calcium hydroxide or other commonly accepted food grade alkaline reagents may be employed to elevate the pH. A pH of above about 7.0 is generally preferred, since analkaline extraction facilitates solubilization of the protein. Typically, the pH of the aqueous extract of protein will be at least about 6.5 and preferably about 7.0 to 10.0. The ratio by weight of the aqueous extractant to the vegetable proteinmaterial is usually between about 20 to 1 and preferably a ratio

209

of about 10 to 1. In an alternative embodiment, the vegetable protein is extracted from the milled, defatted flakes with water, that is, without a pH adjustment.

It is also desirable in obtaining the soy protein isolate used in the present invention, that an elevated temperature be employed during the aqueous extraction step, either with or without a pH adjustment, to facilitate solubilization of theprotein, although ambient temperatures are equally satisfactory if desired. The extraction temperatures which may be employed can range from ambient up to about 120° F. with a preferred temperature of 90° F. The period of extraction isfurther non-limiting and a period of time between about 5 to 120 minutes may be conveniently employed with a preferred time of about 30 minutes. Following extraction of the vegetable protein material, the aqueous extract of protein can be stored in aholding tank or suitable container while a second extraction is performed on the insoluble solids from the first aqueous extraction step. This improves the efficiency and yield of the extraction process by exhaustively extracting the protein from theresidual solids from the first step.

The combined, aqueous protein extracts from both extraction steps, without the pH adjustment or having a pH of at least 6.5, or preferably about 7.0 to 10, are then precipitated by adjustment of the pH of the extracts to, at or near theisoelectric point of the protein to form an insoluble curd precipitate. The actual pH to which the protein extracts are adjusted will vary depending upon the vegetable protein material employed but insofar as soy protein, this typically is between about4.0 and 5.0. The precipitation step may be conveniently carried out by the addition of a common food grade acidic reagent such as acetic acid, sulfuric acid, phosphoric acid, hydrochloric acid or with any other suitable acidic reagent. The soy proteinprecipitates from the acidified extract, and is then separated from the extract. The separated protein may be washed with water to remove residual soluble carbohydrates and ash from the protein material and the residual acid can be neutralized to a pHof from about 4.0 to about 6.0 by the addition of a basic reagent such as sodium hydroxide or potassium hydroxide to form a slurry of an aqueous protein material. At this point the aqueous protein material is optionally subjected to a pasteurizationstep. The pasteurization step kills microorganisms that may be present. Pasteurization is carried out at a temperature of at least 180° F. for at least 10 seconds, at a temperature of at least 190° F. for at least 30 seconds or at atemperature of at least 195° F. for at least 60 seconds. If pasteurization is not carried out, the aqueous protein is defined as component (C1). With pasteurization, the aqueous protein is defined as Component (C). Typically, at thispoint, the separated protein is then dried using conventional drying means to form a soy protein isolate. However, in the present invention, it is necessary that the soy protein isolate be an aqueous soy protein isolate.

Preferably the aqueous protein material used in the present invention, is modified to enhance the characteristics of the protein material. The modifications are modifications which are known in the art to improve the utility or characteristicsof a protein material and include, but are not limited to, denaturation and hydrolysis of the protein material.

The aqueous protein material may be denatured and hydrolyzed to lower the viscosity. Chemical denaturation and hydrolysis of protein materials is well known in the art and typically consists of treating an aqueous protein material with one ormore alkaline reagents in an aqueous solution under controlled conditions of pH and temperature for a period of time sufficient to denature and hydrolyze the protein material to a desired extent. Typical conditions utilized for chemical denaturing andhydrolyzing a protein material are: a pH of up to about 10, preferably up to about 9.7; a temperature of about 50° C. to about 80° C. and a time period of about 15 minutes to about 3 hours, where the denaturation and hydrolysis of theaqueous protein material occurs more rapidly at higher pH and temperature conditions.

Hydrolysis of the aqueous protein extract may also be effected by treating the aqueous protein extract with an enzyme capable of hydrolyzing the protein. Many enzymes are known in the art which hydrolyze protein materials, including, but notlimited to, fungal proteases, pectinases, lactases, and chymotrypsin. Enzyme hydrolysis is effected by adding a sufficient amount of enzyme to an aqueous dispersion of the aqueous protein material, typically from about 0.1% to about 10% enzyme by weightof the aqueous protein extract, and treating the enzyme and aqueous protein extract at a temperature, typically from about 5° C. to about 75° C., and a pH, typically from about 3 to about 9, at which the enzyme is active for a period oftime sufficient to hydrolyze the aqueous protein extract. After sufficient hydrolysis has occurred the enzyme is deactivated by heating to a temperature above 75° C., and the protein extract is precipitated from the aqueous extract by adjustingthe pH of the solution to about the isoelectric point of the protein material. Enzymes

210

having utility for hydrolysis in the present invention include, but are not limited to, bromolein and alcalase.

Mineral enrichment or fortification of the soy protein material is also desirable. The aqueous protein material is modified by the inclusion of an alkaline earth metal phosphate either as magnesium phosphate or calcium phosphate. Calciumphosphate is preferred. Typically phosphoric acid is quickly added to an aqueous slurry of an alkaline earth metal hydroxide such as calcium hydroxide while employing ultrasonication or homogenization. The ultrasonication and homogenization serve toreduce the particle size of the formed calcium phosphate and also provides mechanical energy such that all the calcium hydroxide erects with the phosphoric acid.

Casein protein materials useful in the process of the present invention are prepared by coagulation of a curd from skim milk. The casein is coagulated by acid coagulation, natural souring, or rennet coagulation. To effect acid coagulation ofcasein, a suitable acid, preferably hydrochloric acid, is added to milk to lower the pH of the milk to around the isoelectric point of the casein, preferably to a pH of from 4.0 to 5.0, and most preferably to a pH of from 4.6 to 4.8. To effectcoagulation by natural souring, milk is held in vats to ferment, causing lactic acid to form. The milk is fermented for a sufficient period of time to allow the formed lactic acid to coagulate a substantial portion of the casein in the milk. To effectcoagulation of casein with rennet, sufficient rennet is added to the milk to precipitate a substantial portion of the casein in the milk. Acid coagulated, naturally soured, and rennet precipitated casein are all commercially available from numerousmanufacturers or supply houses.

Corn protein materials that are useful in the present invention include corn gluten meal, and most preferably, zein. Corn gluten meal is obtained from conventional corn refining processes, and is commercially available. Corn gluten mealcontains about 50% to about 60% corn protein and about 40% to about 50% starch. Zein is a commercially available purified corn protein which is produced by extracting corn gluten meal with a dilute alcohol, preferably dilute isopropyl alcohol.

Wheat protein materials that are useful in the process of the present invention include wheat gluten. Wheat gluten is obtained from conventional wheat refining processes, and is commercially available.

The below Examples 1-5, as part of the present invention, are directed to the preparation of either Component (C) or Component (C1).

EXAMPLE 1

To an extraction tank is added 100 pounds of defatted soybean flakes and 1000 pounds water. The contents are heated to 90° F. and sufficient calcium hydroxide is added to adjust the pH to 9.7. This provides a weight ratio of water toflakes of 10:1. The flakes are separated from the extract and reextracted with 600 lbs. of water having a pH of 9.7 and a temperature of 90° F. This second extraction step provides a weight ratio of water to flakes of 6:1. The flakes areremoved by centrifugation, and the first and second extracts are combined and adjusted to a pH of 4.5 with either hydrochloric acid or phosphoric acid, which forms a precipitated protein curd and a soluble aqueous whey. The acid precipitated waterinsoluble curd is separated from the aqueous whey by centrifuging and washing in a CH-14 centrifuge at a speed of 4,000 rpm and a Sharples P3400 centrifuge at a speed of 3,000 rpm. Protein curds are re-suspended in water at a 10-12% solid concentrationand the pH is adjusted to 5.2 with sodium hydroxide to partially solubilize the protein. The product is an aqueous protein that has not been pasteurized.

EXAMPLE 2

To an extraction tank is added 100 pounds of defatted soybean flakes and 600 pounds water. The contents are heated to 90° F. and sufficient calcium hydroxide is added to adjust the pH to 9.7. This provides a weight ratio of water toflakes of 6:1. The flakes are separated from the extract and reextracted with 400 lbs. of water having a pH of 9.7 and a temperature of 90° F. This second extraction step provides a weight ratio of water to flakes of 4:1. The flakes areremoved by centrifugation, and the first and second extracts are combined and adjusted to a pH of 4.5 with phosphoric acid, which forms a precipitated protein curd and a soluble aqueous whey. The acid precipitated water insoluble curd is separated fromthe aqueous whey by centrifuging and washing in a CH-14 centrifuge at a speed of 4,000 rpm and a Sharples P3400 centrifuge at a speed of 3,000

211

rpm. Protein curds are re-suspended in water at a 10-12% solid concentration to give a diluted curd. Added tothe diluted curd is an aqueous blend of sodium hydroxide and potassium hydroxide to adjust the pH to 9.0. The alkali treated material is heated to about 145° F. and a 10% solution of Alcalase is added. The enzyme treated slurry is mixed for 30minutes and the pH is maintained at 9.0 with the alkali blend. After an additional 22 minute hold after the completion of the alkali treatment, a 0.1% bromolain solution is added. After a hold time of 22 minutes, a mixture of hydrochloric acid andphosphoric acid is added to adjust the pH to 5.54. The contents are pasteurized at 305° F. for 9 seconds to give an aqueous protein material.

EXAMPLE 3

The procedure of Example 1 is repeated with the following exception. A 3.4% total solids aqueous slurry of freshly prepared calcium phosphate is added after the first addition of an aqueous solution of a mixture of sodium hydroxide and potassiumhydroxide. The product obtained is a calcium fortified aqueous protein material.

EXAMPLE 4

An acid precipitated protein curd as prepared per Example 1 is diluted to 18% total solids. The contents are heated to above 100° F. Bromelain enzyme at 0.015% of the total solids is added and the contents are mixed. Added to thediluted curd is an aqueous blend of sodium hydroxide and potassium hydroxide to adjust the pH to 8.4. A 3.4% total solids of an aqueous slurry of freshly prepared calcium phosphate is added and the contents are maintained at above 100° F. for 20minutes. The contents are pasteurized at 265° F. for 9 seconds. Added is an additional bromelain enzyme at 0.015% of the total solids and the contents are stirred for 35 minutes. The contents are pasteurized at 305° F. or 9 seconds togive a calcium fortified aqueous protein material

EXAMPLE 5

An acid precipitated protein curd as prepared per Example 1 is diluted to 14.5% total solids. The contents are heated to above 100° F. Added to the diluted curd is an aqueous blend of sodium hydroxide and potassium hydroxide to adjustthe pH to 7.2. A 3.4% total solids of an aqueous slurry of freshly prepared calcium phosphate is added and the contents are maintained at above 100° F. The contents are pasteurized at 308° F. for 9 seconds. Added is an additional amountof sodium hydroxide and potassium hydroxide at 125° F. to adjust the pH to 9.0 and the contents are stirred. Alcalase at 0.02% of the total solids and bromelain at 0.015% of the total solids is added and the contents are stirred at above 100Ffor 22 minutes. The enzyme contents are adjusted to a pH of 7.2 with hydrochloric acid. The contents are pasteurized at 305° F. or 9 seconds to give a calcium fortified aqueous protein material.

Acid Beverage Compositions

Examples A-D are baseline process examples of acid beverage compositions as defined within FIG. 1. The acid beverage compositions of these examples employ a dry protein as a protein source.

EXAMPLE A

A 6.5 g protein per 8 oz serving fortified juice beverage is made using Supro.RTM. Plus 675 made by Solae.RTM. LLC.

Added to a vessel are 5494 g of distilled water followed by 332 g of Supro Plus 675. The contents at 5.70% solids are dispersed under medium shear, mixed for 5 minutes, followed by heating to 170° F. for 10 minutes to give a proteinsuspension slurry. In a separate vessel, 60 grams of pectin (YM-100L) are dispersed into 2940 grams of distilled water under high shear to give a 2% pectin dispersion. The dispersion is heated to 170° F. until no lumps are observed. The pectindispersion is added into the protein suspension slurry and mixed for 5 minutes under medium shear. This is followed by the addition of 27 grams of citric acid, 27 grams of phosphoric acid, 210 grams of concentrated apple juice and 1000 grams of sugar. The contents are mixed for 5 minutes under medium shear. The pH of this mixture at room temperature is in the range of 3.8-4.0. The contents are pasteurized at 195° F. for 30 seconds, and homogenized at 2500 pounds per square inch in the firststage and 500 pounds per square inch in the second stage to give a protein stabilized acid

212

beverage. Bottles are hot filled with the beverage at 180-185° F. The bottles are inverted, held for 2 minutes and then placed in ice water to bring thetemperature of the contents to about room temperature. After the contents of the bottles are brought to about room temperature, the bottles are stored at room temperature for 6 months.

EXAMPLE B

The procedure of Example A is repeated except that the protein Supro.RTM. Plus 675 is replaced with the protein FXP 950 made by Solae.RTM. LLC.

EXAMPLE C

The procedure of Example A is repeated except that the protein Supro.RTM. Plus 675 is replaced with the protein FXP HO120 made by Solae.RTM. LLC.

EXAMPLE D

The procedure of Example A is repeated except that the protein Supro.RTM. Plus 675 is replaced with the protein Supro.RTM. XT 40 made by Solae.RTM. LLC.

The invention having been generally described above, may be better understood by reference to the examples described below. The following examples represent specific but non-limiting embodiments of the present invention.

Once components (A), (B) and (C) or (C1) are prepared, all that remains is to combine the components to form the acid beverage composition according to the three processes. For the first process, a preblend (I) is prepared by combining (A)and (B). Preblend (I) is further combined with (C) followed by pasteurization and homogenization to form the acid beverage composition. After hydration of the stabilizing agent slurry, Component (A), is complete. The flavoring material, Component (B),is added to Component (A) to form preblend (I). It is necessary in the present invention to keep preblend (I) at a pH lower than 7 to prevent the stabilizing agent being degraded by beta-elimination. To this end, the pH of preblend (I) is maintained atbetween 2.0-5.5. The (A):(B) weight ratio for forming preblend (I) is generally from 65-73:27-32, preferably from 65-75:25-35 and most preferably from 60-80:20-40. The preblend (I):(C) for forming the acid beverage composition by the first process isgenerally from 55-75:25-45, preferably from 60-70:30-40 and most preferably from 62-68:32-38.

In the second process, in addition to forming preblend (I) by combining (A) and (B), a preblend (II) is formed by combining (A) and (C). Preblend (I) and preblend (II) are combined followed by pasteurization and homogenization to form the acidbeverage composition. The (A):(B) weight ratio for forming preblend (I) is generally from 65-73:27-32, preferably from 65-75:25-35 and most preferably from 60-80:20-40. The (A):(C) weight ratio for forming preblend (II) is generally from 25-35:65-75,preferably from 20-30:70-80 and most preferably from 15-25-75-85. Further, the preblend (I):preblend (II) weight ratio is generally from 25-55:45-75, preferably from 30-50:50-70 and most preferably from 35-45:55-65.

For the third process, a preblend (III) is prepared by combining (A) and (C1). Component (C1) is a non-pasteurized aqueous protein slurry. Preblend (III) is further combined with (B), followed by pasteurization and homogenization. The (A):(C1) weight ratio for forming preblend (III) is generally from 45-70:30-55, preferably from 50-65:35-50 and most preferably from 55-60:40-45. Further, the preblend (III):(B) weight ratio is generally from 70-95:5-30, preferably from75-90:10-25 and most preferably from 80-85:15-20.

Preblend (I) and Component (C) are blended together as per the first process. Preblend (I) and preblend (II) are blended together as per the second process. Preblend (III) and Component (C1) are blended together as per the third process. The blend, irrespective of its process, has a pH of from 3.0-4.5, preferably from 3.5-4.2 and most preferably from 3.8-4.0 and is subjected to a sterilization or pasteurization step by heating either blend at a relatively high temperature for a shortperiod of time. This pasteurization step kills microorganisms in the blend. For example, an effective treatment for killing microorganisms in the blend involves heating the blend to a temperature of about 180° F. for about 10 seconds,preferably to a temperature of at least 190° F. for at least 30 seconds and most preferably at a temperature of 195° F. for 60 seconds. While a

213

temperature lower than 180° F. may work, a temperature of at least 180° F.provides a safety factor. Temperatures greater than 200° F. also have an effect on the killing of microorganisms. However, the cost associated with the higher temperature does not translate to a product that contains appreciably fewer harmfulmicroorganisms. Further, pasteurizing at too high a temperature for too long a period of time may cause the protein to further denature, which generates more sediment due to the insolubility of the further denatured protein.

Homogenization serves to decrease the particle size of the protein in the blend. Either blend is transferred to a Gaulin homogenizer (model 15MR) and is homogenized in two stages, a high pressure stage and a low pressure stage. The highpressure stage is from 1500-5000 pounds per square inch and preferably from 2000-3000 pounds per square inch. The low pressure stage is from 300-1000 pounds per square inch and preferably from 400-700 pounds per square inch.

The blend, by either process, has a pH of from 3.0-4.5, preferably from 3.2-4.0 and most preferably from 3.6-3.8. The bottles are hot filled, inverted for 2 minutes and then placed in ice water to bring the temperature of the contents to aboutroom temperature. The bottles are stored and particle size and viscosity values are determined at 1 month. Sediment values are determined at 1, 4 and 6 months.

Examples 6-9 are directed to the preparation of a stabilized acid beverage composition using Component (C) of Examples 2-5 and Components (A) and (B) as shown within the third process as defined within FIG. 4.

EXAMPLE 6

A 6.25 g protein per 8 oz serving fortified juice beverage is made using the aqueous protein slurry of Example 2.

Added to a vessel are 2695 g of de-ionized water and 55 g pectin (YM-100L). The contents are stirred at 170° F. for 5 minutes and then cooled to room temperature. The pectin slurry is added to 2360 g of an aqueous protein slurry asprepared in Example 2 followed by 1 kg sucrose and mixed for 5 minutes. Added are 210 grams of apple juice concentrate and 27 grams of citric acid and the pH is adjusted to 3.8-4.0 with phosphoric acid. The contents are pasteurized at 195° F.for 30 seconds, and homogenized at 2500 psi in the first stage and 500 psi in the second stage to give a protein stabilized acid beverage. Bottles are hot filled with the beverage at 180-185° F. The bottles are inverted, held for 2 minutes andthen placed in ice water to bring the temperature of the contents to about room temperature. After the contents of the bottles are brought to about room temperature, the bottles are stored and evaluated for sediment.

EXAMPLE 7

A 6.25 g protein per 8 oz serving fortified juice beverage is made using the aqueous protein slurry of Example 3 following the procedure of Example 6.

EXAMPLE 8

A 6.25 g protein per 8 oz serving fortified juice beverage is made using the aqueous protein slurry of Example 4 following the procedure of Example 6.

EXAMPLE 9

A 6.25 g protein per 8 oz serving fortified juice beverage is made using the aqueous protein slurry of Example 5 following the procedure of Example 6.

The baseline process beverage Examples A, B, C and D and the inventive process beverage examples 6, 7, 8 and 9 are compared to each other, protein for protein, in storage sediment values in Table I. Inventive Example 6 is compared to baselineExample A; inventive Example 7 is compared to baseline Example B; inventive Example 8 is compared to baseline Example C; and inventive Example 9 is compared to baseline Example D.

TABLE-US-00001 TABLE I % Storage Sediment Values One Month Four Months Six Months Example 4° C. 25° C. 4° C. 25° C. 4° C. 25° C. A 5.7 7.0 6.4 7.3 NA 11.0 6 0.8 1.2 1.1 2.1 2.2 3.2 B

214

6.3 5.9 NA NA10.0 11.6 7 0.5 0.6 1.1 1.6 1.1 2.1 C 1.1 2.7 7.6 9.6 9.0 13.2 8 0.0 0.0 0.0 1.2 1.2 4.9 D 3.4 3.3 5.5 6.2 6.4 8.7 9 2.1 0.5 2.2 3.3 5.4 6.6

It is observed from the storage sediment data of the above examples that the embodiments encompassing the process of this invention offer an improvement in less sediment in preparing a protein based acid beverage over the normal process forpreparing the beverage.

While the invention has been explained in relation to its preferred embodiments, it is to be understood that various modifications thereof will become apparent to those skilled in the art upon reading the description. Therefore, it is to beunderstood that the invention disclosed herein is intended to cover such modifications as fall within the scope of the appended claims. FIELD OF THE INVENTION

The present invention generally relates to a process for manufacturing cheese products and other dairy products, and more particularly, to a process for manufacturing cheese products and other dairy products using lactobionic acid and to theresulting products thereof.

BACKGROUND OF THE INVENTION

Cheeses are generally made by adding a microorganism to milk which is capable of metabolizing lactose to produce lactic acid and develop acidity. The milk is usually set with a milk clotting or coagulation enzyme, such as rennet, or bydeveloping acidity to the isoelectric point of the casein. Enzyme coagulation of milk also requires an acidic environment. The milk is inoculated with a bacterial culture or starter culture which produces sufficient lactic acid for the rennet to work. The coagulum or curd that results generally incorporates transformed casein, fats including natural butter fat, and flavorings that arise (especially when a bacterial culture is used). The coagulated milk is cut, whey separated and then recovered fromthe resulting curd. The curd may be pressed to provide a cheese block; curing may take place over a period of time under controlled conditions. For instance, a hard cheese such as cheddar cheese may be cured from about 10 days to one year or more,depending on the desired cheese flavor and body breakdown.

It also is well known to provide a cheese product having some of the characteristics of natural cheese by comminuting one or more natural cheeses, and heating the cheese with an emulsifying agent. The name given to the resulting product dependsupon the ingredients used and its composition and, in some instances, is determined by Regulations promulgated by the U.S. Food and Drug Administration, known as Standards of Identity. For example, the term "pasteurized process cheese" refers to aproduct comprising a blend of cheeses to which an emulsifying agent, and possibly acids, are added, and the mixture is then worked and heated into a homogeneous, plastic mass. Under the current Standards of Identity, the moisture level of process cheesegenerally does not exceed about 44 percent and process cheese has a minimum fat level of about 40 percent on a dry basis.

It is also known that natural cheese can be manufactured using concentrated milk which has been prepared by membrane processing, such as ultrafiltration, in which milk is cycled across a semi-permeable membrane at an elevated pressure such thatwater and low molecular weight components pass through the membrane, while certain proteins and fats are retained by the membrane. Cheese making cultures are added to the obtained concentrated milk which is then fermented, usually in the presence of amilk coagulating enzyme, such as rennet, to provide a coagulum. The resulting coagulum is cut or broken to cause syneresis resulting in whey separation. The whey is drained and the curd is processed. The type of cheese cultures used and the processingvaries with the desired cheese product. The curd may then be salted, placed in molds, and pressed to allow further whey drainage. The cheese is then ripened to the extent desired.

Cream cheese is an acid-coagulated, non-cured cheese made of dairy components including cream. Cream cheese, which is normally stored under refrigeration conditions, has a smooth and butter-like consistency with a delicate dairy flavor profile,which does not accommodate off-flavors. The texture and body of cream cheese at refrigeration temperatures is generally such that the cream cheese can be sliced and spread. In making cream cheese, sweet cream and dry milk-derived solids or milk aretypically blended with a dry blend of vegetable gum and salt in preselected proportions to form a cream cheese mix. The cream cheese mix normally has a butterfat content of from about 10 to about 14 percent (and in certain make procedures up to as muchas 20 percent), so that after processing, the finished cream cheese product will have a butterfat content of at least

215

about 33 percent of the product, and a total milk solids content of at least 45 percent corresponding to the presence of not more thanabout 55 percent moisture in the cream cheese product.

The cream cheese mix is inoculated with a lactic acid culture. Rennet may be used to aid the coagulation of the mix. The mix is cultured by holding it at the inoculation temperature until it has ripened and a coagulum is formed. The acidity ofthe coagulum may typically be in the range of from about 0.6 to about 0.9 percent (calculated as percent equivalent lactic acid), and the pH of the cultured coagulum may typically be in the range of from about 4.2 to about 5. The resulting coagulum isexposed to a temperature of about 180° F. for a brief period of time and then centrifuged to separate the curd from the whey, and then the cream cheese product is cooled and packaged. Cream cheese generally contains about 2 to about 3 percentlactose.

Lactose (4-O-β-D-galactopyranosyl-D-glucopyranose), commonly called milk sugar, is the primary carbohydrate of milk. Lactose is a low value sugar in food systems because of lactose intolerance and due to its contribution to browningreactions and crystallization. The use of milk substitutes or reduced dairy content in cheese mixes to reduce lactose content in the produced cheese may not provide acceptable products from standpoints of complying with Standards of Identityregulations, processability, and/or ultimate product physical properties and flavor characteristics.

Lactobionic acid (4-O-β-D-galactopyranosyl-D-gluconic acid; CAS Reg. No. 96-82-2) is a water soluble, white crystalline compound and can be synthesized from lactose by oxidation of the free aldehyde group in lactose as carried outcatalytically, chemically, electrolytically, or enzymatically. Harju, Bulletin of the IDF 289, ch. 6., pp. 27-30, 1993; Satory et al., Biotechnology Letters 19 (12) 1205-08, 1997. The use of lactobionic acid or its salts as additives in food productspreviously has been suggested for several specific applications. Calcium or iron chelate forms of lactobionic acid has been described for dietary mineral supplementation. Riviera et al., Amer. J. Clin. Nutr.; 36 (6) 1162-69, 1982. U.S. Pat. No.5,851,578 describes a clear beverage having a non-gel forming fiber, and water soluble salts of calcium, with or without water soluble vitamins, with or without additional mineral salt supplements and buffered with food acids. The food acid bufferingagent includes citric, lactic, maleic, adipic, succinic, acetic, acetic gluconic, lactobionic, ascorbic, pyruvic, and phosphoric acids, as well as combinations thereof. Calcium lactobionate, a salt form of lactobionic acid, has been approved for use asa firming agent in dry pudding mixes. 21 C.F.R. .sctn.172.720 (1999). Also, the possible use of lactobionic acid as a general food acidulent has been proposed, albeit without exploration or illustration. Timmermans, Whey: Proceedings of the 2nd Int'lWhey Conf., Int'l Dairy Federation, Chicago, October 1997, pp. 233, 249. This article generally describes lactobionic acid as being useful as an antibiotics carrier, an organ transplant preservative, mineral supplementation, growth promotion ofbifidobacteria, or as a co-builder in detergents in its K-lactobionate salt form.

It would be desirable to manufacture cheeses with reduced lactose content while preserving flavor, texture, and appearance characteristics comparable with conventional cheese products. It would also be desirable to reduce starter culturingrequirements and the time associated therewith in cheese production, while maintaining acceptable organoleptic attributes. It would also be desirable to increase the solids levels in manufactured cheeses while using reduced amounts of starter culturesas compared to conventional practice. It would also be desirable to be able to use higher lactose containing whey concentrates in cream cheese formulations without the need to increase the usage of cultures. The present invention provides such methodsand products in which lactobionic acid is provided in a cheese mix.

SUMMARY OF THE INVENTION

The present invention relates to a process for manufacturing cheeses and other dairy products, and the resulting products, in which lactobionic acid is added, or generated in situ, in combination with a dairy component in the course of theprocess. The cheeses and other dairy products made according to this invention have fully acceptable organoleptic attributes, while permitting reductions in processing time, and/or the requirements for other ingredients, such as starting cultures and/orrennet. Process flexibility is provided in this way, as well as increased production yields and possible savings in ingredient costs. For purposes of this invention, the term "lactobionic acid" is intended to include lactobionic acid as well as ediblesalts thereof (e.g., alkali and alkaline earth salts, ammonium salts, and the like).

It has surprisingly been found that lactobionic acid can be used for direct acidic coagulation of

216

cheeses, such as cream cheeses, without the need to use culturing and/or rennet. Lactobionic acid also has a pH-decreasing effect on cheese mixes,such that it acidifies dairy components used in cheese production, such as milk, sweet creams, and whey. In addition, lactobionic acid has a sweet acidic taste that has been found to be compatible with cheese products. The resulting cheese productsmade with lactobionic acid have fully acceptable flavor, appearance, texture, and mouthfeel attributes.

In another embodiment, lactobionic acid is used to reduce, and optionally even eliminate, the amount of cheese starting culture used in cheese manufacture, such as hard cheese or ultrafiltered (UF) cheese production. A starting culture, asreferenced in this context, generally means a lactic acid bacteria. In the instance of hard-cheese production, such as cheddar cheese production, the lactobionic acid introduced to the cheese mix is used to partially replace and reduce the amount ofstarting cultures that otherwise normally would be used, which effectively aids the acidification of the cheese mix. This procedure provides a cheese product including a mixture of lactic acid and lactobionic acid, which improves yield. The lactobionicacid also can be used as an ingredient in process cheese production, yielding acceptable products.

The lactobionic acid can be added to a cheese mixture in a process according to any of the embodiments described herein to provide these effects in its free acid form, or as a consumable salt form thereof, or in a pH neutralized form Neutralizedform, for purposes herein, means that lactobionic acid is neutralized, prior to admixture with the cheese mix, in an aqueous solution to a pH of about 7 by admixture therewith an alkaline agent that will yield biocompatible neutralization products, suchas an alkali metal hydroxide like sodium hydroxide or potassium hydroxide, or an alkaline earth metal hydroxide such as calcium hydroxide, or an alkaline earth metal carbonate such as calcium carbonate.

In another advantageous mode of the invention, which is applicable to all the various cheese-making and other dairy product-making embodiments described herein that employ one or more lactose-containing dairy component ingredients in the cheesemix, the lactobionic acid can be introduced to the cheese mixture through its in situ generation by catalytic action of an added carbohydrate oxidase enzyme on the lactose present in the dairy component(s) of the cheese mixture. Suitable carbohydrateoxidase enzymes include, for example, lactose oxidase, glucose oxidase, hexose oxidase, and the like, as well as mixtures thereof. Generally, lactose oxidase is preferred.

The in situ generation of lactobionic acid in a cheese mix during cheese manufacture gives rise to a multitude of beneficial effects. First, it effectively reduces the lactose content of the original dairy component(s) of the cheese mixtures,permitting lactose-reduced products to be achieved. Therefore, among other things, this aspect of the invention can be used for the production of lactose-reduced cheese products. Alternatively, it allows the use of relatively richer-lactose ingredientsin the original cheese mix, due to the conversion of a portion of the lactose content thereof to lactobionic acid, as will occur during the course of cheese making after the lactobionic acid is generated. In addition, lactobionic acid has a mass weightthat is approximately four times greater than that of lactic acid. Consequently, the lactobionic acid retained in the cheese product, which has been derived from the catalytic conversion of lactose, has a much greater mass, on an equi-molar basis, thanthe lactose converted to lactic acid. This effect enhances the appearance, texture and mouthfeel of the cheese product. In this way, the lactobionic acid can act as a bulking agent. For purposes herein, the term "bulking agent" means an agent whichmimics the effects of natural fat and/or protein in cheese compositions insofar as its effects on the. appearance (e.g., firmness, opacity) and textural qualities (e.g., lubricity, smoothness, mouthfeel) of the cheese.

In general, the proportion of lactobionic acid added to a cheese mix, or generated in situ via enzymatic lactose conversion as catalyzed by carbohydrate oxidase addition, to provide one or more of these advantageous effects, ranges from about 0.1to about 10 percent, particularly from about 2 to about 6 percent, and more particularly from about 3 to about 5 percent, based on the total weight of the cheese mix before separation of curd and whey.

The whey products of cheeses made using lactobionic acid according to this invention, and which therefore retain a portion of the lactobionic acid ingredient, also can be recycled, instead of being completely discarded as waste, for use asstarting ingredients in separate cheese production batches or runs used for making process cheeses or cream cheeses. Alternatively, the whey product of a natural cheese making procedure can have the lactobionic acid or lactose oxidase

217

added thereto, andthe so-treated whey product can be used as a starting ingredient in the separate manufacture of process cheeses, cream cheeses, or other dairy products (including, for example, whey beverages, whey-containing power or candy bars, and the like).

The invention is remarkable in its versatility. Experimental studies, as described herein, demonstrate its applicability in the manufacture of widely varied types of cheeses including cream cheeses, hard cheeses, and pasteurized process cheeses. The invention also has been successfully demonstrated in the manufacture of so-called UF cheeses made from ultrafiltered (UF) concentrated milk. The invention also has been successfully demonstrated in the manufacture of other dairy products such as,for example, sour cream, yogurt, milk, reduced-lactose milk, and the like. Cheeses and other dairy products prepared with and/or containing lactobionic acid according to this invention have acceptable tastes and textures similar to the conventionalcheeses and other dairy products of the corresponding kind.

The cheese products containing lactobionic acid also have improved product stability due to the preservative effect of the lactobionic acid. As an added advantage, the chelation properties of the lactobionic acid can be utilized as amilk-derived delivery vehicle in calcium supplementation of food products. 

BRIEF DESCRIPTION OF THE DRAWINGS

Other features and advantages of the present invention will become apparent from the following detailed description of preferred embodiments of the invention with reference to the drawings, in which:

FIG. 1 is a flow chart of steps used in an embodiment of the invention for production of cream cheese;

FIG. 2 is a flow chart of steps used in another embodiment of the invention for production of cream cheese;

FIG. 3 is a flow chart of steps used in an embodiment of the invention for production of cheddar cheese;

FIG. 4 is a flow chart of steps used in another embodiment of the invention for production of cheddar cheese;

FIG. 5 is a flow chart of steps used in an embodiment of the invention for production of UF cheese;

FIG. 6 contains flow charts of steps used in embodiments of the invention for production of process cheese wherein lactobionic acid from various sources (6A, 6B, and 6C) is added to a process cheese mixture;

FIG. 7 is a reaction flow scheme showing a theorized reaction mechanism for the enzymatic oxidation of lactose using lactose oxidase.

FIG. 8 is a graph showing post-creaming curves (viscosity as a function of time) for the process cheeses (inventive and control) as prepared in Example 7; and

FIG. 9 is a graph showing post-creaming curves (viscosity as a function of time) for the process cheeses (inventive and control) as prepared in Example 8.

DETAILED DESCRIPTION OF THE INVENTION

Referring to FIG. 1, a general process scheme according to one embodiment of the invention is illustrated in which lactobionic acid is used for direct acidic coagulation of a cream cheese, without culturing or the addition of rennet. The creamcheese made is a soft, mild, acid-coagulated non-cured cheese made of dairy products including cream, such as mixtures of cream and whey protein concentrate. As indicated in step 101, the consistency of the cream cheese composition, permittingspreadability while retaining firmness, is modulated by the addition of a vegetable gum, such as bean carob gum. Salt and a preservative is added. Any lack of cultured notes in the directly acidified cheese can optionally be overcome by usingflavoring. systems for creating the desired

218

cheese flavor. The dairy fluid and whey protein concentrate are added in suitable proportions to provide a cheese mix that can be processed according to the invention to provide a cream cheese having a milkfat content of least about 33 percent, and a moisture content not exceeding about 55 percent based on the weight of the cream cheese product.

The lactobionic acid is added in an amount effective to reduce the pH to the isoelectric point (i.e., about 4.52) of the casein in the dairy ingredients. The proportion of lactobionic acid added to the cream cheese mix generally ranges fromabout 0.1 to about 10 percent, particularly from about 2 to about 6 percent, and more particularly from about 3 to about 5 percent, based on the total weight of the cheese mix before separation of curd and whey.

The lactobionic acid can be added to the cheese mix directly as an extraneous ingredient in its free acid form, or, alternatively in salt form or in neutralized acid form. The free acid form reduces the pH of the cheese blend. The cheese mixformulation can be adjusted to compensate for any reductions in pH that are greater than desired for optimal coagulation and physical properties in the product. The neutralized form of the lactobionic acid does not impact the pH of the product. In saltform, the lactobionic acid generally is provided as an alkali salt or an alkaline earth metal salt, such as a sodium salt, a potassium salt, or a calcium salt thereof; of course, other lactobionic salts can be used, if desired, so long as they areacceptable for use in food products. The neutralized form of the lactobionic acid can be prepared by neutralizing lactobionic acid dissolved in an aqueous solution, such by addition thereto of an alkaline agent such as sodium or potassium hydroxidesufficient to adjust the pH of the solution to about 7.

As shown in FIG. 1, a cheese mix is thoroughly blended and coagulates due to the acidity of the lactobionic acid (step 103), or other acid added in the case of using neutralized lactobionic acid. The mix is then heated to about 180° F.for about 5 minutes for a short-time pasteurization treatment (step 105), and thereafter is homogenized (step 107). In step 109, the curds and whey can be separated by any conventional technique, including, for example, centrifugation, filtration,mechanical treatment, and the like. The curd product can be packaged cold or hot, and thereafter is stored cold. The cream cheese product (111) and the whey (113) contain lactobionic acid. The whey product containing the lactobionic acid can be reusedas a starting ingredient in subsequent cream cheese mixes. This reduces the amount of waste and makes the processing operation more efficient. The introduction of lactobionic acid (whether free, salt form or neutralized) does not bring about anyundesirable organoleptic attributes, such as off flavors, in the cream cheese product, while the texture, appearance and mouthfeel is comparable with conventionally manufactured cream cheese.

Referring now to FIG. 2, cream cheese is prepared according to another aspect of the invention in which lactobionic acid is generated in situ in the cream cheese mix via lactose conversion as catalyzed by lactose oxidase addition. In thisprocess scheme, the cream cheese mix is prepared (step 201), and then it is pasteurized (step 203) and thereafter homogenized (step 205). At this juncture (step 207), an oxidase enzyme is added which catalyzes the in situ oxidization of lactose presentin the dairy liquids to lactobionic acid. The lactobionic acid generated has a pH-reducing effect on the cheese mix. Suitable oxidases in this respect include, for example, lactose oxidase, cellobiose dehydrogenase, glucose-fructose oxidoreductase,hexose oxidase, and any other oxidases having the above-mentioned functionality.

A particularly suitable enzyme for lactose oxidation has been developed by Novozymes A/S and is described in Patent WO 9931990 which is hereby incorporated by reference. As illustrated in FIG. 7, the lactose oxidase can be introduced and used inthe form of a flavo-enzyme. This flavo-enzyme from Novozymes A/S contains flavin adenine dinucleotide (FAD) and, thus, does not require an external electron acceptor or a second enzyme to regenerate the cofactor. This carbohydrate oxidase is producedin a genetically modified microorganism. FAD (flavin adenine dinucleotide) is used as a electron-transfer co-factor with the carbohydrate oxidase enzyme. The enzyme includes activity between a pH of about 5 to about 9, and at temperatures including upto approximately 100° F. (88° C.). The preferred substrates are di, tri, and tetrasaccharides. Among the disaccharides, lactose is the most suitable substrate; oxidation at the C1 position of the glucose moiety of lactose results inlactobionic acid and hydrogen peroxide formation in a single reaction step. This enzyme will generally be referred to as "lactose oxidase." The activity units value is 146 U/ml, measured as mMole oxidized glucose per minute at pH 6 and 77° F.(25° C.). As shown in the reaction pathway schematically illustrated in FIG. 7, FAD is reduced in an intermediate form and then is deoxidized upon completion of the conversion of the lactose to lactobionic acid. Hydrogen peroxide is aby-

219

product of the reaction.

Cellobiose dehydrogenase is also a useful enzyme for converting lactose to lactobionic acid Canevascini et al., Zeitschrift fur Lebensmittel Untersuchung und Forschung, 175: 125-129 (1982). This enzyme is, however, complex and requires the useof a relatively expensive co-factor (e.g., quinones, cytochrome C, Fe(III), and the like); it also requires immobilization. Also, a second enzyme, laccase, is required to regenerate the co-factor used with cellobiose dehydrogenase. The use ofglucose-fructose oxidoreductase to oxidize lactose results in two products, sorbitol and lactobionic acid, and a further separation procedure is necessary to recover the lactobionic acid product. Nidetzky et al., Biotechnology and Bioengineering, Vol.53 (1997). Nonetheless, glucose-fructose oxidoreductase also is a suitable enzyme for the practice of this embodiment of the invention. Alternatively less efficient enzyme systems can be used. For example, lactase can be used to first hydrolyze thelactose to glucose and galactose followed by oxidation of glucose and galactose using glucose oxidase and galactose dehydrogenase.

The amount of oxidase enzyme added is an amount effective to reduce the pH or help reduce the pH of the cheese mix such that it coagulates. The amount of oxidase addition preferably is sufficient to generate a lactobionic acid content in thecheese mix of from about 0.1 to about 10 percent, particularly from about 2 to about 6 percent, and more particularly from about 3 to about 5 percent, based on the total weight of the cheese mix before separation of curd and whey.

A lactic acid culture also can be added in step 207. As the lactic acid culture also has the effect of converting lactose to lactic acid and reducing the pH of the cheese mix, the amount of lactose oxidase added can be adjusted downward to arelatively smaller amount to accommodate any addition of culture in this regard.

Referring still to FIG. 2, in step 209, the cheese mix is then incubated at about 72° F. for about 12 to about 20 hours. This incubation period or fermentation, is allowed to continue until the pH of the cheese mix is about 4.5 to about4.6. This is followed by heating to 180° F. to inactivate any culture added (step 211). After homogenization (step 213), the cream cheese curd (217) is separated from the whey (219).

In experimental studies, such as described below, the addition of carbohydrate oxidase permits the use of higher lactose levels or increases the amount of the lactose-derived solids in the dairy liquid ingredients that are converted tolactobionic acid, as compared to controls prepared with cultures but not the oxidase. The amount of lactose conversion achieved in the dairy liquid ingredients in this embodiment can reach about 85 percent or more. This permits cheeses to be preparedhaving highly reduced lactose content, or, alternatively, higher lactose content dairy ingredients can be used in the cheese mix.

Referring to FIG. 3, another embodiment of the invention is illustrated in which lactobionic acid is used as an active ingredient in a cheddar cheese mix. Furthermore, in this illustration, lactic acid bacteria, or other culture, is completelyomitted, such that the cheese mix is directly acidified using lactobionic acid alone in step 301. The cheese mix is prepared by mixing whole milk, water, and lactobionic acid in amounts generally as described relative to the discussion of FIG. 1. Nextrennet (e.g., chymosin) is added and the mixture is incubated at about 88° F. for about 30 minutes. The coagulum is cut with a knife to permit syneresis (step 307). The temperature is increased to about 102° F. with agitation and heldfor about 60 minutes. The pH of the coagulum can be about 5.8 at this point.

The whey (314) is removed from the curd (step 313), followed by salting (315), pressing (317), and packing the cheese curd (319). The whey by-product (314) contains lactobionic acid and can be reused as a starting ingredient in cheeseproduction.

As to the renneting in step (303), the most common method of enzyme coagulation is proteolysis by aspartate proteinases, which are enzymes that hydrolyze proteins. The main source of these enzymes is rennet, which can be obtained from animal,plant or fungal sources. The active ingredient of rennet is the enzyme fraction called rennin. The most important rennet is chymosin. The traditional main source of rennet has been the abomasum of young calves, but presently chymosin is commerciallyproduced from genetically altered-micro-organisms.

The cheddar cheese product made with and containing lactobionic acid has satisfactory

220

organoleptic and textural attributes without any off-flavors, and it is comparable to conventional cheddar cheese in terms of these characteristics. Thisembodiment, while illustrated with respect to cheddar cheese, is also applicable to the production of other hard cheeses.

Referring to FIG. 4, this embodiment is a variation on the embodiment of FIG. 3 in that the lactose oxidase is used to partially replace cultures to aid acidification of cheddar cheese. In step 401, the cheddar cheese mix is prepared with onlyabout 10 percent of the conventional amount of culturing (i.e., about 0.001 percent culture). An oxidase enzyme, such as lactose oxidase, is also added to the cheese mix. The function and amount of lactose oxidase added here are similar to thatdescribed above. relative to the embodiment described in connection with FIG. 2. Thereafter, steps 403-419 are performed which are similar to steps 303-319 described in relation to FIG. 3.

The cheddar cheese product had satisfactory organoleptic and textural attributes without any off-flavors, and it is comparable to conventional cheddar cheese in terms of these characteristics. The oxidase converts a significant portion of theoriginal lactose content of the dairy ingredient (e.g., milk) to lactobionic acid, which also helps to acidify the mix. Generally, about 10 to about 50 percent of the lactose can be converted to lactobionic acid; more preferably, about 20 to about 40percent is converted.

Referring now to FIG. 5, oxidase enzyme generation of lactobionic acid in situ for direct acidification of membrane filtered cheese in lieu of culturing is illustrated according to another embodiment of the invention. The UF cheese mix isprepared including an oxidase (step 501). Useful oxidases in this regard include those such as described above relative to the discussion of FIG. 2. Whole milk is ultrafiltered or microfiltered using a conventional apparatus for this purposes (step503). Milk is cycled across a semi-permeable membrane at an elevated pressure such that water and low molecular weight components pass through the membrane, while certain proteins and fats are retained by the membrane. The semi-permeable membrane, forexample, can be selected to restrict passage of molecules having a molecular weight larger than about 10,000. In step 505, sweet cream and rennet are added, followed by coagulation (step 507), and evaporation (step 509) to form the product 511 which isthen packed.

The lactose oxidase is added in an amount effective to oxidize at least a portion of the lactose to lactobionic acid, and to reduce the pH of the cheese mix sufficiently that a separately added rennet can induce coagulation. Generally the amountof oxidase added is sufficient to oxidize at least about 10 percent of the lactose present, more preferably about 10 to 95 percent of the lactose present, and even more preferably about 20 to about 40 percent of the lactose present.

The use of such an oxidase to generate lactobionic acid in situ using lactose present in the mixture offers the added advantage of significantly reducing lactose levels in the manufactured cheese or other dairy products as compared to thoseotherwise present in the absence of oxidase addition, all other things equal. Again, this permits attainment of either lower lactose levels in the cheese or other dairy product or the ability to use dairy ingredients in the cheese mix having higherlactose levels than otherwise would be ordinarily used. The lactobionic acid also serves to displace and diminish starter culture requirements, either partly or fully, otherwise applicable to cheese manufacture, while maintaining adequate texture andwithout the appearance of off-flavors. Where only part of the culturing is replaced with lactobionic acid introduction, the coagulation of the cheese mix can be performed via acid coagulation alone using both lactic acid and lactobionic acid added in acombined amount. In this way, yields are improved as time savings are achieved by at least reducing the culturing requirements. The optional co-addition of flavor concentrate to the cheese mix including the lactobionic acid can be used to adequatelycompensate in flavor for any reduced or omitted starter culture usage insofar as any desired cultured notes.

In an important embodiment of the present invention, lactobionic acid is incorporated into process cheese. Referring to FIG. 6, lactobionic acid, in various forms, is added to a process cheese mix otherwise including conventional ingredientssuch as emulsifiers, salt, preservative, colorants, comminuted hard cheese, and dairy components such as whey protein concentrates and dry whey (step 601). The cheese mix is heated to a plastic homogenous mass (step 603), and then is packed and cooled(step 605). In FIG. 6A, the lactobionic acid is added directly to the process cheese mix preparation. In FIG. 6B, the lactobionic acid is added using cheese containing biogenerated lactobionic acid. And in FIG. 6C, the lactobionic acid is added usingwhey or whey concentrate or permeate containing biogenerated lactobionic acid. Such whey concentrate could be obtained, for example, by treating whey with an appropriate lactose oxidase. The process cheese product made

221

with and containing lactobionicacid has satisfactory organoleptic and textural attributes without any off-flavors, and it is comparable to conventional process cheese in terms of these characteristics.

In the production of process cheese, it is often desired to reduce the fat and/or dry matter content of the process cheese. This need is based, inter alia, on consumer preferences for low calorie products and attempts to save costs per unitamount of process cheese. If either the fat or dry matter content in process cheese is reduced, however, there is often a problem concerning the texture of the resulting reduced fat and/or dry matter content product. Namely, such a product will usuallyhave a degraded texture and fail in the sensory evaluation (i.e., mouthfeel). The addition of lactobionic acid and/or a salt thereof to process has been found to provide a process cheese capable of having a reduced fat and/or dry matter content whilepreserving the texture and the sensory characteristics associated therewith. Specifically, it has been found that lactobionic acid or a salt thereof enhances process cheese post-creaming behavior (i.e., it increases the hot cheese viscosity duringcreaming following a heat treatment of the process cheese formulation). Lactobionic acid was found to be effective in enhancing process cheese post-creaming (i.e., increasing the hot cheese viscosity (or maintaining it at a reduced fat and/or dry mattercontent)), but not delaying the creaming process. Many firming agents (e.g., dextran, locust bean gum, and the like) also increase the hot cheese viscosity during creaming, but generally result in delaying the entire creaming process. Furthermore, gumsand starches lead to negative sensory attributes (e.g., mouthfeel and surface gloss) even at amounts of less than 2 percent. Gums, for example, cannot be used in some process cheese spreads at all for that reason.

Accordingly, the present invention provides a process cheese comprising about 0.1 to about 10 percent of lactobionic acid and/or a salt thereof. Preferably, the amount of lactobionic acid or a salt thereof in the process cheese of the presentinvention is in the range of from about 0.5 to about 7 percent, and more preferably about 1 to about 5 percent.

The lactobionic acid may be introduced into the process cheese formulation as such or in the form of its salt or mixtures thereof Any salt may be used as long as it is acceptable in a food product and does not otherwise deteriorate the processcheese characteristics. Examples of respective salts are alkali and earth alkali metal salts such as sodium, potassium, calcium, and magnesium salts as well as ammonium salts. Among these salts, sodium and calcium salts are preferred.

The dry matter content in the process cheese of the invention preferably amounts to about 25 to about 60 percent, and more preferably about 30 to about 50 percent. The fat content in the process cheese according to the present invention ispreferably about 5 to about 40 percent, and more preferably about 7 to about 30 percent. In this context, the expression "reduced fat and/or dry matter content" is to be understood as relating to a corresponding cheese formulation which does not containlactobionic acid. Accordingly, the person skilled in the art will appreciate that there may be process cheese formulations without lactobionic acid and having a lower fat and/or dry matter content than a process cheese according to the presentinvention. However, those conventional process cheese formulations will consequently lack the characteristics of the corresponding process cheese of the invention, such as textural stability and sensory benefits.

A process cheese of the present invention, including one having a reduced fat and/or dry matter content, may be produced by mixing conventional process cheese formulation ingredients with lactobionic acid and/or a salt thereof. Ingredientsconventionally used in the manufacture of process cheese comprise cheese, butter, anhydrous milk fat, casein, skim milk powder, whey powder, carbohydrates (such as starch, lactose, lactic acid and binding agent), salts (such as sodium chloride andmelting or emulsifying salts (e.g., salts of citric and phosphoric acids)) and water. That is, conventionally used process cheese formulations may be employed in the process of the present invention.

In the process of the invention, the lactobionic acid is preferably added in the form of an aqueous solution wherein the acid is introduced as such or in the form of its salt. A salt of lactobionic acid may be formed by adding a base such assodium hydroxide, potassium hydroxide, magnesium hydroxide or calcium hydroxide or the respective carbonates to a solution of lactobionic acid. The salt may also be formed by adjusting the pH in the process cheese formulation. Thus, it is to beunderstood that normally lactobionic acid salt will be formed upon mixing of the process cheese formulation ingredients with lactobionic acid. Preferably, the pH of the resulting process cheese formulation is adjusted in the range of about 5.5 to about5.9, more preferably about 5.6 to about 5.8.

222

In a preferred embodiment of the process of the present invention for preparing process cheese, the lactobionic acid and/or its salt partially or fully replaces lactose in the process cheese formulation. An additional benefit of the invention isthat browning due to the Maillard reaction is not increased in formulations with maintained lactose level and drastically reduced in formulations where lactose is partially replaced by lactobionic acid or its salt.

In the mixing step of the process according to the present invention, any mixing procedure practiced in the manufacture of process cheese can be used. Typically, this is a mixing to homogeneity under stirring/shear conditions at temperaturesbetween about 15 and about 30° C., and more preferred between about 20 and about 25° C. Conventional mixing equipment may be used such as any type of blender (e.g., stirrer, single or double ribbon, and the like). The mixing step as suchwill result in the desired texture (i.e., gel-like paste); the resulting product can be packaged as the final product or it may be treated further if desired or necessary depending on relevant government regulations. For example, an UHT (ultra hightemperature) treatment is legally required in certain countries or regions (e.g., European Union) to ensure a reduction of specific microorganisms (e.g., Clostridia). The structure of the process cheese mixture will usually be destroyed in a heattreatment step yielding a solution of highly hydrated ingredients regardless of the particular mixing device or procedure applied. Such a treatment will normally require a subsequent post-creaming of the mixture to regain the desired textural properties(i.e., a firm gel structure). Process cheese that does not undergo such a texture-destroying treatment, such as in the United States, generally are not post-creamed.

A detailed process for preparing process cheese with a post-creaming procedure will now be described. If the resulting mixture of process cheese formulation ingredients and lactobionic acid or its salt is heat treated, this treatment can becarried out under conditions commonly employed in the sterilization or UHT treatment. That is, the temperature is preferably about 105 to about 150° C. If the heat treatment is a UHT treatment, the temperature is more preferably about 135 toabout 140° C. (in case of indirect heating, e.g., with a plate heat exchanger) or about 140 to about 150° C. (in case of direct heating, e.g., by steam injection). If the heat treatment is a sterilization treatment, a more preferredtemperature is in the range of about 110 to about 120° C. The heat treatment is preferably carried out for about 2 seconds to about 20 minutes. More preferably, in case of the UHT treatment, the heating time is from about 2 to about 15 seconds,whereas it is in the range of from about 10 to about 20 minutes for the sterilization treatment. In general, the heat treatment can be carried out by means of direct steam injection or by using a scraped surface heat exchanger or any type of batchcooker (e.g., Stephan cooker) as conventionally used in this art.

In case of heat treatment, the heat-treated mixture is subsequently cooled to a temperature of preferably below about 100° C. and above about 15° C. (e.g., about 25 to about 98° C.). Economically sensible is of course atemperature that is close to that one of the following post-creaming step. Therefore, a particularly preferred range is about 70 to about 95° C. The cooling may be carried out by flash cooling (by pressure release) or by using any type of heatexchanger or other cooling device such as a plate heat exchanger, scraped surface heat exchanger, and the like, or any combination thereof.

Next, the cooled mixture is subjected to post-creaming which is preferably carried out at a temperature from about 70 to about 95° C., and more preferably about 80 to about 85° C. The post-creaming treatment can be carried out inany conventional vessel or tank with a device that allows a gentle, smooth stirring/shearing action. The post-creaming treatment is preferably conducted until the viscosity level of a corresponding process cheese not containing lactobionic acid or itssalt is achieved. Time-dependent viscosity curves of conventional post-creaming procedures are shown in FIGS. 8 and 9. As is evident from these curves, after an initiation phase, the viscosity reaches a plateau; preferably, the post-creaming treatmentis continued until this plateau is reached. For purposes of this invention, this plateau is considered to be the "time-independent viscosity level."

Although it may be desirable for better process monitoring, it is not necessary to measure the viscosity or related parameter in order to benefit from the effect of the invention. A few test trials and the evaluation of the corresponding producttexture may be sufficient to quickly identify the optimum creaming time (which will usually be at the plateau) for a formulation containing lactobionic acid or its salt. A plant manufacture can then be run with a time identified this way. The period ofthe post-creaming treatment is preferably up to about 90 minutes, and more preferably about 10 to about 40 minutes. The shear rate employed in the post-creaming treatment will usually

223

affect the creaming time and will vary depending on the plant layout(e.g., size, continuous or batch operation, and the like). However, characteristics such as shear rate do not have to be used as a controlling parameter.

In a preferred embodiment of the process of the present invention, the post-creaming reaction is initiated ("catalyzed") by adding well-creamed finished product (i.e., pre-cooked cheese) in an amount of up to about 10 percent, preferably morethan about 0.1 percent, more preferably in the range of from about 0.5 to about 5 percent, and most preferably about 2 percent. The pre-cooked cheese may be an ad hoc prepared material or, as in Examples 8 and 9, a commercial product. In the plant, itmay be convenient to use rework as the pre-cooked cheese for initiating the post-creaming reaction. The amount of pre-cooked cheese will affect the creaming time to a certain extent (i.e., the more pre-cooked cheese the shorter the creaming time); inExamples 8 and 9, portions of a creamed commercial product served this purpose. The addition of such a "catalyst" (i.e., pre-cooked cheese) is important to achieve the short creaming times in the Examples 8 and 9. If no pre-cooked cheese is used, thepost-creaming usually takes considerably longer (e.g., sometimes twice as long). FIGS. 8 and 9 are graphs showing the post-creaming curves (i.e., viscosity as a function of time) for the samples described in Examples 7 and 8, respectively.

The heat-treated and post-creamed process cheese may be further treated in the conventional manner (e.g., cooled, packaged, stored). The resulting process cheese is beneficial over conventional products in that it preserves comparable textureand sensory attributes at a lower fat and/or dry matter content or, alternatively, excels when exhibiting the same fat and dry matter content.

Having generally described the embodiments of the process illustrated in the figures as well as other embodiments, the invention will now be described using specific examples which further illustrate various features of the present invention butare not intended to limit the scope of the invention, which is defined in the appended claims. All percentages used herein are by weight, unless otherwise indicated.

EXAMPLE 1

An experimental composition incorporating features of one embodiment of the invention was prepared to demonstrate the use of lactobionic acid for direct acidification in the manufacture of cream cheese. The composition of the cheese mix preparedin this regard is presented in Table 1.

In order to prepare the cream cheese mixture, the lactobionic acid, commercially obtained from Lonza Inc. (Fairlawn, N.J.) as a white crystalline powder, was dissolved with stirring in the water used in the composition. The lactobionic acid wasadded in its free acid form in this experiment. The lactobionic acid-containing solution then was blended with the rest of the ingredients comprised of the sweet cream, ultrafiltered milk, salt (NaCl), and gum carob. The blend coagulated and the pH ofthe resulting mix was about 4.52. The blend was then cooked to about 180° F., and then homogenized at about 2500 psi. Throughout this process, the liquid dairy component was not permitted to cool to below about 140° F. The cream cheeseproduct obtained was then packaged in individual eight ounce cups and stored cold.

TABLE-US-00001 TABLE 1 Ingredients of an inventive cream cheese composition. Component Amount (%) sweet cream 77.89 UF milk (5×) 17.0 lactobionic acid 4.0 salt 0.7 gum 0.3 potassium sorbate 0.03 flavorants 0.08

The cream cheese product was organoleptically evaluated by trained evaluators. No off-flavors were detected. The overall appearance, taste, texture, and mouthfeel were acceptable. Also, the lack of cultured notes in the directly acidifiedcream cheese obtained could be overcome by using flavoring systems for creating a desired cream cheese flavor.

EXAMPLE 2

An experimental composition incorporating features of another embodiment of the invention was prepared to demonstrate the use of lactose oxidase enzyme to generate lactobionic acid in situ for acidification of cream cheese. The composition ofthe cream cheese mix is presented in Table 2. This composition was compared with a control composition representative of a conventional cream cheese.

224

In this experiment, an enzyme ingredient, lactose oxidase, was used to generate lactobionic acid in situ during the production of the cream cheese. The lactose oxidase was obtained from Novozymes A/S (Franklinton, N.C.). This lactose oxidasewas a flavo-enzyme having FAD (flavin adenine dinucleotide) present as co-factor with the lactose oxidase.

In order to prepare the cream cheese mix, the sweet cream, WPC 80, salt, gum carob, cream cheese flavor concentrate, and K sorbate were blended. The blend was then cooked to about 180° F. by heating and held for about 5 minutes, followedby homogenization of the cooked blend at about 2500 psi. At this juncture, the homogenized mix was inoculated with the lactose oxidase enzyme and a bulk cream cheese starter culture. The starter culture was a commercially available DVS Lactococcuslactis culture obtained from Chris Hansen, Inc., Milwaukee, Wis. After incubating at about 72° F. overnight (about 16 hours), the pH had dropped to about 4.4. After adjusting the pH to about 4.7 using fresh uninoculated cream cheese mix, themixture was then subjected to a heating step at about 180° F. and homogenized at about 2500 psi. The cheese product obtained was then packaged in 8 ounce cups and stored cold.

As a control run, another cheese mix was prepared according to the formulation described in Table 2 and the procedure described above, except that it omitted the lactose oxidase ingredient. The mixing percentages of the control run also arepresented in Table 2.

TABLE-US-00002 TABLE 2 Ingredients of inventive and control cream cheese compositions. Inventive Sample Control Sample Ingredient Amount (%) Amount (%) sweet cream 77.83 79.41 water 3.23 2.43 UF milk (5×) 17.0 17.0 lactose oxidase 0.82 0(258 U/ml) culture 0.01 0.01 salt 0.70 0.73 gum 0.30 0.31 potassium sorbate 0.03 0.03 flavorants 0.08 0.08

The untreated control cream cheese product was determined to contain about 2.5 percent lactose. By contrast, the lactose oxidase enzyme-treated cream cheese product representative of the invention contained only about 0.3 percent lactose. Thelactobionic acid content of the cream cheese products was determined using high performance liquid chromatography using an ion exchange protocol. In the case of the lactose oxidase enzyme-treated product, about 88 percent of the original lactose hadbeen converted to lactobionic acid.

As also shown by these results, this invention permits and enables the use of higher lactose containing whey protein concentrates in cream cheese mix formulations in addition to in situ generation of acidity to aid acidification.

EXAMPLE 3

An experimental composition incorporating features of yet another embodiment of the invention was prepared to demonstrate the use of lactobionic acid for direct acidification in the manufacture of cheddar cheese.

A cheddar cheese mixture containing 20 g lactobionic acid dissolved in 475 ml milk and 5 ml water was prepared in a sterile beaker. 500 μL double strength CHY-MAX™ was then added to the mixture. CHY-MAX™ is a range of fermentationproduced chymosin products, and it was obtained from Chr. Hansen, Inc., Milwaukee, Wis. The resulting mixture was incubated at about 88° F. for about 30 minutes. The coagulum was cut with a knife to allow syneresis. The coagulum was cooked toincrease its temperature from about 88° F. to about 102° F. with frequent shaking in a water bath. Once the coagulum reached a bout 102° F., it was incubated for about an additional 60 minutes at a pH of about 5.8, decanted, andthen pressed to remove whey. The curd was salted with 0.7 percent sodium chloride. The salted curd was pressed overnight (i.e., about 16 hours), and then the cheese was packed in vacuum bags.

The cheddar cheese product had satisfactory organoleptic and textural attributes without any off-flavors being detected. This embodiment offers time savings in hard cheese production, and thus increased output yields, due to the elimination ofprocessing involving lactic acid bacterial cultures.

EXAMPLE 4

An experimental composition incorporating features of another embodiment of the invention related to the manufacture of hard cheeses was prepared to demonstrate the use of lactose oxidase to

225

partially replace cultures, to aid acidification incheddar cheese making.

In order to prepare the cheddar cheese mixture, 950 units of lactose oxidase of the same type as that described in Example 2, was added to 475 ml milk and 5 ml water in a sterile beaker with mixing along with 0.001 percent starter culture. Thestarter culture was a DVS Lactococcus lactis culture, supplied by Chris Hansen, Inc., Milwaukee, Wis. The amount of culture normally used in cheddar cheese making is about 0.01 percent of the cheese mix, so this example employed only about 10 percent ofthe typical amount of starter culture content in a cheese mix.

Then, 500 μL of double strength CHY-MAX™ was added, and the resulting blend was incubated at about 88° F. for about 30 minutes. The coagulum was cut with a knife to allow syneresis. The coagulum was cooked to increase itstemperature from about 88° F. to about 102° F. with frequent shaking in a water bath. Once the coagulum reached about 102° F., it was incubated for an additional 60 minutes at pH 5.8, decanted, and then pressed to remove whey. The curd was salted with 0.7 percent sodium chloride. The salted curd was pressed overnight (i.e., about 16 hours), and then the cheese was packed in vacuum bags.

The results demonstrated that the in situ production of the lactobionic acid in cheddar cheese prepared in this experiment according to an embodiment of the invention reduced the amount of culture needed to be added to the cheese mix to lower thepH as needed.

Also, the lactose oxidase enzyme-treated cheddar cheese product representative of the invention contained less than about 0.2 percent lactose. A separate control run of the cheddar cheese product, prepared in the same way except using 0.01percent starter culture and without the lactose oxidase ingredient, was determined to contain less than about 0.3 percent lactose. The cheddar cheese product had satisfactory organoleptic and textural attributes without any off-flavors, and it wascomparable to the control sample of cheddar cheese in terms of these characteristics.

EXAMPLE 5

In another experiment, a lactose oxidase enzyme was used to generate lactobionic acid in situ for acidification in the production of UF cheese in lieu of culturing. The composition of the UF cheese mix is presented in Table 3.

For this procedure, 1000 ml of fresh skim milk was concentrated up to about five times at about 145° F. using a ultrafiltration device having a membrane pore size which restricted passage of molecules larger than 10,000 molecular weight. Prior to starting ultrafiltration, a lactose oxidase enzyme of the same type described in Example 2 was added in an amount of 0.2 units per gram of milk. 5.4 g of salt also was added at this time. Concentration was completed by the ultrafiltrationprocedure when 80 percent of the original milk volume was removed. 103 g of sweet cream (40 percent) was then added to the concentrated milk to achieve a protein to fat ratio of about 0.8. 10 μL of rennet was added to the concentrated skimmilk/cream mixture, and the mixture was stirred slowly until the lactose oxidase enzyme had converted sufficient lactose to lactobionic acid such that the mixture to reached a pH of about 5. Evaporation was performed to reach the final desired cheesemoisture level by a conventional evaporation method used for purpose.

TABLE-US-00003 TABLE 3 Ingredients of an inventive UF cheese composition. Ingredient Amount skim milk 1000 ml sweet cream (40%) 103 g enzyme 2000 units salt 5.4 g rennet 10 μL

By determining the lactose content in the product UF cheese and comparing that value with that of a control run, in which the UF cheese was prepared in the same manner except omitting the addition of the lactose oxidase, it was confirmed that thelactose present in the skim milk was converted into lactobionic acid when processed in the presence of the lactose oxidase enzyme. Additionally, less diafiltration was needed for the reacted retentate, as compared to that typically used in conventionalUF cheese production, because of the conversion of lactose to lactobionic acid. That is, this embodiment captured much more lactose derived solids than the same process would using starter cultures. Since lactobionic acid (formula weight 358.3) has amass weight/mole that is about four times the mass weight/mole of lactic acid (formula weight 90.08), on a molar basis, a greater mass derived from lactose is therefore retained on an equimolar basis when lactose is converted to lactobionic acid, such asaccording to this embodiment of the invention, rather than to lactic acid.

226

EXAMPLE 6

In this experiment, process cheeses were prepared from cheese mix compositions containing one of three different forms of lactobionic acid. The basic compositions of the three process cheese mixes are presented in Table 4. They only varied asto the particular form of the lactobionic acid used. As a control run, another cheese mix was prepared according to the formulation described in Table 4 and the procedure described below, except that it omitted the lactobionic acid.

The cheese mixes representing this invention comprised the following ingredients: whey protein concentrate (WPC 34, Wisconsin Whey International, Juda, Wis.) containing 34 percent whey protein, milk protein concentrate (NZ MPC-70, New ZealandMilk Products, Wellington, New Zealand), dry whey (containing 71.78 percent lactose; Krafen, Kraft Foods, Glenview Ill.), water, comminuted cheese, anhydrous milk fat (AMF), the colorants APO and annatto, sorbic acid, emulsifying agents (i.e., monosodiumphosphate and disodium phosphate), salt (NaCl), condensate, and lactobionic acid. The condensate is the water added into the cheese mass during cooking by way of condensation of steam used in the direct steam injection process used in the process cheesemanufacture. The amount of condensate is dependent upon the time, temperature of cooking, and initial temperature of the cheese mix. This amount is determined and is used in adjusting the water in the formulation. The control run had the samecomposition except that it did not contain lactobionic acid (all other components were included using the same ratios).

The cheese making procedure was as follows. Cheese, AMF, emulsifying salt, sorbic acid, mono and disodium phosphate, APO and annatto were added to a Hobart blender bowl and blended for about 2 minutes. A wet blend of the rest of the ingredientswas made in the lactobionic acid solution (described below) and added to the blender bowl. Mixing was continued until all the components were well blended. For the control run, a wet blend of the rest of the ingredients was instead made in the waterwithout the lactobionic acid, and that wet blend was added to the blender bowl.

The blended mixture was transferred to a cooker where it was cooked via direct steam injection. The mix was cooked to about 184° F. at a heating rate of about 1° F./min. The temperature was maintained at about 184° F. andblending was continued for about 2 minutes. The product was poured into 8 ounce cups, cooled and stored refrigerated until further use.

TABLE-US-00004 TABLE 4 Ingredients of an inventive process cheese composition. Ingredient Amount (g) Amount (%) MPC-70 344.74 15.22 WPC 34 94.80 2.18 Dry Whey 21.55 6.95 Water 679.04 29.94 Cheese 340.20 15.0 AMF 378.76 16.70 APO 0.46 0.02Annatto 0.46 0.02 Sorbic acid 2.29 0.10 MSP1 7.20 0.32 DSP1 55.63 2.45 Emulsifying salt 34.38 1.52 Condensate2 204.12 9.0 Form of Lactobionic acid3 90.72 4.0 1No monosodium phosphate was added when the lactobionic acid wasdirectly used. Instead, an equivalent amount of disodium phosphate was added in addition to the amount of that ingredient already specified forthat ingredient in Table 4 for the formulation. 2The"condensate" was the water added into the cheesemass during cooking by way of condensation of steam used in the conventional direct steam injection process used in the process cheese making. Theamount of condensate is dependent upon the time, temperature of cooking and the initial temperature of themix. This amount was determined and was used in adjusting the water in the cheese composition. 3One of three different forms of lactobionic acid were added respectively to the three different cheese mix samples having the above composition. Thesethree different lactobionic acid forms tested were addedin solution as follows: (a) lactobionic acid dissolved in the waterand used directly; (b) lactobionic acid solution, made by dissolving free acid in the water followed by neutralizing the acidsolution with sodium hydroxide to a pH of about 7 before adding the lactobionic acid containingsolution to the cheese mix; and (c) calcium salt of lactobionic acid, calcium lactobionate, which was dissolved in the water.

Additional process cheese samples of each of the three basic formulations described above were prepared by adjusting the lactobionic acid addition rate such that its level varied from about 1 to about 6 percent, in about 1 percent incrementsthrough that range. A level of about 4 percent lactobionic acid was found to be optimal in the process cheese products tested.

Appearance, flavor, texture and mouthfeel, and overall taste were organoleptically evaluated in a qualitative manner for each sample by a group of five evaluators using a four point scale of scoring: not acceptable, same as reference product,marginally better than reference product, and significantly better than reference product.

227

As the results of this evaluation, the process cheese containing the neutralized lactobionic acid was found to have an appearance similar to the control product. The texture and mouthfeel of that cheese product was also found to be on par withthe control. Use of free form lactobionic acid did not contribute to any off-flavors and some evaluators commented that it enhanced cheesy/dairy notes in the product.

The process cheese products containing non-neutralized lactobionic acid and calcium lactobionate were found to have acceptable cheese flavor. The appearance, texture, and mouth feel of those samples declined at higher levels of addition (greaterthan about 4 percent).

EXAMPLES 7 AND 8

These examples also illustrate the inclusion of lactobionic acid in process cheeses. All ingredients of the desired process cheese formulation are mixed and pre-emulsified for 3 minutes using a Thermomix TM21 (Vorwerk) at speed setting 6 androom temperature. In Example 7, the resulting mixture is heated in a Roversi apparatus to 60° C. by indirect heating followed by direct steam hearing for 80 seconds. In Example 8, the mixture is heated in the Roversi apparatus to 50° C.by indirect heating followed by direct steam heating for 105 seconds. In both examples, the mixture is cooled to 80° C., mixed with 2 percent pre-cooked cheese ("rework"; creamed commercial product), and post creamed in a BrabenderFarinograph-Resistograph, speed setting 2, at 80° C. until the viscosity plateau is reached (about 1 hour in both examples). The product is filled into containers, allowed to cool to ambient temperature, further cooled, and stored at 4° C. for at least 2 weeks.

The Brabender Farinograph used in the Examples 7 and 8 records the torque (100 Farino units=1 N m) which is related to the hot cheese viscosity. This device is used for small-scale experimentation since it mimics the creaming tank that is usedin a plant and combines it with a viscosity-recording device; such a device is, of course, not mandatory in the plant. Tests were conducted to ensure that the creaming curves obtained from both the Brabender Farinograph and the viscosity-measuringdevice used in the pilot plant are comparable (i.e., representative). The Farinograph is further described in detail in "The Farinograph Handbook", 3rd ed., B. L. D'Appolonia and W. H. Kunerth, eds., American Association of Cereal Chemists, St. Paul,U.S.A., 1984.

In Example 7, process cheese compositions of the following final formulations were prepared:

TABLE-US-00005 Control 1 Inventive Example 7 Dry matter 42.0 40.9 Fat 17.8 15.0 Protein 9.9 9.5 Lactose 5.8 5.7 Lactobionic acid 0.0 2.0

All processing parameters are identical for both formulations. The incorporation of 2 percent lactobionic acid allows a solids reduction of 1.1 percent and at the same time a fat reduction of 2.8 percent.

The detailed ingredients of the samples of Example 7 are as follows:

TABLE-US-00006 Control 1 Inventive Example 7 Butter 16.87 13.40 Milk protein 14.58 14.02 Cheese 17.50 17.50 Melting salts 3.15 3.28 Water 45.38 47.28 Sodium chloride 0.90 0.90 Binding agent 1.62 1.62 Lactobionic acid 0.0 2.0

Both formulations exhibit or are finally adjusted to a pH between 5.6 and 5.9, more preferred to a pH between 5.6 and 5.8.

In Example 8, process cheese compositions of the following final formulations were prepared:

TABLE-US-00007 Control 2 Inventive Example 8 Dry matter 40.7 40.1 Fat 22.2 18.9 Protein 12.3 12.3 Lactose 0.2 0.2 Lactobionic acid 0.0 3.0

All processing parameters are identical for both formulations. The incorporation of 3 percent of lactobionic acid allows a solids reduction of 0.6 percent and at the same time a fat reduction of 3.3 percent.

The detailed ingredients of the samples of Example 8 are as follows

228

TABLE-US-00008 Control 2 Inventive Example 8 Butter 18.94 15.59 Milk protein 10.96 10.96 Cheese 11.44 11.44 Melting salts 3.45 3.45 Water 53.81 54.56 Sodium chloride 1.0 1.0 Lactic acid 0.4 0 Lactobionic acid 0.0 3.0

Both formulations exhibit or are finally adjusted to a pH between 5.6 and 5.9, more preferred to a pH between 5.6 and 5.8.

The creaming curves (i.e., changes in hot cheese viscosity) for Example 7 samples are shown in FIG. 8 and for Example 8 samples in FIG. 9. The creaming curves of both inventive samples closely match those of the reference (prior art) samplesrepresenting the desired hot cheese viscosity. Differences in sensory attributes (e.g., surface gloss, stickiness to the foil, creaminess, saltiness, and sourness) between the inventive and control samples could not be identified by an informal sensoryevaluation.

EXAMPLE 9

This example illustrates the preparation of reduced lactose milk using lactose oxidase to convert lactose to lactobionic acid. Whole milk was pasteurized at 161° F. for 15 seconds and then cooled to 113° F. Lactose oxidase wasadded at a level of about 4 units/ml of milk. The reaction mixture was stirred thoroughly to disperse the enzyme. The resulting mixture was then incubated at 113° F. overnight to allow the enzymatic reaction to proceed. A control sample wasexposed to the same conditions except no enzyme was added. Samples were analyzed for lactose and lactobionic acid:

TABLE-US-00009 Control Inventive Lactose 4.45% 1.5% Lactobionic acid 0 3.2%

EXAMPLE 10

This example illustrates the biogeneration of lactobionic acid in sour cream using lactose oxidase. Formulations for a control and inventive sour cream are as follows:

TABLE-US-00010 Amount Ingredient Control Inventive Skim milk 52% 52% Cream 45% 45% Water 1% 1% Culture 0.1% 0.1% Rennet 0.01% 0.01% Lactose oxidase 0 4 units/ml

A mixture of skim milk, cream, and water was heated to 72° F. followed by the addition of the culture (i.e., Lactococcus lactis subsp. diacetilactis and Leuconostoc) and rennet for the control sample or the addition of culture (i.e.,Lactococcus lactis subsp. diacetilactis and Leuconostoc), rennet, and lactose oxidase for the inventive sample. The mixtures were incubated at 72° F. overnight to obtain the sour cream. The amount of lactose was reduced from about 2.5 percentin the control sample to about 1.7 percent in the inventive sample using the enzyme treatment.

EXAMPLE 11

This examples illustrates the biogeneration of lactobionic acid in yogurt using lactose oxidase oxidase to generate acidity and reduce lactose levels. Milk standardized to 2% milk fat was heated to 187° F. and held at that temperaturefor 20 minutes. After homogenization at 150° F., the mixture was cooled to 115° F. Culture (control sample) or culture and lactose oxidase (inventive sample) were added and the mixture incubated at 113° F. for 4 hours to pH 4.6. Lactose oxidase was added at a level of about 4 units/ml of milk. The culture was a mixture of Lactobacillus bulgaricus and Streptococcus thermophilus. The control yogurt contained about 3.4 percent lactose as compared to about 0.14 percent in theenzyme treated yogurt.

EXAMPLE 12

This example illustrates the use of lactobionic acid (either directly added or generated in situ) to modify whey proteins. Whey proteins modified using lactobionic acid are more functional as process cheese ingredients compared to whey proteinsmodified using traditional acids. Such modified whey proteins can be used as an ingredient in cheese or other dairy products.

Sample A. WPC-35 (30.5 lbs; whey protein concentrate containing 35 percent protein) was mixed in 51.2 lb water and acidified to pH 3.78 using 3.7 lb lactobionic acid. The resulting mixture was heated to 80° C. and held for 180 minutesand spray dried to produce a powder containing 26

229

percent protein. The modified WPC was incorporated into a process cheese formula at 16 percent by weight. The resulting process cheese had a penetrometer firmness value of 8.6 mm compared to 11.9 mm inprocess cheese incorporating the same level of whey protein modified using lactic acid, and 15.4 mm for process cheese produced using an unmodified WPC-35.

Sample B. WPC-35 was reconstituted in water to a total solids concentration of 33 percent and a final lactose concentration of 15 percent. This solution was pasteurized at 70.4° C. for 15 minutes and cooled to 55° C. Lactoseoxidase was added at 2 units/mL. Three liters of the reaction mixture was incubated in a 5 liter bioreactor vessel (New Brunswick) at 55° C.; pH was maintained constant at 7.0 and aeration was provided with constant sparging of filtered air andagitation at 75 rpm. The bioconversion was allowed to proceed for 48 hours resulting in the formation of the sodium salt of lactobionic acid. The pH of the resulting solution was adjusted to 3.35 with lactic acid; this was followed by heating to176° F. for 180 minutes. The heat-treated slurry was freeze dried.

The freeze dried modified WPC was incorporated into a process cheese formula at 16 percent. The resulting process cheese had a penetrometer firmness value of 8.2 mm compared to 12.6 mm in process cheese incorporating the same level of wheyprotein modified using lactic acid, and 16.5 mm for process cheese produced using an unmodified WPC-35.

Sample C. WPC-35 was reconstituted in water to a total solids concentration of 33 percent and-a final lactose concentration of 15 percent. This solution was pasteurized at 70.4° C. for 15 minutes and cooled to 55° C. Lactoseoxidase was added at 2 units/mL. Three liters of the reaction mixture was incubated in a 5 liter bioreactor vessel (New Brunswick) at 55° C., pH was maintained constant at 7.0 using pH stat and aeration was provided with constant sparging offiltered air and agitation at 75 rpm. The bioconversion was allowed to proceed for 48 hours resulting in the formation of the sodium salt of lactobionic acid. The pH of the resulting solution was adjusted to 3.35 with lactic acid; this was followed byheating to 176° F. for 180 minutes. The heat-treated slurry was cooled to 40F and stored for use as a liquid ingredient

The liquid modified WPC was incorporated into a process cheese formula at an amount providing 12% whey protein by weight. The resulting process cheese had a penetrometer firmness value of 3.9 mm compared to 14.9 mm in process cheeseincorporating the same level of whey protein modified using lactic acid, and 17.7.5 mm for process cheese produced using an unmodified WPC-35.

EXAMPLE 13

This examples illustrates the use of lactobionic acid to increase the lactose derived solids in process cheese. Because of the tendency of lactose to form undesirable crystals, lactose contents are generally limited to between about 6 and about9 percent in process cheese products depending on the specific formulation. Using lactobionic acid in addition to the lactose normally present allows higher lactose derived solids to be used in process cheese products.

Lactobionic acid 0.7 lb was combined with 2.9 lb MPC-70, 0.5 lb WPC-35, 4.7 lb dried sweet whey, and 11 lb water. This mixture was added to a melted blend of 40 lb cheddar cheese, 2 lb anhydrous milk fat, and 1.7 lb emulsifying salts. Theresulting process cheese was packed into slices. The process cheese slices containing 1 percent lactobionic acid were no different from control process cheese slices containing no lactobionic acid, but had the advantage of replacing about 1 percent ofthe protein and fat solids with lactobionic acid.

EXAMPLE 14

This examples illustrates the use of lactobionic acid to replace milk fat in process cheese. Lactobionic acid can replace up to 25 percent of the milk fat in process cheese with slight increase in product firmness and slight melt restriction.

The following formulations were used to produce several process cheese products.

TABLE-US-00011 Amount 2% 4% lactobionic lactobionic Ingredient Control acid acid Cheddar Cheese 26% 26% 26% Milk Fat 12.6% 10.6% 8.6% MPC-70 7.1% 7.1% 7.1% WPC-34 13.9% 13.9% 13.9% Dried Sweet Whey 0.2% 0.2% 0.2% Lactic Acid 0.6% 0.6% 0.6%Lactobionic Acid 0% 2.0% 4.0% (neutralized with NaOH) Water 35.2% 35.2% 35.2% Penetrometer 26.5 mm 21.1 mm

230

23.1 mm Firmness Melting Point 50.9° C. 64.7° C. 66.8° C.

Replacing milk fat with lactobionic acid increased firmness slightly and reduced melt restriction by a small amount.

Although the use of lactobionic acid has been illustrated herein in the manufacture of various types of cheeses and dairy products, it will be appreciated that the present invention also contemplates the use of lactobionic acid as a general foodacidulant, an emulsifying agent, a calcium fortifier or chelater, antioxidant, and bulking agent for other types of foods in addition to dairy products.

While the invention has been particularly described with specific reference to particular process and product embodiments, it will be appreciated that various alterations, modifications and adaptions may be based on the present disclosure, andare intended to be within the spirit and scope of the present invention as defined by the following claims. FIELD OF THE INVENTION

The invention is directed to a food product that is stabilized against the growth of microbiological contaminants. More specifically, the present invention is directed to a fresh mozzarella cheese that is stabilized against the growth ofmicrobiological contaminants by using a nisin-containing whey. The invention is also directed to a method of producing a nisin-containing whey and, more specifically, to a method of producing a nisin-containing whey from acid whey. The invention isalso directed to a nisin-containing whey, and more particularly, to a nisin-containing whey that is suitable for use in pack water of fresh mozzarella cheese.

BACKGROUND OF THE INVENTION

Mozzarella cheese is one of the more popular cheeses, especially for use in Italian cooking. There are generally two types of mozzarella cheese: a low-moisture mozzarella and a high-moisture mozzarella. Low moisture mozzarella, which typicallyhas a moisture content of less than 50%, has a long shelf life and is suitable for lengthy distribution supply chains and subsequent store display. High-moisture mozzarella, such as a fresh mozzarella cheese, on the other hand, typically has a moisturecontent of greater than 50%. The higher moisture gives the cheese a softer and more desirable taste and texture. To maintain this desired taste and texture, fresh mozzarella cheese is often packed in water to maintain its freshness.

Unfortunately, high-moisture, water-packed fresh mozzarella cheeses are more perishable and have shorter shelf lives. The higher moisture content of the cheese and the added pack water renders the product more susceptible to microbiologicalgrowth. Fresh mozzarella cheese also naturally has a pH of about 5.8, which may further cause problems with extended freshness. In combination, the relatively high pH and high moisture content poses a risk of growth of pathogenic bacteria such asListeria monocytogenes if contaminated with such bacteria. In addition, the typical shelf life of commercial fresh mozzarella cheese is generally only about four weeks due to gas formation by gas-producing spoilage bacteria such as bacteria from theLeuconostoc species in the event of contamination.

Whey is a diary processing byproduct from the manufacture of cheese. It is the serum or watery part of milk that is separated from the curd during the cheese-making process. Whey is often characterized by the type of cheese produced. Forexample, sweet whey is a whey generated from the manufacture of cheddar, mozzarella, or Swiss cheeses. On the other hand, acid whey is a whey generated from the manufacture of ricotta, impastata, cottage, or cream cheeses. Acid whey typically containsmainly lactose and low levels of denatured and highly cross-linked whey proteins. It has very limited commercial value due to difficulties in recovering such solid substances. Processing acid whey by traditional methods such as spray drying for proteinand lactose recoveries is quite difficult and cost prohibitive. More often, a manufacturer simply disposes of the acid whey byproduct, and generally pays a disposal fee to get rid of it.

Nisin is a peptide-like antibacterial substance produced by microorganisms such as Lactococcus lactis subsp. lactis (formerly known as Streptococcus lactis). It has been used to help stabilize various food products and its structure isillustrated in U.S. Pat. No. 5,527,505 to Yamauchi et al. The highest activity preparations of nisin contain about 40 million International Units (IU) per gram. Commercial preparations of nisin are available. For example, one commercial preparation,NISAPLIN.RTM., containing about 1 million IU, nisin per gram, is available from Aplin &

231

Barrett Ltd., Trowbridge, England. Another commercial preparation, CHRISIN.RTM., also containing about 1 million IU, nisin per gram, is available from Chr. HansonA/S (Denmark). Nisin has no known toxic effects in humans. It is widely used in a variety of prepared dairy foods. Experimental use in preserving other foods has also been reported. Details on these applications are provided below.

In U.S. Pat. No. 5,527,505, yogurt was produced from raw milk by incorporating a nisin-producing strain, Lactococcus lactis subsp. lactis, along with the traditional yogurt culture consisting of Streptococcus salivarius subsp. thermophilus(ST) and Lactobacillus delbrueckii subsp. bulgaricus (LB). This patent teaches that the lactococci are needed to secrete the nisin, whose effect is to retard the activity of ST and LB. The resulting yogurt therefore contains the lactococci used toproduce the nisin.

In U.S. Pat. No. 5,015,487, the use of nisin, as a representative of the class of lanthionine bacteriocins, to control undesirable microorganisms in heat processed meats is disclosed. In tests involving dipping frankfurters in nisin solutions,the growth of L. monocytogenes was effectively inhibited upon storage at 40° F.

Chung et al. (Appl. Envir. Microbiol., 55, 1329-1333 (1989)) report that nisin has an inhibitory effect on gram-positive bacteria, such as L. monocytogenes, Staphylococcus aureus, and Streptococcus lactis, but has no such effect ongram-negative bacteria such as Serratia marcescens, Salmonella typhimurium, and Pseudomonas aeruginosa.

Nisin or a nisin-producing bacterial culture has been added to cheeses to inhibit toxin production by Clostridium botulinum (U.S. Pat. No. 4,584,199). Nisaplin.RTM. has been found to preserve salad dressings from microbiological contaminationfor extended shelf life periods (Muriana et al., J. Food Protection, 58:1109-1113 (1995) (challenge studies using Lactobacillus brevis subsp. lindnen)).

More recently, whey from nisin-producing cultures has been used to preserve and stabilize food compositions, including fermented dairy products, mayonnaise-type spreads, cream cheese products, meat compositions, meat/vegetable compositions, andcooked pasta. These uses of whey from nisin-producing cultures are described in U.S. Pat. No. 6,136,351 ("Stabilization of Fermented Dairy Compositions Using Whey from Nisin-Producing Cultures"); U.S. Pat. No. 6,113,954 ("Stabilization of MayonnaiseSpreads Using Whey from Nisin-Producing Cultures"); U.S. Pat. No. 6,110,509 ("Stabilization of Cream Cheese Compositions Using Nisin-Producing Cultures"); U.S. Pat. No. 6,242,017 ("Stabilization of Cooked Meat Compositions Stabilized byNisin-Containing Whey and Methods of Making"); and U.S. Pat. No. 6,613,364 ("Stabilization of Cooked Meat and Vegetable Compositions Using Whey From Nisin-Producing Cultures and Product Thereof"); and U.S. patent application Ser. No. 09/779,756, nowU.S. Pat. No. 6,797,308 ("Stabilization of Cooked Pasta Compositions Using Whey From Nisin-Producing Cultures"). These applications, which are owned by the same assignee as the present invention, are incorporated herein by reference in theirentireties.

Methods of producing the nisin-containing whey have also been documented. For example, a method of producing nisin-containing whey from skim milk is disclosed in U.S. Pat. Nos. 5,716,811; 6,242,017; 6,110,509; 6,136,351; and 6,113,954. Furthermore, another method to produce a similar nisin-containing whey from sweet whey is disclosed in U.S. Pat. No. 6,613,364 and U.S. patent application Ser. No. 09/779,756, now U.S. Pat. No. 6,797,308.

Unfortunately, a shortcoming of the existing nisin-containing whey compositions and accompanying methods for their production is that the inhibitor is unsuitable for use in fresh mozzarella cheese and the accompanying pack water. The poorclarity of existing nisin-containing whey compositions manufactured using known methods is unacceptable for addition to the clear pack water of fresh mozzarella cheese because it renders the product undesirable to consumers. Moreover, the resultingacidity of nisin-containing whey compositions made from known methods actually shortens the shelf-life of fresh mozzarella cheese by affecting the texture and integrity of the cheese.

Accordingly, there remains a need to provide a stabilized, fresh mozzarella cheese and a need to provide a method of producing an antimicrobial ingredient that is suitable for use in the pack water of fresh mozzarella cheese. In particular,there remains a need to improve the safety of fresh mozzarella cheese by retarding the growth of pathogenic bacteria or limiting their growth below detection levels and there also remains a need to increase the usable shelf life of a fresh

232

mozzarellacheese in pack water by retarding or limiting below detection levels gas-forming bacteria. There also remains a need to provide a stabilized fresh mozzarella cheese using natural and innocuous ingredients. Furthermore, there also remains a need toprovide a value added use to the acid whey byproduct from cheese manufacture.

SUMMARY OF THE INVENTION

The invention is directed to a fermented, nisin-containing whey, especially a fermented and clarified nisin-containing whey, and methods of making such nisin-containing whey. The resulting clarified nisin-containing whey can be used to producestabilized food products, such as, for example, fresh mozzarella cheese. The use of such nisin-containing whey (generally at a level of about 10 to about 30%) in the pack water of fresh mozzarella cheese stabilizes the fresh mozzarella cheese andimproves its safety by retarding the growth of undesirable microorganisms (e.g., Listeria monocytogenes, gas forming bacteria such as leuconostoc species, and the like) or reducing their growth to below detection levels.

In a preferred form, the stabilized food product comprises fresh mozzarella cheese and pack water, where the pack water comprises a clarified nisin-containing whey. The pack water should generally have a nisin-equivalent activity of at least 360IU/ml and preferably at least 460 IU/ml. The stabilized food product comprises between about 10 to about 40% of the nisin-containing whey (preferably 20 to about 30%).

The invention is also directed to a method of making a clarified nisin-containing whey comprising (a) preparing an aqueous composition comprising at least one whey source selected from the group consisting of acid whey, whey protein concentrate,and protein hydrolysate; (b) fermenting the aqueous composition with a nisin-producing culture until the pH attains about 5.2 to about 5.8 (preferably about 5.5); (c) maintaining the pH of the fermenting composition at about 5.2 to about 5.8 (preferablyabout 5.5) for about 8 to about 12 hours (preferably about 10 hours); (d) allowing the pH of the fermenting composition to drop to about 4.8 to 5.2 (preferably about 5.0) to form a fermented composition containing nisin having a nisin equivalentactivity; (e) adding an acid to the fermented composition to drop the pH to about 3.5 to about 5.0 (preferably about 4.0) to form an acidified composition; (f) filtering the acidified composition to form a filtered composition; (g) adding a base to thefiltered composition to raise the pH to about 5.5 to about 6.0 (preferably about 5.8) to form the clarified nisin-containing whey, wherein the clarified nisin-containing whey has a nisin-equivalent activity of about 800 to about 2,0000 IU/ml (preferablyabout 1500 IU/ml). Generally, the length of step (b) is about 4 to about 8 hours (preferably 6 hours) and the length of step (d) is about 2 to about 6 hours (preferably about 4 hours).

The invention is also directed to a clarified nisin-containing whey that includes an acid whey, whey protein concentrate, a protein hydrolysate, and a naturally produced nisin-like peptide. The clarified nisin-containing whey has a pH of about5.5 to about 6.0 (preferably 5.8) and a nisin-equivalent activity of at least about 800 IU/ml, preferably about 800 to about 2000 IU/mg, and more preferably about 1500 IU/mg. Preferably, the clarified nisin-containing whey reduces the risk of the growthof Listeria monocytogenes or leuconostoc species or reduces the growth below detection limits.

In another form, the clarified nisin-containing whey has an activity of at least about 1500 IU/ml. Preferably, the clarified nisin-containing whey has a clarity sufficient to be added to pack water of fresh mozzarella cheese withoutsignificantly altering the texture of the cheese as compared to a fresh mozzarella cheese without the nisin-containing whey. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 provides a flow chart illustrating an exemplary method for the production of a clarified nisin-containing whey.

FIG. 2 provides an example of a preferred method to produce a clarified nisin-containing whey.

DETAILED DESCRIPTION

The invention relates to a stabilized food product, preferably a fresh mozzarella cheese, with enhanced safety and shelf life through the addition of a clear liquid antimicrobial ingredient. The invention also relates to a method of producing aclear liquid antimicrobial ingredient from whey.

233

The invention is further directed to a clear liquid antimicrobial ingredient that is suitable for addition to pack water of fresh mozzarella cheese.

In general, the liquid antimicrobial ingredient is preferably a clarified nisin-containing whey or nisin-containing whey composition, which is a liquid having a clarity suitable for addition to pack water of fresh mozzarella cheese. Theclarified nisin containing whey is suitable for use with fresh mozzarella cheese because it does not significantly affect the texture or integrity of the resulting fresh mozzarella cheese product and does not affect the clarity of the cheese's packwater. By incorporating the clarified nisin-containing whey into the pack water of fresh mozzarella cheese at levels of about 10 to about 40% (preferably about 20 to about 30%), the stabilized fresh mozzarella cheese is obtained where the growth ofpathogens such as Listeria monocytogenes and gas-formers such as Leuconostoc species are significantly retarded or reduced below detection levels.

In general, the preferred method to produce the clarified nisin-containing whey suitable for use with fresh mozzarella cheese comprises the fermenting of a whey, preferably acid whey, with a nisin-producing culture followed by acidification,filtration, and neutralization of the fermented composition as shown in FIG. 1. The resulting product of the method in FIG. 1 has strong antimicrobial activity against certain gram-positive pathogenic and spoilage bacteria such as Listeria monocytogenesand Leuconostoc species and is suitable for use in the pack water of high moisture cheeses.

For purposes of this invention, the terms "nisin-containing whey" and "nisin-containing cultured whey," which can be used interchangeably, are intended to include the whey product derived from a nisin-producing culture. Generally, such anisin-containing cultured whey is obtained by any of a variety of equivalent procedures involving fermentation by a nisin-producing microorganism in an acceptable medium (e.g., whey, corn syrup, sugar solution, and the like). In one such procedure, thenisin-containing cultured whey is obtained from the fermentation of a fortified cheese whey composition using nisin-producing microorganisms. In this procedure, after the pH in the fermentation has fallen to about 5.5, the pH is maintained at this valuefor about 8 to about 10 hrs before allowing the pH to drop further. In an alternative procedure, a pasteurized dairy product such as milk is first inoculated with the nisin-producing microorganism. Following curd formation, the nisin-containing whey isseparated from the curd using any conventional technique, including, for example, centrifugation, filtration, and the like. This method effectively removes most or essentially all of the microorganisms in the nisin-containing cultured whey. Thenisin-containing cultured whey may be employed in the products and methods of this invention.

Cultures capable of producing nisin-containing cultured whey have the potential of secreting many fermentation products into the fermentation medium. Thus, in addition to nisin and lactate, there may be further components present innisin-containing whey produced in the fermentation process. Some of the components may contribute to the beneficial properties of the preservable preparations of the invention, and to the beneficial effects of the methods of the invention. Withoutwishing to limit the scope of this invention, therefore, the terms "nisin-containing whey" and "nisin-containing cultured whey" encompass all components contained therein, both those currently known and those which may remain uncharacterized at thepresent time, that contribute to the beneficial attributes of the present invention.

As used herein, "nisin-containing whey" and "nisin-containing cultured whey" also relates to the whey described above that has subsequently been reduced in volume to a more concentrated liquid, or that has been completely dried, by evaporation,lyophilization, or comparable procedures. The terms relate additionally to such a concentrated or dried whey that is subsequently reconstituted, either partially or completely, by the addition of water or a water-containing composition.

As used herein, the term "stabilized preparation" as applied to a food product, such as, fresh mozzarella cheese in pack water, relates to a preparation which has been treated so that the growth of pathogenic microorganisms that may contaminatethe preparation are retarded or reduced below detection levels, or in which the production of toxins by such microorganisms is retarded or reduced below detection levels.

The stabilization of fresh mozzarella cheese against the hazardous proliferation of pathogenic microorganisms results from the use of the clear, liquid antimicrobial composition added to the pack water of fresh mozzarella cheese. The clear,liquid antimicrobial composition is preferably a clarified nisin-containing cultured whey produced from acid whey.

234

More specifically, the clarified nisin-containing whey is produced by a preferred method as generally illustrated through the sequential steps shown in FIG. 2. This preferred method comprises (a) preparing an aqueous composition comprising atleast one whey source selected from the group consisting of acid whey, whey protein concentrate, and protein hydrolysate; (b) fermenting the aqueous composition with a nisin-producing culture until the pH attains about 5.2 to about 5.8 (preferably about5.5); (c) maintaining the pH of the fermenting composition at about 5.2 to about 5.8 (preferably about 5.5) for about 8 to about 12 hours (preferably about 10 hours); (d) allowing the pH of the fermenting composition to drop to about 4.8 to 5.2(preferably about 5.0) to form a fermented composition containing nisin having a nisin equivalent activity; (e) adding an acid to the fermented composition to drop the pH to about 3.5 to about 5.0 (preferably about 4.0) to form an acidified composition;(f) filtering the acidified composition to form a filtered composition; (g) adding a base to the filtered composition to raise the pH to about 5.5 to about 6.0 (preferably about 5.8) to form the clarified nisin-containing whey, wherein the clarifiednisin-containing whey has a nisin-equivalent activity of about 800 to about 2,0000 IU/ml (preferably about 1500 IU/ml). Generally, the length of step (b) is about 4 to about 8 hours (preferably 6 hours) and the length of step (d) is about 2 to about 6hours (preferably about 4 hours).

A base fermentation medium may be an aqueous composition of at least about 30% acid whey. The acid whey used for the method can be obtained, for example, from the fermentation of a ricotta cheese, impastata cheese, cream cheese, or cottagecheese. The typical ricotta acid whey contains a high level of lactose as a carbon source but low levels of a nitrogen source; as a result, acid whey is not an ideal composition for the production of nisin-containing whey. Consequently, to increase theyield of antimicrobial metabolites including nisin-like bacteriocin produced by the nisin-producing culture, the fermentation medium preferably includes supplements and/or increased acid whey concentrations. For example, preferred supplements include atleast about 0.05 to about 2% whey protein concentrate (WPC) (most preferably about 1%) and/or about 0.05 to about 0.05% (most preferably about 0.1%) protein hydrolysate such as N,Z-amine™. Optional supplements include a yeast extract, such asconcentrations of about 0.1 to about 0.5% (preferably about 0.25%). In addition, fermentation mediums may include up to about 70% acid whey. A preferred supplemented fermentation medium is a blended aqueous composition comprising about 50 to about 70%ricotta whey, about 0.5 to about 1% WPC, and about 0.1 to about 0.5% protein hydrolysate.

Prior to fermentation, the aqueous medium may optionally be pasteurized. Typical pasteurization conditions include heating the medium at about 85° C. for about 45 minutes and then cooling the medium to about 30° C.

For fermentation, the composition is inoculated with about 1×105 to about 1×107 cfu/ml (preferably about 2×106 cfu/ml) of a nisin-producing culture. An example of a nisin-producing microorganism is Lactococcuslactis subsp. lactis. The preferred fermenting method is to incubate at about 30° C. for about 16 hours at a pH of about 5.5, followed by a pH drop to about 5.0 for about 4 hours. The resultant fermented medium has about 1.2×109cfu/ml of live bacteria cells, a pH of about 4.9-5.0, and a titratable acidity of about 0.42%. These preferred fermentation conditions combined with the preferred fermentation medium generally yields a fermented composition, prior to filtering orclarification, having a nisin equivalent activity of about 1600 IU/ml as determined by well assay using a nisin-sensitive strain of Lactococcus lactis subsp. cremoris. As later described in the examples, other fermentation conditions and fermentationmediums will also produce acceptable results. Alternative fermentation mediums produce yields of at least 800 IU/ml.

The resulting product of the fermentation is a whey containing nisin; however, at this point, the whey is not yet suitable for use with fresh mozzarella. After fermentation, the product may be further processed as described below to render ituseful with fresh mozzarella cheese, or it may be centrifuged in order to use the supernatant only, or it may be concentrated by evaporation of the whole fermented whey.

As suggested above, it is preferred that the fermented medium be processed further to render it suitable for use with fresh mozzarella. Unfortunately, the fermented composition generally has a pH of about 5.0, which as discussed more below, istypically not suitable for use with fresh mozzarella cheese and creates difficulty in subsequent processing steps. Moreover, the fermented composition contains high levels of solid suspensions and bacterial cells, which also are not acceptable to beadded to the clear pack water of fresh mozzarella cheese.

235

To be useful with fresh mozzarella, the nisin-containing whey is first filtered or clarified to a clear liquid. As noted above, the composition has a pH of about 5.0, which presents difficulties in obtaining a clear preparation that retains goodantimicrobial activity. Simple centrifugation can only remove a small portion of the suspended solids leaving the lower density solids still suspended in the liquid. Microfiltration may be an effective way to obtain a clear preparation, but asignificant amount of the antimicrobial activity in the filtrate is lost during filtration. Even filtering with a membrane having a pore size of 0.65 μm, which is much larger than the size of individual nisin molecules, results in significantantimicrobial activity lost in the filtration. While not wishing to be limited to theory, a possible explanation is that the nisin molecules tend to interact with each other and/or with other proteins to form aggregates of multiple complexes at nearneutral or higher pH, and such aggregates cannot easily pass through the microfiltration membrane, resulting in significant loss in nisin equivalent activity in the filtrate.

In order to clarify the composition and retain high antimicrobial activity, the composition is acidified before microfiltration to solubilize nisin molecule complexes allowing the nisin molecules to pass through the microfiltration membrane. This phenomenon was also observed by several independent researchers (Ray, "Nisin of Lactococcus lactis ssp. lactis as a food biopreservative," in Food Biopreservatives of Microbial Origin, edited by Bibek Ray and Mark Daeschel, CRC Press, 207-264(1992); U.S. Pat. No. 5,232,849 to Vedamuthu et al.,). The solubility of nisin is highly pH-dependent. Hurst reported that the solubility of nisin is about 12% at pH 2.5 and this is reduced to only 4% at pH 5.0 and almost to zero at neutral andalkaline pH. Nisin has an isoelectric point in the alkaline side (Hurst, "Nisin," in Advances in Applied Microbiology, 27, 85-163, (1981)).

By acidifying prior to microfiltration, the antimicrobial activity is almost completely retained in the resultant clarified fermented whey. To obtain a clear preparation of the nisin-containing composition with high antimicrobial activity, thefermented whey is acidified with and edible acid (e.g., lactic acid, citric acid, hydrochloric acid, phosphoric acid, and mixtures thereof, or the like) to a pH of about 4 or below prior to microfiltration. It is preferred to acidify using lactic acidto a pH of about 4.0 and then to filter using a membrane with a pore size of about 0.65 μm.

In order to effectively add the filtered nisin-containing acid whey composition to the pack water of fresh mozzarella cheese, the composition still needs to be neutralized. Naturally, the pH of fresh mozzarella cheese is about 5.8. Unfortunately, adding the clarified nisin-containing whey directly after the microfiltration step (with a pH of about 4.0 or below) to the pack water of fresh mozzarella cheese, which has a pH of about 5.8, causes the cheese to fall apart during itsusable shelf life. Therefore, the fermented nisin-containing whey is neutralized to a pH of about 5.5 to about 6.0 (preferably about 5.8) before being added to pack water of fresh mozzarella cheese.

On the other hand, the nisin-containing whey composition with a pH of about 4.0 is very stable and, if pasteurized, can be stored for several months at refrigeration temperatures without losing activity. Consequently, it is preferred to storethe nisin-containing whey composition at a pH of about 4.0 and then neutralize the nisin-containing whey composition to a pH of about 5.8 just prior to addition to fresh mozzarella.

Choosing an appropriate neutralizer is also very important for fresh mozzarella applications. For example, if NaOH is used to neutralize the preparation, and the preparation added to fresh mozzarella cheese, the cheese falls apart even quickerthan when the non-neutralized preparation is used. To be suitable in fresh mozzarella cheese, this nisin-containing composition preferably is neutralized to a pH of about 5.5 to about 6.0 (preferably about 5.8) with food grade calcium hydroxide. Thefermented whey neutralized with calcium hydroxide does not significantly alter the texture of the cheese, and in fact, improves the stability of the product over an extended shelf life.

The above described method produces a clarified nisin-containing whey composition, which is suitable for use with fresh mozzarella cheese and comprises a naturally produced nisin-like peptide. The clarified nisin-containing whey composition issuitable for fresh mozzarella because it does not significantly affect the cheese texture or integrity and is a substantially clear liquid that generally does not impact the clarity of the pack water. Moreover, the clarified nisin-containing wheycomposition improves the safety of the cheese because it retards the growth of bacteria such as Listeria monocytogenes or reduces their growth below detectable levels and also increases shelf life because it similarly retards or reduces the growth belowdetection levels of the gas-forming bacteria such as bacteria from the leuconostoc species. The clarified nisin-containing whey composition produced from the method of the invention has at least a nisin-equivalent activity of

236

about 800 IU/ml andpreferably at least about 1500 IU/ml if the preferred fermentation medium and conditions are used.

When the clarified nisin-containing whey composition is added to the pack water of fresh mozzarella cheese, the stabilized fresh mozzarella cheese is obtained. Once added to the product, the stabilized fresh mozzarella having, for example, aninitial nisin equivalent activity of about 460 IU/ml still has a nisin-equivalent activity of about 360 IU/ml after 50 to 55 days. To obtain the stabilized preparation, it is preferred to add the clarified nisin-containing whey composition to the packwater of the fresh mozzarella in amounts between about 10 and about 40%, and most preferably in amounts between about 20 and about 30%. The stabilized fresh mozzarella cheese retards or reduces below detection levels the growth of microorganisms such aslisteria monocytogenes or leuconostoc specie and has a shelf life exceeding four weeks.

In addition, the antimicrobial activity of the clarified nisin containing whey in the pack water of fresh mozzarella cheese generally remains stable over the shelf life of the product. Thus, even after the product is opened by the consumer, butnot consumed at once, the remaining pack water still has effective antimicrobial activity against potential recontamination of Listeria monocytogenes or spoilage organisms for a reasonable time period (generally about 7 to about 14 days underrefrigerated conditions). Of further importance, the bioconversion process involves a natural fermentation of natural dairy materials with a food grade culture and when added to fresh mozzarella cheese, the product is still a natural dairy product.

It should also be noted that, although the above description was completed in the context of fresh mozzarella, the present invention would be useful in other high-moisture, high-pH cheeses as well. The clarified nisin-containing whey compositionwith high antimicrobial activity could also be used directly, or further concentrated or dried and used in other food or drink products for pathogen control and shelf life extension.

The following examples are intended to illustrate the invention and not to limit it. Unless otherwise indicated, all percentages are by weight. All references cited in the present specification are hereby incorporated by reference.

EXAMPLE 1

This example provides a process for producing a nisin-containing whey yielding a high level of nisin-equivalent activity. Acid whey from fermentation of ricotta cheese (composition shown in Table 1) was fortified with whey protein concentrate(WPC) and a protein hydrolysate (N--Z amine™ from Quest International, Rochester, Minn.). The components were blended with water to form the fermentation medium as shown in Table 2.

TABLE-US-00001 TABLE 1 Compositions of a Typical Acid Set Ricotta Whey. Composition Content (%) Lactose 6.0 Fat 0.2 Total protein 0.5 α-lactalbumin 0.1 β-lactoglobulin 0.1 Cross-linking 77 Non protein nitrogen 0.06 Calcium 0.05Lactic acid 0.04 Ash 0.9 Total solids 7.4 pH 5.8

TABLE-US-00002 TABLE 2 Fermentation medium formulation for the nisin-containing whey composition production. Component Content (%) Ricotta whey 50 WPC 1 Protein hydrolysate 0.1 Water 48.9

The blended formulation of Table 2 was pasteurized, cooled, and inoculated with a culture containing about 2×106 cfu/ml of a nisin-producing culture. The fermentation was allowed to proceed for about 6 hours to a pH of about 5.5. Thefermentation was then held at a pH of about 5.5 for about 10 hours, followed by a pH drop to about 5.0 over an additional about 4 hour period. The resultant medium had the characteristic shown in Table 3.

TABLE-US-00003 TABLE 3 Characteristics of fermented ricotta whey Measure Value pH 5.0 Titratable acidity 0.42% Culture count 1.2 × 109 cfu/ml Nisin equivalent activity 1600 IU/ml

The cell count and nisin equivalent activity in the medium during the fermentation process were monitored. While not wishing to be limited by theory, the bacteria appears to have a very short lag phase under the fermentation conditions, andrapidly reached the maximum growth in about 6 hours. However, the nisin activity was not detected until about 5 hours of fermentation. Again, not wishing to be limited by theory, it appears that the nisin-like antimicrobial metabolites were

237

producedduring the late log phase and maximized in the stationary phase.

EXAMPLE 2

This example illustrates the yield (i.e., nisin-equivalent activity) at different pH and compositions of the fermentation medium. The fermentation was carried out as illustrated in Example 1, but the pH and composition of the base medium andsupplement were varied as shown in Table 4. The results of the experiment are also shown in Table 4, which provides the yield as a function of different mediums and pH. The data shows that the fermentation preferably should be carried out under acontrolled pH (generally at about 5.5) because the effect of fermentation pH on the yield of antimicrobial activity can be significant.

TABLE-US-00004 TABLE 4 Effect of Media Composition and Fermentation pH on Antimicrobial Activity Yield. Activity Base medium Supplement pH (IU/ml) 100% Ricotta whey 1% WPC, 0.1% N,Z-amine ™ 5.5 1750 70% Ricotta whey 1% WPC, 0.1% N,Z-amine™ 5.5 1702 50% Ricotta whey 1% WPC, 0.1% N,Z-amine ™ 5.5 1625 30% Ricotta whey 1% WPC, 0.1% N,Z-amine ™ 5.5 1433 50% Ricotta whey 1% WPC, 0.1% N,Z-amine ™, 5.5 1692 0.1% yeast extract 50% Ricotta whey 1% WPC, 0.1% N,Z-amine ™, 5.5 17290.25% yeast extract 50% Ricotta whey 0.5% WPC, 0.1% N,Z-amine ™, 5.5 1605 0.25% yeast extract 50% Ricotta whey 0.5% WPC, 0.1% N,Z-amine ™, 5.5 1640 0.5% yeast extract 50% Ricotta whey 1% WPC, 0.1% N,Z-amine ™ 5.0 1554 50% Ricotta whey 1% WPC,0.1% N,Z-amine ™ 6.0 1200 50% Ricotta whey 1% WPC, 0.1% N,Z-amine ™ -- 810

EXAMPLE 3

This example illustrates the effect of pH on the yield during the microfiltration step. A fermented composition was prepared as illustrated in Example 1. The fermented composition contained high levels of solid suspensions and bacterial cells,and, thus, was not suitable to be added to the clear pack water of fresh mozzarella cheese. Different clarification methods, such as centrifugation and microfiltration, were tried. Microfiltration was most effective to remove cloudiness from thefermented whey.

The fermented whey was first filtered at a pH of about 5. At this pH, a significant amount of the antimicrobial activity was lost in the retentate as shown in Table 5. The material was filtered through a commercial microfiltration unit with amembrane pore size of 0.65 μm (CFP-6-D-6A, A/G Technology Corporation). Nisin is a small peptide with a molecular weight of 3500 Dalton; therefore, it theoretically should easily pass through the microfiltration membrane. As a matter of fact, themicrofiltration results shown in Table 5 contradict this assumption. While not wishing to be limited by theory, this contradiction suggests the nisin-like antimicrobial peptides in the fermented whey tend to interact with each other or with otherprotein molecules to form aggregates or multiple complexes at near neutral pH, and thus, cannot easily pass through the microfiltration membrane.

The fermented whey was next acidified in separate trials with lactic acid to a pH of about 4 and about 3.5. After filtration, the antimicrobial activity was recovered at high levels in the filtrate as shown in Table 5. The resulting clearfiltrate retained the majority of the antimicrobial activity (i.e., about 95%). Preferably, the filtered composition retains at least about 95% of the activity of the original fermented composition.

TABLE-US-00005 TABLE 5 Effect of pH on microfiltration efficacy of fermented whey pH Membrane Original activity Filtrate activity Retentate activity 5.0 0.1 μm 1500 u/ml 0 u/ml 6800 u/ml 5.0 0.65 μm 1530 u/ml 800 u/ml 3420 u/ml 4.0 0.65μm 1640 u/ml 1550 u/ml 1810 u/ml 3.5 0.65 μm 2030 u/ml 1900 u/ml 2110 u/ml

EXAMPLE 4

This example illustrates the inhibition of Listeria monocytogenes by fermented whey in a liquid system. The nisin-containing whey composition fermented as in Example 1 and microfiltered at a pH of 4 as in Example 3 was added to BHI (brain heartinfusion) broth medium at concentration levels of 0, 2.5, 5, 10, 15, 20, 25 and 30%. The BHI medium was then inoculated with 1% of activated Listeria monocytogenes 5-strain cocktail (about 1×107 cfu/ml) containing the following strains: (1)Center for Disease Control coleslaw isolate 861, (2) Jalisco F2399, (3) National Food Processors Association isolate 83, (4) plant environment isolate 328, and (5) plant environment

238

isolate 225. The inoculated broth medium was then incubated at35° C. and the growth of L. monocytogenes was monitored. Optical density (absorbance at 630 nm) of the broth was used to measure the growth of the bacteria. Table 6 shows the growth data of L. monocytogenes in BHI containing different levels offermented whey.

TABLE-US-00006 TABLE 6 Growth of Listeria monocytogens in BHI broth with various concentrations of clarified nisin containing whey Absorbance at 630 nm Time (h) 0 5 10 15 20 25 29 0% 0.096 0.27 0.713 0.583 0.521 0.486 0.516 2.5% 0.095 0.1070.525 0.593 0.558 0.539 0.534 5% 0.096 0.089 0.093 0.228 0.481 0.511 0.465 10% 0.095 0.09 0.088 0.088 0.09 0.09 0.087 15% 0.1 0.091 0.091 0.091 0.093 0.091 0.089 20% 0.095 0.093 0.09 0.091 0.09 0.09 0.089 25% 0.097 0.097 0.097 0.098 0.096 0.096 0.093 30%0.093 0.093 0.091 0.092 0.092 0.092 0.091

Clearly, the fermented whey had strong inhibitory effect on the growth of Listeria monocytogenes in the liquid medium. Lower levels of such nisin-containing whey compositions delayed the growth by extending its lag phase; 10% or higher levels ofsuch nisin-containing whey compositions reduced the growth of L. monocytogenes in BHI broth medium to undetectable levels as shown in Table 6.

EXAMPLE 5

This example illustrates the inhibition of a spoilage organism which generates gas by nisin-containing whey in a liquid system. Among spoilage organisms associated with fresh mozzarella cheese is the natural occurring gas-formers such as theLeuconostoc species. Such bacteria generate gas within a sealed container of the product during storage and cause a blistering appearance on the cheese. The gas accumulated in the pack water will eventually build pressure inside the plastic containerand such pressure can cause visible deformation or damage to the package. By visual observation, a gassy product is easily rejected by consumers because it is viewed as spoiled. Therefore, the gas formation is often used as an indicator of spoilage offresh mozzarella cheese, and it is a critical limiting factor determining the shelf life of the product.

A gas-producing bacteria isolate was obtained from commercial fresh mozzarella cheese product. It was identified as Leuconostoc citreum. This example illustrates the inhibitory effect of the fermented nisin containing whey made in Example 1 andmicrofiltered at a pH of 4 as in Example 3 against the gas forming isolate in a liquid system. MRS broth containing various levels of the fermented whey made in Example 1 was inoculated with 1% of the activated gas-forming isolate (about1.0×107 cfu/ml). The mixture was then incubated at 30° C. for 30 hours and the absorbance of the broth at 630 nm was monitored as an indicator of bacterial growth. Table 7 shows data from the growth curves of the gas-former isolatein MRS broth containing different levels of fermented whey. The fermented whey, even at low levels, inhibited the gas-forming isolate.

TABLE-US-00007 TABLE 7 Inhibition of Leuconostoc citreum by Fermented Whey at Various Concentrations in MRS Broth. Time Absorbance at Various Levels of Nisin-Containing Whey (hours) 0 2.5% 5% 10% 15% 20% 25% 30% 0 0.264 0.256 0.266 0.249 0.2490.249 0.226 0.223 5 0.292 0.247 0.263 0.248 0.248 0.251 0.229 0.226 10 0.611 0.245 0.261 0.247 0.249 0.253 0.232 0.228 15 0.671 0.246 0.261 0.248 0.252 0.255 0.234 0.233 20 0663 0.242 0.260 0.246 0.252 0.254 0.235 0.234 25 0.674 0.238 0.260 0.247 0.2540.255 0.237 0.237

EXAMPLE 6

This example illustrates the inhibition of Listeria monocytogenes by fermented whey in fresh mozzarella cheese. The fermented nisin containing whey prepared in Example 1 and microfiltered at pH 4 as in Example 3 was added to pack water of freshmozzarella cheese at concentrations of 0, 5, 10, 15, 20, and 25%. The pack water was inoculated with the 5-strain Listeria monocytogenes cocktail of Example 4 at about 5×103 cfu/ml. All packaged products were stored at 4° C. forextended periods. The survival of Listeria monocytogenes in each package was monitored during the storage period. The results are shown in Table 8.

TABLE-US-00008 TABLE 8 Fate of L. monocytogenes in fresh mozzarella pack water containing various levels of nisin-containing whey composition. Survival (cfu/ml) at Varying Concentrations of Storage Added Fermented Whey time (days) 0% 5% 10% 15%20% 25% 0 5600 610 630 440 210 270 2 4100 330 280 220 130 120 7 1600 95 27 22 29 19 21 1500 81 11 20 11 12 28 1300 74 17 13 4 6 35 1300 72 20 7 8 2 42 2000 96 8 29 2 1 49 6500 440 28 7 1 <1* *Below detection levels.

239

The data shows that the fermented whey was effective in retarding the growth of Listeria monocytogenes in the pack water of fresh mozzarella cheese product. Addition of such clarified nisin-containing whey in the pack water at 20% or higherresulted in complete (i.e., below detection levels) or near complete elimination of Listeria monocytogenes from the initial inoculation level of 5600 cfu/ml in 7 weeks. In contrast, Listeria levels in the control sample (0% nisin containing whey)initially decreased somewhat but then actually increased over time.

EXAMPLE 7

This example illustrates the effect of fermented whey on the texture of fresh mozzarella cheese. A fermented nisin containing whey composition was prepared as in Example 1. The composition was then microfiltered at a pH of about 4 to produce aclear microfiltered preparation as described in Example 3. The microfiltered preparation at pH 4 (control), a preparation neutralized with NaOH to pH 5.8 (NaOH adjusted), and a preparation neutralized with Ca(OH)2 to pH 5.8 (Ca(OH)2 adjusted)were added to the pack water of fresh mozzarella cheese balls at a level of 25%. All samples were packaged in sealed containers and stored at 4° C. for 8 weeks. The clarity of the pack water was measured periodically at an absorbance at 650 nmas shown in Table 9. The higher integrity demonstrated by the cheese balls during storage, the higher the clarity (and lower absorbance value) of the pack water observed.

TABLE-US-00009 TABLE 9 Clarity of Pack Water of Fresh Mozzarella Cheese as Affected by the Addition of Fermented Whey Preparations. Absorbance at 650 nm Storage time NaOH Ca(OH)2 (days) Control adjusted adjusted 1 0.1466 0.0687 0.1145 20.1902 0.4425 0.0527 5 0.2772 1.3881 0.2136 7 0.4078 1.7616 0.3919 14 0.7333 2.063 0.4716 21 0.6889 1.9998 0.5125 28 0.6682 2.0044 0.5841 35 0.7359 2.0398 0.5008 42 0.823 1.9866 0.5375 49 0.9557 2.0985 0.59 56 0.9817 2.1325 0.5778

The product with the pack water containing the nisin-containing whey composition neutralized with NaOH to a pH of about 5.8 was very detrimental to the texture of the fresh Mozzarella cheese. In the NaOH adjusted samples, the cheese balls fellapart within a few days, resulting in a rapid increase in turbidity of the pack water. The product with pack water containing the nisin-containing whey composition neutralized with Ca(OH)2 to a pH of about 5.8 maintained the integrity of the cheeseballs over the extended shelf life. In fact, the clarity of the pack water was better with the Ca(OH)2 adjusted samples than the clarity of the pack water in the untreated control. Consequently, it is preferred that the clarified nisin-containingwhey be fermented as in Example 1, microfiltered at a pH of about 4 as in Example 3, and neutralized with calcium hydroxide to a pH of about 5.8 as in this example.

EXAMPLE 8

This example shows the stability of the clarified nisin-containing whey composition in the pack water of fresh mozzarella cheese. The clarified nisin-containing whey was prepared as described in Example 7. The clarified fermented whey was addedto the pack water of fresh mozzarella cheese at a level of 25%. At time zero, the pack water exhibited a nisin equivalent activity of about 460 IU/ml, which appears to be high enough to effectively retard both pathogens such as Listeria monocytogenesand spoilage organisms such as gas producing Leuconostoc species. After 8 weeks of storage, which is twice the current shelf life for conventional fresh mozzarella cheese, the pack water still contained about 360 IU/ml of nisin equivalent activity(Table 10), which still appears to be effective in retarding pathogenic and spoilage organisms in the product. The components in the cheese and the pack water did not appear to substantially affect the antimicrobial activity of the nisin-containing wheycomposition. The overall antimicrobial activity of the fermented whey in the pack water remained stable over a prolonged storage of the product.

Unlike process treatments such as heat pasteurization, the antimicrobial activity of the nisin-containing whey composition prepared in Example 1 appears to remain substantially stable in the product over the shelf life and appears to continuouslyserve as a barrier to both pathogenic and spoilage organisms. The data in Table 10 shows that the nisin level in the pack water containing 25% of the clarified nisin-containing whey composition remained substantially stable over 8 weeks at 4° C.

TABLE-US-00010 TABLE 10 Stability of nisin-containing whey in pack water Storage time Nisin-equivalent activity (IU/ml) 1 460 2 469 5 489 7 462 14 459 28 396 35 388 42 369 49 385 56 360

240

EXAMPLE 9

This example illustrates the retardation of nisin-resistant Listeria monocytogenes by the clarified nisin-containing composition. Fermented whey contains naturally produced nisin-like peptide and other antimicrobial compounds such as organicacids and hydrogen peroxide. This complex system may exhibit stronger antimicrobial activities than purified individual components. To confirm and better understand the synergism of this system, the antimicrobial efficacies of the clarifiednisin-containing whey as described in Example 7 were compared with a commercial, purified nisin preparation available under the tradename Nisaplin.RTM., which is available from Danisco A/S (Denmark). Nisaplin.RTM. is a natural antimicrobial compositiontypically comprising 2.5% nisin, 77.5% sodium chloride, 12% protein, 6% Carbohydrate, and 2% moisture with a nisin activity of about 1×106 IU/g.

A mixture of 5 strains of Listeria monocytogenes as described in Example 4 was inoculated with BHI broth containing varying concentrations (i.e., 100, 200, and 500 IU/ml nisin equivalent activity) of the clarified nisin-containing wheycomposition and Nisaplin.RTM.. The samples were incubated at 35° C. for 48 hours. The microbial growth was measured automatically every hour as the optical density at 630 nm in a Microplate Autoreader. The inhibition results are shown in Table11 where the concentration of both the clarified nisin-containing whey and Nisaplin.RTM. are expressed as standard nisin units equivalent per ml.

TABLE-US-00011 TABLE 11 Growth of Listeria monocytogens by BHI broth at 35° C. with Nasaplin .RTM. and the clarified nisin containing whey. Absorbance at 650 nm Incubation time (h) 0 5 10 15 20 25 26 30 35 40 45 48 Control 0.099 0.1430.618 0.609 0.595 0.586 0.586 0.572 0.558 0.536 0.502 - 0.489 100 IU/ml 0.098 0.102 0.315 0.556 0.525 0.437 0.428 0.389 0.329 0.284 0.29- 0.294 Nisaplin 200 IU/ml 0.094 0.096 0.158 0.486 0.539 0.465 0.454 0.406 0.372 0.307 0.28- 3 0.292 Nisaplin 500IU/ml 0.1 0.097 0.098 0.098 0.131 0.407 0.458 0.562 0.536 0.496 0.462 - 0.451 Nisaplin 100 IU/ml 0.094 0.098 0.147 0.333 0.421 0.435 0.423 0.427 0.408 0.396 0.38- 1 0.378 inhibitor 200 IU/ml 0.093 0.095 0.098 0.104 0.111 0.116 0.115 0.117 0.115 0.1080.10- 9 0.109 inhibitor 500 IU/ml 0.09 0.096 0.096 0.094 0.095 0.098 0.098 0.099 0.1 0.1 0.099 0.1- 01 inhibitor

The clarified nisin-containing whey composition showed significantly stronger anti-listerial activity than Nisaplin.RTM.. The clarified nisin-containing whey composition as described in Example 7 at 200 IU/ml level was able to completely inhibit(i.e., below detection levels) the growth of Listeria monocytogenes, while Nisaplin.RTM. extended the lag phase but did not significantly inhibit the growth even at the level of 500 IU/ml. TECHNICAL FIELD

The present invention relates generally to extruded food products, and, more particularly, to improved cheese snacks in which an inner flavoring core is co-extruded with an outer annular cheese product.

BACKGROUND OF THE INVENTION

This invention relates to the manufacture of edible cheese snacks having components of different properties (e.g., taste, texture, comestibility, color, etc.).

Various techniques for manufacturing string cheeses and cheese pieces have been in commercial use for several years. For example, U.S. Pat. Nos. 4,738,863 and 4,850,837 disclose methods and apparatuses for the extrusion of cheese pieces. Both of these patents appear to be directed toward processes for molding and chilling cheese.

The extrusion of molten cheese masses in form of ropes or strings has also been used commercially in the manufacture of string cheese. For example, U.S. Pat. No. 4,392,801 describes the apparatus that can be used to manufacture cheese rope. Downstream rollers are operated at higher surface speeds to pull the rope from an extrusion die. U.S. Pat. No. 4,902,523 discloses a method and apparatus that can be used to extrude cheese into multiple ropes. Each of the devices and apparatusesdisclosed in these patents produce cheese pieces, and, in most cases, string cheese having only one type of cheese product.

U.S. Pat. No. 5,792,497 is directed toward a process and equipment for the production of twisted string cheeses. Here, two cheeses are severally melted, and these molten masses are combined in

241

the extrusion head to provide woven string of thetwo different cheese types.

U.S. Pat. No. 3,480,445 discloses cereal-encapsulated products having cheese in the center. U.S. Pat. No. 4,659,580 discloses a method and apparatus for the extrusion of food product having a cheese core completely encapsulated within anedible coating, such as a meat base.

Attempts have been made to co-extrude two different types of cheeses into cylindrical shapes. U.S. Pat. No. 5,194,283 discloses a process of co-extruding two different types of unripened cheese at temperatures less than about 30° C.This patent also discloses co-extrusion of fruit and savory preparations in the core. However, these types of core materials were only used when the co-extruded food product could be dispensed in a cup, where the bottom of the cup prevented soft corefrom leaking out.

While it has been known to co-extrude different cheese products, a problem has persisted when the extruded length of the composite product is cut transversely to form individual bite-sized snacks. Such transverse cutting leaves the snack pieceswith two exposed end faces. If the flavoring core is sufficiently fluid, it may actually flow or leak out of the snack at the exposed end faces. This problem is exacerbated if the composite product is not chilled, but is adapted to be stored at roomtemperature prior to use or consumption.

SUMMARY OF THE INVENTION

This invention overcomes the problem of a relatively-fluid central core leaking out of the exposed end faces of a cheese snack. The technologies heretofore developed are believed to have failed to permit the use of softer more-fluid corematerials, without leakage of the core material from the exposed end face(s) upon transverse cutting or slicing of the composite food product. In the prior art, the probability of core material leakage required that the core be completely encapsulatedwithin an outer layer, or required extrusion of the product in to cup. The present invention permits co-extrusion and transverse cutting or severance of co-extruded masses having softer and more-liquid cores, without leakage of the core material fromthe exposed end face(s) of the cheese snack during further processing steps, including packaging.

The improved technology also permits extrusion of cheese using a conventional cooker-stretcher where cheese enters the extrusion device at temperatures on the order of 54-60° C., but sometimes as high as 75° C.

The critical parameters to be controlled are the viscoelastic properties of co-extruded cheese molten masses, viscosity of the core and its temperature, the rate of extrusion of both core and the surrounding coating, the line pressure, and thecryogenic freezing of cut pieces. The cryogenic freezing is adjusted as a function of tunnel temperature and rate of hardening. Conventional techniques of rapid hardening will result in uneven freezing of core and coating, and variations in the thermalexpansion/contraction of core and surrounding. This can lead to leakage (i.e., "oozing out") of the core material from the exposed end face(s). After packaging, the frozen core will melt, resulting in poor seal and unclean looking edge(s). Suchproducts may not be saleable, and may have poor shelf life due to leaking core materials.

Accordingly, and with parenthetical reference to the corresponding parts, portions or surfaces of the disclosed embodiment, merely for purposes of illustration and not by way of limitation, the present invention provides an improved cheese snack(10) that broadly comprises: an extruded annular cheese product (12), and a flavoring core (11) co-extruded within the cheese product. The core is of relatively low viscosity, and is normally flowable at room temperature. The extruded composite producthave substantially planar end faces, with the core material being exposed at the end faces. The cheese snack is processed such that core material will not substantially flow out of the exposed end faces of the sliced product prior to consumption, whenthe product is stored at room temperature.

The cheese product may be selected from the group consisting of mozzarella, cheddar and Monterey Jack cheeses, and the core may be selected from the group consisting of pizza sauce, salsa, soft cheese, peanut butter and fruit flavoring. Whilethese cheeses and core materials are preferred, the invention contemplates that other cheeses and core materials may also be used.

The core has a normal viscosity of about 100-500 grams when measured by a Texture Profile

242

Analyzer ("TPA") at room temperature before the cheese snack is formed. The core may contain at least one of the group consisting of flavoring,maltodextrine, starch and hydocolloids. In one form, the flavoring core contains up to about 1.5% starch. In another form, the flavoring core contains up to about 3% maltodextrine. The flavoring core may contain pieces of flavoring material. Anexterior coating may be provided on the cheese product. The cheese product and flavoring core are frozen for a time sufficient to prevent water in the core from migrating into the cheese product. The flavoring core may contain at least one hydrocolloidin an amount sufficient to prevent the flavoring core from leaking out of the exposed end faces of the cheese product, but to prevent the core from drying out. In one form, the one hydrocolloid is present in an amount equal to about 0.2-0.4% by weight. The hydrocolloid may be selected from the group consisting of guar, locust, xanthan, agar and carrageenan.

Accordingly, the general object of this invention is to provide an improved cheese snack.

Another object is to provide an improved composite cheese snack in which co-extruted flavoring core is formed within an outer annular cheese product such that the flavoring core will not substantially flow out of the exposed end face(s) of thesnack when stored at room temperature.

These and other objects and advantages will become apparent from the foregoing and ongoing written specification, the drawings and the appended claims. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A is a side elevation of a first form of an improved cheese snack.

FIG. 1B is an end elevation of the cheese snack shown in FIG. 1A, this view showing the flavoring core as having a circular transverse cross-section.

FIG. 2A is a side elevation of a second form of an improved cheese snack.

FIG. 2B is an end elevation of the cheese snack shown in FIG. 2A, this view showing the flavoring core as having a star-shaped transverse cross-section.

FIG. 3A is a side elevation of a third form of an improved cheese snack.

FIG. 3B is an end elevation of the cheese snack shown in FIG. 3A, this view showing the flavoring core as having a triangular transverse cross-section.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

At the outset, it should be clearly understood that like reference numerals are intended to identify the same structural elements, portions or surfaces consistently throughout the several drawing figures, as such elements, portions or surfacesmay be further described or explained by the entire written specification, of which this detailed description is an integral part. Unless otherwise indicated, the drawings are intended to be read (e.g., cross-hatching, arrangement of parts, proportion,degree, etc.) together with the specification, and are to be considered a portion of the entire written description of this invention. As used in the following description, the terms "horizontal", "vertical", "left", "right", "up" and "down", as well asadjectival and adverbial derivatives thereof (e.g., "horizontally", "rightwardly", "upwardly", etc.), simply refer to the orientation of the illustrated structure as the particular drawing figure faces the reader. Similarly, the terms "inwardly" and"outwardly" generally refer to the orientation of a surface relative to its axis of elongation, or axis of rotation, as appropriate.

The present invention is directed toward the production of co-extruded food products, where the coating layer consists of cheese, the core is made up of semi-solid to fairly-fluid food material, and resulting composite product has the capabilityof being packaged without sealing the exposed end face(s) of the product. However, if desired, one could seal one or both end faces to enhance esthetical appearance of the cheese snack.

Referring now the drawings, three different forms of composite products are disclosed. The first form is shown in FIGS. 1A and 1B, the second in FIGS. 2A and 2B, and the third in FIGS. 3A and 3B. The lengths of the various co-extruded foodproducts, as shown in FIGS. 1A, 2A and 3A, are

243

specifically different to demonstrate that the length of the cheese snack may be varied. For example, it may be a relatively short bite-sized piece, or may be an elongated rod, such as commonly found withstring cheese, and so on.

The transverse views, namely, FIGS. 1B, 2B and 3B, illustrate that the flavoring core may have different transverse shapes.

Thus, in FIGS. 1A and 1B, the extruded composite material is generally indicated at 10. This product is shown as having a flavoring core 11 that has a circular transverse shape when seen at an exposed end face. The flavoring core is whollycontained within an outer annular cheese product 12. If desired, the product may have an outermost coating 13, of a flavorant, coloring agent, texturing agent, or the like.

In FIGS. 2A and 2B, the food product is generally indicated at 20. Here, the composite food product has a flavoring core 21 that appears to be somewhat star-shaped when seen in transverse cross-section at the end face. Here again, the flavoringcore 21 is contained within outer cheese product 22, and the product may have an outermost coating 23.

In FIG. 3, the composite cheese product is generally indicated at 30. Here again, the flavoring core 31 is still a different shape, and appears to be somewhat triangular when seen in transverse cross-section at the end face. The flavoring core31 is wholly contained within the outer co-extruded cheese product 32. Again, the product may have an outermost coating at 33. It should also be appreciated that the outer shape or appearance of the cheese product need not necessarily be cylindrical,be may have some other shape as well.

In the inventive process, the curd of natural cheeses, like mozzarella and or cheddar, is transported to a cooker-stretcher, where the curd is heated and kneaded with the aid of warm water and twin screws. The movement of the rotating screws andwarm water convert the curd into a molten mass, which is further kneaded and stretched, resulting in the formation of fibrous plastic mass. At this stage, the molten mass is typically at a temperature of 54-60° C. At these temperatures, the milkfat is in a liquid state, and molten mass is plastic in nature. Hence, it has a tendency to lose shape, to collapse into a hollow space, and to shrink upon cooling. The molten mass is carried into an extrusion head with the help of two augers.

The extrusion head is rather complex. It has to perform several tasks simultaneously. The extrusion head is mounted on a housing. The housing supports a hopper, and has twin augers, the speed of which is controlled by a variable-speedhydraulic motor. The twin screws force the molten mass into the extrusion head. Part of housing containing the twin screws is jacketed, and warm water is circulated through the jacket to keep molten mass pliable. The cylindrical extrusion head has adual jacket with a cone in the center. The sharp edge of this cone faces the molten mass and regulates the flow of molten mass to each of the extrusion nozzles.

The extrusion head jacket located closer to the point of molten mass entry has circulating water at a temperature of about 73° C. Depending upon the operating parameters and thermo-mechanical properties of the outer coating, the watertemperature can be adjusted upwardly or downwardly, as needed, with the aid of a suitable heat exchanger. The portion of the extrusion head jacket located toward the brine (i.e., toward the exit end of the extrusion head) is circulated with coolingwater at a temperature of about 4° C. Again, this temperature can be adjusted upwardly or downwardly, as desired, with the help of a second heat exchanger.

Each of the extrusion nozzles includes two concentric tubes. The outer tube conveys a suitable cheese product. The inner tube, which is slightly shorter in length than the outer tube, conveys the flavoring core food material, such as pizzasauce, salsa, soft cheese, peanut butter, fruit flavoring, or the like. The exit end of the extrusion head is cooled with chilled water or brine to cool the outer surface of the composite food material.

The extrusion head is submerged in chilled brine. This is done to minimize the gravitational force on the co-extruded stings. These strings are carried longitudinally on a conveyer belt while submerged in brine. The belt rises at an angle ofabout 25-30 degrees, and is operated at a greater-than-extrusion speed to pull strings away from the extrusion head. The brine is maintained at a temperature of about 0-5° C. The chilled extruded co-extruded strings are transversely cut orsliced to obtain desired or size of cheese snack. At this stage, the core material is still at a temperature of

244

about 4-20° C.

Depending upon the desired level of viscosity, the core food material is thickened with the help of conventional food grade starches, maltodextrins and hydrocolloids. The individual formulations vary with the particular foodstuff added to thecore material.

The secondary purpose of stabilizing the core material is directed to managing water migration between core and outer coating. Each of the components (i.e., core and coating foodstuffs) has unique functional and organoleptic properties. Therefore, it is critical to minimize migration of water and other solutes therebetween. To meet commercial requirements, products have to remain acceptable,judging by organoleptically and microbiological standards, for up to 120 days at storagetemperatures of up to about 7° C. The coating, consisting of natural cheeses like cheddar and mozzarella, contains viable culture. Thus, their physicochemical properties will continue to change during refrigerated storage. The core is heattreated with a stabilizing agent to initiate activation and hydration of stabilizing agents.

The freezing profile, energy-required-to-freeze, heat transfer and expansion/contraction coefficients of both core and coating materials are significantly different. To prevent the leakage of the low viscosity fluid core upon transverse cutting,the co-extruted strings should be cooled to a sub-zero temperature in few seconds. The freezing process also has to be rapid to prevent the formation of large ice crystals. The slow formation of large ice crystals could have harmful impact on thetexture and appearance of core and coating. On the other hand, such rapid cooling to sub-zero temperatures could lead to serious deformation problems associated with the difference in the coefficients of thermal expansion between the core and coating. This problem is compounded by differences in the rate of cooling for outer and inner surfaces. Extreme rapid cooling below sub-zero temperatures can cause shrinkage of outer coating, which results in contraction of cross-section of the core. Being lessviscous and unfrozen, the core material may be forced out (e.g., "squeezed") at both end faces. Once exposed to atmosphere, the core freezes rapidly. This may create an unusual product in which the core appears as a spindle on which the outer coat iswound.

The freezing profile of coating and core food stuff can be determined by means of a Differential Scanning Calorimeter ("DSC") and Thermo-Mechanical Analyzer ("TMA").

Modifications

The present invention contemplates that many changes and modifications may be made. For example, the cheese product is not necessarily limited to mozzarella, cheddar or Monterey Jack. Similarly, the flavoring core is not limited to pizza sauce,salsa, soft cheese, peanut butter or fruit flavoring. As previously mentioned, the shape and configuration of the cheese snack, both as to length and transverse appearance and cross-section, may be readily changed or modified. Therefore, while threepreferred forms of the improved cheese snack have been shown and described, and several modifications thereof discussed, persons skilled in this art will readily appreciate that various additional changes and modifications may be made without departingfrom the spirit of the invention, as defined and differentiated by the following claims. FIELD OF THE INVENTION

This invention relates to the preparation of a homogeneous cheese, for example a mozzarella variety of cheese. In particular, it relates to a process of making such a cheese in which a GRAS food additive, in the form of an undissolved solid, isadded to the cheese curd.

DESCRIPTION OF RELATED ART

Homogeneous cheeses are often, if not generally, made by acidifying milk to convert it to a cheese milk, coagulating the cheese milk to obtain a coagulum comprised of curd and whey, cutting the coagulum and draining the whey therefrom, therebyleaving a cheese curd, and then forming the curd into a homogeneous mass of cheese. In one forming process the cheese curd is heated, kneaded, and stretched until it is a homogeneous, fibrous mass of cheese. In another forming process the cheese curdis pressed, for example in a cheddaring tower.

Sometimes it is desired to add a GRAS (generally recognized as safe) food additive to the curd to alter the properties of the final cheese, e.g., its taste, texture, color, or baking performance. In U.S. Pat. No. 6,120,809 (Rhodes), forexample, a process is disclosed in which whey protein isolate and

245

modified starch are mixed into mozzarella curd prior to heating, kneading, and stretching it. Often it is preferred to add the GRAS additive in the form of a comminuted solid. That canpose problems, however, in that it can be difficult to get the solid additive thoroughly blended into the finished cheese. Pockets or deposits of the additive sometimes survive the cheese-forming operation. They can be quite large, e.g., 1/2 inch to 4inches in diameter. This is particularly true when the additive is proteinaceous. These deposits can be so large as to clog some of the equipment used in making the cheese. Even if small, the presence of such deposits detracts from the appearance andmouth feel of the cheese, and can adversely affect the taste as well. In addition, if the cheese is to be diced or shredded prior to consumption, as, for example, in the case of cheese that is to be baked, e.g., on a pizza, these deposits can sometimesbecome so hard as to damage the cutting blades. The result can be metal fragments in the comminuted cheese.

SUMMARY OF THE INVENTION

The present invention addresses this problem by using a process comprising the following steps to make a homogeneous cheese that is augmented by a GRAS food additive that is in the form of an undissolved solid:

(a) preparing a cheese curd,

(b) grinding the curd while in admixture with (i) an aqueous solution of at least one cheese emulsifying salt and (ii) at least one GRAS food additive in the form of a comminuted solid, to obtain a ground curd that is impregnated with theemulsifying salt and the other GRAS food additive; and

(c) converting the emulsifier/additive-impregnated ground curd into cheese either by (i) heating, kneading, and stretching the emulsifier/additive-impregnated ground curd to obtain a homogeneous mass of cheese, or (ii) pressing theemulsifier/additive-impregnated ground curd to obtain a homogeneous mass of cheese. 

DETAILED DESCRIPTION

The process of the present invention can be used in the manufacture of any cheese that is made by either pressing the curd or subjecting it to the heating/kneading/stretching process. It is believed to be most useful for the manufacture ofcheeses that are designated as "Soft," "Firm/Semi-hard," or in between, according to the CODEX General Standard for Cheese (A6) Firmness Designators. These include, for example, Colby, Havarti, Monterey Jack, Gorgonzola, Gouda, Cheshire, and Muenster,all of which are in the Firm/Semi-hard category, as well as the mozzarella variety cheeses, which are in the Soft or Firm/Semi-hard categories, or in between the two. By "mozzarella variety cheese" we mean to include all of the cheeses thattraditionally were prepared by the pasta filata process, which cheeses are known by a variety of names, including mozzarella, pasta filata, provolone, scamorze, and pizza cheese. Standard mozzarella is designated as a Soft cheese. Part-skim mozzarellais between Soft and Firm/Semi-hard. Low-moisture mozzarella and low-moisture part-skim mozzarella are both designated as Firm/Semi-hard.

How to prepare a suitable curd for making a pressed curd cheese or a heated/kneaded/stretched cheese is well known to those skilled in the art. Typically the curd is prepared from pasteurized cow's or buffalo milk. The acidification step can beperformed either microbially or directly. Microbial acidification is accomplished by the addition of a starter culture of one or more lactic acid-producing bacteria to the milk, and then allowing the bacteria to grow and multiply. When making amozzarella variety cheese, a bacterial starter culture composed of coccus, rods, or a combination of both is preferably used. Direct acidification is faster and is accomplished by the addition of a GRAS acid, such as, for example, acetic acid (e.g., asvinegar), phosphoric acid, citric acid, lactic acid, hydrochloric acid, sulfuric acid, or glucono-delta-lactone (GdL) to the milk.

Following acidification, it is conventional to add rennet to the milk, to enhance the coagulation activity. The resulting coagulum is cut, and the whey is drained. Typically the curd is scalded (cooked) for about 0.08 to 1.0 hours at about30-48° C., and then is subjected to either the cheddaring process or the heating/kneading/stretching operation.

The term "cheese emulsifying salt" is intended to include (but not be limited to) the chemical compounds known as sequestrants. Preferably what is used is a cheese emulsifier that sequesters

246

calcium ions in the cheese--i.e., reduces the degreeto which the calcium is ionically bound to the protein in the cheese. Calcium-binding emulsifying salts are preferred, particularly those selected from the group consisting of phosphates and citrates. Sodium, sodium aluminum, and potassium salts aremost preferred. Examples of suitable phosphates are sodium hexametaphosphate (SHMP), monosodium phosphate (MSP), sodium tripolyphosphate (STPP), disodium phosphate (DSP), potassium tripolyphosphate (KTP), potassium polyphosphate (KPP), and potassiumtetrapolyphosphate (KTPP). DSP is generally available in its hydrated form, disodium phosphate dihydrate. The preferred citrate emulsifier is sodium citrate, which, in solid form, is generally commercially available as sodium citrate dihydrate.

The ideal amount of emulsifying agent to use will vary, depending upon its chemical identity and the other combination of cheese-making conditions employed, but it can be easily ascertained on a case-by-case basis with a slight amount ofexperimentation. Preferably, however, the emulsifying agent will be used in an amount within the range of about 0.01 to 2%, based on the weight of the curd. Often, about 0.1 to 0.7% of the emulsifying agent will be used, or an amount within the rangeof about 0.2 to 0.6%.

The solution of cheese emulsifying salt preferably contains about 5 to 50 weight percent of dissolved salt, often about 20 to 40 weight percent thereof.

Among the GRAS food additives that may be present with the curd and aqueous solution of emulsifying salt in the grinder are gums, stabilizers, dairy solids, cheese powders, non-dairy protein isolates, sodium chloride, potassium chloride, nativeor physically or chemically modified food starches, food colorants, and food flavorants.

The incorporation of a gum and/or stabilizer in the cheese is generally useful to bind water and firm the cheese body. Examples of suitable gums include xanthan gum, guar gum, and locust bean gum. Examples of suitable stabilizers includechondrus extract (carrageenan), pectin, gelatin, and alginate, with alginate being generally preferred. The total amount of gums and stabilizers added will generally be in the range of about 0.1 to 10%, e.g., about 1 to 4%, based on the weight of thecurd

The purpose of incorporating a dairy solid into the cheese in the process of the present invention is to firm the cheese, bind water, improve the melt appearance of the cooked cheese, and/or to increase the blistering of the cooked cheese. Examples of suitable dairy solids include, but are not limited to, whey protein concentrate, dried whey, whey protein isolate, delactose permeate, casein hydrolyzate, milkfat, lactalbumin, and nonfat dry milk. The dairy solids may generally be includedin an amount within the range of about 0.1 to 15%, e.g., about 1 to 8%, based on the weight of the curd.

A cheese powder is a dried cheese in particulate form. The purpose of incorporating a cheese powder in the cheese is to impart a different cheese flavor to the finished product. Examples of suitable cheese powders include, but are not limitedto, Parmesan, cheddar, Monterey Jack, Romano, Muenster, Swiss, and provolone powders. The cheese powder can generally be included in an amount within the range of about 0.25 to 10%, preferably about 0.25 to 1%, based on the weight of the curd.

The purpose of incorporating a non-dairy protein isolate into the cheese in the process of the present invention is to alter the texture of the cheese and/or to change the size, color, or integrity of the blisters that are formed when the cheeseis baked on a pizza, as well as other cook characteristics. Examples of suitable non-dairy protein isolates include soy protein (sometimes called "soy powder"), gelatin, wheat germ, corn germ, gluten, and egg solids. (Gelatin, as previously indicated,also acts as a stabilizer to bind water and firm the cheese.) The amount of non-dairy protein isolate that might be added will generally be within the range of about 0.1 to 10 percent, e.g., about 1 to 4%, based on the weight of the curd.

If sodium chloride and/or potassium chloride is mixed with the curd during the grinding operation, preferably the total amount of those salts will be about 0.1 to 5%, e.g., about 0.1 to 2%, based on the weight of the curd.

Sometimes, when the exposed cheese on a pizza completely melts, it appears as though the cheese has been "cooked into" the sauce. To the consumer, the topping on the pizza can appear to

247

have less cheese than is desired or expected. In theindustry this is referred to as the pizza appearing "thin" or having a "poor yield." The inclusion of a food starch in the cheese tends to obviate this problem. Generally the amount of starch should be in the range of about 0.5 to 20%, most commonly inthe range of about 1 to 4%, based on the weight of the curd.

Suitable starches include both vegetable starches, such as potato starch, pea starch, and tapioca, and grain starches, such as corn starch, wheat starch, and rice starch. The starch can be modified (chemically or physically) or native. Suitablecorn starches include dent corn starch, waxy corn starch, and high amylose corn starch.

Modified food starches differ in their degree of cross-linking, type of chemical substitution, oxidation level, degree of molecular scission, and ratio of amylose to amylopectin. Examples of some commercially available modified food starchesthat are generally suitable for obviating the "poor yield" problem include Mira-Cleer 516, Pencling 200, Batterbind SC, Penbind 100, and MiraQuick MGL. A suitable, commercially available native (unmodified) starch is Hylon V.

Mira-Cleer 516, from A.E. Staley Company, is a dent corn starch that is cross-linked and substituted with hydroxypropyl groups. The cross-linking increases its gelatinization temperature and acid tolerance. The hydroxypropyl substitutionincreases its water binding capability, viscosity and freeze-thaw stability.

MiraQuick MGL, from A. E. Staley Company, is an acid-thinned potato starch. The acid thinning breaks amylopectin branches in the starch, creating a firmer gel.

Pencling 200,from Penwest Foods, is an oxidized potato starch. The oxidation increases its capacity to bind water and protein. Penbind 100,also from Penwest Foods, is a cross-linked potato starch.

Batterbind SC, from National Starch, is a cross-linked and oxidized dent corn starch. Hylon V, also from National Starch, is an unmodified, high amylose corn starch.

All of the specific starches mentioned above are "cook-up" starches--that is, they are not pre-gelatinized. Pre-gelatinized starches can also be used in the process of the present invention.

As suitable food flavorants may be mentioned, for example, powdered butter and cheddar cheese flavorants.

Powdered food colorants come in a variety of colors and can be used to impart a creamier, richer color to the finished cheese or even a non-cheeselike novelty color.

In order to adjust the composition of the finished cheese, a minor amount of water and/or dairy cream also can be in an admixture with the curd during the grinding step. Adding a metered amount of either can assist in the effort to control themoisture and/or milkfat content of the finished cheese. This can be done, for example, by use of an additional spray line at the inlet to the grinder. The amount of added water or cream preferably will not be more than can be absorbed by thecurd--i.e., not so much as to result in separation of the water and/or cream from the curd, after the mixture leaves the grinder.

The grinding reduces the curd to smaller size particles, thus increasing its surface area. Preferably, the curd is ground to an extent that at least about 90 weight percent thereof has a particle size with a longest dimension of no more thanabout 0.5 inch, and most preferably no more than about 0.3 inch. Most preferably, substantially all of the curd will have such a particle size.

A preferred type of grinding machine is one in which the curd is swept by high speed impellers around the inside of a stationary circular wall with exit slots having a knife blade mounted in front of each slot opening, parallel to the wall, withthe blade edge facing the onrushing curd. Due to centrifugal force, the curd hugs the wall as it is swept past the blades. As a piece of curd is forced past an exit slot, it is sliced by the blade and the sliced-off segment is propelled out the slot. By setting the distance between the blade and the wall, the cheese curd is reduced in size by precise increments and can be ground to a predetermined size. One suitable example of such a grinder is the Urschel Comitrol Processor, model 1700,withvariable speed control, which has three blades and a dogleg impeller. Using this particular machine, the preferred impeller speed is about 3600 to

248

5600 rpm.

Preferably the grinding step is performed in a continuous manner. Thus, for example, the grinding machine can have an upwardly open inlet and the supply curd can be made to fall into the grinder in a continuous stream, while the grinder isoperating. In such an arrangement it is preferred that the aqueous solution of emulsifying salt be sprayed onto the falling curd. Similarly, the GRAS food additive solids can be made to fall into the same inlet, at a location on or near the locationwhere the supply curd falls into the grinder. One example of a suitable machine for introducing the powdered GRAS food additive into the grinding chamber is an Allen Machinery Company salter/seasoner applicator, model no. ss66.5/36.

When the emulsifier/additive-impregnated ground curd is to be formed into a cheese by heating, kneading, and stretching, the heating/kneading/stretching machine may be, for example, a single or twin-screw mixer or a twin-screw extruder, eitherfitted for steam injection or having a heated jacket, or a combination of both. When using a twin-screw mixer or extruder as the heating/kneading/stretching machine, preferably the screws (also known as augers) will be arranged so that they overlap, toinsure thorough mixing.

Preferably, the heating, kneading, and stretching will be performed under low shear conditions. Thus, for example, when using a twin-screw mixer having a 1/4 inch clearance between the outer edge of each flight and the wall past which that edgemoves, the speed of revolution of the screws will preferably be no more than about 50 rpm, e.g., in the range of about 12 to 40 rpm. Wider clearances can be used as well, e.g., up to, say, 1/2 inch.

The heating of the curd while it is being kneaded and stretched can be accomplished, for example, by conduction, through the wall of the kneading and stretching chamber, e.g., by use of a hot water jacket. In addition to or instead of conductiveheating, the contents of the chamber can be heated by releasing live steam into the kneading and stretching chamber. Where live steam is used to heat the curd, the steam condensate is absorbed by the curd and forms part of the final mass of cheese. When using live steam in the heating/kneading/stretching machine, typically the water content of the emulsifier/additive-impregnated ground curd immediately prior to entering the mixer is about 45 to 55 wt. %, and sufficient steam is released into thekneading and stretching chamber that the water content of the mass of cheese immediately after exiting the machine is up to about 5 percentage points higher, e.g., about 0.5 to 5 points higher. Often, it will be about 1.5 to 2.5 points higher. Thus,for example, if, say, the water content of the ground curd entering the machine is 45 wt. %, then preferably the amount of injected steam that is used to bring the curd up to the necessary temperature to obtain a homogeneous, fibrous mass of cheese willbe an amount that raises the water content to no more than about 47 wt. %.

When the emulsifier/additive-impregnated ground curd is subjected to a heating/kneading/stretching operation, it is preferred that that too be performed on a continuous basis. Thus, for example, the emulsifier/additive-impregnated curd that isdischarged from the grinder can be continuously collected in a funnel, passed into a flowline, and pumped to a heating/kneading/stretching machine that is in operation. As the ground curd is introduced at one location into theheating/kneading/stretching chamber, finished cheese can be continuously withdrawn from another location in the chamber.

The heating, kneading, and stretching step can be performed in the absence of any exogenous water. By "exogenous water" is meant water that is used to bathe the curd and which is subsequently separated from the homogeneous cheese. A shortcomingof the use of exogenous water during the heating, kneading, and stretching step is that, when the water is separated, it removes valuable protein, fat, and other solids that otherwise would be bound up in the finished cheese.

The emulsifier/additive-impregnated ground curd that is withdrawn from the grinder is preferably at a temperature of about 70 to 120° F., and often within the range of about 85 to 105 or 110° F. Typically that ground curd willthen be heated in the heating/kneading/stretching machine to an exit temperature in the range of about 120 to 150° F., preferably about 130 to 145° F.

The hot cheese that exits the heating/kneading/stretching machine may be packaged either before or after being cooled to room temperature or below. No special type of cooling is required. Thus, for example, the cheese can be cooled by extrudingit from the heating/kneading/stretching machine

249

directly into a cold water or cold sodium chloride brine channel or tank, for example as described in U.S. Pat. No. 4,339,468 to Kielsmeier or U.S. Pat. No. 5,200,216 to Barz et al., both of which arehereby incorporated herein by reference.

Instead of floating or immersing the cheese in cold water or brine to cool it, it can be sprayed with cold brine or water and/or passed through a cold air chamber, e.g., a blast cooler.

When extruding the hot cheese and cooling it while in ribbon form, the cheese ribbon is preferably contacted with the cooling medium (e.g., cold water, brine, or air) until its core temperature drops to about 75° F. (24° C.) orbelow. Then the cooled ribbon is cut into segments. The cheese ribbon can even be cooled to a core temperature of about 250° F. (-3.9° C.) or below before being cut.

If the product is string cheese, e.g., having a diameter of about 1/4 to 3/4 inch (0.6 to 2 cm.), the segments of the string will generally be about 11/2 to 8 inches (4 to 20 cm.) long. If the string cheese is not to be baked, or if it is to bebaked only while enclosed in pizza crust, e.g., in a stuffed crust pizza, it will generally not be necessary to age the cheese before using it. If desired, the string cheese may be frozen and stored.

If it is intended to use the cheese as exposed topping for a pizza, then the continuous ribbon, which will preferably be rectangular in cross section, may be cut into loaves, for example having a width of about 12 to 36 inches (30 to 91 cm.), aheight of about 1/16 to 2 inches (0.15 to 5 cm.), and a length of about 14 to 24 inches (36 to 61 cm.). The loaves can be comminuted. Preferably the loaves will have a core temperature at or below 30° F. prior to being comminuted. Theresultant pieces of cheese can be individually quick frozen, for example by the process described in U.S. Pat. No. 5,030,470 to Kielsmeier, et al., which is hereby incorporated herein by reference.

If, instead of being heated, kneaded, and stretched, the emulsifier/additive-impregnated ground curd is transformed into a homogeneous cheese by pressing, then it can be continuously conveyed from the grinder to a cheddaring tower in which themixture is not heated, but rather pressed into blocks, e.g., ranging in size from about 5 to about 640 lbs. Even mozzarella variety cheeses can be made by the pressed curd process, as disclosed, for example, in U.S. Pat. No. 6,086,926 (Bruce et al.),which is hereby incorporated herein by reference. As discussed in Bruce et al., when using the pressed curd process it is preferred to treat the curd with a proteolytic enzyme, so as to impart stretching properties to the finished cheese. Preferably,the enzyme is added together with salt, and the treated curd is allowed about 3 to 48 hours, at a temperature of about 15 to 40° C., to incorporate the salt and enzyme (mellowing) before the curds are filled into moulds and placed into a cheeseprocess. Typically the pressing is continued overnight, e.g., under a pressure of about 40 lb/in2 (280 kPa) and at ambient temperature.

Depending on the composition of the cheese, if it is intended to be used for baking purposes it may be preferable to store the cheese for a time (e.g., about 7 to 21 days, at about 35 to 45° F. (2 to 7° C.)) after it is removedfrom the cooling medium and before it is comminuted and frozen. However, as described in U.S. Pat. No. 5,200,216 (Barz et al.), if the process is controlled so that the cooled cheese removed from the cooling medium has a moisture content of about 45to 60 wt. %, a milkfat content of at least about 30 wt. % (dried solids basis), and a combined moisture and wet milkfat content of at least about 70 wt. %, then the cheese can be frozen immediately and will still perform satisfactorily when baked on apizza, under a variety of conditions.

When the process of the present invention is used to make standard mozzarella cheese, steps (a) through (c) are controlled so that the cheese obtained has a minimum milkfat content of 45% by weight of the solids and a moisture content that ismore than 52 wt. % but not more than 60 wt. %.

When the present process is used to make low-moisture mozzarella cheese, steps (a) through (c) are controlled so that the cheese obtained has a minimum milkfat content of 45% by weight of the solids and a moisture content that is more than 45 wt.% but not more than 52 wt. %.

When the process of the present invention is used to make part-skim mozzarella cheese, steps (a) through (c) are controlled so that the cheese obtained has a milkfat content of 30 to 45% by weight of the solids and a moisture content that is morethan 45 wt. % but not more than 60 wt. %.

When the process of the present invention is used to make low-moisture, part-skim mozzarella cheese, steps (a) through (c) are controlled so that the cheese obtained has a milkfat content of

250

less than 45% but not less than 30%, by weight of thesolids, and a moisture content that is more than 45% but not more than 52% by weight.

The moisture percentages given above are for bound plus free water--i.e., the percent of weight lost when the cheese is dried overnight in a 200° C. oven.

ILLUSTRATIVE EXAMPLES

The following examples illustrate how the process of the present invention may be performed. Unless otherwise indicated, all percentages are by weight.

Example I

Mozzarella cheese curd is made from cow's milk, using the overnight-curd-hold system described in U.S. Pat. No. 3,961,077 (Kielsmeier). A starter culture containing lactobacillus and streptococcus organisms is used, and the cheese milk iscoagulated by the addition of veal rennet. Most of the individual curd particles range in size from about 1/2 inch to 11/2 inches, in their longest dimension.

Approximately 9,500 lbs. of the cheese curd, having a moisture content of 54.33 wt. %, a milkfat content of 53.65 wt. % FDB (fat on a dry basis) and a pH of 5.61 is passed continuously thru a grinder (Urschel Laboratories, Inc., Valparaiso,IN/Comitrol Processor Model 1700). The grinder is fitted with a cutting head (part number 3M025040U) set to produce a particle size of 0.04 inch. Simultaneously, as the curd falls into the grinder, 1.14% (based on the weight of the curd) of anemulsifier solution is sprayed onto the curd, and a blend of 0.8% salt (sodium chloride), 1.16% modified food starch (Mira-Cleer 516), and 1.16% NFDM (non-fat dry milk), based on the weight of the finished cheese, is sprinkled onto the sprayed curd. Theemulsifier solution is a 0.45 wt. % solution of sodium polyphosphate glass in water. The curd and ingredients are in contact with each other for only a fraction of a second before landing in the grinder.

The ground mixture of curd and ingredients, at a temperature of about 80° F., is captured in a funnel as it is expelled from the grinder. The mixture is then pumped and passed through a series of two, hot-water-jacketed, single-screwmixers running at 12 rpm and a jacket temperature of 165° F. The mixture is heated to 112° F. in the first single auger-mixer and 133° F. in the second single-auger mixer. The heated mixture begins to take on a fibrousconsistency but is not homogeneous yet. The heated mixture is then transferred to a hot-water-jacketed, double-auger mixer running at 22 rpm and a jacket temperature of 145° F. It is in this double auger mixer that a homogeneous, fibrous mass iscreated.

The homogeneous, fibrous mass of cheese (143° F.) is transferred to an extruder. The cheese is extruded into cold brine, where the temperature is dropped from 140° F. to 30° F. in 15-20 minutes. Final productspecifications are 58.10% moisture, 45.34% FDB, 5.56 pH, and 1.80% salt. The cooled cheese is shredded, and then frozen. Upon thawing and baking the thawed cheese on pizza, it performs comparable to traditionally made cheese, and even shows signs ofmore meltdown. More important is the fact that no pockets or lumps of powder are found in the cheese that might cause dicer blade damage.

Example II

Approximately 9,500 lbs. of cheese curd having 52.52% moisture, 52.00% FDB and a pH of 5.62 is passed continuously thru the Comitrol Processor Model 1700 grinder. It is made in the same manner as the curd used in Example I. The grinder isfitted with a cutting head (part number 3M030250U) set to produce a particle size of 0.25 inch. Simultaneously, as the curd falls into the grinder, 0.75 wt. % of an emulsifier solution is sprayed onto the curd, and a blend of 0.8% salt and 4.0% NFDM,based on the weight of the finished cheese, is sprinkled onto the sprayed curd, in the same manner as in Example I. The emulsifier solution is again a 0.45 wt. % solution of sodium polyphosphate glass in water.

The ground mixture of curd and ingredients, at a temperature of about 80° F., is captured in a funnel as it is expelled from the grinder. The mixture is then pumped and passed through an unheated twin-screw mixer running at 80 rpm. Themixture is then transferred to a hot-water-jacketed, double-auger mixer running at 12 rpm and a jacket temperature of 155° F. The heated mixture takes on some fibrous characteristics but is not homogeneous yet. The heated mixture is

251

thentransferred to a hot-water-jacketed, single auger mixer running at 12 rpm and a jacket temperature of 150° F. It is in this single auger mixer that a homogeneous, fibrous mass is created.

The homogeneous, fibrous mass of cheese (130° F.) is transferred to an extruder. The cheese is extruded into cold brine, where the temperature is dropped from 140° F. to 30° F. in 15-20 minutes. Final productspecifications are 58.10% moisture, 45.34% FDB, 5.56 pH, and 1.80% salt. The cooled cheese is shredded, and then frozen. Upon thawing and baking the thawed cheese on pizza, it performs comparable to traditionally made cheese, and even shows signs ofmore meltdown. More important is the fact that no pockets or lumps of powder are found in the extruded cheese which might cause dicer blade damage.

Example III

Approximately 9,500 lbs. of cheese curd having a moisture content of 52.52%, 52.00% FDB and a pH of 5.62 is passed continuously thru the Comitrol Processor Model 1700 grinder. The grinder is fitted with a cutting head (part number 66793) set toproduce a particle size of 0.025 inch. Simultaneously, as the curd falls into the grinder, 0.75 wt. % of an emulsifier solution (0.45 wt. % sodium polyphosphate glass) is sprayed onto the curd, and a blend of 1.0% salt and 4.0% NFDM, based on the weightof the finished cheese, is sprinkled onto the sprayed curd, in the same manner as in Example I.

The mixture is then pumped to a twin-screw mixer. The mixture is continuously moved through three chambers in the mixer, each chamber having independent temperature control via jacketed hot water. Also, all of the screws are heated by hot-water(150° F.) that flows through passages through both the flights and the axles. The temperature of the water flowing through the jacket of the first chamber is approximately 110° F., that flowing through the second chamber's jacket isabout 175° F., and that flowing through the third chamber's jacket is about 160° F. The trip through the three chambers raises the temperature of the cheese mixture from 80° F. to 150° F. Towards the end of its residencetime in the second chamber, the cheese mixture begins to stretch, such that upon exiting the third chamber it is a homogeneous, fibrous mass.

The homogeneous, fibrous mass of cheese is transferred to an extruder. The cheese is extruded into cold brine, where the temperature is dropped from 140° F. to 30° F. in 15-20 minutes. Final product specifications are 51.8%moisture, 41.5% FDB, 5.64 pH and 1.73% salt. The cooled cheese is shred, and then frozen. No pockets or lumps of powder are present in the cheese. FIELD OF THE INVENTION

This invention relates to shelf-stable shredded cheeses and methods of preparing such shelf-stable shredded cheeses using a combination of natural or process cheese, cheese powder, glycerin, and filler. The shredded cheeses of this invention areshelf-stable at ambient temperatures, have good organoleptic properties (e.g., not brittle or dry), and exhibit good melt restriction with essentially no browning upon melting. The shredded cheeses of this invention are especially adapted forincorporated into, or use on or with, snack foods (e.g., chips and the like).

BACKGROUND OF THE INVENTION

Shredded cheese is a growing component of the overall cheese market largely because such a product offers the consumer convenience in the preparation of a wide variety of products in the home kitchen. Shredded cheeses, for example, can be usedas toppings or ingredients in homemade dishes such as pizzas, casseroles, salads, and the like and in retail snack products.

Shredded cheeses often employ anti-caking agents such as cellulose-based products or formulations. For example, U.S. Pat. No. 5,626,893 (May 6, 1997) provided an anti-caking agent formulated from fine mesh vegetable flour, bentonite,cellulose, and antimycotic agents or bacterial cultures. This anti-caking agent reportedly reduces the stickiness of the chunked, diced, or shredded cheese, improves the functionality of the cheese, and reduces yeast and/or mold growth.

U.S. Pat. No. 5,876,770 (Mar. 2, 1999) provided a reduced fat shredded cheese prepared by applying a small amount of fat to the surface of an essentially fat-free shredded natural cheese. The reduced fat shredded cheese product had melt andmouthfeel characteristics similar to that of the corresponding full-fat cheese product but with significantly reduced levels of fat. More recently, U.S. patent application Ser. No. 09/618,514, filed Jul. 18, 2000 (assigned to the assignee of

252

thepresent application and hereby incorporated by reference) provided natural cheese shreds containing a nutritional calcium supplement; the calcium supplement also provided non-agglomerating properties whereby conventional anti-caking agents could besignificantly reduced or eliminated.

Conventional cheese products generally have water activities of about 0.92 to about 1 and must, therefore, be stored at refrigerated temperatures. Attempts to produce shelf-stable cheese which can be stored at room temperature have generallyinvolved the reduction of moisture in the cheese composition. Such efforts generally result in a brittle and dry cheese which is not acceptable for most uses. Such defects are especially noticeably when such cheeses are used to prepare shredded cheesebecause of the increased surface area of shredded cheese.

Using the process of this invention, shredded cheeses which are shelf-stable at ambient temperatures and exhibit good melt restriction and essentially no browning (i.e., when melted at about 375° F. for about 3 minutes) can be prepared. Using a combination of a natural or process cheese, a cheese powder, glycerin, and a filler, the present invention provides a shelf-stable shredded cheese having low water activity without brittleness and dryness. The shredded cheeses of this inventionare especially adapted for incorporated into, or use on or with, retail snack foods.

SUMMARY OF THE INVENTION

The present invention provides shelf-stable shredded cheeses and methods of preparing such shelf-stable shredded cheeses using a combination of a natural or process cheese, a cheese powder, glycerin, and a filler. The shredded cheeses of thisinvention are shelf-stable at ambient temperatures, have good organoleptic properties, and exhibit good melt restriction and essentially no browning upon melting. The shredded cheeses of this invention are especially adapted for incorporation into, oruse on or with, snack foods. For example, the shredded cheeses of this invention can be used on chips, crackers, and other snack foods which can be stored at room temperatures (especially low water activity snack foods). If desired, such foods can beeaten as is or briefly heated in, for example, a microwave oven before consuming. An especially preferred food product prepared with the shredded cheese of this invention is a low water activity chip topped with the shredded cheese of this invention andspices; such a product can be stored without refrigeration and is suitable eating as it or for heating (e.g., sufficient to melt the cheese) by the consumer prior to consumption.

The shelf-stable shredded cheese of the present invention comprises (1) natural or process cheese, (2) cheese powder, (3) glycerin, and (4) filler; wherein the shelf-stable shredded cheese has a water activity of less than about 0.5, exhibitsgood melting properties, and has a shelf life of at least about 3 months at ambient temperatures. A preferred shelf-stable shredded cheese comprises (1) about 3 to about 30 percent natural or process cheese, (2) about 5 to about 60 percent cheesepowder, (3) about 5 to about 25 percent glycerin, (4) about 15 to about 45 percent filler, (5) 0 to about 25 percent sweetness modifier, and (6) 0 to about 5 percent emulsifier; wherein the shelf-stable shredded cheese has a water activity of less thanabout 0.5, exhibits good melting properties, and has a shelf life of at least about 3 months at ambient temperatures. A more preferred shelf-stable shredded cheese comprises (1) about 10 to about 20 percent natural or process cheese, (2) about 30 toabout 45 percent cheese powder, (3) about 5 to about 15 percent glycerin, (4) about 20 to about 40 percent filler, (5) 0 to about 3 percent sweetness modifier, and (6) 0 to about 3 percent emulsifier; wherein the shelf-stable shredded cheese has a wateractivity of about 0.3 to about 0.45, exhibits good melting properties, and has a shelf life of at least about 3 months at ambient temperatures. When included in the compositions of this invention, the sweetness modifier is preferably at about 0.5 toabout 3 percent and the emulsifier is preferably at about 0.5 to about 3 percent.

In another embodiment, the present invention provides a shelf-stable shredded cheese comprising (1) a cheese product selected from the group consisting of natural cheese, process cheese, cheese powder, and mixtures thereof, (2) glycerin, and (4)filler; wherein the shelf-stable shredded cheese has a water activity of less than about 0.5, exhibits good melting properties, and has a shelf life of at least about 3 months at ambient temperatures. A more preferred shelf-stable shredded cheesecomprises (1) about 3 to about 60 percent cheese product, (2) about 5 to about 15 percent glycerin, (3) about 20 to about 40 percent filler, (4) 0 to about 3 percent sweetness modifier, and (5) 0 to about 3 percent emulsifier; wherein the shelf-stableshredded cheese has a water activity of about 0.3 to about 0.45, exhibits good melting properties, and has a shelf life of at least about 3

253

months at ambient temperatures. Preferably, the chesses product contains both natural or process cheese andcheese powder.

The present invention also provides a method of preparing a shelf-stable shredded cheese, said method comprising (A) heating a mixture comprising (1) about 3 to about 30 percent natural or process cheese, (2) about 5 to about 60 percent cheesepowder, (3) about 5 to about 25 percent glycerin, (4) about 15 to about 45 percent filler, (5) 0 to about 25 percent sweetness modifier, and (6) 0 to about 5 percent emulsifier at a temperature and for a time sufficient to obtain a homogenous mixture;(B) cooling the homogenous mixture to form a solid cheese composition; and (C) shredding the solid cheese composition to form the shelf-stable shredded cheese, wherein the shelf-stable shredded cheese has a water activity of less than about 0.5, exhibitsgood melting properties, and has a shelf life of at least about 3 months at ambient temperatures. Water can be added as need; unless the level of natural or process cheese is low, no additional water, other than that contained in the various components,is generally required. 

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a shelf-stable shredded cheese which has a water activity of less than about 0.5, exhibits good melting properties, and has a shelf life of at least about 3 months at ambient temperatures. More preferably, theshelf-stable shredded cheese of the present invention has a water activity of about 0.3 to about 0.45 and a shelf life of at least about 3 months at ambient temperatures. For purposes of this invention, "good melting properties" is intended to mean thatthe shredded cheese exhibits good melt restriction (i.e., significant reduction or elimination of both stickiness and rapid skin formation upon melting), exhibits essentially no browning and generally retains its shape or form upon melting (i.e., heatedto about 375° F. for three minutes).

The shelf-stable shredded cheese of the present invention comprises (1) natural or process cheese, (2) cheese powder, (3) glycerin, and (4) filler; wherein the shelf-stable shredded cheese has a water activity of about 0.3 to about 0.45, exhibitsgood melting properties, and has a shelf life of at least about 3 months at ambient temperatures. A preferred shelf-stable shredded cheese comprises (1) about 3 to about 30 percent natural or process cheese, (2) about 5 to about 60 percent cheesepowder, (3) about 5 to about 25 percent glycerin, (4) about 15 to about 45 percent filler, (5) 0 to about 25 percent sweetness modifier, and (6) 0 to about 5 percent emulsifier. A more preferred shelf-stable shredded cheese comprises (1) about 10 toabout 20 percent natural or process cheese, (2) about 30 to about 45 percent cheese powder, (3) about 5 to about 15 percent glycerin, (4) about 20 to about 40 percent filler, (5) 0 to about 3 percent sweetness modifier, and (6) 0 to about 3 percentemulsifier.

The process or natural cheeses employed in the present invention may be derived from the treatment of any dairy liquid that provides cheese curds upon renneting (using either cheese-making cultures or direct acidification). Suitable naturalcheeses include, by way of nonlimiting example, Cheddar cheese, Colby cheese, Monterey Jack, Havarti cheese, Muenster cheese, Brick cheese, Gouda cheese, and the like. For purposes of this invention, "process or natural cheeses" is intended to includecream cheeses and other soft cheeses. Mixtures of such natural cheeses and process cheeses may also be used. Generally the process or natural cheese is present in the present compositions at about 3 to about 30 percent, and more preferably about 10 toabout 20 percent.

Suitable cheese powders include commercially available cheese powders prepared from natural or process cheeses. Such cheese powders generally have a low moisture content (generally less than about 3 percent). Examples of suitable commerciallyavailable cheese powders included, for example, Cheez Tang.RTM., Sequio.RTM., and Exceed.RTM. 2000 (available from Kraft Foods, Inc.). Generally the cheese powder is present in the present compositions at about 5 to about 60 percent, and morepreferably at about 30 to about 45 percent.

The shelf-stable shredded cheese of the present invention contain significant amounts of glycerin (generally about 5 to about 30 percent). Although not wishing to be limited by theory, the glycerin appears to act as a solvent to help overcomethe brittleness and dryness normally associated with low moisture cheese products. By incorporating glycerin in the present compositions, organoleptic pleasing cheese shreds can be obtained at low moisture levels (i.e., water activities below about0.5). Glycerin also appears to provide the composition with sweetness level that may be undesirable. If desired, corn syrup (generally at 0 to about 10 percent) can be included in the

254

composition to replace a portion of the glycerin or to supplementthe glycerin.

The present compositions also contain fillers (generally at about 5 to 45 percent, preferably at about 20 to about 40 percent) to provide body and texture to the compositions. Suitable fillers include, for example, starches, fibers, inulin,dextrose, gums (i.e., water binders), and the like. Preferred fillers include the fat replacement compositions described in U.S. Pat. No. 6,658,609 (Aug. 19, 1997; vegetable fiber, starch, and gum) and U.S. Pat. No. 5,851,576 (Dec. 22, 1998;inulin and emulsifiers).

The shelf-stable shredded cheese of the present invention may also contain other ingredients so long as they do not significantly and adversely effect the organoleptic, melting, or stability properties of the present compositions. Such optionalingredients include, for example, sweetness modifiers (e.g., acid whey, sweet whey, whey protein concentrate, sugar inhibitors, and the like), emulsifiers (e.g., disodium phosphate, dipotassium phosphate, tricalcium phosphate, and the like), gums (e.g.,carboxymethyl cellulose, xanthan, guar, and the like), flavorants (e.g., salt, cheese flavors, and the like), colorants, nutritional supplements (e.g., vitamins, minerals, antioxidants, probiotics, botanicals, and the like), anti-caking agents (e.g.,calcium sulfate, potassium starch, cellulose, and the like), and the like as well as mixtures thereof. Although the shredded cheeses of this invention are shelf stable for long periods at ambient temperatures without any added preservatives,preservatives (e.g., natamycin, nisin, and the like), can be added if desired; it is generally preferred, however, that preservatives are not added.

Preferably, one or more of these optional ingredients are included in the present compositions. Sweetness modifiers are generally included in the present composition at 0 to about 25 percent, more preferably at about 3 to about 10 percent. Emulsifiers are generally included in the present composition at 0 to about 5 percent, more preferably at about 1 to about 3 percent. Gums are generally included in the present composition at 0 to about 3 percent, more preferably at 0 to about 0.2percent. Flavorants are generally included in the present composition at 0 to about 2 percent, more preferably at about 0.1 to about 0.5 percent. Colorants are generally included in the present composition at 0 to about 1 percent, more preferably atabout 01 to about 0.5 percent. If desired, nutritional supplements (generally at levels of 0 to about 2 percent) can be included in the present composition. If desired, preservatives (generally at levels of 0 to about 2 percent) can be included in thepresent composition. Anti-caking agents are generally included in the present composition at 0 to about 5 percent, more preferably at about 1 to about 3 percent.

The shelf-stable shredded cheese of the present invention are generally prepared by mixing the natural or process cheese and glycerin (as well as any other liquid ingredients such as, for example, corn syrup) for a time and at a temperaturesufficient to provide a homogenous mixture. Generally the natural or process cheese and glycerin are heated to about 110 to about 160° F. for about 5 to about 15 minutes. Although the other ingredients can be added at any time, it is generallypreferred that the dry ingredients be added after the formation of the homogenous mixture of natural or process cheese and glycerin. Once the dry ingredients are added, mixing is continued until a homogenous cheese product is obtained; generally thismixing is at a temperature of about 100 to about 130° F. for about 5 to about 15 minutes. Once the final homogenous cheese mixture has been obtained, it is cooled to about 20 to about 45° F. After cooling, the final homogenous cheesemixture can be shredded immediately or at a later time to form pieces whose sizes are suitable for shredded cheese. In general, cheese fragments used in the present invention may be regular or irregular sized shreds, particles, or slices; regular sizedshreds or particles are preferred. The size of the shredded pieces can vary widely but are generally about 1/32 to about 3/8 inches in diameter and about 0.75 to about 3 inches in length; more preferably, they are about 1/16 to about 1/8 inches indiameter and about 1 to about 2 inches in length. Of course, other shaped particles having similar dimensions to those just discussed can be used in the practice of this invention; such other shaped particles are intended to be included within the terms"shreds," "shredded," and the like.

The following examples are intended to illustrate the invention and not to limit it. Unless noted otherwise, all percentages throughout this specification are by weight. All patents, patent applications, and publication cited herein areincorporated by reference.

EXAMPLE 1

The following cheese formulations were prepared:

255

TABLE-US-00001 Sample 1 Sample 2 (%) (%) Sample 3 (%) Sample 4 (%) Cheese 16.2 16.2 16.2 16.2 Cheese Powder 41.7 41.6 41.8 41.6 Glycerin 14.6 14.6 14.4 16.2 Gellan Gum 1.6 1.6 0 0 Salt 1.6 1.6 1.6 1.6 Instant Starch 6.8 6.8 6.9 6.8 Filler I*15.6 15.5 0 0 Filler II** 0 0 17.2 15.3 Cheese Flavor 0 0.1 0 0.1 Colorant 0 0.8 0 0.05 Disodium 1.9 1.9 1.9 1.9 Phosphate *K-Blazer II ST (Kraft Foods, Inc.); **K-Blazer II HP (Kraft Foods, Inc.)

In a steam jacketed bowl, the cheese, cheese powder, and glycerin were heated to about 100° F., for about 15 minutes to obtain a homogenous mixture. The emulsifier, filler I or II, and gum were added with continuous mixing after whichthe remaining ingredients were added. Mixing was continued for about 20 minutes at about 130° F. until a homogenous mixture was obtained. After cooling to about 40° F., a shredded cheese was formed using a conventional shredder;generally the sheds were, on average, about 1/16 inches in diameter and about 1 inch in length. The following results were obtained.

TABLE-US-00002 Water Sample Activity Comments 1 0.416 Shredded well; no browning upon melting 2 0.460 Shredded well; slight browning on edges of shreds upon melting 3 0.405 Shreds torn on edges; no browning upon melting 4 0.410 Shreds torn onedges; browning on ends of shreds upon melting

All samples were shelf stable at ambient temperatures with good organoleptic properties.

EXAMPLE 2

The following cheese formulations were prepared:

TABLE-US-00003 Sample 1 Sample 2 (%) (%) Sample 3 (%) Sample 4 (%) Cheese 15.6 15.1 15.2 11.8 Cheese Powder 42.9 43.0 41.4 32.2 Glycerin 15.0 15.1 14.5 11.3 Salt 1.7 1.7 1.6 1.2 Instant Starch 7.0 0 0 0 Filler* 16.0 16.0 15.4 12.0 Gum 0 0.2 0 0Disodium 1.9 1.9 1.9 1.4 Phosphate Whey 0 7.0 10.0 30.0 *K-Blazer II ST (Kraft Foods, Inc.)

Heated glycerin (temperature of about 130° F. and an amount of about 15 percent of the total) and cheese were heated to about 150 to about 160° F. in a mixer to form a homogenous mixture. The various dry ingredients were thenadded and mixed into the cheese/glycerin mixture for about 3 minutes during which time the temperature fell to about 100° F. The remainder of the glycerin (chilled to below room temperature) was then added with mixing and cooled to about 70 toabout 75° F. After further cooling to below room temperature, the resulting cheese was formed into cubes and then shredded using a conventional shredder; generally the sheds were, on average, about 1/16 inches in diameter and about 1 inch inlength. After shredding, an anti-caking agent was added at about 3.5 percent and the cheese packaged under an inert gas flush. The following results were obtained.

TABLE-US-00004 Water Sample Activity Comments 1 0.439 Good cohesive product; little sweet aftertaste; good melting properties with no browning upon melting 2 0.427 Good cohesive product; very good taste; good melting properties with no browningupon melting 3 0.405 Good cohesive product; good taste; good melting properties with no browning upon melting 4 0.406 Sour taste; good melting properties with little browning upon melting

All samples had good melting properties (i.e., retained shape upon heating in oven for 3 minutes at 375° F.).

EXAMPLE 3

The following formulations were prepared:

TABLE-US-00005 Sample 1 (%) Sample 2 (%) Cheese 12.8 12.8 Cheese Powder 26.2 26.1 Glycerin 11.1 11.1 Corn Syrup (43DE) 3.3 3.3 Salt 1.0 1.0 Starch 3.6 3.6 Filler* 16.4 16.3 Acid Whey 19.1 19.1 Dextrose 6.5 6.5 Cheese Flavor 0 0.1 *K-Blazer II ST(Kraft Foods, Inc.)

In a steam jacketed bowl, the cheese and corn syrup were heated to about 130° F. for about 1.5 minutes to obtain a homogenous mixture. Glycerin was then added followed by the remaining ingredients. Mixing was continued for about 3minutes at about 130° F. until a homogenous mixture

256

was obtained. After cooling to about 40° F., a shredded cheese was formed using a conventional shredder; generally the sheds were, on average, about 1/16 inches in diameter and about 1inch in length. The following results were obtained.

TABLE-US-00006 Water Sample Activity Comments 1 0.410 Soft & cohesive with no oil out; acid whey helped mask sweetness; no browning issues 2 0.400 Soft & cohesive with no oil out; better cheese flavor than Sample 1; acid whey helped masksweetness; no browning issuesBACKGROUND OF THE INVENTION

The present invention relates to processed cheese and methods of making processed cheese. In particular, the invention relates to the use of a protein cross-linking enzyme during the manufacturing process to produce a processed cheese having animproved firmness.

Processed cheese has become a staple of the food industry. It is also a commodity, meaning that there are many suppliers of processed cheese. As a result, the price charged for processed cheese has a great impact on a supplier's share of themarket. Thus processed cheese manufacturers are under constant pressure to reduce their costs. On the other hand, government regulations regarding the ingredients that can be used, and the desire for functional qualities such as taste, firmness, mouthfeel and meltability, constrain efforts to reduce costs. In addition to the quality perceived by the consumer, functional qualities are also important in the manufacturing process.

One of the efforts to reduce cost for cheese has been to keep the whey proteins from being lost in the cheese making process. For example, U.S. Pat. No. 5,356,639 discloses a process for making cheese by using ultrafiltration and diafiltrationto keep all of the whey proteins in the final cheese. Also, U.S. Pat. No. 5,681,598 discloses the use of transglutaminase to cross-link proteins in milk to increase the yield of the curds from the milk. In addition, whey solids are a commoningredient mixed with cheese to make processed cheese. However, the presence of whey solids in processed cheese has a negative impact on the firmness of the processed cheese. Other ingredients that may he added to processed cheese may also have anegative impact on the firmness or meltability of the processed cheese. Also, many other measures taken to reduce cost often have a negative impact on the firmness of processed cheese.

Transglutaminase has been suggested for use in various food products. Transglutaminase cross-links proteins in meat products to improve the hardness and elasticity of the products, as well as to improve the texture of products containing lowmeat content. Transglutaminase has also been disclosed for use in dairy products. For example, U.S. Pat. No. 6,224,914 discloses a process for incorporating whey proteins into cheese using transglutaminase, and U.S. Pat. No. 6,242,036 disclosescheese curd made using transglutaminase and a non-rennet protease. U.S. Pat. No. 6,270,814 discloses incorporation of whey into process cheese. However, the common problem with many of these processes is that transglutaminase is currently fairlyexpensive. Thus, the benefit it provides is not worth its cost. None of the foregoing processes using transglutaminase are believed to be currently used on a commercial basis in the United States.

Another approach for utilizing transglutaminase in processed cheese is disclosed in Japanese Patent Publication No. 2594340. In the disclosed process, cheese and other ingredients are melted, mixed together and cooked to make a processed cheese. The temperature is then reduced and transglutaminase is added and allowed to act on the melted cheese mixture to produce a product with optimal stringiness and high temperature shape retention. One problem with this process is that the processed cheeseis stirred at a medium temperature, such as 50° C. (122° F.), for 30 minutes while the transglutaminase reacts. This material then has to be reheated to 85° C. (185° F.) to deactivate the transglutaminase. All of thispost-manufacture processing of the processed cheese is impractical in making a commodity processed cheese, which otherwise requires only a very short residence time in the mixing and cooking equipment.

Hence, there is still a need for a process for making processed cheese that has good firmness, but which is commercially practical. Also, a processed cheese that is inexpensive, but still has good firmness and melt properties would be highlydesirable.

BRIEF SUMMARY OF THE INVENTION

A process has been invented that allows an efficient use of a protein cross-linking enzyme, such as transglutaminase, in making a processed cheese with improved firmness.

257

In a first aspect, the invention is a method of making a processed cheese with improved firmness comprising: mixing a protein cross-linking enzyme and optionally first other ingredients with a cheese material having a pH of less than 5.6, amoisture content of less than 60% and preferably containing one or more coagulating agents to form a mixture; providing temperature and pH conditions and allowing time for the enzyme to react with protein in the mixture to cross link at least a portionof the protein; and thereafter combining one or more emulsifying agents and optionally second other ingredients with the mixture and heating the combination to thereby produce processed cheese from the combined cheese material containing cross-linkedproteins, emulsifying agents and optional first and second other ingredients.

In a second aspect, the invention is a method of making a processed cheese comprising: producing cheese curds; mixing transglutaminase with the cheese curds; packing the mixture of cheese curds and transglutaminase to form cheese; allowing thecheese to age for a period of at least 24 hours, the transglutaminase reacting with protein in the curds to cross-link the protein while the cheese is aging; and combining the transglutaminase-treated cheese with other processed cheese ingredients andheating and mixing the combination to produce the processed cheese.

In a third aspect, the invention is a method of making processed cheese comprising: ultrafiltering and diafiltering milk to produce a retentate; fermenting the retentate; adding transglutaminase to the retentate; removing water from the fermentedretentate; providing temperature and pH conditions and allowing a period of time for the transglutaminase to cross link at least a portion of proteins in the retentate; and combining the fermented dewatered retentate with cross-linked proteins thereinwith other processed cheese ingredients, and heating and mixing the combination to produce the processed cheese.

In a fourth aspect, the invention is a method of making processed cheese comprising: providing cheese material and other ingredients used to make the processed cheese; mixing transglutaminase with the cheese material and providing temperature andpH conditions and allowing time for the transglutaminase to cross link at least a portion of proteins in the cheese material; and heating and mixing the cheese material, transglutaminase and other processed cheese ingredients to form the processedcheese.

The present invention also encompasses a processed cheese made by any of the foregoing methods, as well as novel intermediate compositions and methods of adding a protein cross-linking enzyme to a cheese material. In this regard, in anotheraspect the invention is a mixture of a cheese material and a protein cross-linking enzyme comprising: a cheese material selected from the group consisting of comminuted natural cheese, conventional cheese curds and fermented UF retentate, andtransglutaminase, wherein the transglutaminase is present at a level of between about 0.2 units and about 10 units of transglutaminase per gram of protein in the mixture.

In yet another aspect, the invention is a process of adding a protein cross-linking enzyme to a cheese material so as to allow the enzyme to cross link protein in the cheese material comprising the steps of: ultrafiltering and diafiltering milkto produce a UF retentate; adding transglutaminase to the retentate at a level of between about 0.2 units and about 10 units of transglutaminase per gram of protein in the UF retentate; and evaporating water from the retentate to produce a UF cheesecontaining active transglutaminase.

In still yet a further aspect, the invention is a process of adding a protein cross-linking enzyme to a cheese material so as to allow the enzyme to cross link protein in the cheese material comprising the steps of: producing conventional cheesecurds; mixing transglutaminase with the cheese curds at a level of between about 0.2 units and about 10 units of transglutaminase per gram of protein in the curds; and packing the mixed curds and transglutaminase into a container.

In addition to increased firmness, there are other advantages of the present invention. Primarily, the cross-linking enzyme is utilized in a composition that has a fairly high solids level. In many of the prior art processes, transglutaminaseis used in milk, or other dilute casein sources, or compositions where casein only makes up a small percentage of the composition. As a result, either large quantities of transglutaminase must be used, or long reaction times must be allowed, both ofwhich are not very cost efficient. Further, in the present invention, the cross-linking enzyme is preferably mixed with a cheese material at a stage in the overall processed cheese manufacturing process when the cheese material (such as cheese curds orUF cheese) is normally

258

given time to age. As a result, in preferred embodiments of the invention, the cross-linking reaction can occur over a fairly long period of time without adding to the time required to actually make the processed cheese.

Finally, the preferred embodiments of the invention utilize temperatures normally encountered in processed cheese manufacturing processes to deactivate the cross-linking enzyme, as opposed to additional mixing, holding and deactivation stepsafter processed cheese is made.

These and other advantages of the invention, as well as the invention itself, will be best understood in light of the following detailed description and examples, which are given by way of explanation and are not to be considered as limiting theinvention. 

DETAILED DESCRIPTION OF THE INVENTION AND PREFERRED EMBODIMENTS

Definitions

Unless indicated otherwise, percentages given for components in a composition are percentages by weight of the composition. "Conventional cheese" as used herein means a cheese made by the traditional method of coagulating milk, cutting thecoagulated milk to form discrete curds, stirring and heating the curd, draining off the whey, and collecting or pressing the curd. Milk from many different mammals is used to make cheese, though cow's milk is the most common milk for cheese used to makeprocessed cheese. Cow's milk contains whey proteins and casein at a weight ratio of about 1:4 whey proteins to casein. The conventional process for making natural cheese recovers the casein from the milk. Whey proteins dissolved in the whey are mostlydischarged during the whey drainage step. The ratio of whey proteins to casein is between about 1:150 and about 1:40 for conventional cheese. For example, Cheddar cheese contains about 0.3% whey proteins. The ratio of whey proteins to casein is about1:100 in typical Cheddar cheese, the most common conventional cheese. Cheddar cheese contains about 23% to about 26% protein by weight. Conventional cheese is often categorized by its age. Within 0 to 24 hours after the whey is drained, the materialis often referred to as fresh curd. The curds are pressed and fused together to become cheese. Young cheese is often categorized as cheese that has been aged either 1-7 days, 1-2 weeks or 2 weeks to 1 month. Medium cheese is often categorized as aged1-3 months or 3-6 months. Aged cheese is usually older than 6 months. "American-type cheeses" as used herein means the group of conventional cheeses including Cheddar, washed curd, Colby, stirred curd cheese and Monterey Jack. All must contain atleast 50% fat in dry matter (FDM). Modifications in the process for making Cheddar led to the development of the other three varieties. Washed curd cheese is prepared as Cheddar through the milling stage, when the curd is covered with cold water for 5to 30 minutes. Washing increases moisture to a maximum of 42%. Stirred curd cheese has practically the same composition as Cheddar but has a more open texture and shorter (less elastic) body. It is manufactured as Cheddar except that agitation ofcooked curd particles is used to promote whey drainage, and the Cheddars and milling steps are eliminated. Colby cheese and Monterey Jack cheese are manufactured the same way as stirred curd except that water is added to wash and cool the curd when mostof the whey has been drained away, thus increasing the moisture content to a maximum of 40% for Colby cheese and 44% for Monterey Jack cheese.

"Pasta filata-type cheese" as used herein means a type of cheese having a plastic, pliable, homogeneous, stringy structure. The pasta filata cheeses are traditionally made by producing curds and whey, draining the whey and immersing the curd inhot water or hot whey and working, stretching, and molding the curd while it is in a plastic condition. The principal varieties of pasta filata cheeses are: cociocavallo, provolone, provolette, pizza cheese, mozzarella, provole, scamorze, and provatura. The most well known example of pasta filata-type cheese is mozzarella. In the U.S., the standards of identity of the code of federal regulations subdivide mozzarella cheeses into: "mozzarella", "low moisture mozzarella," "part skim mozzarella", and "lowmoisture part skim mozzarella." As defined by food and drug administration (FDA) regulations, mozzarella has a moisture content of more than 52 but not more than 60 weight percent and fat in dry matter (FDM) of not less than 45 percent by weight. Thelow moisture mozzarella has moisture content of more than 45 but not more than 52 weight percent and FDM of not less than 45 weight percent. The part skim mozzarella contains more than 52 but not more than 60 percent of moisture by weight and has FDM ofless than 45 but not less than 30 percent. The low moisture part skim mozzarella contains more than 45 but not more than 52 percent of moisture by weight and has FDM of less than 45 but not less than 30 percent.

259

"UT cheese" means a cheese produced by a process in which milk is processed by ultratiltration and usually diafiltration to remove water and lactose, but leave the whey proteins in the UF retentate. Fermentation or direct acidification, followedby further water removal, results in UF cheese. If fermentation is used, a starter culture is added to the UF retentate. Fermented UF retentates often contain about 55-60% moisture, and are evaporated to less than 40% moisture, and most preferably toabout 30-35% moisture in the final UF cheese. The final evaporation step may be made easier if the retentate is preheated to a temperature of between about 140° F. and about 212° F. before being evaporated, as disclosed in U.S. Pat. No. 5,356,639, which is incorporated herein by reference. As also disclosed in the '639 patent, rennet may be added to the retentate prior to evaporation, and possibly at the same time as the starter culture, to make a product more suitable forconversion to processed cheese. However, the amount of rennet may be sufficient to coagulate the retentate, contrary to the statement on col. 15 lines 58-59 of the '639 patent.

"Processed cheese" as used herein generally refers to a class of cheese products that are produced by comminuting, mixing and heating natural cheese into a homogeneous, plastic mass, with emulsifying agents and optional ingredients, depending onthe class of processed cheese produced. The comminuted cheese is blended and sent to cookers or the like, which commonly heat the mass to a temperature of 150°-210° F., preferably 165°-190° F. During cooking, fat isstabilized with the protein and water by the emulsifying agents, which are typically citrate or phosphate salts, usually at a level of about 3%. The emulsifying agent causes the protein to become more soluble. Under these circumstances a stableemulsion of protein, fat and water occurs to provide a smooth, homogeneous mass. The hot mass is packaged directly, or formed into slices and packaged. There are four main classes of processed cheese in the U.S.: pasteurized process cheese, pasteurizedprocess cheese food, pasteurized process cheese spread and pasteurized process cheese product. All four classes of processed cheese are made with emulsifying agents. Standards of identity apply to pasteurized processed cheese and are established by theFDA. By those standards, whey solids, including whey proteins, may not be added to the pasteurized process cheese.

"Emulsifying agents" as used herein means emulsifying agents used in the making of processed cheese. These include one or any mixture of two or more of the following inorganic salts: monosodium phosphate, disodium phosphate, dipotassiumphosphate, trisodium phosphate, sodium metaphosphate, sodium acid pyrophosphate, tetrasodium pyrophosphate, sodium aluminum phosphate, sodium citrate, potassium citrate, calcium citrate, sodium tartrate, and sodium potassium tartrate. In processedcheese, these emulsifying agents act as calcium sequestering (or chelating) agents.

"Natural cheese" as used herein means a cheese that does not contain emulsifying agents. Conventional cheeses (containing very small amounts of whey proteins) and cheeses made using an UF process (containing high levels of whey proteins) are theusual varieties of natural cheeses.

"Cheese material" as used herein includes conventional cheese, UF cheese and intermediate materials in the conventional or UF cheese making process. The most common cheese materials used in the present invention are cheese curds, comminutednatural cheese and UF cheese. Cheese materials also include cheese made from other than fresh milk. For example, cheese material may be made from dairy liquids such as reconstituted dry milk powder. The fat content of the milk or other dairy liquidmay be adjusted before making the cheese material. Preferably the cheese material will have a pH of less than 5.6, a moisture content of less than 60% and contain one or more coagulating agents, such as a protease, and most commonly rennet. Preferably,the cheese material will contain at least 15% protein by weight, more preferably at least 20% protein by weight and preferably at least 10% casein by weight.

TEST PROCEDURES

The present invention and the benefits thereof are most easily understood when described in terms of several standards for evaluating the firmness and melt properties of processed cheese.

Schreiber Melt Test

The L. D. Schreiber melt test is a well-known and accepted standardized test for determining the melt properties of cheese. The test uses a kitchen oven and a standardized piece of cheese, and

260

measures the size of the cheese piece after it ismelted. The instructions for the procedure, as used in tests with results reported below, are as follows:

1. Preheat oven to 450° F. (232.2° C.).

2. Slice cheese 3/16 thick (5 mm). If cheese is already sliced, use 2-3 slices to get closest to the 3/16 thickness.

3. Cut a circle out of the cheese slice using a copper sampler with a diameter of 39.5 mm.

4. Center the cheese circle in a thin wall 15×100 mm petri dish, cover and place on the center rack of the oven. Do this quickly so the oven temperature does not drop below 400° F. (204.4° C.).

5. Bake for 5 minutes and remove. Up to 4 dishes may be done at the same time.

6. Once cooled, the melt is measured on the score sheet.

The score sheet comprises a series of concentric circles with increasing diameters. The first circle has a diameter of 40.0 mm. Each succeeding circle is 6.5 mm larger is diameter. The melted cheese receives a score of 1 if it fills the firstcircle, a score of 2 if it fills the second circle, etc. As used herein, the scores include a " " (or "-") indicating that the cheese was slightly larger (or smaller) than the indicated score ring. A cheese with an acceptable Schreiber melt test willscore 3 or above.

Mettler Melt Test

The meltabilities of cheeses can also be compared using an apparatus for determination of dropping point or softening point, such as the Mettler FP 800 thermosystem. In such an apparatus, the temperature at which a plug of cheese falls throughan orifice is measured. In general, cheeses with acceptable melt characteristics have a Mettler melt temperature below 200° F. Cheeses exhibiting non-melt characteristics will not melt at 230° F., which is the shut-off temperature of theMettler FP 800 instrument as set up for this test, which prevented the temperature from rising too high and burning non-melting samples inside the instrument. The Mettler FP 800 instrument was set up with the start temperature at 100.0° F. andthe heating temperature rate at 5.0° F./minute.

The instructions for sample preparation are as follows:

1. The sample cup (middle piece) is pushed through the cheese sample until the sample extruded from the small top hole of the cup.

2. A knife is used to carefully trim around the cup and square off cheese at the top and bottom.

3. Samples of cheese to be prepared are kept in airtight bags to prevent drying out. Samples of cheese that are prepared for analysis in their cups are kept in a petri dish to prevent drying out if they are not to be analyzed immediately.

4. The bottom holder and top holder of the sample cup are assembled with the center section.

5. The entire assembly, using the top holder stem, is placed in the oven and gently turned until it is seated on the bottom of the oven.

6. After the sample is placed in the instrument, the run/stop button is pushed. At this point there is a 30 second countdown while the oven temperature equilibrates at 100° F. The oven temperature will begin to rise and will shut off atthe softening point of the cheese or at 230° F., in case the cheese does not soften and flow. The softening point reading will be printed on paper, or the end temperature (230° F.) will be printed if the cheese does not soften.

7. A fan inside the oven will turn on to bring the temperature back to 100° F. or below. When the fan has turned off, the entire assembly is removed from the oven and disassembled. The sections are cleaned using the scraper providedfor the cup and tweezers to remove cheese from the bottom holder.

261

Instron Firmness Measurement

The firmness of the cheese is measured by an Instron Tester (Model 5542 Canton, Mass.). The cheese is cut into chunk size (2''×3''×4'') and tempered at 40° F. overnight. A compressive loading force is applied to the cheesesample with a McCormic Fruit Tester plunger (8 mm diameter) attached to a load cell (500 Newton). The maximum force (kgf) recorded for the plunger as it travels downward (at a speed of 330 mm/min.) with a penetration depth of 11 mm into cheese isdefined as the firmness of the cheese.

Because the moisture content of processed cheese has a significant impact on the Instron firmness measurement, it is useful to compare firmness data of different processed cheeses on a comparable moisture content basis. To do this, a correctionfactor of 0.2 kgf for each 1% moisture decrease has been found to be fairly accurate. Therefore, this correction factor is used herein to determine firmness at a corrected moisture content of 40%. For example, a processed cheese with actual moisture at39.8% and a measured Instron firmness of 1.0 kgf would have an Instron firmness value corrected to 40% moisture of 0.96 kgf.

Transglutaminases are enzymes that catalyze the transfer of the γ-carboxamide group of a glutaminyl residue in a protein or peptide to the ε-amino of a lysyl residue of the same or a different protein or peptide, thereby forming aγ-carboxyl ε-amino cross-link. Transglutaminases have a broad occurrence in living systems, and may be obtained, for example, from microorganisms such as those belonging to the genus Streptoverticillium, Bacillus subtilis, variousActinomycetes and Myxomycetes, or from plants, fish species, and mammalian sources including pig liver and the blood clotting protein activated Factor XIII. In general, transglutaminases from animal sources require calcium ions for activity. Recombinant forms of transglutaminase enzymes may be obtained by genetic engineering methods as heterologous proteins produced in bacterial, yeast, and insect or mammalian cell culture systems. The principal requirement of any transglutaminase employedin the instant invention is that it have the cross-linking activity discussed above. Any enzyme having transglutaminase activity may be employed in the methods of the present invention. In a preferred embodiment, the transglutaminase is obtained fromthe genus Streptoverticillium.

Transglutaminase activity may be determined using known procedures. One such colorimetric procedure uses benzyloxycarbonyl-L-glutaminyl-glycine and hydroxylamine to form a γ-carboxyl-hydroxamic acid if transglutaminase is present. An ironcomplex of the hydroxamic acid can be formed in the presence of ferric chloride and trichloroacetic acid. Using the absorbance at 525 mm with appropriate standards, the activity of enzyme present may be determined. Activity in the present invention isdetermined and defined as follows. A reaction system containing benzyloxycarbonyl-L-glutamylglycine and hydroxylamine as substrates is reacted with transglutaminase in a tris buffer (pH 6.0) at a temperature of 37° C., and the hydroxamic acidformed is transformed into an iron complex in the presence of trichloroacetic acid. Then, the absorbance at 525 nm is measured, and the amount of hydroxamic acid is calculated using a calibration curve. Thus, the amount of enzyme by which 1 μmol ofhydroxamic acid is formed in 1 minute is defined as 1 unit (1 U) of transglutaminase activity. The complete procedure for determining activity is disclosed in U.S. Pat. No. 5,156,956, which is hereby incorporated by reference.

There are three presently preferred embodiments of the invention. These embodiments are explained in detail by the examples that follow. In the first embodiment, transglutaminase is mixed with the comminuted cheese during the normal processedcheese manufacturing process, but this mixture is given time to react before it is heated up to the temperature at which processed cheese is pasteurized. In the second embodiment, transglutaminase is added to cheese curds as the cheese curds are packedinto blocks or barrels. The transglutaminase can then cross link proteins in the cheese curds while the curds knit together as the cheese is aged before it is comminuted and used to make processed cheese. In the third embodiment, transglutaminase isadded to UF cheese as it is manufactured and before it is placed in barrels. Again, the transglutaminase can cross link proteins while the UF cheese is aged before being made into processed cheese.

All three of these preferred embodiments are common in that transglutaminase is allowed to react on, and cross link the proteins in, a cheese material rather than on a dilute system such as milk or other dairy liquid. As noted above, the cheesematerial will preferably have a moisture content of less than 60%, and more preferably less than 50%. The cheese material will also preferably have a

262

pH of less than 5.6, and more preferably less than 5.3. However, a UF cheese with a pH of between 5.6and 6.0, and even as high as 6.6, may also be used as a cheese material in some embodiments of the invention. It is typical that the transglutaminase will be mixed with the cheese material after the cheese material has already been formed with thosemoisture and pH properties. However, as explained below, there are modifications of the process in which the transglutaminase may be mixed with a material that then later has those properties. The key factor is that during the majority of the time thatthe transglutaminase is allowed to react on the protein in the cheese material, the moisture content is preferably less than 60%. In this fashion, the protein will be concentrated and the amount of transglutaminase needed to catalyze the cross-linkingreaction can be minimized.

It is possible that other ingredients that will eventually be in the processed cheese may be mixed with the transglutaminase as it is allowed to cross-link the proteins. However, such ingredients are optional, and added only as a matter ofconvenience or for some reason unrelated to the cross-linking reaction. For example salt, such as sodium chloride, is often added to curds before the curds are packed in blocks or barrels. The transglutaminase may be mixed with the salt or otherwiseadded to the curds with the salt, the salt being an optional first other ingredient in the second preferred embodiment of the invention. Also, the cheese material in the preferred embodiments has not been melted prior to the cross-linking reaction.

After the transglutaminase and cheese making material have been mixed, conditions are provided under which the cross-linking reaction can favorably occur. Commercially available ACTIVA TG-TI transglutaminase sold by Ajinomoto U.S.A. Inc. hashigh activity in a range of pH from 5-8. As with all reactions, the higher the temperature the greater the reaction speed. However, the commercial enzyme activity decreases gradually above about 50° C. (122° F.) and drops to a fairlylow level at 60° C. (140° F.). At 80° C. (176° F.) the enzyme is deactivated within 1 minute. Thus there is a balance between stability and reaction rate that must be made. As a result, the optimum temperature range forthe commercial enzyme is between about 20° C. (78° F.) and about 60° C. (140° F.). However, if sufficiently long reaction times are available, lower temperatures may be used. The commercially available enzyme is activeat 15° C. (59° F.) and even at 5° C. (41° F.). The preferred reaction temperature are thus in the range of between about 50° F. and about 120° F.

The reaction time, temperature and pH must be sufficient to allow at least a portion of the proteins in the cheese material to become cross-linked. Of course, a high degree of cross-linking is desired. Normally the reaction time will be shorterin the first preferred embodiment of the invention, and longer in the second and third preferred embodiments. It would be preferable to give the enzyme plenty of time to react. However, it is cost prohibitive to significantly lengthen the manufacturingtime for making processed cheese. Of course, higher levels of enzyme can be added to achieve a sufficient reaction, but again the enzyme cost is currently a considerable factor that precludes this option. In the first preferred embodiment of theinvention the reaction time will preferably be in the range of about 10 minutes to about 3 hours, more preferably between about 11/2 and about 21/2 hours, and most preferably about 2 hours. In this embodiment the enzyme will be mixed at a ratio ofbetween about 0.2 and about 10 units per gram of protein. In the second and third preferred embodiments of the invention, the enzyme can be used at lower levels, preferably less than 5 units per gram of protein. The reaction time for these embodimentsof the invention will typically be greater than 24 hours, and more preferably greater than two weeks. These long reaction times coincide with the periods that conventional cheese and UF cheese are normally aged before being used to make processedcheese. Thus in these embodiments, the time it takes to manufacture process cheese is not lengthened at all.

The end of the reaction time occurs when the enzyme is deactivated, which preferably occurs during the normal practice of making processed cheese. Government regulations require the processed cheese to be heated to a temperature of 150° F., but it is more common that it is heated to 170° F. or even up to 210° F. As noted above, these temperatures will deactivate the commercially available transglutaminase.

In the preferred embodiments of the invention, the mixture is preferably essentially free of emulsifying agents during the reaction time. Thus, the preferred methods of the invention include the step of mixing emulsifying agents with the mixtureof cheese material and transglutaminase after the reaction time has occurred. The emulsifying agents are those normally used in making processed cheese. Sodium citrate, trisodium phosphate and disodium phosphate are the presently preferred emulsifyingagents.

263

Typically additional processed cheese ingredients will be added along with the cheese material having cross-linked proteins to make the processed cheese. These second other optional ingredients typically include sorbic acid, sodium chloride, drycream, concentrated milk fat, whey powder, whey protein concentrate, milk protein concentrate, non-fat dry milk, buttermilk powder and water.

As will be seen in the examples below, the optional second ingredients in the second and third preferred embodiments may include an additional cheese material that has not been treated with transglutaminase.

As will also be seen in the examples below, the finished processed cheese will typically have a moisture content of between about 30% and about 60%, a fat content of between about 10% and about 40%, and a protein content of between about 10% andabout 30%. The processed cheese of the present invention will preferably have a Mettler melt temperature of between about 120° F. and about 200° F., more preferably between about 120° F. and about 150° F. and a Schreibermelt score of at least 3 and more preferably at least 5.

It has been found that the firmness of processed cheese can be affected by a number of factors unrelated to the cross linking of proteins. For example, it has been found that processed cheese made in a pilot plant typically has an Instronfirmness of about 0.5 kgf less than that of processed cheese made on commercial equipment. It is believed that the sheer applied to the cheese material when making processed cheese has a big impact on the resulting firmness, and that commercial scaleequipment usually involves higher sheer rates and greater firmness. Also, the age of the cheese used to make the processed cheese has a major impact on firmness. The use of younger cheese will result in greater firmness. While the processed cheese ofthe present invention will generally have an Instron firmness, corrected to 40% moisture, of at least 1 kgf, the preferred processed cheese of the present invention made in commercial equipment, after being cooled for 3 days at 40° F., will havean Instron firmness, corrected to 40% moisture, of at least 1.5 kgf. More preferably the Instron firmness, corrected to 40% moisture, will be at least 1.8 kgf, and most preferably at least 2.0 kgf. In any event, it is preferred that the cross linkingincrease the firmness of processed cheese to be at least 5% greater than the firmness of processed cheese made by the same procedure but without the cross-linking enzyme. The following examples show how such a comparison can be made. It is morepreferred that the firmness increase by at least 10%. With some preferred embodiments of the invention, firmness will be increased by more than 25% and even 30%.

EXAMPLE 1

Treating Cheese Blend with Transglutaminase Shortly Before Converting it into Processed Cheese

A ten pound processed cheese formula with a target finished product composition of 39.5% moisture, 32.0% fat and 2.3% salt is shown in Table 1 below:

TABLE-US-00001 TABLE 1 Processed Cheese (10 lbs.) Cheese/Ingredient Weight (lb) Barrel Cheese (1.5 months old) 4.24 UF Cheese (1 month old) 2.08 Trisodium Phosphate 0.013 Sodium Citrate 0.348 Sorbic Acid 0.02 Salt 0.117 Dry Cream 0.231Concentrated Milk Fat 1.08 Whey Powder 0.37 Water 1.50 10 lbs

The above processed cheese formula was made using two types of cheese: conventional barrel cheese and the UF cheese. The conventional barrel cheese (500 lbs) was purchased from Associated Milk Producers, Inc. (Paynsville, Wis.). The finishedbarrel cheese met the standards of Cheddar cheese for manufacturing as defined by 21 C.F.R. .sctn.133.114 (2001). The UF cheese was made using the Jameson et al. process as disclosed in U.S. Pat. No. 5,356,639; with the modification that rennet wasadded. The UF cheese was prepared by ultrafiltering and diafiltering milk to produce a retentate, adding salt to the retentate, fermenting the retentate and evaporating the fermented retentate to produce cheese containing all the casein and whey proteinof the original milk. The fermented retentate was treated with rennet in an amount sufficient to coagulate the fermented retentate prior to the evaporation. Also, the fermented retentate was preheated to a temperature of between about 170° F.and about 190° F. before being introduced into the evaporator.

264

The transglutaminase enzyme preparation (ACTIVA TG-TI) was obtained from Ajinomoto U.S.A. Inc. (Teanack, N.J.). The ACTIVA TG-TI contains about 100 units of activity per gram. ACTIVA TG-TI contains 99% maltodexrin and 1% transglutaminaseenzyme.

A cheese blend containing the ground barrel cheese (4.24 lbs), UF cheese (2.08 lbs) and water (1.5 lbs) was mixed with 35 grams of ACTIVA TG-TI in a 10 lb size Rietz cooker for 2 hours at 85° F. with the auger speed set at 1. Thisprovided time for the transglutaminase to cross link at least a portion of the proteins in the cheese blend. The calculated ratio of ACTIVA TG-TI (35 gram) to cheese blend (7.82 lbs) was estimated at ~1.0%, and the ratio of transglutaminasecross-linking enzyme to protein was estimated at ~5.13 units per gram of protein. A control processed cheese was made using the same cheese blend except 35 grams of maltodextrin were used to replace the 35 grams of ACTIVA TG-TI.

After the 2 hour, 85° F. mixing, other ingredients were added to the cooker and the temperature was increased as in a normal processed cheese manufacturing process. Both control and transglutaminase-treated cheese blends were used tomake control and inventive processed cheese according to the processed cheese formula (Table 1). The control and inventive processed cheese mixtures were each cooked to 170° F. with indirect steam jacket heating with the auger speed set at 4. It took approximately 10 minutes to reach the 170° F. temperature in each case. The indirect steam heat was then turned off. The finished processed cheeses had a homogeneous, plastic, molten consistency when they were discharged at 170° F. to 14 oz. tubs. The cook temperature of 170° F. also provided the necessary heat to deactivate the transglutaminase in the inventive cheese blend. The finished processed cheeses were cooled at 40° F. for 3 days. The proximatecomposition, melt properties, and Instron firmness of the finished processed cheeses are shown in Table 2 below:

TABLE-US-00002 TABLE 2 Processed Cheese Composition SFI Mettler Instron % Increase Melt Temp Firmness in Cheese Blend % H2O % Fat % Salt pH Score (° F.) kgf* Firmness 1. Control 39.82 32.0 2.72 5.85 5 131 1.015 -- 2. Transglutaminase 39.48 32.5 2.44 5.87 4 148 1.441 41.97 treated (~1% ACTIVE TG TI) *Instron firmness readings corrected to 40% moisture.

The composition differences between the control and transglutaminase-treated processed cheeses reflect normal variations due to cheese ingredients and measurement error. The data in Table 2 clearly demonstrates that the transglutaminase-treatedcheese blend of Example I resulted in a significant increase in firmness ( 41.9%) as compared to the control.

EXAMPLE 2

Treating Cheese Curd with Transglutaminase During the Manufacture of the Conventional Cheddar Cheese

Cheddar cheese in a 40 lb block form was made at Carr Valley Cheese Co., Inc., (Lavelle, Wis.) following the conventional milled curd process. A commercial transglutaminase enzyme preparation, ACTIVA TG-TI, was first mixed with salt and thenapplied to the milled curd during the regular salting step of the make process. The curd/salt/ACTIVA TG-TI ratios were set at 1000 lbs curd/27.3 lbs salt/2.5 lbs ACTIVA TG-TI.

The calculated ratio of ACTIVA TG-TI to the curd was ~0.25%. The ratio of transglutaminase activity to protein was estimated at ~1 unit per gram of protein. A control Cheddar cheese was made in an identical fashion compared to thecheese made with the transglutaminase treatment except maltodextrin was used to replace ACTIVA TG-TI.

The control and AVTIVA TG-TI treated cheese curd were then each pressed in 40 lb hoops overnight and packed/stored in a 40° F. cooler until their use in the processed cheese formulation. The produced Cheddar cheeses had the followingproximate composition:

TABLE-US-00003 TABLE 3 Cheddar Cheese (40 lb Composition block) % H2O % Fat % Salt pH 1. Control 37.47 33 1.74 4.97 2. Transglutaminase treated 36.82 34 1.72 5.00 (~0.25% ACTIVA TG TI)

Both control and transglutaminase-treated Cheddar cheeses had a typical Cheddar cheese composition with acceptable flavor and texture. Both the control and transglutaminase-treated

265

Cheddar cheeses were made into processed cheese as describedbelow in conjunction with Example 4.

EXAMPLE 3

Treating Fermented Milk Retentate with Transglutaminase During the Manufacture of UF Cheese

The UF cheese was manufactured according to the modified Jameson et al. process disclosed in U.S. Pat. No. 5,356,639 described in Example 1.

An ACTIVA TG-TI suspension (~28%) was first prepared by dispersing 12 lbs ACTIVA TG-TI in 5 gallons of cold water. The prepared ACTIVA TG-TI solution was then injected into the feed stream of fermented retentate immediately after thepreheating step (which was at 170° F.-190° F.) and before reaching the evaporator. The flash evaporation in the evaporator reduced the temperature of the cheese material to about 120° F. so that the transglutaminase was notdeactivated. Evaporation was completed in a swept-surface evaporator with a product exit temperature of 90° F.-95° F. The feed rate of the fermented retentate to the evaporator was set to produce ~4900 lbs. cheese/hr. Theinjection rate of the ACTIVA TG-TI solution (~28%) was set at 5 gallons/hr.

The resulting UF cheese was calculated as containing (after evaporation) ~0.25% active ACTIVA TG-TI. The ratio of transglutaminase activity to protein was calculated to be ~1.09 units/gram of protein. A control UF cheese wasprepared using identical feed materials and processing conditions except that an injection of 28% maltodextrin was used to replace the ACTIVA TG-TI solution.

Both control and transglutaminase-treated UF cheeses were packed in 500 lbs. barrels and stored in a cooler at ~40° F. until their use in the processed cheese formulation. The produced UF cheeses had the following proximatecomposition:

TABLE-US-00004 TABLE 4. Composition UF Cheese (500 lbs. Barrel) % H2O % Fat % Salt pH 1. Control 33.23 38.0 1.76 5.51 2. Transglutaminase treated 32.82 37.5 1.78 5.58 (~0.25% ACTIVA TG TI)

Both control and transglutaminase-treated UF cheeses had a typical UF cheese composition with acceptable flavor and texture. Both the control and transglutaminase-treated UF cheeses were made into processed cheese as described below inconjunction with Example 4.

EXAMPLE 4

Processed Cheese made from Cheddar Cheese (Example 2) and UF Cheese (Example 3)

Cheddar cheese (aged 28 days with approximately 0.25% transglutaminase) from Example 2 and UF cheese (aged 22 days with approximately 0.25% transglutaminase) from Example 3 were cooked into process cheese following the formula of Table 5.

TABLE-US-00005 TABLE 5 Processed Cheese (10 lbs) Cheese/Ingredient Weight (lbs) Cheddar Cheese (28 days, Example 2) 4.24 UF Cheese (22 days, Example 3) 2.08 Trisodium Phosphate 0.013 Sodium Citrate 0.348 Sorbic Acid 0.02 Salt 0.117 Dry Cream0.231 Concentrated Milk Fat 1.08 Whey Powder 0.37 Water 1.50 10 lbs

To demonstrate the impact of transglutaminase-treated cheese on the finished processed cheese firmness, four 10 lb cook experiments were conducted using different combinations of control and transglutaminase-treated cheese materials as outlinedbelow.

TABLE-US-00006 Cheese type used in processed cheese formulation Cook ID Cheddar (Example 2) UF Cheese (Example 3) 1 Control Control 2 Transglutaminase Control 3 Control Transglutaminase 4 Transglutaminase Transglutaminase

A mixture of the ground Cheddar cheese (Example 2 or control) and UF cheese (Example 3 or control) were blended with other ingredients as shown in the above formula (Table 5). The blend mixtures were cooked in a 10 lb Rietz cooker with indirectsteam jacket heating at an auger speed setting of 4. The finished processed cheeses were heated to 170° F. in a period of about 10 minutes to achieve homogeneous, molten, plastic body and immediately discharged into 14 oz.

266

tubs for cooling(~40° F., 3 days). Cook ID 2, 3 and 4 thus relate to Examples 2, 3 and 4, respectively. The proximate composition, melt properties and Instron firmness of the processed cheeses are shown in Table 6.

TABLE-US-00007 TABLE 6 Processed Cheese Cheese Type Mettler Instron UF Temp Firmness Cook ID Cheddar Cheese % H2O % Fat % Salt pH SFI Melt (° F.) kgf* 1 Control Control 40.45 33.0 2.46 5.78 7 125 1.026 2 Transgl. Control 40.4633.5 2.58 5.82 5 134 1.317 3 Control Transgl. 40.70 34.5 2.48 5.81 5 134 1.152 4 Transgl. Transgl. 40.49 33.5 2.58 5.81 5 136 1.388 *Instron firmness corrected to 40% moisture.

From the Instron firmness data in Table 6, the impact of 0.25% transglutaminase-treated Cheddar and UF cheese on processed cheese firmness was calculated and is shown in Table 7.

TABLE-US-00008 TABLE 7 Processed Instron* Cheese Firmness Firmness Comparison Increase Impact due to 1. Cook 2 vs. Cook 1 28.36% 0.25% ACTIVA TG-TI treated Cheddar 2. Cook 4 vs. Cook 3 20.48% 0.25% ACTIVA TG-TI treated Cheddar 3. Cook 3 vs. Cook 1 12.28% 0.25% ACTIVA TG-TI treated UF cheese 4. Cook 4 vs. Cook 2 5.39% 0.25% ACTIVA TG-TI treated UF cheese 5. Cook 4 vs. Cook 1 35.28% 0.25% ACTIVA TG-TI treated Cheddar cheese and UF cheese××××××××××.tim- es.××××××××× ##EQU00001##

The results reported in Table 7 demonstrate that the transglutaminase-treated Cheddar cheese (0.25% ACTIVA TG-TI) would contribute ~20.48 to 28.36% firmness increase in the processed cheese formula studied. The data also demonstrates thatthe transglutaminase-treated UF cheese (0.25% ACTIVA TG-TI) would provide ~5.39% to 12.28% firmness increase in the processed cheese formula studied. The impact of both transglutaminase-treated Cheddar cheese (0.25% ACTIVA TG-TI) and UF cheese(0.25% ACTIVA TG-TI) resulted in even greater firmness increase (~35.28%) in the processed cheese formula studied.

EXAMPLE 5

Commercial Scale Production of Processed Cheese Containing the Transglutaminase-Treated UF Cheese (Example 3)

The UF cheese from Example 3, (containing approximately 0.25% ACTIVA TG-TI) and a conventional Cheddar cheese were ground and blended with the other ingredients according to the following formulation (Table 8). A control batch of processedcheese was made using the control UF cheese from Example 3.

TABLE-US-00009 TABLE 8 Cheese/Ingredient Weight (lbs) UF Cheese (Example 3) 3147 Young Cheddar 3560 Medium Cheddar 173 Sodium Citrate 297 Concentrated Milk Fat 594 Non-Fat Dry Milk 495 Whey Powder 100 Carotenal Color 8.6 Salt 127 Sorbic 20 Water1702 10223.6

Blend 1 contained the control UF cheese (0.25% maltodextrin, Example 3). Blend 2 contained the transglutaminase-treated UF cheese (0.25% ACTIVA TG-TI, Example 3). All other cheese/ingredients in blends 1 and 2 were the same.

The ground cheese and other ingredient mixture was blended for 30 minutes before being fed continuously into a commercial size swept surface cooker with indirect steam jacket heating. The blend mixture was cooked to 190° F. anddischarged with a molten plastic homogeneous body. The molten process cheese was quickly cooled down to below 60° F. The finished process cheese was further cooled down (<40° F.) inside the final packages during distribution.

The proximate composition, melt properties and Instron firmness of the finished process cheeses are shown in Table 9.

TABLE-US-00010 TABLE 9 Process Cheese Mettler Instron % Instron Blend SFI Melt Firmness Firmness ID UF Cheese Type % H2O % Fat % Salt pH Melt (° F.) kgf* ** 1 Control 39.16 30.0 2.64 5.99 3 146 2.388 -- 2 Transglutaininase 38.9531.0 2.44 6.00 4 156 2.605 9.08 treated (~0.25% ACTIVA TG-TI) *Instron firmness collected to 40% moisture ××× ##EQU00002##

The higher Instron firmness results in Table 9 compared to Table 6 reflect the fact that processed cheese made in commercial scale equipment is generally firmer than processed cheese made in

267

pilot plant equipment, and the fact that the cheeseused in Example 5 had a younger average age than the cheese used in Examples 1-4. The test results reported in Table 9 demonstrate that the transglutaminase-treated UF cheese (0.25% ACTIVA TG-TI) provided ~9.08% firmness increase in the processedcheese formula studied.

An increased firmness in processed cheese has numerous benefits. A firmer product can be packaged at higher rates of speed. Manufacturing steps are also easier to perform when the processed cheese is firm. The packaged product maintains itsshape, resisting cold flow. The moisture content of the product can be increased (resulting in a lower product cost) if the firmness of the product can otherwise be maintained. The preferred embodiment of the present invention provides a mechanismwhereby the firmness of the processed cheese can be improved without adding significantly to the time required to make the processed cheese, and while maintaining acceptable melt properties. Further, the amount of transglutaminase required to improvethe firmness is minimized by using it in a concentrated protein composition.

It should be appreciated that the method and products of the present invention are capable of being incorporated in the form of a variety of embodiments, only a few of which have been illustrated and described above. The invention may beembodied in other forms without departing from its spirit or essential characteristics. For example, while the transglutaminase was mixed with the cheese blend in the cooker in Example 1, commercial use of that embodiment of the invention would likelyinvolve mixing the transglutaminase with the cheese blend in a different vessel, such as a blender, and later placing the mixture into the cooker, with the time for the cross-linking reaction occurring in the blender, the cooker or even in anintermediate vessel.

As noted above, the other processed cheese ingredients, particularly the emulsifying agents, are preferably added after the cross-linking reaction has progressed. Alternatively, these other ingredients could be added before the time for thecross-linking reaction has elapsed. Also, if a preheating step were not used in the UF cheese-making process, the transglutaminase could be added at an earlier point in the process, even to the initial milk after it was pasteurized, because thetransglutaminase would be retained with the milk proteins in the ultrafiltration and diafiltration steps. Also, the UF cheese could be made by direct acidification rather than fermentation, and rennet may be added to the retentate prior to thefermentation or not used at all.

The above examples use Cheddar and UF cheese, but other cheeses can be used, particularly other American-type cheeses and pasta filata-type cheeses. The described embodiments are thus to be considered in all respects only as illustrative and notrestrictive, and the scope of the invention is, therefore, indicated by the appended clams rather than by the foregoing description. All changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope.FIELD OF THEINVENTION

This invention relates to a cheese-like product and a novel method for preparing such a product. More specifically, this invention relates to a cream cheese product that is substantially casein-free prepared using an edible fat and a non-caseinprotein source comprising a polymerized whey protein from a whey protein concentrate. The cream cheese product prepared according to the present method exhibits an unexpected increase in firmness and has excellent syneresis properties.

BACKGROUND OF THE INVENTION

Cheese compositions are generally prepared from dairy liquids by processes that include treating the liquid with a coagulating or clotting agent. The coagulating agent may be a curding enzyme, an acid, a suitable bacterial culture, or an agentincluding a culture. The coagulum or curd that results generally incorporates casein that has been suitably altered by the curding process, fats including natural butter fat, and flavorings arising during the processing (especially when using abacterial culture as the coagulating agent). The curd is usually separated from the whey. The resulting liquid whey generally contains soluble proteins not affected by the coagulation; such proteins are, of course, not incorporated into the coagulumbecause they are solubilized in the liquid whey.

Nevertheless, whey proteins have high nutritive value for humans. In fact, the amino acid composition in whey proteins is close to an ideal composition profile for human nutrition. Whey proteins are also understood to have superior emulsifyingcapabilities in comparison with casein.

268

Without wishing to be bound by theory, this should reduce defects such as phase separation during processing, and, in the case of cream cheese, can also provide a smoother creamier product. In addition, such wheyproteins provide a low cost dairy product which, if successfully incorporated into cheese products, would significantly increase the overall efficiency and effectiveness of the cheese-making process.

Cream cheese products are produced on large scale in the United States and ways to improve the product and to produce it in a more economical manner have been long sought in the dairy and food industry.

Unfortunately, methods or attempts to incorporate or use whey protein in cheese products have generally been unsuccessful. For example, whey proteins have been concentrated or dried from whey and then recombined with cheese (see, e.g.,Kosikowski, Cheese and Fermented Foods, 2nd ed., Edwards Brothers, Inc., Ann Arbor, Mich., 1977, pp. 451-458). The whey proteins recovered from such procedures, however, do not have the appropriate or desired physical and chemical properties requiredfor good, high quality natural cheeses or process cheeses.

Still other numerous attempts have tried various forms of modified native whey protein, modified, expensive whey protein isolate, or even cellular sources. For instance, a process for improving the functional properties of a protein-containingmaterial selected from the group consisting of single-cell protein material, plant protein material, and mixtures of single-cell protein with plant material, whey solids or both plant protein and whey solids, in which the mixtures contain 1 to 99 weightpercent of the single-cell protein is described in U.K. Patent 1,575,052. An aqueous slurry of the specified protein-containing material having 1 to 99 percent of the single cell protein is heated to a temperature of 75 to 100° C., the pH isadjusted to within the range of 6.6 to 8.0 by adding a compound selected from the group consisting of anhydrous ammonia, ammonium hydroxide, calcium hydroxide, sodium hydroxide, sodium bicarbonate, calcium sulfate, potassium carbonate, calcium carbonate,sodium carbonate, potassium hydroxide, magnesium hydroxide and mixtures thereof, maintaining the heated, pH-adjusted slurry under such conditions for 1 to 120 minutes, and then drying the material. The products are described as being capable ofreplacing nonfat dry milk in formulations which include bakery goods.

According to Watanabe et al., J. Dairy Res., 43:411 (1976), intermolecular disulfide bonds are formed when β-lactoglobulin is heated, with a maximum amount of such bonds being formed at pH 7.0. The β-lactoglobulin is the major proteincomponent in whey and the covalent disulfide bonds link together individual proteins to form extended polymers. Larger sized aggregates are formed at 75° C. and smaller sized aggregates form at 97° C.

U.K. Patent Application 2,063,273A (Jun. 3, 1981) describes a method of preparing soluble denatured whey protein compositions that involves raising the pH of an aqueous solution of native whey protein to a pH of more than 6.5 and then heatingthe solution at a temperature and for a time greater than that at which the native whey protein is denatured and mentioned yogurt and salad dressing.

U.S. Pat. No. 5,416,196 to Kitabatake et al. describes a method of producing a transparent, purified milk whey protein having a salt concentration of less than 50 millimoles/liter. Using this purified whey protein in solution, Kitabatake etal. produced a whey protein product by adjusting the pH of the solution, readjusting the pH to either below 4 or above 6, and again heating the solution. This patent describes the use of whey protein from which the salts and saccharides normallycontained in whey are substantially removed, for example by dialysis, chromatography, or microfiltration. While salt maybe re-added to the whey solution during processing for flavoring, this is done after adjusting the pH.

A heat treatment described in Hoffman, J. Dairy Res., 63:423-440 (1996) reportedly concerned formation of very large β-lactoglobulin aggregates at pH≤6.4.

Rheological properties and characterization of polymerized whey isolates are described in Vardhanabhuti et al., J. Agric. Food Chem., 47:3649-3655 (1999). The whey isolate was heat denatured and polymerized to produce soluble polymers. Wheyisolate solutions in deionized water were prepared at concentrations of 8, 10, and 11 percent and heated in a water bath for 1, 3, and 9 hours at unspecified pH.

269

Gelation properties of polymerized whey protein isolates are described in Vardhanabhuti et al., Abstract 6-9, IFT Annual Meeting (1999). Whey polymers are described as being produced by heating a pH adjusted (pH 7.0) 11 percent protein solutionof whey protein isolate (WPI) at selected salt concentrations of 10 mM CaCl2 and 200 mM NaCl.

U.S. Pat. No. 6,139,900 (Oct. 31, 2000) provides a complex, multi-heating step process for producing whey protein dispersions involving heating a 2 percent solution of whey protein isolate having a pH of at least 8.0 to 75° C. in afirst heating step, cooling it, adjusting the pH to less than about 8.0 (e.g., 7.0), and heating the solution in a second heating step at a temperature of 75 to 97° C. to produce a polymerized whey protein product. This is a relatively complex,multi-step process that requires expensive starting materials and is relatively energy inefficient.

Whey protein isolate, which is required in the process of U.S. Pat. No. 6,139,900, is a highly purified and expensive product. Conventionally, whey protein isolate is made by drying and removing non-protein constituents from pasteurized wheyso that the finished product contains more than 81 percent protein, typically greater than 90 percent, such as on the order of 98 percent protein. The highly purified whey protein isolate may contain small amounts of fat and lactose. Removingnon-protein constituents can be achieved using physical separation techniques such as precipitation, filtration, or dialysis. The acidity of the final isolate product can be adjusted.

Whey protein concentrate (WPC) is more cost-effective than whey protein isolate (WPI) and can be easily produced on a much larger scale. It has a higher lactose but a lower protein content than whey protein isolate. It would be a significantadvance in the art if WPC could be recovered from unit operations in an easy, reliably, economically, and energy efficient manner for use in the manufacture of dairy products, such as cream cheese type products.

SUMMARY OF THE INVENTION

The present invention provides an economical method for producing cream cheese products (e.g., cream cheese spreads and the like), in which a polymerized whey protein from a single-heat treatment of a suitable whey protein concentrate source, canreplace casein protein.

The present method avoids the cumbersome and expensive treatments that are required when single cell organisms are used as a protein source in a foodstuff.

In one embodiment, the method provides for at least reducing the content of casein-containing dairy liquids in the process for making cream cheese, and in the resulting cream cheese product. This reduction is attainable by incorporating athermally modified and functionally enhanced polymerized whey protein to displace the functionality of the casein that has been eliminated.

Another embodiment of the present method involves the heat treating an aqueous suspension, emulsion, or solution of WPC at about 70 to about 105° C. (preferably at about 80 to 85° C.) for about 0.5 to about 180 minutes (preferablyabout 15 to about 45 minutes), wherein the aqueous suspension, emulsion, or solution has a mildly alkaline pH; admixing thereto an edible fat source to obtain an admixture; heating and homogenizing the admixture; pasteurizing the homogenized admixture;cooling the admixture; fermenting the cooled admixture with a culture suitable for a cheese, such as a cream cheese; admixing thereto at least one stabilizer and salt and cooking; homogenizing the cooked admixture; and collecting the product. Thecollected product can be cooled and, if desired, packaged. 

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 illustrates one embodiment of the method of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

The present method involves producing a cream cheese type product that contains significantly reduced levels of casein and preferably that contains essentially no casein. For purposes of this invention, "significantly reduced levels of casein"or equivalent phrases are intended to mean that the cream cheese type product contains less than about 2 percent casein, and preferably less than about 1 percent casein. For purposes of this invention, a cream cheese type product which contains"essentially no casein" is intended to mean that it contains less than about 0.5 percent

270

casein. Typically, conventional cheese type products contain about 5 to about 10 percent casein. More preferably, the protein source in the present methodconstitutes polymerized whey protein from a thermally induced polymerization of at least one whey protein concentrate. The thermal induced polymerization is advantageously carried out in a single polymerization step.

This present invention provides processes for making a stable cheese product supplemented with functionally enhanced, polymerized whey protein. As used herein, the term "stable" as applied to the resulting cheese product relates tocharacteristics such as the product having minimal syneresis, an unexpectedly improvement in firmness (which can be measured as yield strength), and minimal disruption of the emulsion during processing. As used herein, the term "functionally enhanced"and similar expressions relate to an alteration in the structure and properties of the polymerized whey proteins.

Whey proteins have high nutritive value for humans, and can provide a favorable sensory quality, conferring a creamy and spreadable quality to dairy products in which they are incorporated. Whey proteins also can enhance cheesecake bakingperformance, when added to a cream cheese product, especially in cheesecake formulations with low protein content. In addition, their cost is low, compared to the other proteins present in milk, making it desirable to incorporate whey proteins intocheese products. The present method overcomes the difficulties previously encountered in dairy production in which attempts to incorporate whey proteins into cheese, such as cream cheese products, have led to excessive separation losses (syneresis) andconcomitant decreases in yield and/or to very poor firmness of the finished product.

A cream cheese product can be prepared by inoculating a homogenized and pasteurized mixture of at least a portion of the mixture containing the polymerized whey protein polymers obtained from WPC, water, and an edible fat with a suitable lacticculture and fermenting it under conditions to aid in acid production; admixing at least one additive selected from the group consisting of salt and stabilizer (e.g., edible gum such as carob gum, tara gum, guar gum, carrageenan, alginate, and xanthangum; maltodextrin; starches; and the like); cooking the admixture; and homogenizing the product before packaging. In principle, the at least one salt and stabilizer can be added as the temperature is being raised to the cooking temperature, providedthere is sufficient mixing of ingredients. The homogenized admixture can be cooled before packaging for bulk shipment or packaging in containers for direct sale to consumers, or collected under conditions effective to collect the product in a brickform.

The present method initially involves producing a polymerized whey protein from at least one WPC in a single heat treatment. An exemplary methodology includes preparing an aqueous suspension of at least one WPC; optionally adjusting the pH ofthe aqueous suspension to a mildly alkaline pH; heating the aqueous suspension to a temperature and for a time sufficient to form polymerized whey proteins in a mixture; and optionally cooling the thus obtained mixture.

Whey protein concentrate (WPC) is significantly different from a whey protein isolate (WPI). WPC is generally a white to light cream colored product with a bland but clean flavor. Although non-protein constituents can be removed, the proteinconcentration is generally about 10 to about 80 percent, and more usually about 25 to about 75 percent. WPC alsohas a higher concentration of fat and lactose than whey protein isolate. The higher lactose concentration means there is increased shieldingfor the whey proteins against denaturation. Industrially, concentrating the whey can be achieved by ultrafiltration, where low molecular weight compounds are filtered from the whey to a permeate, with the proteins being concentrated in the retentate,from which the WPC can be obtained. The permeate can be used in cattle feed, to manufacture certain pharmaceutical products, and in producing lactose.

The WPC can, for instance, be selected from the group consisting of dry whey protein concentrate, liquid whey protein concentrate and any combination thereof. Generally, WPCs having a protein concentration of about 25 to about 85 percent areused in the present method. Commercially available WPC having about 34, 50, or 70 percent protein are especially preferred. Powdered concentrated whey, known in the trade as "WPC" (whey protein concentrate), which is available in grades having proteinconcentrations (dry basis) of about 34, 50, 70, and up to less than about 80 percent can also be sued. Other commercially available WPC (e.g., "FDA 50" (a WPC containing about 50 percent protein), WPC 8000 (a WPC containing 80 percent protein)) can alsobe used. These WPC concentrations are with respect to WPC in powder form. It would be advantageous to use a WPC that is commercially available and processible on currently used equipment.

271

A general method of preparing cream cheese according to the present invention is illustrated in FIG. 1. In the present method, the aqueous suspension (solution, dispersion etc.) of whey protein concentrate is provided in which the proteinconcentration is selected to enable facile and reliable processing. The protein concentration in the aqueous WPC suspension is generally on the order of about 4 to about 20 percent protein, although protein concentrations of about 5 to about 8 percentprotein may be preferred. If the protein concentration in the aqueous media is too low (generally less than about 1 percent) the polymerization may proceed too slowly, whereas if the concentration is too high (generally greater than about 20 percent),the "polymerized" material obtained may be undesirable (i.e., lack the desired functionality). Generally, protein concentrations less than about 8 percent protein are preferred since higher levels can result in the formation of curd-like materials. Ifbroken up (using, for example, a shear device), such curd-like materials may be used, if desired.

The pH of the aqueous suspension may be adjusted, if desired or as needed, to a mildly alkaline level (generally greater than about 7 up to about 9) by addition of an edible base (e.g., NaOH, KOH, and the like). Preferably the pH is adjusted toabout 7 to about 8, and more preferably to about 7.2 to about 7.5.

This aqueous solution is heated in a single heat treatment to a temperature and for such time as desired to induce thermal polymerization of the whey protein from the WPC. Generally, sufficient thermal polymerization of the whey protein is thatdegree of polymerization that will provide a yield stress value of greater than about 2500 Pascals in the final cream cheese product. The actual time and temperature may vary as a function of the equipment used and on the pH of the starting WPC. Ingeneral, the WPC can be heated to a temperature ranging from about 70 to about 105° C. (preferably about 80 to about 85° C.) for about 0.5 to about 180 minutes (preferably for about 15 to about 45 minutes). In principle, the heating stepcan, if desired, be conducted at elevated pressures, such as in a heated extruder, in which case the temperature can be suitably adjusted. Multiple heat treatments to induce thermal polymerization are inefficient and waste energy, both of whichundesirably increase the costs to make the product. Thus, the present invention only requires, and specially does not include, multiple (i.e., two or more) heat treatment steps for thermal polymerization. The polymerized whey protein can, if desired,be cooled to about ambient temperature.

The whey protein polymers result from unfolded proteins cross linking by --S--S-- bonding. In general, the consequent increase in molecular weight indicates increased crosslinking with a whey protein. In principle, about 30 to about 85 percentdisulfide crosslinking may be attainable in the present method, although crosslinking in a range of about 50 to about 80 percent is generally preferred. The degree of crosslinking can be estimated, for example, using polyacrylamide gel electrophoresiswith disulfide reducing reagents such as dithiothreitol (see, e.g., U.S. Pat. No. 4,885,183 and Laemmi, Nature, 227:680-685 (1970), both of which are incorporated by reference).

The use of polymerized whey protein from a single controlled heat treatment of an aqueous media including WPC saves energy, reduces overall processing time, and allows for a decrease in fat content, provides satisfactory moisture levels in thecream cheese product without sacrificing product quality and while employing a by-product of conventional cream cheese manufacture. The cost to produce a cream cheese product can thus be considerably reduced. A mixture of the product comprising thepolymerized whey protein (oftentimes characterized as a suspension, although it may also be deemed an emulsion or solution; these terms are used interchangeably in the present specification) from the WPC concentrate along with a selected amount of ediblefat, such as milkfat (preferably anhydrous milk fat), and water are mixed to form an essentially homogeneous mixture or slurry. A selected source of edible fat includes dairy fat, natural and partially hydrogenated edible oil, and the like as well asmixtures thereof. Non-dairy fats, such as vegetable, animal fats or oils, which can be hydrogenated or partially hydrogenated, may also be used. By present preference, a dairy fat is the fat source used. Illustrative dairy fat sources include, but arenot limited to, anhydrous milk fat (AMF), concentrated milk fat (CMF), cream, and the like. It is possible to include other fat-containing dairy materials, such as dry cream, along with or as the fat source. The specific fat source used will also playa role in determining the characteristics flavors and aromas in the resulting cream cheese product. Preferably, the cheese products of this invention include only proteins derived from polymerized whey protein and milkfat. As those skilled in art know,the milk or dairy product composition may be varied, for example, by using fat from one or more milk sources, including no-fat or skim milk, low-fat milk, full-fat or whole milk, whole milk

272

with added fat, and the like. The milk or dairy productcomposition may also be varied, for example, by inclusion of additional dairy components such as milk solids, cream, and the like. In this fat-containing mixture, the concentration of the polymerized whey protein from the WPC can be in a range of about3 to about 8 percent, preferably about 4 to about 6 percent, based on the weight of the mixture. This fat-containing mixture is heated to a temperature m the range of about 55 to about 75° C., preferably about 60 to about 65° C. Theheated fat-containing mixture is homogenized. Homogenization may be at a pressure up to about 14,500 psi, generally from about 1,500 to about 14,500 psi. Preferably the homogenization pressure is about 1,500 to about 10,000 psi, and more preferablyabout 3,000 to about 5,000 psi. The homogenization can be, and preferably is, conducted concurrently with the heating. The use of heating during homogenization is helpful in maintaining the milk fat in a liquid treatment, thereby increasing theefficiency of the homogenization step. In most cases, only a single pass through the homogenizer, especially when used with heating, is required. Homogenization reduces the average particle size in the mixture (oil/water); generally the averageparticle size is less than about 2.5 μm, and preferably less than about 1.5 μm. Suitable homogenizers that can be employed for this purpose are well-known in the fields of dairy science and food chemistry.

A two-stage homogenizer is preferred. All homogenization pressures specified hereafter refer to the first stage homogenization unless otherwise indicated. For cream cheese products, the pressure is preferably less than about 10,000 psi. Ahigher homogenization pressure (generally up to about 14,500 psi) can be used to achieve a thicker product. Softer and creamer products can be obtained using lower or more moderate homogenization pressures (generally about 3,000 to about 3500 psi). Aswill be appreciated, typically, flow rate and valve settings are adjusted to achieve the desired results herein; the homogenization pressure varied as needed to achieve the desired consistency of the final product.

The homogenized mixture can, if desired, be pasteurized. The current invention includes a fermentation step. The homogenized mixture should be cooled to a temperature suitable for inoculation and fermentation (e.g., ambient temperatures) usingsuitable cooling techniques and equipment known to those skilled in the art. The cooled homogenized mixture is inoculated with a suitable culture and allowed to ferment under conditions appropriate for forming curds and the whey. In principle, anylactic acid-producing bacteria used in conventional cheese making can be used in th process of the current invention. Suitable lactic acid-producing bacteria include, for example, Streptococcus or Leuconostoc such as Streptococcus lactis, Streptococcuscremoris, Streptococcus diacetyllactis, Leuconostoc cremoris, Betacoccus cremoris, and the like. These, lactic acid-producing bacteria can be used alone or in combination thereof. Not to be limited by theory, as is known in the art, lacticacid-producing microbes are used in cheese manufacturing to ferment lactose present in the dairy liquid and to cause further decomposition of the clotted casein into smaller peptides and free amino acids as a result of the culture's production ofproteases and peptidases. The lactic acid-producing culture may be added in amounts which are conventional for the present purpose (i.e., typically about 10,000 to 100,000 bacteria/g of dairy liquid). The cultures can be added as freeze-dried, frozen,or liquid cultures. If appropriate, an additional acidifying agent, such as a lactic acid solution, may be added to bring the pH within the final target range. For cream cheese production, preferably cultures include lactic cultures, such asLactococcus cremoris (commercially available from CHR Hansen, Milwaukee, Wis.) and the like. Fermentation is conducted using conventional techniques and procedures as well known in the art. For example, fermentation can be carried out at about 10 toabout 40° C. for about 1 to about 36 hours, preferably at about 20 to about 25° C. for about 15 to about 24 hours. Fermentation can, if desired, be terminated by a brief exposure to an elevated temperature that inactivates the culture.

After fermentation, the product is mixed, such as with a stirring apparatus, and the pH can, if desired, be monitored to ensure the fermented product has a mildly acid pH, such in a range of about 4.7 to about 5.0. If the pH is too low, the pHcan be adjusted by adding appropriate amounts of a basic compound, such as NaOH, that is acceptable in the manufacture of food products. It will be appreciated that in large batch or semi-continuous production that the present process parameters, suchas temperature and pH, can be monitored as needed consistent with good manufacturing practice.

The fermented product is, optionally, salted with a suitable salt such as NaCl, KCl, and the like. Preferably, NaCl is used. Generally, the salt is added at a level of about 0.5 to about 1 percent, depending on the taste profile desired.

273

It is preferred to add one or more selected stabilizers (food grade hydrocolloids such as gums, starches, maltodextrins, and the like or texture modifiers such as emulsifiers and the like) to the fermented product. The stabilizer or stabilizersmay be added with or without the salt. Generally, the amount of stabilizer or stabilizers added is less than about 4 percent; preferably, the amount of stabilizer or stabilizers added is about 0.1 to about 0.5 percent. The current Federal Standards ofIdentity can be taken into account in determining the level of added stabilizer; levels outside of the Federal Standards of Identity can be added if desired, however. Examples of suitable stabilizers include, but are not limited to, ionic or non-inoicgums such as locust bean gum, guar gum, tara gum, konjac gum, xanthan gum, carrageenan, and the like; cellulose derivatives such as carboxymethylcellulose; starches such as corn starch, waxy maize starch, rice starch, potato starch, tapioca starch, wheatstarch; and modified starches such as phosphorylated starch. Instant and pregelatinized starches can be used, if desired. Other exemplary ionic gums include gellan, low methoxy pectin, and alginate. In one preferred embodiment, xanthan gum is used dueto its cold water solubility, consistent composition, availability, and low cost. For a traditional cream cheese product, locust bean gum can be used. It will be appreciated that one of more dextrins, such as one or more maltodextrins, can be includedin an amount of up to about 4 percent. Maltodextrin(s) is preferably added along with a gum to enhance stability and mouth feel for a cream cheese type product. Suitable maltodextrins include those having a dextrose equivalence (DE) of about 2 to about10; C*deLight.RTM. commercial maltodextrin (DE about 3) from Cerestar is illustrative. It is possible to increase the initial and aged yield stress of a product by including at least one selected maltodextrin as a stabilizer in addition to ahydrocolloid gum stabilizer. Suitable gum stabilizers are described in Glicksman, Gum Technology in the Food Industry (1969 Academic Press) and in Davidson, Handbook of water-soluble gums and resins (1992 McGraw-Hill Book, Inc.).

Other texture modifiers may be added singly or in combination and include, for instance, emulsifiers. Generally, ionic, high hydrophillic lipophilic balance (HLB) emulsifiers are suitable; examples sodium stearoyl lactylate, calcium stearoyllactylate, diacetyl tartaric acid esters, and the like. Other non-ionic emulsifiers can, if desired, be used, including monoglycerol esters of fatty acids and the like. Still other suitable emulsifiers include fatty acid esters of sucrose, fatty acidesters of propylene glycol, fatty acid esters of sorbitol, and polysorbate 60.

After adding the gum(s) and salt(s), the material is cooked at a temperature sufficient to dissolve the added gum or other stabilizer, but insufficient to induce significant a Maillard reaction. The cooking can be conducted in a suitablecooking-mixing apparatus until the desired temperature is reached. Generally, the cooking is carried out at about 70 to about 105° C. (preferably about 80 to about 85° C.) for about 0.5 to about 180 minutes (preferably for about 15 toabout 45 minutes). Cooking temperature conditions that induce significant Maillard reactions should be avoided.

The cooked product is then homogenized to obtain a creamy texture and/or mouthfeel appropriate for the type of cheese desired (usually a cream cheese). The homogenization is generally carried out at about 1500 to about 5000 psi and preferably atabout 2500 to about 3000 psi. The homogenization can be conducted using a single or multi-stage homogenizer. The resulting homogenized product is cheese-type product, preferably a cream cheese product, having significantly reduced levels of casein or,more preferably, essentially no casein. It can, if desired, be stored or packaged using conventional techniques. Conventional additives, such as vitamins, flavorings, colorants, preservatives and the like, can be included.

The use of the polymerized whey proteins from WPC unexpectedly and significantly increase (in some cases almost doubling) the firmness of the cream cheese product compared to a cream cheese product at the same protein concentration made usingunpolymerized WPC (i.e., control prepared under similar conditions). The inventive cream cheese products of the present invention generally had yield stress values greater than about 2500 (and more preferably about 2600 to about 3800 Pascals);conventional cream cheese normally have yield stress values about 1400 to about 2000 Pascals.

The following examples describe and illustrate the processes and products of the invention. These examples are intended to be merely illustrative of the present invention, and not limiting thereof in either scope or spirit. Those skilled in theart will readily understand that variations in the materials, conditions, and process steps described in these examples can be used. Unless noted otherwise, all percentages in the present specification are by weight. All references cited herein areincorporated by reference in their entirety.

274

EXAMPLE 1

Preparation of Whey Protein Polymers

This examples illustrates the preparation of polymerized whey protein using a single-heating polymerization step. A sodium citrate solution was prepared and divided into two portions. A whey protein concentrate (WPC 34, Wisconsin WheyInternational, Juda, Wis.) was hydrated in one portion of the sodium citrate solution (80 percent of the total solution). The pH was adjusted to 8 using 1N NaOH after which the remainder of the sodium citrate solution was added to obtain a solution(total solution was 400 grams). Several solutions were prepared having different citrate levels as indicated in the Table below. The solutions were poured into individual containers, covered with aluminum foil, and heated at 90° C. for varioustimes as also indicated in the Table below in order to effect polymerization. Time zero was taken when the center of each beaker reached 80° C. The beakers and their contents were stored overnight at room temperature. The resulting slurrieswere used in Example 2.

TABLE-US-00001 Heating Sample Protein (%) Citrate (mM) Time (min) 1 5.1 0.5 60 2 6.0 0.5 30 3 5.5 0.75 45 4 5.1 0.5 30 5 5.1 1.0 60 6 6.0 2.0 45 7 8.3* 1.0 30 8 5.1 0.5 10 9 5.1 0.5 20 10 5.1 0 30 11 6.0 0.5 10 *demineralized WPC

EXAMPLE 2

Preparation of Cream Cheese Products

Cream cheese products were formulated to a target 4 percent protein level using the polymerized whey proteins of Example 1 with the following general formulation:

TABLE-US-00002 Ingredient Amount (%) Polymerized Whey ? Protein (dry basis) Anhydrous Milkfat 21.5 NaCl 0.7 Locust Bean Gum 0.25 Water (total) 65.9

The whey polymers of Example 1, anhydrous milkfat, and water were mixed together and then transferred to a Stephen mixer attached to a recirculating oil bath at a temperature of 110° C. The material was mixed at the lowest speed until thetemperature reached 60° C. (about 6 to about 8 minutes). The mixture was then homogenized at 3000 psi followed by a second heating in the Stephan mixer to a temperature of 81° C., which took approximately 20 minutes. Once the mixturereached 81° C., it was poured into a stainless steel bowl and cooled to 22° C. in an ice bath. After the product was cooled, it was inoculated using a starter culture (CH--N 120 brand lactic culture from Christian Hansen, Milwaukee,Wis.). The culture was prepared by a 1:1 dilution of the frozen culture in sterile phosphate buffer. The amount of culture was based on 0.05 percent of the total weight and then doubled due to the dilution. After inoculation, the material was storedovernight in a 30° C. incubator to aid in acid production. The product was then stirred in a Hobart mixer at speed 1 for 1 minute and then the pH was measured. The pH was typically about 4.7 to about 5.0.

Sodium chloride and locust bean gum were then added with mixing. The resulting composition was then until a temperature of 85° C. was reached (after about 24 minutes) followed by homogenization at 3000 psi. The resulting cream cheesewas then packaging into 8 ounce cups and stored at refrigeration temperature. The yield stress (firmness) was measured after one week of storage at about 6° C.; the results are reported in the Table below.

TABLE-US-00003 Sample Yield Stress (Pa) 1 3625 2 3073 3 2607 4 3495 5 3255 6 2638 7 2303 8 3733 9 3715 10 3557 11 3786

For comparison purposes, the yield stress of a convention cream cheese prepared in essentially the same manner except for the use of the whey protein of Example 1 is expected to have a value significantly less than 2500 Pa.

The use of this single-heat treatment to effect polymerization of proteins from a WPC leads to a protein polymer composition that can be used in manufacturing a cream cheese product manifesting an unexpected improvement in firmness compared tocontrol products. At bench scale, cream cheese products made using the whey protein polymerization step had a yield stress values between about 2300 pascals and about 3700 pascals depending on the conditions of polymerization. Control cream cheeseproducts made from respective corresponding whey protein

275

that had not undergone the single-heating polymerization step had yield stress values dramatically less (generally about 40 to 50 percent less).

6. TECHNICAL FIELD

The present invention relates to a cheese-like dairy product and a method of producing the same. More specifically, the present invention relates to a method of producing a cheese-like dairy product in which, using water containing Paenibacillussp. bacteria or water that has been treated with immobilized cells of Paenibacillus sp. bacteria, starting material milk is coagulated, and the viable count of general live bacteria, coli bacteria, coliform bacteria and so on is markedly reduced,whereby it becomes possible to produce a novel cheese-like dairy product having good flavor and safety as a product, and to the product produced. The present invention is useful as an invention providing a novel technique that enables such a cheese-likedairy product having good flavor and safety to be produced by utilizing the functions of Paenibacillus sp. bacteria, without using a starter or rennet as used in conventional cheese production.

BACKGROUND ART

In general, in the cheese production process, a method is adopted in which pasteurized cow's milk or goat's milk is used as starting material milk, a lactic acid bacteria starter is added thereto to make the starting material milk acidic, amilk-coagulating enzyme such as chymosin is added to coagulate the milk protein casein, the coagulum (curd) and milk serum (whey) are separated, and the coagulum is matured to produce cheese. The above-mentioned milk-coagulating enzyme does not havesterilizing ability, and hence in general it is only acceptable to use pasteurized milk as the starting material milk.

In this way, with the conventional cheese production method, a method is adopted in which a lactic acid bacteria starter is added to the starting material milk, and once the pH has dropped to a prescribed level, rennet is added to coagulate themilk. With the conventional method, it is thus necessary to proliferate the starter lactic acid bacteria by repeating subculture a plurality of times from a stored strain. Moreover, the starter is added to a large amount of the starting material milk,and hence it is necessary to produce a large amount of a highly active mother starter. Furthermore, quality control must be carried out thoroughly such that there is no contamination with other unwanted bacteria when using the starter.

Moreover, to inoculate with the starter and attain the target pH, it is necessary, for example, to culture the starting material milk at 20° C. for at least several hours. Furthermore, rennet is added to coagulate the milk once the pHhas dropped; this rennet is an enzyme taken from calves' stomachs, and is expensive. There is, on the other hand, a method of preparing rennet by culturing a microorganism, but as with the case of taking the rennet from calves' stomachs, this isexpensive, and moreover there is a problem that the product becomes bitter.

In view of the prior art described above, it is a problem of the present invention to develop a novel technique enabling a high-quality cheese-like dairy product to be produced without using a starter or rennet as described above; according tothe present invention, this problem can be solved by utilizing the functions of Paenibacillus sp. cells, instead of using a starter and rennet as described above.

The present invention provides a method of producing a high-quality cheese-like dairy product without using rennet, which is expensive, or a starter, as used in a conventional cheese production method, and a product thus produced.

The present invention relates to a method of producing a cheese-like dairy product, characterized by adding at least 10 wt %, relative to the starting material milk, of water containing Paenibacillus sp. bacteria or water that has been treatedwith immobilized cells of Paenibacillus sp. bacteria, into starting material milk, followed by maintaining at a prescribed temperature, separating off the curd thus formed, and performing productization with or without further manufacturing; acheese-like dairy product thus produced; and a water purifier packed with a support having Paenibacillus sp. bacteria immobilized thereon and a filter medium as a packing material.

DISCLOSURE OF THE INVENTION

It is an object of the present invention to provide a method of producing a cheese-like dairy product

276

that enables a high-quality cheese-like dairy product to be produced efficiently and economically, without using rennet, which is expensive, ora starter, as used in a conventional cheese production method.

Moreover, it is an object of the present invention to provide a method of producing a novel cheese-like dairy product that enables the production to be carried out using not only pasteurized milk but also raw milk, and a product thus produced.

Furthermore, it is an object of the present invention to provide a milk-coagulating agent that contains Paenibacillus sp. cells and is used when implementing the above-mentioned method for producing a cheese-like dairy product, and a waterpurifier packed with a support having Paenibacillus sp. cells immobilized thereon and a filter medium as a packing material.

To attain the above objects, the present invention is constituted from the following technical means.

(1) A method of producing a cheese-like dairy product, characterized by adding, to starting material milk, water containing Paenibacillus sp. bacteria or water that has been treated with immobilized cells of Paenibacillus sp. bacteria,maintaining the resulting mixture at a prescribed temperature, separating off the curd thus formed, and making into a product as is or after maturing.

(2) The method according to (1) above, wherein the starting material milk is selected from raw milk, low-temperature-pasteurized milk, high-temperature-sterilized milk, and ultrapasteurized milk.

(3) The method according to (1) above, wherein the water containing Paenibacillus sp. bacteria or the water that has been treated with immobilized cells of Paenibacillus sp. bacteria is added in an amount of at least 10 wt % relative to thestarting material milk.

(4) The method according to (1) above, wherein the mixture is held at room temperature or heated to 30 to 38° C., and the curd and whey are separated once the pH has reached 4 to 6.

(5) The method according to (1) above, wherein the curd is matured by immersing in saturated brine.

(6) The method according to (1) above, wherein water that has been treated using a water purifier packed with a support having Paenibacillus sp. bacteria immobilized thereon and a filter medium as a packing material is added to the startingmaterial milk.

(7) The method according to (6) above, wherein the support contains, as a constituent thereof, a sintered body obtained by sintering a ceramic starting material.

(8) A milk-coagulating agent for use in the method according to any of (1) through (7) above, the milk-coagulating agent being for producing the cheese-like dairy product and characterized by containing Paenibacillus sp. bacteria and/or anextracellular product thereof.

(9) A cheese-like dairy product produced using the method according to any of (1) through (7) above, the cheese-like dairy product characterized by separating off curd formed using the milk-coagulating action of the water containing Paenibacillussp. bacteria or the water that has been treated with immobilized cells of Paenibacillus sp. bacteria, and making into a product as is or after maturing.

(10) A water purifier for use in the method according to any of (1) through (7) above, the water purifier characterized by being packed with a support having Paenibacillus sp. bacteria immobilized thereon and a filter medium as a packingmaterial.

(11) The water purifier according to (10) above, wherein the support contains, as a constituent thereof, a sintered body obtained by sintering a ceramic starting material.

The present invention will now be described in more detail.

The present invention relates to a method of producing a cheese-like dairy product, characterized by adding, to starting material milk, water containing Paenibacillus sp. bacteria or water that has been treated with immobilized cells ofPaenibacillus sp. bacteria, maintaining the resulting mixture

277

at a prescribed temperature, separating off the curd thus formed, and making into a product as is or after maturing, and to the product produced.

In the present invention, for example raw milk, low-temperature-pasteurized milk, high-temperature-sterilized milk, ultrapasteurized milk, or the like can be used, but there is no limitation thereto. Out of these, use oflow-temperature-pasteurized milk or raw milk having a large number of useful bacteria gives a product having good texture, taste, flavor and so on after maturation, and hence in the present invention it is favorable to use such a starting material milk.

In the present invention, water containing Paenibacillus sp. bacteria, or water that has been treated with immobilized cells of Paenibacillus sp. bacteria, is added to the starting material milk. This bacterium has been deposited with theNational Institute of Advanced Industrial Science and Technology (Independent Administrative Institution), which is a public depository institution, with the accession number being FERM P-18138.

This Paenibacillus sp. bacterium is known to be low risk, with most strains falling under level 1 in the new biosafety level classification for pathogenic bacteria described in `Japanese Journal of Bacteriology, 55 (4): 655-674, 2000`. Moreover, Paenibacillus sp. is split off from the Bacillus genus, is named in `IJSB (International Journal of Systematic Bacteriology), Vol. 147, 289-298, 1997` naming only the major fatty acids characteristically, and has been registered using 16S rRNADNA analysis.

The water containing Paenibacillus sp. bacteria, or the water that has been treated with immobilized cells of Paenibacillus sp. bacteria, is preferably prepared, for example, by treating water using a water purifier packed with a support havingPaenibacillus sp. bacteria immobilized thereon and a filter medium as a packing material. However, there is no limitation thereto, with it being possible to similarly use water having Paenibacillus sp. bacteria added thereto, or water prepared bymaking water come into contact with immobilized cells of Paenibacillus sp. bacteria, or any water prepared using a method having equivalent effects thereto.

Preferable examples of the support and the filter medium in the water purifier are supports and filter media selected as appropriate from herkimer diamond, lapis lazuli, howlite, amethyst, garnet, sapphire, aquamarine, yellow jasper, rose quartz,moonstone, carnelian, tourmaline, pearl, amber, ferrite magnet, granite porphyry, coral, phyllite, quartz diorite-porphyrite, graphite silica, magnetite, lodestone, quartz schist, bincho charcoal, bamboo charcoal, activated charcoal, KDF alloy, watercontaining agate, ceramics, and so on; however, there is no limitation thereto, with it being possible to similarly use supports and filter media having equivalent effects thereto.

Because the water prepared using a method as described above contains Paenibacillus sp. bacteria (and an extracellular product thereof), a milk-coagulating action can be obtained merely by adding this water to the starting material milk. Thewater containing Paenibacillus sp. bacteria, or the water in which are immobilized Paenibacillus sp. bacteria, is added in a suitable amount to the starting material milk. Here, the amount added of the water is preferably at least 10 wt %; the higherthe amount of the water, the faster the starting material milk is coagulated through the milk-coagulating action of the water. However, although this method is fine in the case that the amount produced of the product is small, in the case that theamount produced of the product is more than a certain amount (e.g. more than 500 liters), then a vessel (cheese vat) having double the capacity will be required.

Considering the production efficiency at a factory, this would be very disadvantageous, and hence it is preferable to first produce a fermentation starter using the starting material milk and the water containing Paenibacillus sp. bacteria. Specifically, taking 1% of the starting material milk as a guide, starting material milk for the starter is prepared, and the same amount of the water containing Paenibacillus sp. bacteria is added thereto. The resulting mixture is maintained at 30 to38° C. for approximately 24 hours, thus carrying out fermentation and culturing, and once the pH has reached approximately 4.6, this culture is added to the starting material milk as a starter. Through this operation, the production efficiencycan be kept high, and hence the production efficiency of the cheese-like dairy product using the water containing Paenibacillus sp. bacteria can be improved.

Next, the starting material milk is heated to 30 to 38° C. This temperature condition is the optimum coagulation reaction temperature. After the starting material milk has been coagulated, the curd is

278

cut up, and then the temperature israised to 30 to 53° C. while stirring. At this time, it is preferable to raise the temperature gradually rather than at a single stroke. As a result, it becomes possible to utilize to the utmost the action of bacteria that are activated in anyof various temperature ranges, i.e. psychrophiles, mesophiles, and thermophiles. Moreover, in the case of producing a hard type cheese-like dairy product, the temperature is raised to approximately 53° C.

Next, once the acidity has reached pH 6 to 4, the curd and whey are separated, and once transparent whey has appeared, whey removal is carried out. In this case, the curd is subjected to the whey removal once the acidity has reached pH 6 to 4;the subsequent quality and flavor of the cheese-like dairy product differs between the case that the whey removal is carried out when the acidity is pH 4 and the case that the whey removal is carried out when the acidity is pH 6. It is thus preferableto carry out the whey removal at a suitable acidity between pH 6 and 4, giving consideration to the desired quality and flavor of the cheese-like dairy product.

Next, the curd is matured. When maturing the curd, the curd is steeped, for example, in saturated brine, preferably approximately 20% saturated brine. By steeping the curd in 20% saturated brine after the curd has been pressed in gauze, aflavorsome cheese-like dairy product can be produced. Moreover, by steeping the curd in saturated brine for 3 months to 1 year or longer, the degree of maturation can be increased.

Next, the curd is taken out from the saturated brine, and is dewatered whereby a fresh type product can be produced, or is air-dried and stored whereby a semi-hard type product or a hard type product can be produced. By steeping the curd insaturated brine in this way, infiltration of unwanted bacteria from the outside can be prevented, and hence a highly safe cheese-like dairy product can be produced, and moreover a cheese-like dairy product having a mellow saltiness can be obtained. Solong as the cheese-like dairy product of the present invention is prepared by coagulating milk using the method described above, there are no particular limitations on the type of the cheese-like dairy product, with all types of product being included inthe present invention. Moreover, a milk-coagulating agent of the present invention is prepared by incorporating therein as an active ingredient Paenibacillus sp. bacteria and/or an extracellular product thereof, and is used formulated into a suitableform. There are no particular limitations on the method of incorporating the active ingredient, the proportion of the active ingredient, or the carrier, with design being carried out as appropriate in accordance with the usage.

A water purifier of the present invention is characterized by being packed with a support having Paenibacillus sp. bacteria as described above immobilized thereon and a filter medium as a packing material. Here, a preferable example of thesupport is a ceramic sintered body manufactured by subjecting a ceramic starting material to forming and sintering, but there is no limitation thereto, with it being possible to similarly use any other support having equivalent effects. Moreover,preferable examples of the filter medium are supports and filter media selected as appropriate from herkimer diamond, lapis lazuli, howlite, amethyst, garnet, sapphire, aquamarine, yellowjasper, rosequartz, moonstone, carnelian, tourmaline, pearl, amber,ferrite magnet, granite porphyry, coral, phyllite, quartz diorite-porphyrite, graphite silica, magnetite, lodestone, quartz schist, bincho charcoal, bamboo charcoal, activated charcoal, KDF alloy, water containing agate, ceramics, and so on, with itbeing possible to use these in combination as appropriate. In the present invention, the above-mentioned supports and filter media are used in a freely chosen combination with design being carried out as appropriate. With the water purifier of thepresent invention, apart from the constitution specified above, an ordinary water purifier constitution can be used, with there being no particular limitations on the constitution. 

BEST MODE FOR CARRYING OUT THE INVENTION

Next, the present invention will be described concretely through experimental examples and working examples; however, the present invention is not limited whatsoever by the following experimental examples and working examples.

EXPERIMENTAL EXAMPLE 1

In the present experimental example, water that had been treated using a water purifier packed with a support having Paenibacillus sp. bacteria immobilized thereon and a filter medium as a packing material was added to starting material milk,thus trialing the production of a raw cheese-like product having the form of soft lumps.

279

(1) Experimental Method

1) Water Purifier

A water purifier packed with a ceramic sintered body having cells of Paenibacillus sp. bacteria (FERM P-18138) immobilized thereon and another filter medium as a packing material was used.

2) Preparation of Cheese-Like Dairy Product

3 liters of raw milk and 2 liters of water that had been passed through the water purifier were mixed together to prepare 5 liters of mixed liquid. Neither the raw milk nor the water had been subjected to heat treatment. The mixed liquid wasput into a vessel, the vessel was immersed in steep water, the temperature was held at 20° C., and coagulation was carried out over 24 hours. Maintaining room temperature at 20° C., the experiment was carried out 10 times for raw cow'smilk, and 5 times for goat's milk. Additives (fermenting yeast, interfacial yeast, rennin) were not added to the above-mentioned mixed liquid. After the mixed liquid had been coagulated, the milk plasma was removed using a straining cloth at 20° C. over 24 hours, and then after a further 24 hours, the coagulated mass was put into a shaping mold and thus shaped. Sudden changes were seen in the product 24 hours and 48 hours after putting into the mold. Salting was carried out twice:approximately 2% of dry salt relative to the weight of the cheese was sprinkled onto the surface immediately after putting into the mold and after the first change. 48 hours after carrying out the shaping, the cheese was removed from the mold, andmaturation was carried out at approximately 15° C.

3) Bacteriological Analysis

To test the safety of the product, an analysis was carried out of the viable count in the product of Staphylococcus aureus, salmonella bacteria, coli bacteria and Listeria monocytogenes.

(2) Results

1) Physicochemical Properties

For each experiment, the mixed liquid was coagulated in 24 hours, and 24 hours after straining the coagulum produced was of high quality, having an appearance like soft cheese that is spread on bread, and being very smooth on the tongue and thushighly palatable. 48 hours after putting into the mold, the cheese-like product produced maintained its shape without disintegrating. The cheese closely resembled orthodox soft Camembert cheese in terms of density, feel and texture.

2) Bacteriological Properties

The results of the bacteriological analysis are shown in Tables 1 to 3. Here, Table 3 shows the analysis results for a cheese of a comparative example prepared through a traditional production method using the same starting material milk.

TABLE-US-00001 TABLE 1 Raw cow's milk cheese-like product of the present invention Analyzed bacteria Result Standard value Staphylococcus aureus/g Salmonella bacteria/g Zero Zero Coli bacteria/g Listeria monocytogenes/25 g Zero Zero

TABLE-US-00002 TABLE 2 Goat's milk cheese-like product of the present invention matured for 3 months Analyzed bacteria Result Standard value Staphylococcus aureus/g Salmonella bacteria/g Zero Zero Coli bacteria/g Listeria monocytogenes/25 g ZeroZero

TABLE-US-00003 TABLE 3 Raw cow's milk cheese produced using traditional method (comparative example) Analyzed bacteria Result Standard value Staphylococcus aureus/g Salmonella bacteria/g Zero Zero Coli bacteria/g

From the analysis results in Tables 1 and 2, it can be seen that the viable count was below the standard value for all of the types of bacteria, showing that water containing Paenibacillus sp. bacteria (i.e. containing an extracellular productthereof) has an action of inhibiting these types of bacteria. It can thus be seen that by using water containing Paenibacillus sp. bacteria, production

280

can be carried out adequately using raw milk, not only pasteurized milk.

It is highly significant that the number of bacteria detected in the cheese-like product produced was very small. Looking at the results comparing the raw cow's milk cheese produced using the traditional method (Table 3) and the cheese-likeproducts produced using a water purifier according to the present invention (Tables 1 and 2), the analysis results show that the number of bacteria in the latter cheese-like products is very low. That is, comparing with the analysis results for thecheese produced using the traditional method (Table 3), it can be seen that the number of bacteria in the cheese-like product produced using the water purifier (Table 1) is very low. These two types of analysis results were obtained from cheese and acheese-like product prepared using the same starting material milk. Furthermore, the bacteriological analysis results in Table 2 were also good. These analysis results for the cheese-like product matured for 3 months show a bacterial contamination ratethat is almost unbelievably low for a raw milk product.

With the present invention, a soft lumpy cheese-like product can be produced merely by mixing together water that has been passed through a water purifier as described above and raw milk (i.e. without adding additives). This fact would be veryhard to believe for a person working in traditional cheese production. A big advantage of the present invention is that the number of bacteria in the cheese-like product is greatly reduced, and hence a low habitation rate of pathogenic bacteria can becompletely (100%) maintained. Data on the time limit for consumption of the product is also excellent.

Next, working examples with regard to methods of producing a hard type cheese-like product, a semi-hard type cheese-like product, a pasta filata type cheese-like product, and a fresh type cheese-like product will be described in detail.

EXAMPLE 1

(Production of Hard Type Cheese-like Product)

Starting material milk was coagulated as in Experimental Example 1, the curd produced was cut up, and then the curd was heated from 30° C. to 53° C., thus discharging whey and lactose from the curd as much as possible. Once thecurd particles had become about as big as grains of rice, the curd was collected together in whey, and was then put into a mold, and was pressed. Next, the curd was steeped in brine and heated. Maturation was carried out for 4 months during which timesurface treatment was carried out, whereby a hard type cheese-like product was obtained.

EXAMPLE 2

(Production of Semi-hard Type Cheese-like Product)

Curd was prepared as in Experimental Example 1, and once the pH of the curd had become approximately 6.4, the curd was accumulated in whey, preliminary pressing was carried out to produce a mat, and then the curd was put into a mold and pressedby placing a weight thereon, whereby a semi-hard type cheese-like product was obtained.

EXAMPLE 3

(Production of Pasta Filata Type Cheese-like Product)

Curd was prepared as in Experimental Example 1, and once the pH of the curd had become 5.2, the curd was kneaded in hot water from 85° C. to 100° C. to produce a soft dough like mochi rice cake, and then after shaping, steeping inbrine was carried out, whereby a pasta filata type cheese-like product was obtained.

EXAMPLE 4

(Production of Fresh Type Cheese-like Product)

Curd was prepared as in Experimental Example 1, the pH of the curd was reduced as far as 4.8, the whey was drained off, and a small amount of salt (approximately 1%) for shaping was mixed in and kneading was carried out. Once the shape had set,the curd was put into brine and heated, and

281

then dry salt was rubbed in (salt content approximately 2% of cheese). Next, maturation was carried out for 3 months during which time surface treatment was carried out, whereby a fresh type cheese-likeproduct was obtained.

INDUSTRIAL APPLICABILITY

According to the cheese-like dairy product and method of producing the same of the present invention, the following remarkable effects are obtained. (1) A high-quality cheese-like dairy product can be produced efficiently and economically,without using rennet, which is expensive, or a starter, merely by adding at least 10 wt % of water containing Paenibacillus sp. bacteria (i.e. containing an extracellular product thereof) to starting material milk. (2) A water purifier packed with asupport having Paenibacillus sp. bacteria immobilized thereon and a filter medium as a packing material can be provided. (3) A cheese-like dairy product that is highly safe and has a mature flavor can be provided. (4) A milk-coagulating agent forproduction of a cheese-like dairy product that contains Paenibacillus sp. bacteria and enables a cheese-like dairy product as described above to be produced can be provided. Statement of Deposited Microorganism Name and address of depositoryinstitution: International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Independent Administrative Institution) (address: Tsukuba Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki, Japan (postal code 305-8566))Date deposited: Dec. 8, 2000 Accession number: FERM P-18138 Indication of microorganism: Paeni

FIELD OF THE INVENTION

This invention relates to a process for preparing a protein based acid beverage which is smooth, tasteful, palatable and has good storage stability.

BACKGROUND OF THE INVENTION

Juices and other acidic juice-like beverages are popular commercial products. Consumer demand for nutritional healthy beverages has led to the development of nutritional juice or juice-like beverages containing protein. The protein providesnutrition in addition to the nutrients provided by the components of the beverage. Recently it has been discovered that certain proteins have specific health benefits beyond providing nutrition. For example, soy protein has been recognized by theUnited States Food and Drug Administration as being effective to lower blood cholesterol concentrations in conjunction with a healthy diet. In response, there has been a growing consumer demand for acidic juice-like beverages containing proteins thatprovide such specific health benefits.

A hurdle to adding protein to acidic beverages, however, is the relative insolubility of proteins in an aqueous acidic environment. Most commonly used proteins, such as soy proteins and casein, have an isoelectric point at an acidic pH. Thus,the proteins are least soluble in an aqueous liquid at or near the pH of acidic beverages. For example, soy protein has an isoelectric point at pH 4.5 and casein has an isoelectric point at a pH of 4.7, while most common juices have a pH in the range of3.7 to 4.0. As a result, protein tends to settle out as a sediment in an acidic protein-containing beverage-an undesirable quality in a beverage.

Protein stabilizing agents that stabilize proteins as a suspension in an aqueous acidic environment are used to overcome the problems presented by protein insolubility. Pectin is a commonly used protein stabilizing agent.

U.S. Pat. No. 5,286,511 (Klavons et al., Feb. 15, 1994) provides a beverage such as orange juice that is clouded by a suspension of soy protein particles, where the protein particles are prevented from aggregating to the point of settling outby pectin. Pectin inhibits the protein from settling by adsorbing to individual protein particles and imparting an overall negative charge to the protein particles, resulting in repulsion of the particles from one another, and thereby preventing theprotein particles from aggregating and settling out of the suspension. Pectin also increases the viscosity of the beverage, which helps stabilize protein particles against gravitational forces.

U.S. Pat. No. 6,221,419 (Gerrish, Apr. 24, 2001) relates to a pectin for stabilizing proteins particularly for use in stabilizing proteins present in aqueous acidified milk drinks. It must be understood that the inclusion of pectin has bothdesirable and undesirable effects on the properties of acidified milk drinks. While pectin can act as a stabilizer against sedimentation of casein particles or whey separation, it can have the disadvantage of increasing the viscosity of the drink due toits cross-linking with naturally co-present calcium cations rendering the drink unpalatable. It will be seen that in the absence of pectin, there is significant

282

sedimentation in the case of both drinks caused by the instability of the casein particleswhich also results in relatively high viscosity. After a certain concentration of pectin has been added, the casein particles become stabilized against sedimentation after which increasing the pectin concentration has little effect on sedimentation. Turning to the viscosity of the drinks, this also significantly drops on stabilisation of the casein particles but then almost immediately begins to rise again due to cross-linking of the excess pectin added by the co-present calcium cations. Thisincreased viscosity is undesirable as it leads to the beverage having poor organoleptic properties. This range may be as narrow as only 0.06% by weight of pectin based upon the beverage weight as a whole. Below this working range, sedimentation is asignificant problem, whereas above it, the viscosity of the beverage is undesirably high.

Pectin, however, is an expensive food ingredient, and manufacturers of aqueous acidic beverages containing protein desire less expensive stabilizers, where the amount of required pectin is either reduced or removed in favor of less expensivestabilizing agents.

SUMMARY OF THE INVENTION

This invention is directed to a process for preparing a stable suspension of a protein material in an acidic beverage, comprising;

blending

(A) a hydrated and homogenized protein material slurry with

(B) a hydrated protein stabilizing agent-acid dispersion, and pasteurizing and homogenizing the blend.

In a second embodiment, the invention is directed to a process for preparing a stable suspension of a protein material in an acidic beverage, comprising;

blending

(A1) a hydrated and homogenized protein material-protein stabilizing agent slurry with

(B) a hydrated protein stabilizing agent-acid dispersion, and pasteurizing and homogenizing the blend. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a block flow diagram of an industry wide process for producing a typical protein containing acid beverage wherein the protein hydration slurry and pectin hydration slurry are blended together and the remaining ingredients added followedby pasteurization and homogenization.

FIG. 2 is a block flow diagram of one embodiment of the invention for producing a protein containing acid beverage wherein the hydrated protein slurry is homogenized, the pectin slurry is hydrated and the remaining ingredients added to the pectinslurry and the two slurries blended together followed by pasteurization and homogenization in accordance with the principles of the invention.

FIG. 3 is a block flow diagram of another embodiment of the invention for producing a protein containing acid beverage wherein protein and a portion of pectin are homogenized to a slurry, the remaining pectin is hydrated and the remainingingredients added to the pectin slurry and the two slurries blended together followed by pasteurization and homogenization in accordance with the principles of the invention.

DETAILED DESCRIPTION OF THE INVENTION

A protein based acid beverage is normally stabilized by a high methoxyl (HM) pectin that provides a stable suspension through possible steric stabilization and electrostatic repulsive mechanism. FIG. 1 refers to the normal processing conditionsof protein stabilized acid beverages. At 1, protein is first dispersed in water at ambient temperature and hydrated at an elevated temperature for a period of time. The pH at 1 is about neutral. As a stabilizer, HM pectin is either hydrated separatelyinto 2 3% dispersion or blended with sugar at 5 to give an HM pectin dispersion having a pH of 3.5 and then added into the protein slurry. The two slurries are mixed together at 10 for 10 minutes under agitation. The pH at 10 is about 7. Otheringredients such as additional sugar, fruit juices or vegetable juice, and various acids such as phosphoric acid, ascorbic acid citric acid, etc., are added at 20 to bring the pH to about 3.8. The contents are pasteurized at 195° F. for 30seconds and then homogenized first at 2500 pounds per square inch and then at 500 pounds per square

283

inch at 30. Containers are hot filled and cooled at 40 to give the product at 50 with a pH of 3.8. The problem with this method is that after the HMpectin is mixed with the protein, the pH of the blend is close to neutral, and HM pectin is potentially degraded by beta-elimination, especially under heat. This causes a decrease in the molecular weight of the pectin and the ability of the pectin tostabilize the proteins when the pH is later lowered even more is greatly reduced. HM pectin is only stable at room temperature. As the temperature increases, beta elimination begins, which results in chain cleavage and a very rapid loss of the abilityof the HM pectin to provide a stable suspension.

In the present invention, a hydrated protein material (A) and a hydrated protein material stabilizing agent-acid dispersion (B) are mixed together such that an acid beverage is obtained and the acid beverage forms a stable suspension. FIG. 2 andFIG. 3 refers to the processing conditions of the present invention.

FIG. 2 outlines the first embodiment of this invention. In FIG. 2, at 1 protein material is first dispersed in water at ambient temperature and hydrated at an elevated temperature for a period of time. The pH at 1 is about neutral. Thehydrated protein material is then homogenized at 2 in two stages, a high pressure stage and a low pressure stage. The high pressure stage is 2500 pounds per square inch and the low pressure stage is at 500 pounds per square inch. The pH at 2 is stillabout neutral. The stabilizer pectin is hydrated separately into a 0.5 10% dispersion with or without sugar at 4. The pH at 4 is 3.5. At 5, other ingredients such as additional sugar, fruit juices, vegetable juices, various acids such as phosphoricacid, ascorbic acid, citric acid, etc. are added and the contents mixed at an elevated temperature. The slurry from 2 and the dispersion from 5 are blended together at 10 with additional acid to a pH of 3.8. At 30, the contents are pasteurized at atemperature of 180° F. for 30 seconds and homogenized in two stages--the high pressure stage of 2500 pounds per square inch and then the low pressure stage at 500 pounds per square inch Containers are hot filled and cooled at 40 to give theproduct at 50 with a pH of 3.8.

FIG. 3 outlines the second embodiment of this invention. In FIG. 3, at 1 protein material is first dispersed in water at ambient temperature and hydrated at an elevated temperature for a period of time. The pH at 1 is about neutral. A portionof the total stabilizer pectin charge (about 30%) is added at 3, mixed briefly and then homogenized at 3 in two stages, a high pressure stage and a low pressure stage. The high pressure stage is 2500 pounds per square inch and the low pressure stage isat 500 pounds per square inch. The pH at 3 is about 6.5. The remaining stabilizer is hydrated without sugar at 4. The pH at 4 is 3.5. At 5 other ingredients such as phosphoric acid, ascorbic acid, citric acid, juices, and sugars, etc. are added andthe contents mixed at an elevated temperature. The slurry from 3 and the dispersion from 5 are blended together at 10 with additional acid to a pH of 3.8. At 30, the contents are pasteurized at a temperature of 195° F. for 30 seconds andhomogenized in two stages--the high pressure stage of 2500 pounds per square inch and then the low pressure stage at 500 pounds per square inch. Containers are hot filled and cooled at 40 to give the product at 50 with a pH of 3.8.

Component (A)

The protein material of the process of the present invention may be any vegetable or animal protein that is at least partially insoluble in an aqueous acidic liquid, preferably in an aqueous acidic liquid having a pH of from 3.0 to 5.5, and mostpreferably in an aqueous acidic liquid having a pH of from 3.5 to 4.5. As used herein a "partially insoluble" protein material is a protein material that contains at least 10% insoluble material, by weight of the protein material, at a specified pH. Preferred protein materials useful in the composition of the present invention include soy protein materials, casein or caseinates, corn protein materials--particularly zein, and wheat gluten.

Soybean protein materials which are useful with the present invention are soy flour, soy concentrate, and, most preferably, soy protein isolate. The soy flour, soy concentrate, and soy protein isolate are formed from a soybean starting materialwhich may be soybeans or a soybean derivative. Preferably the soybean starting material is either soybean cake, soybean chips, soybean meal, soybean flakes, or a mixture of these materials. The soybean cake, chips, meal, or flakes may be formed fromsoybeans according to conventional procedures in the art, where soybean cake and soybean chips are formed by extraction of part of the oil in soybeans by pressure or solvents, soybean flakes are formed by cracking, heating, and flaking soybeans andreducing the oil content of the soybeans by solvent extraction, and soybean meal is formed by grinding soybean cake, chips, or flakes.

Soy flour, as that term is used herein, refers to a comminuted form of defatted soybean material, preferably containing less than 1% oil, formed of particles having a size such that the particles can pass through a No. 100 mesh (U.S. Standard)screen. The soy cake, chips, flakes, meal, or mixture of the materials are comminuted into a soy flour using conventional soy grinding processes. Soy flour has a soy protein content

284

of about 40% to about 60%. Preferably the flour is very finelyground, most preferably so that less than about 1% of the flour is retained on a 300 mesh (U.S. Standard) screen.

Soy concentrate, as the term is used herein, refers to a soy protein material containing about 65% to about 90% of soy protein. Soy concentrate is preferably formed from a commercially available defatted soy flake material from which the oil hasbeen removed by solvent extraction. The soy concentrate is produced by an acid leaching process or by an alcohol leaching process. In the acid leaching process, the soy flake material is washed with an aqueous solvent having a pH at about theisoelectric point of soy protein, preferably at a pH of about 4 to about 5, and most preferably at a pH of about 4.4 to about 4.6. The isoelectric wash removes a large amount of water soluble carbohydrates and other water soluble components from theflakes, but removes little of the protein, thereby forming a soy concentrate. The soy concentrate is dried after the isoelectric wash. In the alcohol leaching process, the soy flake material is washed with an aqueous ethyl alcohol solution whereinethyl alcohol is present at about 60% by weight. The protein remains insoluble while the carbohydrate soy sugars of sucrose, stachyose and raffinose are leached from the defatted flakes. The soy soluble sugars in the aqueous alcohol are separated fromthe insoluble protein and the insoluble protein is dried to form the soy concentrate.

Soy protein isolate, as the term is used herein, refers to a soy protein material containing about 90% or greater protein content, and preferably about 95% or greater protein content. Soy protein isolate is typically produced from a startingmaterial, such as defatted soybean material, in which the oil is extracted to leave soybean meal or flakes. More specifically, the soybeans may be initially crushed or ground and then passed through a conventional oil expeller. It is preferable,however, to remove the oil contained in the soybeans by solvent extraction with aliphatic hydrocarbons, such as hexane or azeotropes thereof, and these represent conventional techniques employed for the removal of oil. The defatted, soy protein materialor soybean flakes are then placed in an aqueous bath to provide a mixture having a pH of at least about 6.5 and preferably between about 7.0 and 10 in order to extract the protein. Typically, if it is desired to elevate the pH above 6.7 various alkalinereagents such as sodium hydroxide, potassium hydroxide and calcium hydroxide or other commonly accepted food grade alkaline reagents may be employed to elevate the pH. A pH of above about 7 is generally preferred, since an alkaline extractionfacilitates solubilization of the protein. Typically, the pH of the aqueous extract of protein, will be at least about 6.5 and preferably about 7.0 to 10. The ratio by weight of the aqueous extractant to the vegetable protein material is usuallybetween about 20 to 1 and preferably a ratio of about 10 to 1. In an alternative embodiment, the vegetable protein is extracted from the milled, defatted flakes with water, that is, without a pH adjustment.

It is also desirable in obtaining the soy protein isolate used in the present invention, that an elevated temperature be employed during the aqueous extraction step, either with or without a pH adjustment, to facilitate solubilization of theprotein, although ambient temperatures are equally satisfactory if desired. The extraction temperatures which may be employed, can range from ambient up to about 120° F. with a preferred temperature of 90° F. The period of extraction isfurther non-limiting and a period of time between about 5 to 120 minutes may be conveniently employed with a preferred time of about 30 minutes. Following extraction of the vegetable protein material, the aqueous extract of protein can be stored in aholding tank or suitable container while a second extraction is performed on the insoluble solids from the first aqueous extraction step. This improves the efficiency and yield of the extraction process by exhaustively extracting the protein from theresidual solids from the first step.

The combined, aqueous protein extracts from both extraction steps, without the pH adjustment or having a pH of at least 6.5, or preferably about 7.0 to 10, are then precipitated by adjustment of the pH of the extracts to, at or near theisoelectric point of the protein to form an insoluble curd precipitate. The actual pH to which the protein extracts are adjusted will vary depending upon the vegetable protein material employed but insofar as soy protein, this typically is between about4.0 and 5.0. The precipitation step may be conveniently carried out by the addition of a common food grade acidic reagent such as acetic acid, sulfuric acid, phosphoric acid, hydrochloric acid or with any other suitable acidic reagent. The soy proteinprecipitates from the acidified extract, and is then separated from the extract. The separated protein may be washed with water to remove residual soluble carbohydrates and ash from the protein material. The separated protein is then dried usingconventional drying means to form a soy protein isolate. Soy protein isolates are commercially available from Solae.RTM. LLC, for example, as SUPRO.RTM. PLUS 675, FXP 950, FXP HO120, SURPO.RTM. XT 40, SUPRO.RTM. 710, SUPRO.RTM. 720, ALPHA™ 5800, ALPHA™ 5812 and ALPHA™ 5811.

Preferably the protein material used in the present invention, is modified to enhance the characteristics of the protein material. The modifications are modifications which are known in the art to improve the utility or characteristics of aprotein material and include, but are not limited to, denaturation and hydrolysis of the

285

protein material.

The protein material may be denatured and hydrolyzed to lower the viscosity. Chemical denaturation and hydrolysis of protein materials is well known in the art and typically consists of treating a protein material with one or more alkalinereagents in an aqueous solution under controlled conditions of pH and temperature for a period of time sufficient to denature and hydrolyze the protein material to a desired extent. Typical conditions utilized for chemical denaturing and hydrolyzing aprotein material are: a pH of up to about 10, preferably up to about 9.7; a temperature of about 50° C. to about 80° C. and a time period of about 15 minutes to about 3 hours, where the denaturation and hydrolysis of the protein materialoccurs more rapidly at higher pH and temperature conditions.

Hydrolysis of the protein material may also be effected by treating the protein material with an enzyme capable of hydrolyzing the protein. Many enzymes are known in the art which hydrolyze protein materials, including, but not limited to,fungal proteases, pectinases, lactases, and chymotrypsin. Enzyme hydrolysis is effected by adding a sufficient amount of enzyme to an aqueous dispersion of protein material, typically from about 0.1% to about 10% enzyme by weight of the proteinmaterial, and treating the enzyme and protein dispersion at a temperature, typically from about 5° C. to about 75° C., and a pH, typically from about 3 to about 9, at which the enzyme is active for a period of time sufficient to hydrolyzethe protein material. After sufficient hydrolysis has occurred the enzyme is deactivated by heating, and the protein material is precipitated from the solution by adjusting the pH of the solution to about the isoelectric point of the protein material.

A particularly preferred modified soy protein material is a soy protein isolate that has been enzymatically hydrolyzed and deamidated under conditions that expose the core of the proteins to enzymatic action as described in European Patent No. 0480 104 B1, which is incorporated herein by reference. Briefly, the modified protein isolate material disclosed in European Patent No. 0 480 104 B1 is formed by: 1) forming an aqueous slurry of a soy protein isolate; 2) adjusting the pH of the slurry toa pH of from 9.0 to 11.0; 3) adding between 0.01 and 5% of a proteolytic enzyme to the slurry (by weight of the dry protein in the slurry); 4) treating the alkaline slurry at a temperature of 10° C. to 75° C. for a time period effectiveto produce a modified protein material having a molecular weight distribution (Mn) between 800 and 4000 and a deamidation level of between 5% to 48% (typically between 10 minutes to 4 hours); and deactivating the proteolytic enzyme by heating the slurryabove 75° C. The modified protein material disclosed in European Patent No. 0 480 104 B1 is commercially available from Protein Technologies International, Inc of St. Louis, Mo.

Casein protein materials useful in the process of the present invention are prepared by coagulation of a curd from skim milk. The casein is coagulated by acid coagulation, natural souring, or rennet coagulation. To effect acid coagulation ofcasein, a suitable acid, preferably hydrochloric acid, is added to milk to lower the pH of the milk to around the isoelectric point of the casein, preferably to a pH of from 4.0 to 5.0, and most preferably to a pH of from 4.6 to 4.8. To effectcoagulation by natural souring, milk is held in vats to ferment, causing lactic acid to form. The milk is fermented for a sufficient period of time to allow the formed lactic acid to coagulate a substantial portion of the casein in the milk. To effectcoagulation of casein with rennet, sufficient rennet is added to the milk to precipitate a substantial portion of the casein in the milk. Acid coagulated, naturally soured, and rennet precipitated casein are all commercially available from numerousmanufacturers or supply houses.

Corn protein materials that are useful in the of the present invention include corn gluten meal, and most preferably, zein. Corn gluten meal is obtained from conventional corn refining processes, and is commercially available. Corn gluten mealcontains about 50% to about 60% corn protein and about 40% to about 50% starch. Zein is a commercially available purified corn protein which is produced by extracting corn gluten meal with a dilute alcohol, preferably dilute isopropyl alcohol.

Wheat protein materials that are useful in the process of the present invention include wheat gluten. Wheat gluten is obtained from conventional wheat refining processes, and is commercially available.

In one embodiment of this invention, water is added in sufficient quantity to form a slurry in order to hydrate the protein material. It is critical to hydrate the protein material. A suitable slurry (A), once hydrated and homogenized, containsfrom 1 10% by weight solids based on the weight of the slurry. More preferably, the slurry (A) contains from 3 8% by weight solids. Most preferably the slurry (A) contains from 5 7% by weight solids. At this solids concentration which is indicated asmost preferred for the slurry, the most complete hydration is obtained in the protein. Thus, the water in the slurry is used most efficiently at this concentration.

286

Once the protein material is hydrated, it then is homogenized. Homogenization serves to decrease the particle size of the protein in the protein slurry (A). Preferably the slurry is transferred to a Gaulin homogenizer (model 15MR) and ishomogenized in two stages, a high pressure stage and a low pressure stage. The high pressure stage is from 1500 5000 pounds per square inch and preferably from 2000 3000 pounds per square inch. The low pressure stage is from 300 1000 pounds per squareinch and preferably from 400 700 pounds per square inch.

Component (B)

The present invention also employs a stabilizing agent and the stabilizing agent is a hydrocolloid comprising alginate, microcrystalline cellulose, jellan gum, tara gum, carrageenan, guar gum, locust bean gum, xanthan gum, cellulose gum andpectin. A preferred hydrocolloid is pectin. As used herein, the term "pectin" means a neutral hydrocolloid that consists mainly of partly methoxylated polygalacturonic acid. The term "high methoxyl pectin" as used herein means a pectin having a degreeof methoxyl esterification of fifty percent (50%) or greater. High methoxyl (HM) pectins useful in the present invention are commercially available. One supplier is Copenhagen Pectin A/S, a division of Hercules Incorporated, DK-4623, Lille Skensved,Denmark. Their products are identified as Hercules YM100L, Hercules YM100H, Hercules YM115L, Hercules YM115H and Hercules YM150H. Hercules YM100L contains about 56% galacturonic acid, where about 72% (. -.2%) of the galacturonic acid is methylated. Another supplier is Danisco A/S of Copenhagen, Denmark and they supply AMD783.

In order to prepare the hydrated protein stabilizing agent-acid dispersion (B), water and pectin are added in sufficient quantity to form a dispersion. A sweetener may be added this point or later or a portion of the sweetener added here andalso added later. Preferred sweeteners comprise sucrose, corn syrup, and may include dextrose and high fructose corn syrup and artificial sweeteners. The pectin is hydrated in the same manner as the protein, above. The term "dispersion" means acolloidal suspension. After hydration is complete, acid is added to the dispersion. The acid added to the dispersion comprises a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid glucone delta lactone,phosphoric acid or combinations thereof. Pectin is present in (B) at from 0.5 10% by weight and preferably from 0.75 5% by weight. It is necessary in the present invention to keep the hydrated protein stabilizing agent-acid dispersion (B) at a pH lowerthan 7 to eliminate pectin being degraded by beta-elimination. To this end, the pH of (B) is maintained at between 2.0 5.5.

Components (A) and (B) are then blended together and the blend has a pH of from 3.0 4.5, preferably from 3.5 4.2 and most preferably from 3.8 4.0 and subjected to a sterilization or pasteurization step by heating the (A) and (B) blend at arelatively high temperature for a short period of time. This pasteurization step kills microorganisms in the (A) and (B) blend. For example, an effective treatment for killing microorganisms in the (A) and (B) blend involves heating the (A) and (B)blend to a temperature of about 180° F. for about 10 seconds, preferably to a temperature of at least 190° F. for at least 30 seconds and most preferably at a temperature of 195° F. for 60 seconds. While a temperature lower than180° F. may work, a temperature of at least 180° F. provides a safety factor. Temperatures greater than 200° F. also have an effect on the killing of microorganisms. However, the cost associated with the higher temperature doesnot translate to a product that contains appreciably fewer harmful microorganisms. Further, pasteurizing at too high a temperature for too long a period of time may cause the protein to further denature, which generates more sediment due to theinsolubility of the further denatured protein.

The (A) and (B) blend, once pasteurized is then subjected to a homogenization step, which is preferably identical to the two-stage homogenization step outlined above for (A). The homogenized suspension is a stable suspension of a proteinmaterial in an acidic beverage.

Component (A1)

In another embodiment of this invention, a portion of the protein stabilizing agent is combined with the protein material and this protein material-protein stabilizing agent mixture is hydrated and homogenized to form (A1). Hydration andhomogenization is carried out in the same manner as disclosed in the preparation of component (A) above. The protein material for (A1) is identical to the protein material disclosed in (A). The protein stabilizing agent used in conjunction withthe protein material is disclosed above as part of Component (B). The preferred stabilizing agent is HM pectin. The ratio of protein material:protein stabilizing agent is generally from 10 20:1 and preferably from 12 18:1 on a dry basis. Water isadded in sufficient quantity to form a slurry in order to hydrate the protein material and pectin. It is critical to hydrate both the protein material and the protein stabilizing agent. Once the protein material-protein stabilizing agent is

287

hydrated,it is then homogenized to form (A1). Homogenization is conducted in the same manner as within (A). A suitable slurry (A1) contains from 1 10% by weight solids based on the weight of the slurry, preferably from 3 8% by weight solids and mostpreferably from 5 7% by weight solids. At this solids concentration which is indicated as most preferred for the slurry, the most complete hydration is obtained in the protein material and the pectin. Thus, the water in the slurry is used mostefficiently at this concentration.

Components (A1) and (B) are then blended together and the blend has a pH of from 3.0 4.5, preferably from 3.5 4.2 and most preferably from 3.8 4.0 and subjected to a pasteurization step by heating the (A1) and (B) blend at a relativelyhigh temperature for a short period of time. Both (A1) and (B) contain the protein stabilizing agent. When (A1) and (B) are blended together, it is at a protein stabilizing agent ratio contained within (A1) and (B) of (B):(A1) offrom 1 5:1. The pasteurization step is preferably the same as the (A) and (B) blend pasteurization disclosed above.

The (A1) and (B) blend, once pasteurized is then subjected to a homogenization step, which is preferably identical to the two-stage homogenization step outlined above for (A). The homogenized suspension is a stable suspension of a proteinmaterial in an acidic beverage.

Examples A D are baseline process examples as defined within FIG. 1.

EXAMPLE A

A 6.5 g protein per 8 oz serving fortified juice beverage is made using Supro.RTM. Plus 675 made by Solae.RTM. LLC.

Added to a vessel are 5494 g of distilled water followed by 332 g of Supro Plus 675. The contents at 5.70% solids are dispersed under medium shear, mixed for 5 minutes, followed by heating to 170° F. for 10 minutes to give a proteinsuspension slurry. In a separate vessel, 60 grams of pectin (YM-100L) are dispersed into 2940 grams of distilled water under high shear to give a 2% pectin dispersion. The dispersion is heated to 170° F. until no lumps are observed. The pectindispersion is added into the protein suspension slurry and mixed for 5 minutes under medium shear. This is followed by the addition of 27 grams of citric acid, 27 grams of phosphoric acid, 210 grams of concentrated apple juice and 1000 grams of sugar. The contents are mixed for 5 minutes under medium shear. The pH of this mixture at room temperature is in the range of 3.8 4.0. The contents are pasteurized at 195° F. for 30 seconds, and homogenized at 2500 pounds per square inch in the firststage and 500 pounds per square inch in the second stage to give a protein stabilized acid beverage. Bottles are hot filled with the beverage at 180 185° F. The bottles are inverted, held for 2 minutes and then placed in ice water to bring thetemperature of the contents to about room temperature. After the contents of the bottles are brought to about room temperature, the bottles are stored at room temperature for 6 months.

EXAMPLE B

The procedure of Example A is repeated except that the protein Supro.RTM. Plus 675 is replaced with the protein FXP 950 made by Solae.RTM. LLC.

EXAMPLE C

The procedure of Example A is repeated except that the protein Supro.RTM. Plus 675 is replaced with the protein FXP HO120 made by Solae.RTM. LLC.

EXAMPLE D

The procedure of Example A is repeated except that the protein Supro.RTM. Plus 675 is replaced with the protein Supro.RTM. XT 40 made by Solae.RTM. LLC.

The invention having been generally described above, may be better understood by reference to the examples described below. The following examples represent specific but non-limiting embodiments of the present invention.

Examples 1 3 are directed to the preparation of a stabilized acid beverage using components (A) and (B) as defined within FIG. 2.

EXAMPLE 1

288

A 6.5 g protein per 8 oz serving fortified juice beverage is made using Supro Plus 675 made by Solae LLC.

Added to a vessel are 5400 g of distilled water followed by 332 g of Supro Plus 675. The contents at 6.15% solids are dispersed under medium shear, mixed for 5 minutes followed by heating to 170° F. for 10 minutes to give a proteinslurry. In a separate vessel, 60 grams of pectin (YM-100L) and 300 grams of sugar are dispersed into 2940 grams of distilled water under high shear to give a 2% pectin dispersion. The dispersion is heated to 170° F. When the pectin is totallydispersed (without lump), added are 27 grams of citric acid, 27 grams of phosphoric acid, 210 grams of concentrated apple juice and 700 grams of sugar. These contents are combined under medium shear, and then mixed for 5 minutes. The solids level ofthe pectin slurry is at 30%. The protein slurry and the pectin dispersion are combined and mixed for 5 minutes. The pH at room temperature is in the range of 3.8 4.0. The contents are pasteurized at 195° F. for 30 seconds, and homogenized at2500 psi in the first stage and 500 psi in the second stage to give a protein stabilized acid beverage. Bottles are hot filled with the beverage at 180 185° F. The bottles are inverted, held for 2 minutes and then placed in ice water to bringthe temperature of the contents to about room temperature. After the contents of the bottles are brought to about room temperature, the bottles are stored.

EXAMPLE 2

A 6.5 g protein per 8 oz serving fortified juice beverage is made using FXP 950 made by Solae.RTM. LLC.

Added to a vessel are 5344 grams of distilled water followed by 332 grams of FXP 950. The contents at 6.22% solids are dispersed under medium shear, mixed for 5 minutes, then heated to 170° F. for 10 minutes to give a protein slurry. The protein slurry is pasteurized at 190° F. for 15 seconds. In a separate vessel, 57 grams of pectin (YM-100L) and 300 grams of sugar are dispersed into 2943 grams of distilled water under high shear to give a 2% pectin dispersion. Then addedare 27 grams of citric acid, 27 grams of phosphoric acid, 210 grams of concentrated apple juice and 700 grams of sugar and mixed for 10 minutes. This pectin dispersion has a solids level of 30%. The protein slurry and the pectin dispersion are combinedand mixed for 5 minutes under agitation. The pH at room temperature is 3.8 4.0. The combined slurry and dispersion are subjected to pasteurization at 195° F. for 30 seconds and homogenization at 2500 psi in the first stage and 500 psi in thesecond stage to give a protein stabilized acid beverage. Bottles are hot filled with the beverage at 175-185° F. The bottles are inverted, held for 2 minutes and then placed in ice water to bring the temperature of the contents to about roomtemperature. After the contents of the bottles are brought to about room temperature, the bottles are stored.

EXAMPLE 3

A 3.0 g protein per 8 oz serving fortified juice beverage is made using FXP HO120 made by Solae.RTM. LLC.

Added to a vessel are 5000 grams of distilled water along with 15 grams of sodium citrate and 143 grams of FXP HO120. The contents at 3.06% solids are dispersed under medium shear, mixed for 5 minutes and then heated to 150° F. for 10minutes to give a protein slurry. In a separate vessel, 39 grams of pectin (YM-100H) and 1000 grams of sugar are dispersed into 3506 grams of distilled water under high shear to give a 1.3% pectin dispersion. Added are 35 grams of citric acid and 164grams of concentrated apple juice under medium shear, and mixed for 10 minutes at 170° F., followed by homogenization first at 2000 pounds per square inch and then at 500 pounds per square inch. This pectin dispersion has a solids level of26.6%. The protein slurry and the pectin dispersion are combined and mixed for 5 minutes. The pH at room temperature is in the range of 3.8 4.0. The contents are pasteurized at three pasteurization settings (190° F., 200° F. and210° F. for 30 seconds, and homogenized at 2500 psi in the first stage and 500 psi in the second stage. Bottles are hot filled with the beverage at 175 185° F. The bottles are inverted, held for 2 minutes and then placed in ice water tobring the temperature of the contents to about room temperature. After the contents of the bottles are brought to about room temperature, the bottles are stored and sediment values are determined at one month and at six months.

TABLE-US-00001 % Sediment Pasteurization at one month % Sediment at six months method 4° C. 25° C. 25° C. 190° F./30 sec 0 1.08 4.33 200° F./30 sec 0.56 1.13 4.45 210° F./30 sec 1.13 1.12 5.59

Examples 4 and 5 are directed to the preparation of a stabilized acid beverage using components (A1) and (B) as defined within FIG. 3.

EXAMPLE 4

289

A 6.5 g protein per 8 oz serving fortified juice beverage is made using FXP HO120 made by Solac.RTM. LLC.

Added to a vessel are 20 grams of sodium citrate and 5000 grams of distilled water and stirred for 1 minute, followed by 307 grams of FXP HO120. The contents are mixed under medium shear, for 5 minutes to give a protein slurry that contained6.14% solids. The contents are then heated to 180° F. for 8 minutes. Added to the protein slurry is 20 grams of pectin (YM-100H) and mixed for 2 minutes. The protein/pectin mixture is homogenized at 2500 pounds per square inch and then at 500pounds per square inch. In a separate vessel is added 40 grams of pectin (YM-100H), 1000 grams of sugar and 3360 grams of distilled water and the contents are mixed under high shear to give a dispersion that contained 1.18% pectin. Then added are 35grams of citric acid, 20 grams of phosphoric acid and 164 grams of concentrated apple juice under medium shear, mixed for 5 minutes, and heated to 190° F. This pectin dispersion has a solids level of 26.9%. The protein slurry and the pectindispersion are combined and mixed for 5 minutes. The pH at room temperature is between 3.8 4.0. The protein/pectin contents are then pasteurized at 195° F. for 60 seconds, and homogenized at 2500 pounds per square inch in the first stage and500 pounds per square inch in the second stage. Bottles are hot filled with the beverage at 175 185° F. The bottles are inverted, held for 2 minutes, then placed in ice water to bring the temperature of the contents to about room temperature. After the contents of the bottles are brought to about room temperature, the bottles are stored.

EXAMPLE 5

A 6.5 g protein per 8 oz serving fortified juice beverage is made using SUPRO.RTM. XT 40 made by Solac.RTM. LLC.

Added to a vessel are 20 grams of sodium citrate and 5000 grams of distilled water and stirred for 1 minute, followed by 331 grams of SUPRO.RTM. XT 40. The contents are mixed under medium shear for 5 minutes to give a protein slurry thatcontains 6.56% solids. The contents are heated to 180° F. for 8 minutes. Added to the protein slurry is 20 grams of pectin (YM-100H) and mixed for 2 minutes. The protein/pectin mixture is homogenized at 2500 pounds per square inch and then at500 pounds per square inch. In a separate vessel is added 40 grams of pectin (YM-100H) 1000 grams of sugar and 3360 grams of distilled water and the contents are mixed under high shear to give a dispersion that contains 1.18% pectin. Then added is 35grams of citric acid, 30 grams of phosphoric acid and 164 grams of concentrated apple juice under medium shear, mixed for 5 minutes and heated to 190° F. This pectin dispersion has a solids level of 26.9%. The protein slurry and the pectindispersion are combined and mixed for 5 minutes. The pH at room temperature is between 3.8 4.0. The protein/pectin contents are then pasteurized at 195° F. for 60 seconds, and homogenize at 2500 pounds per square inch in the first stage and 500pounds per square inch in the second stage. Bottles are hot filled with the beverage at 175 185° F. The bottles are inverted, held for 2 minutes, then placed in ice water to bring the temperature of the contents to about room temperature. Afterthe contents of the bottles are brought to about room temperature, the bottles are stored.

The baseline process beverage examples A D and the inventive process beverage examples 1, 2, 4 and 5 are compared to each other, protein for protein, in storage sediment values in Table I. That is, Supro.RTM. 675 is the protein for Examples Aand 1, FXP 950 is the protein for Examples B and 2, FXT H0120 is the protein for Examples C and 4 and Supro.RTM. XT 40 is the protein for Examples D and 5.

TABLE-US-00002 TABLE 1 % Storage Sediment Values One Month Five Months Six Months Example 4° C. 25° C. 25° C. 4° C. 25° C. A -- -- -- -- 10.99 1 -- -- -- -- 3.42 B 6.26 5.89 -- 10.01 11.56 2 3.18 3.47 --6.91 8.87 C 1.1 2.71 9.58 -- -- 4 0.0 0.0 7.45 -- -- D 3.44 3.26 6.16 -- -- 5 2.12 2.9 5.09 -- --

It is observed from the storage sediment data of the above examples that the embodiments encompassing the process of this invention offer an improvement in less sediment in preparing a protein based acid beverage over the normal process forpreparing the beverage.

While the invention has been explained in relation to its preferred embodiments, it is to be understood that various modifications thereof will become apparent to those skilled in the art upon reading the description. Therefore, it is to beunderstood that the invention disclosed herein is intended to cover such modifications as fall within the scope of the appended claims. FIELD OF THE INVENTION

This invention relates to the preparation of a homogeneous cheese, for example a mozzarella variety of cheese. In particular, it relates to a process of making such a cheese in which a GRAS food additive, in the form of an undissolved solid, isadded to the cheese curd.

290

DESCRIPTION OF RELATED ART

Homogeneous cheeses are often, if not generally, made by acidifying milk to convert it to a cheese milk, coagulating the cheese milk to obtain a coagulum comprised of curd and whey, cutting the coagulum and draining the whey therefrom, therebyleaving a cheese curd, and then forming the curd into a homogeneous mass of cheese. In one forming process the cheese curd is heated, kneaded, and stretched until it is a homogeneous, fibrous mass of cheese. In another forming process the cheese curdis pressed, for example in a cheddaring tower.

Sometimes it is desired to add a GRAS (generally recognized as safe) food additive to the curd to alter the properties of the final cheese, e.g., its taste, texture, color, or baking performance. In U.S. Pat. No. 6,120,809 (Rhodes), forexample, a process is disclosed in which whey protein isolate and modified starch are mixed into mozzarella curd prior to heating, kneading, and stretching it. Often it is preferred to add the GRAS additive in the form of a comminuted solid. That canpose problems, however, in that it can be difficult to get the solid additive thoroughly blended into the finished cheese. Pockets or deposits of the additive sometimes survive the cheese-forming operation. They can be quite large, e.g., 1/2 inch to 4inches in diameter. This is particularly true when the additive is proteinaceous. These deposits can be so large as to clog some of the equipment used in making the cheese. Even if small, the presence of such deposits detracts from the appearance andmouth feel of the cheese, and can adversely affect the taste as well. In addition, if the cheese is to be diced or shredded prior to consumption, as, for example, in the case of cheese that is to be baked, e.g., on a pizza, these deposits can sometimesbecome so hard as to damage the cutting blades. The result can be metal fragments in the comminuted cheese.

SUMMARY OF THE INVENTION

The present invention addresses this problem by using a process comprising the following steps to make a homogeneous cheese that is augmented by a GRAS food additive that is in the form of an undissolved solid:

a) preparing a cheese curd,

b) grinding the curd while in admixture with (i) an aqueous solution of at least one cheese emulsifying salt and (ii) at least one GRAS food additive in the form of a comminuted solid, to obtain a ground curd that is impregnated with theemulsifying salt and the other GRAS food additive; and

c) converting the emulsifier/additive-impregnated ground curd into cheese either by (i) heating, kneading, and stretching the emulsifier/additive-impregnated ground curd to obtain a homogeneous mass of cheese, or (ii) pressing theemulsifier/additive-impregnated ground curd to obtain a homogeneous mass of cheese.

DETAILED DESCRIPTION

The process of the present invention can be used in the manufacture of any cheese that is made by either pressing the curd or subjecting it to the heating/kneading/stretching process. It is believed to be most useful for the manufacture ofcheeses that are designated as "Soft," "Firm/Semi-hard," or in between, according to the CODEX General Standard for Cheese (A6) Firmness Designators. These include, for example, Colby, Havarti, Monterey Jack, Gorgonzola, Gouda, Cheshire, and Muenster,all of which are in the Firm/Semi-hard category, as well as the mozzarella variety cheeses, which are in the Soft or Firm/Semi-hard categories, or in between the two. By "mozzarella variety cheese" we mean to include all of the cheeses thattraditionally were prepared by the pasta filata process, which cheeses are known by a variety of names, including mozzarella, pasta filata, provolone, scamorze, and pizza cheese. Standard mozzarella is designated as a Soft cheese. Part-skim mozzarellais between Soft and Firm/Semi-hard. Low-moisture mozzarella and low-moisture part-skim mozzarella are both designated as Firm/Semi-hard.

How to prepare a suitable curd for making a pressed curd cheese or a heated/kneaded/stretched cheese is well known to those skilled in the art. Typically the curd is prepared from pasteurized cow's or buffalo milk. The acidification step can beperformed either microbially or directly. Microbial acidification is accomplished by the addition of a starter culture of one or more lactic acid-producing bacteria to the milk, and then allowing the bacteria to grow and multiply. When making amozzarella variety cheese, a bacterial starter culture composed of coccus, rods, or a combination of both is preferably used. Direct acidification is faster and is accomplished by the addition of a GRAS acid, such as, for example, acetic acid (e.g., asvinegar), phosphoric acid, citric acid, lactic acid, hydrochloric acid, sulfuric acid, or glucono-delta-lactone (GdL) to the milk.

291

Following acidification, it is conventional to add rennet to the milk, to enhance the coagulation activity. The resulting coagulum is cut, and the whey is drained. Typically the curd is scalded (cooked) for about 0.08 to 1.0 hours at about 3048° C., and then is subjected to either the cheddaring process or the heating/kneading/stretching operation.

The term "cheese emulsifying salt" intended to include (but not be limited to) the chemical compounds known as sequestrants. Preferably what is used is a cheese emulsifier that sequesters calcium ions in the cheese--i.e., reduces the degree towhich the calcium is ionically bound to the protein in the cheese. Calcium-binding emulsifying salts are preferred, particularly those selected from the group consisting of phosphates and citrates. Sodium, sodium aluminum, and potassium salts are mostpreferred. Examples of suitable phosphates are sodium hexametaphosphate (SHMP), monosodium phosphate (MSP), sodium tripolyphosphate (STPP), disodium phosphate (DSP), potassium tripolyphosphate (KTP), potassium polyphosphate (KPP), and potassiumtetrapolyphosphate (KTPP). DSP is generally available in its hydrated form, disodium phosphate dihydrate. The preferred citrate emulsifier is sodium citrate, which, in solid form, is generally commercially available as sodium citrate dihydrate.

The ideal amount of emulsifying agent to use will vary, depending upon its chemical identity and the other combination of cheese-making conditions employed, but it can be easily ascertained on a case-by-case basis with a slight amount ofexperimentation. Preferably, however, the emulsifying agent will be used in an amount within the range of about 0.01 to 2%, based on the weight of the curd. Often, about 0.1 to 0.7% of the emulsifying agent will be used, or an amount within the rangeof about 0.2 to 0.6%.

The solution of cheese emulsifying salt preferably contains about 5 to 50 weight percent of dissolved salt, often about 20 to 40 weight percent thereof.

Among the GRAS food additives that may be present with the curd and aqueous solution of emulsifying salt in the grinder are gums, stabilizers, dairy solids, cheese powders, non-dairy protein isolates, sodium chloride, potassium chloride, nativeor physically or chemically modified food starches, food colorants, and food flavorants.

The incorporation of a gum and/or stabilizer in the cheese is generally useful to bind water and firm the cheese body. Examples of suitable gums include xanthan gum, guar gum, and locust bean gum. Examples of suitable stabilizers includechondrus extract (carrageenan), pectin, gelatin, and alginate, with alginate being generally preferred. The total amount of gums and stabilizers added will generally be in the range of about 0.1 to 10%, e.g., about 1 to 4%, based on the weight of thecurd

The purpose of incorporating a dairy solid into the cheese in the process of the present invention is to firm the cheese, bind water, improve the melt appearance of the cooked cheese, and/or to increase the blistering of the cooked cheese. Examples of suitable dairy solids include, but are not limited to, whey protein concentrate, dried whey, whey protein isolate, delactose permeate, casein hydrolyzate, milkfat, lactalbumin, and nonfat dry milk. The dairy solids may generally be includedin an amount within the range of about 0.1 to 15%, e.g., about 1 to 8%, based on the weight of the curd.

A cheese powder is a dried cheese in particulate form. The purpose of incorporating a cheese powder in the cheese is to impart a different cheese flavor to the finished product. Examples of suitable cheese powders include, but are not limitedto, Parmesan, cheddar, Monterey Jack, Romano, Muenster, Swiss, and provolone powders. The cheese powder can generally be included in an amount within the range of about 0.25 to 10%, preferably about 0.25 to 1%, based on the weight of the curd.

The purpose of incorporating a non-dairy protein isolate into the cheese in the process of the present invention is to alter the texture of the cheese and/or to change the size, color, or integrity of the blisters that are formed when the cheeseis baked on a pizza, as well as other cook characteristics. Examples of suitable non-dairy protein isolates include soy protein (sometimes called "soy powder"), gelatin, wheat germ, corn germ, gluten, and egg solids. (Gelatin, as previously indicated,also acts as a stabilizer to bind water and firm the cheese.) The amount of non-dairy protein isolate that might be added will generally be within the range of about 0.1 to 10 percent, e.g., about 1 to 4%, based on the weight of the curd.

If sodium chloride and/or potassium chloride is mixed with the curd during the grinding operation, preferably the total amount of those salts will be about 0.1 to 5%, e.g., about 0.1 to 2%, based on the weight of the curd.

292

Sometimes, when the exposed cheese on a pizza completely melts, it appears as though the cheese has been "cooked into" sauce. To the consumer, the topping on the pizza can appear to have less cheese than is desired or expected. In the industrythis is referred to as the pizza appearing "thin" having a "poor yield." The inclusion of a food starch in the cheese tends to obviate this problem. Generally the amount of starch should be in the range of about 0.5 to 20%, most commonly in the range ofabout 1 to 4%, based on the weight of the curd.

Suitable starches include both vegetable starches, such as potato starch, pea starch, and tapioca, and grain starches, such as corn starch, wheat starch, and rice starch. The starch can be modified (chemically or physically) or native. Suitablecorn starches include dent corn starch, waxy corn starch, and high amylose corn starch.

Modified food starches differ in their degree of cross-linking, type of chemical substitution, oxidation level, degree of molecular scission, and ratio of amylose to amylopectin. Examples of some commercially available modified food starchesthat are generally suitable for obviating the "poor yield" problem include Mira-Cleer 516, Pencling 200, Batterbind SC, Penbind 100, and MiraQuick MGL. A suitable, commercially available native (unmodified) starch is Hylon V.

Mira-Cleer 516, from A. E. Staley Company, is a dent corn starch that is cross-linked and substituted with hydroxypropyl groups. The cross-linking increases its gelatinization temperature and acid tolerance. The hydroxypropyl substitutionincreases its water binding capability, viscosity and freeze-thaw stability.

MiraQuick MGL, from A. E. Staley Company, is an acid-thinned potato starch. The acid thinning breaks amylopectin branches in the starch, creating a firmer gel.

Pencling 200, from Penwest Foods, is an oxidized potato starch. The oxidation increases its capacity to bind water and protein. Penbind 100, also from Penwest Foods, is a cross-linked potato starch.

Batterbind SC, from National Starch, is a cross-linked and oxidized dent corn starch. Hylon V, also from National Starch, is an unmodified, high amylose corn starch.

All of the specific starches mentioned above are "cook-up" starches--that is, they are not pre-gelatinized. Pre-gelatinized starches can also be used in the process of the present invention.

As suitable food flavorants may be mentioned, for example, powdered butter and cheddar cheese flavorants.

Powdered food colorants come in a variety of colors and can be used to impart a creamier, richer color to the finished cheese or even a non-cheeselike novelty color.

In order to adjust the composition of the finished cheese, a minor amount of water and/or dairy cream also can be in an admixture with the curd during the grinding step. Adding a metered amount of either can assist in the effort to control themoisture and/or milkfat content of the finished cheese. This can be done, for example, by use of an additional spray line at the inlet to the grinder. The amount of added water or cream preferably will not be more than can be absorbed by thecurd--i.e., not so much as to result in separation of the water and/or cream from the curd, after the mixture leaves the grinder.

The grinding reduces the curd to smaller size particles, thus increasing its surface area. Preferably, the curd is ground to an extent that at least about 90 weight percent thereof has a particle size with a longest dimension of no more thanabout 0.5 inch, and most preferably no more than about 0.3 inch. Most preferably, substantially all of the curd will have such a particle size.

A preferred type of grinding machine is one in which the curd is swept by high speed impellers around the inside of a stationary circular wall with exit slots having a knife blade mounted in front of each slot opening, parallel to the wall, withthe blade edge facing the onrushing curd. Due to centrifugal force, the curd hugs the wall as it is swept past the blades. As a piece of curd is forced past an exit slot, it is sliced by the blade and the sliced-off segment is propelled out the slot. By setting the distance between the blade and the wall, the cheese curd is reduced in size by precise increments and can be ground to a predetermined size. One suitable example of such a grinder is the Urschel Comitrol Processor, model 1700, withvariable speed control, which has three blades and a dogleg impeller. Using this particular machine, the preferred impeller speed is about 3600 to 5600 rpm.

293

Preferably the grinding step is performed in a continuous manner. Thus, for example, the grinding machine can have an upwardly open inlet and the supply curd can be made to fall into the grinder in a continuous stream, while the grinder isoperating. In such an arrangement it is preferred that the aqueous solution of emulsifying salt be sprayed onto the falling curd. Similarly, the GRAS food additive solids can be made to fall into the same inlet, at a location on or near the locationwhere the supply curd falls into the grinder. One example of a suitable machine for introducing the powdered GRAS food additive into the grinding chamber is an Allen Machinery Company salter/seasoner applicator, model no. ss66.5/36.

When the emulsifier/additive-impregnated ground curd is to be formed into a cheese by heating, kneading, and stretching, the heating/kneading/stretching machine may be, for example, a single or twin-screw mixer or a twin-screw extruder, eitherfitted for steam injection or having a heated jacket, or a combination of both. When using a twin-screw mixer or extruder as the heating/kneading/stretching machine, preferably the screws (also known as augers) will be arranged so that they overlap, toinsure thorough mixing.

Preferably, the heating, kneading, and stretching will be performed under low shear conditions. Thus, for example, when using a twin-screw mixer having a 1/4 inch clearance between the outer edge of each flight and the wall past which that edgemoves, the speed of revolution of the screws will preferably be no more than about 50 rpm, e.g., in the range of about 12 to 40 rpm. Wider clearances can be used as well, e.g., up to, say, 1/2 inch.

The heating of the curd while it is being kneaded and stretched can be accomplished; for example, by conduction, through the wall of the kneading and stretching chamber, e.g., by use of a hot water jacket. In addition to or instead of conductiveheating, the contents of the chamber can be heated by releasing live steam into the kneading and stretching chamber. Where live steam is used to heat the curd, the steam condensate is absorbed by the curd and forms part of the final mass of cheese. When using live steam in the heating/kneading/stretching machine, typically the water content of the emulsifier/additive-impregnated ground curd immediately prior to entering the mixer is about 45 to 55 wt. %, and sufficient steam is released into thekneading and stretching chamber that the water content of the mass of cheese immediately after exiting the machine is up to about 5 percentage points higher, e.g., about 0.5 to 5 points higher. Often, it will be about 1.5 to 2.5 points higher. Thus,for example, if, say, the water content of the ground curd entering the machine is 45 wt. %, then preferably the amount of injected steam that is used to bring the curd up to the necessary temperature to obtain a homogeneous, fibrous mass of cheese willbe an amount that raises the water content to no more than about 47 wt. %.

When the emulsifier/additive-impregnated ground curd is subjected to a heating/kneading/stretching operation, it is preferred that that too be performed on a continuous basis. Thus, for example, the emulsifier/additive-impregnated curd that isdischarged from the grinder can be continuously collected in a funnel, passed into a flowline, and pumped to a heating/kneading/stretching machine that is in operation. As the ground curd is introduced at one location into theheating/kneading/stretching chamber, finished cheese can be continuously withdrawn from another location in the chamber.

The heating, kneading, and stretching step can be performed in the absence of any exogenous water. By "exogenous water" is meant water that is used to bathe the curd and which is subsequently separated from the homogeneous cheese. A shortcomingof the use of exogenous water during the heating, kneading, and stretching step is that, when the water is separated, it removes valuable protein, fat, and other solids that otherwise would be bound up in the finished cheese.

The emulsifier/additive-impregnated ground curd that is withdrawn from the grinder is preferably at a temperature of about 70 to 120° F., and often within the range of about 85 to 105 or 110° F. Typically that ground curd willthen be heated in the heating/kneading/stretching machine to an exit temperature in the range of about 120 to 150° F., preferably about 130 to 145° F.

The hot cheese that exits the heating/kneading/stretching machine may be packaged either before or after being cooled to room temperature or below. No special type of cooling is required. Thus, for example, the cheese can be cooled by extrudingit from the heating/kneading/stretching machine directly into a cold water or cold sodium chloride brine channel or tank, for example as described in U.S. Pat. No. 4,339,468 to Kielsmeier or U.S. Pat. No. 5,200,216 to Barz et al., both of which arehereby incorporated herein by reference.

Instead of floating or immersing the cheese in cold water or brine to cool it, it can be sprayed with cold brine or water and/or passed through a cold air chamber, e.g., a blast cooler.

294

When extruding the hot cheese and cooling it while in ribbon form, the cheese ribbon is preferably contacted with the cooling medium (e.g., cold water, brine, or air) until its core temperature drops to about 75° F. (24° C.) orbelow. Then the cooled ribbon is cut into segments. The cheese ribbon can even be cooled to a core temperature of about 25° F. (-3.9° C.) or below before being cut.

If the product is string cheese, e.g., having a diameter of about 1/4 to 3/4 inch (0.6 to 2 cm.), the segments of the string will generally be about 11/2 to 8 inches (4 to 20 cm.) long. If the string cheese is not to be baked, or if it is to bebaked only while enclosed in pizza crust, e.g., in a stuffed crust pizza, it will generally not be necessary to age the cheese before using it. If desired, the string cheese may be frozen and stored.

If it is intended to use the cheese as exposed topping for a pizza, then the continuous ribbon, which will preferably be rectangular in cross section, may be cut into loaves, for example having a width of about 12 to 36 inches (30 to 91 cm.), aheight of about 1/16 to 2 inches (0.15 to 5 cm.), and a length of about 14 to 24 inches (36 to 61 cm.). The loaves can be comminuted. Preferably the loaves will have a core temperature at or below 30° F. prior to being comminuted. Theresultant pieces of cheese can be individually quick frozen, for example by the process described in U.S. Pat. No. 5,030,470 to Kielsmeier, et al., which is hereby incorporated herein by reference.

If, instead of being heated, kneaded, and stretched, the emulsifier/additive-impregnated ground curd is transformed into a homogeneous cheese by pressing, then it can be continuously conveyed from the grinder to a cheddaring tower in which themixture is not heated, but rather pressed into blocks, e.g., ranging in size from about 5 to about 640 lbs. Even mozzarella variety cheeses can be made by the pressed curd process, as disclosed, for example, in U.S. Pat. No. 6,086,926 (Bruce et al.),which is hereby incorporated herein by reference. As discussed in Bruce et al., when using the pressed curd process it is preferred to treat the curd with a proteolytic enzyme, so as to impart stretching properties to the finished cheese. Preferably,the enzyme is added together with salt, and the treated curd is allowed about 3 to 48 hours, at a temperature of about 15 to 40° C., to incorporate the salt and enzyme (mellowing) before the curds are filled into moulds and placed into a cheeseprocess. Typically the pressing is continued overnight, e.g., under a pressure of about 40 lb/in2 (280 kPa) and at ambient temperature.

Depending on the composition of the cheese, if it is intended to be used for baking purposes it may be preferable to store the cheese for a time (e.g., about 7 to 21 days, at about 35 to 45° F. (2 to 7° C.)) after it is removedfrom the cooling medium and before it is comminuted and frozen. However, as described in U.S. Pat. No. 5,200,216 (Barz et al.), if the process is controlled so that the cooled cheese removed from the cooling medium has a moisture content of about 45to 60 wt. %, a milkfat content of at least about 30 wt. % (dried solids basis), and a combined moisture and wet milkfat content of at least about 70 wt. %, then the cheese can be frozen immediately and will still perform satisfactorily when baked on apizza, under a variety of conditions.

When the process of the present invention is used to make standard mozzarella cheese, steps (a) through (c) are controlled so that the cheese obtained has a minimum milkfat content of 45% by weight of the solids and a moisture content that ismore than 52 wt. % but not more than 60 wt. %.

When the present process is used to make low-moisture mozzarella cheese, steps (a) through (c) are controlled so that the cheese obtained has a minimum milkfat content of 45% by weight of the solids and a moisture content that is more than 45 wt.% but not more than 52 wt. %.

When the process of the present invention is used to make part-skim mozzarella cheese, steps (a) through (c) are controlled so that the cheese obtained has a milkfat content of 30 to 45% by weight of the solids and a moisture content that is morethan 45 wt. % but not more than 60 wt. %.

When the process of the present invention is used to make low-moisture, part-skim mozzarella cheese, steps (a) through (c) are controlled so that the cheese obtained has a milkfat content of less than 45% but not less than 30%, by weight of thesolids, and a moisture content that is more than 45% but not more than 52% by weight.

The moisture percentages given above are for bound plus free water--i.e., the percent of weight lost when the cheese is dried overnight in a 200° C. oven. 

ILLUSTRATIVE EXAMPLES

The following examples illustrate how the process of the present invention may be performed. Unless

295

otherwise indicated, all percentages are by weight.

Example I

Mozzarella cheese curd is made from cow's milk, using the overnight-curd-hold system described in U.S. Pat. No. 3,961,077 (Kielsmeier). A starter culture containing lactobacillus and streptococcus organisms is used, and the cheese milk iscoagulated by the addition of veal rennet. Most of the individual curd particles range in size from about 1/2 inch to 11/2 inches, in their longest dimension.

Approximately 9,500 lbs. of the cheese curd, having a moisture content of 54.33 wt. %, a milkfat content of 53.65 wt. % FDB (fat on a dry basis) and a pH of 5.61 is passed continuously thru a grinder (Urschel Laboratories, Inc., Valparaiso,Ind./Comitrol Processor Model 1700). The grinder is fitted with a cutting head (part number 3M025040U) set to produce a particle size of 0.04 inch. Simultaneously, as the curd falls into the grinder, 1.14% (based on the weight of the curd) of anemulsifier solution is sprayed onto the curd, and a blend of 0.8% salt (sodium chloride), 1.16% modified food starch (Mira-Cleer 516), and 1.16% NFDM (non-fat dry milk), based on the weight of the finished cheese, is sprinkled onto the sprayed curd. Theemulsifier solution is a 0.45 wt. % solution of sodium polyphosphate glass in water. The curd and ingredients are in contact with each other for only a fraction of a second before landing in the grinder.

The ground mixture of curd and ingredients, at a temperature of about 80° F., is captured in a funnel as it is expelled from the grinder. The mixture is then pumped and passed through a series of two, hot-water-jacketed, single-screwmixers running at 12 rpm and a jacket temperature of 165° F. The mixture is heated to 112° F. in the first single auger-mixer and 133° F. in the second single-auger mixer. The heated mixture begins to take on a fibrousconsistency but is not homogeneous yet. The heated mixture is then transferred to a hot-water-jacketed, double-auger mixer running at 22 rpm and a jacket temperature of 145° F. It is in this double auger mixer that a homogeneous, fibrous mass iscreated.

The homogeneous, fibrous mass of cheese (143° F.) is transferred to an extruder. The cheese is extruded into cold brine, where the temperature is dropped from 140° F. to 30° F. in 15 20 minutes. Final productspecifications are 58.10% moisture, 45.34% FDB, 5.56 pH, and 1.80% salt. The cooled cheese is shredded, and then frozen. Upon thawing and baking the thawed cheese on pizza, it performs comparable to traditionally made cheese, and even shows signs ofmore meltdown. More important is the fact that no pockets or lumps of powder are found in the cheese that might cause dicer blade damage.

Example II

Approximately 9,500 lbs. of cheese curd having 52.52% moisture, 52.00% FDB and a pH of 5.62 is passed continuously thru the Comitrol Processor Model 1700 grinder. It is made in the same manner as the curd used in Example I. The grinder isfitted with a cutting head (part number 3M030250U) set to produce a particle size of 0.25 inch. Simultaneously, as the curd falls into the grinder, 0.75 wt. % of an emulsifier solution is sprayed onto the curd, and a blend of 0.8% salt and 4.0% NFDM,based on the weight of the finished cheese, is sprinkled onto the sprayed curd, in the same manner as in Example I. The emulsifier solution is again a 0.45 wt. % solution of sodium polyphosphate glass in water.

The ground mixture of curd and ingredients, at a temperature of about 80° F., is captured in a funnel as it is expelled from the grinder. The mixture is then pumped and passed through an unheated twin-screw mixer running at 80 rpm. Themixture is then transferred to a hot-water-jacketed, double-auger mixer running at 12 rpm and a jacket temperature of 155° F. The heated mixture takes on some fibrous characteristics but is not homogeneous yet. The heated mixture is thentransferred to a hot-water-jacketed, single auger mixer running at 12 rpm and a jacket temperature of 150° F. It is in this single auger mixer that a homogeneous, fibrous mass is created.

The homogeneous, fibrous mass of cheese (130° F.) is transferred to an extruder. The cheese is extruded into cold brine, where the temperature is dropped from 140° F. to 30° F. in 15 20 minutes. Final productspecifications are 58.10% moisture, 45.34% FDB, 5.56 pH, and 1.80% salt. The cooled cheese is shredded, and then frozen. Upon thawing and baking the thawed cheese on pizza, it performs comparable to traditionally made cheese, and even shows signs ofmore meltdown. More important is the fact that no pockets or lumps of powder are found in the extruded cheese which might cause dicer blade damage.

Example III

Approximately 9,500 lbs. of cheese curd having a moisture content of 52.52%, 52.00% FDB and a pH of

296

5.62 is passed continuously thru the Comitrol Processor Model 1700 grinder. The grinder is fitted with a cutting head (part number 66793) set toproduce a particle size of 0.025 inch. Simultaneously, as the curd falls into the grinder, 0.75 wt. % of an emulsifier solution (0.45 wt. % sodium polyphosphate glass) is sprayed onto the curd, and a blend of 1.0% salt and 4.0% NFDM, based on the weightof the finished cheese, is sprinkled onto the sprayed curd, in the same manner as in Example I.

The mixture is then pumped to a twin-screw mixer. The mixture is continuously moved through three chambers in the mixer, each chamber having independent temperature control via jacketed hot water. Also, all of the screws are heated by hot-water(150° F.) that flows through passages through both the flights and the axles. The temperature of the water flowing through the jacket of the first chamber is approximately 110° F., that flowing through the second chamber's jacket isabout 175° F., and that flowing through the third chamber's jacket is about 160° F. The trip through the three chambers raises the temperature of the cheese mixture from 80° F. to 150° F. Towards the end of its residencetime in the second chamber, the cheese mixture begins to stretch, such that upon exiting the third chamber it is a homogeneous, fibrous mass.

The homogeneous, fibrous mass of cheese is transferred to an extruder. The cheese is extruded into cold brine, where the temperature is dropped from 140° F. to 30° F. in 15 20 minutes. Final product specifications are 51.8%moisture, 41.5% FDB, 5.64 pH and 1.73% salt. The cooled cheese is shred, and then frozen. No pockets or lumps of powder are present in the cheese.TECHNICAL FIELD

The present invention relates to a method for producing a fermented dairy product including the use of an oxidase for the conversion of lactose to lactobionic acid.

BACKGROUND OF THE INVENTION

In the production of fermented dairy products, such as yoghurt, cream cheese, cottage cheese etc. functional and/or organoleptic properties, as well as nutritional value are of importance. Among the organoleptic properties sourness, firmness andmouthfeel of the dairy product is of great importance for customer acceptance. Moreover, there are differences in customer acceptance based on national and cultural differences, which fact requires these properties to be adjustable.

Many efforts have been exercised in order to generate dairy products of nutritional value and with improved functional and/or organoleptic properties, including acidified, edible gels on milk basis. A typical example of such products isdesserts, especially yoghurt and curd. In order to prepare such products of satisfactory quality, it is today necessary to ferment dairy ingredients (whole or low fat milk, skim milk, condensed milk, and dried skim milk) using bacterial cultures. Someof these may be indigenous to milk or introduced during processing. Fermentation not only reduces pH of the milk, but also results in the smooth, viscous liquid or soft curd characteristic of yoghurts. Stabilizers and sweeteners are often added duringprocessing to modify texture and/or prevent syneresis as well as reduce intensity of the tart or sour flavor (Kosikowski & Mistry: Cheese and fermented milk products). For example, Swiss-style yoghurt uses large amounts up to 0.75% of stabilizer toobtain products of high viscosity.

In many fermented dairy products, particularly yoghurt products, firmness and sourness are of great importance. E.g. yoghurt is a soft-textured product where texture and sourness are of specific importance for the final product to be used, eatenas such, or used in a prepared ready-to-eat form. Metabolic activity of the bacterial cultures generate volatile flavor compounds such as acetic acid, diacetyl, and acetaldehyde which coupled with the acidity contribute to the unique sour or tart flavorcharacteristic of yoghurts. However, the tartness or sourness may be too intense and may need to be reduced by adding sweeteners. Another unique characteristic of yoghurt is its viscosity and smooth mouthfeel. The occurrence of syneresis duringstorage releases whey from the smooth gel matrix resulting in significant changes in texture. Hence the addition of stabilizers to prevent or control syneresis. Excessive addition of stabilizers, however, could also make the product too viscousadversely affecting mouthfeel and taste. Wright and Rand, 1973; J. Food Sci. 38: 1132 1135 discloses enzymatic conversion of lactose to lactobiotic acid and its use to acidify milk. Lin et al., 1993; Biotech. Adv. 11: 417 427 discloses the use of anoligosaccharide oxidase to convert lactose to lactobionic acid in a wheat bran substrate. Satory et al., 1997; Biotechnol. Lett. 19:1205 1208 discloses the use of glucose-fructose oxidoreductase (GFOR) for the conversion of lactose to lactobionicacid.

None of these references discusses the use of enzymatic conversion of lactose to lactobionic acid for affecting functional and/or organoleptic properties, such as firmness and sourness of a dairy product.

Thus, there is a need for an improved method for the preparation of fermented dairy products, in particular a

297

method for providing dairy products having improved functional and/or organoleptic properties.

One object of the present invention is to provide a method for the preparation of a fermented dairy product having improved firmness. Specifically, it is an object to provide a less firm fermented dairy product.

Another object of the present invention is to provide a method for the preparation of a fermented dairy product having improved taste. Specifically, it is an object to provide a less sour fermented dairy product.

A still further object of the present invention is to provide a method for affecting firmness and sourness of a fermented dairy product. Specifically, it is an object to provide a less firm and less sour fermented dairy product.

SUMMARY OF THE INVENTION

According to the invention it has been found that by the use of an oxidase from Microdochium in the preparation of a fermented dairy product it has been possible to affect the firmness and sourness of the resulting product. It has specificallybeen found that it is thereby possible to produce a less firm and less sour fermented dairy product.

Thus, the present invention relates to a method for the preparation of a fermented dairy product comprising the steps of providing a dairy base contacting the dairy base with a starter culture for fermentation adding to the dairy base, prior toor during fermentation, an oxidase, produced by a fungus belonging to the genus Microdochium, for conversion of lactose to lactobionic acid to give a fermented dairy product.

In a further aspect the invention relates to a method for affecting firmness of a fermented dairy product comprising the steps of providing a dairy base contacting the dairy base with a starter culture for fermentation adding to the dairy base,prior to or during fermentation, an oxidase, produced by a fungus belonging to the genus Microdochium, for conversion of lactose to lactobionic acid to give a fermented dairy product.

In yet a further aspect the present invention relates to a method for affecting firmness and/or sourness of a fermented acidified dairy product comprising the steps of providing a dairy base contacting the dairy base with a starter culture forfermentation adding to the dairy base, prior to or during fermentation, an oxidase, produced by a fungus belonging to the genus Microdochium, for conversion of lactose to lactobionic acid to give a fermented acidified dairy product.

Moreover, the present invention refers to the use of an oxidase, produced by a fungus belonging to the genus Microdochium, in combination with fermentation of a dairy base in the production of a fermented dairy product for conversion of lactoseto lactobionic acid.

Finally, the present invention refers to fermented dairy products produced by the above methods. 

DETAILED DISCLOSURE OF THE INVENTION

The present invention refers to the preparation of a fermented dairy product having improved functional and/or organoleptic properties. Specifically, it refers to the preparation of a fermented dairy product having improved firmness and taste.

Dairy Base and the Preparation of a Fermented Dairy Product

In the present context the term "dairy base" is to be understood as any milk or milk like product including lactose, such as whole or low fat milk, skim milk, condensed milk, dried skim milk or cream originating from any animal. "Milk" is hereto be understood as the lacteal secretion obtained by milking any animal, such as cows, sheep, goats, buffaloes or camels. Also, it is to be understood that the milk or milk like product can be produced by suspending skim milk powder and/or full fatmilk powder in an aqueous medium.

In the present context the term "fermented dairy product" is to be understood as any dairy product including a dairy base, as defined above, and being subjected to any type of fermentation. Examples of fermented dairy products applicable for thepresent invention are products like yoghurt, cream cheese and cottage cheese.

For the preparation of a fermented dairy product a dairy base, as defined above, is provided. The dairy base

298

may be heat treated by pasteurisation, sterilization or treated in any other appropriate way. The pasteurisation and sterilizationprocedures may be any such procedure known in the art. For fermentation the dairy base is contacted with a starter culture, which is chosen depending on the product to be produced. Examples of starter cultures to be used according to the invention arelactic starter cultures, such as yoghurt cultures (Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus. Others include Lactobacillus acidophilus, Lactobacillus lactis, and bifidobacteria), cheese cultures (Lactococcus spp. Lactobacillus spp. Streptococcus spp.). Such cultures are readily available from e.g. Chr. Hansen A/S, Denmark. However, any starter culture available within the art and suitable for producing a fermented dairy product may be used.

Doses of starter culture added and incubation temperatures vary depending e.g. on the culture/dairy base used and the final product required. However, culture doses often range between 2 5% inoculated into warm homogenized mix and incubated atabout 45° C. for about 3 6 hrs until pH drops to about 4.4. In some cases, a lower temperature (32° C.) coupled with a lower culture dose of 0.25% may be used with long incubation times (12 14 hrs).

Prior to or during the fermentation the dairy base is subjected to an oxidase produced by a fungus belonging to the genus Microdochium. Preferably the fungus is Microdochium nivale, such as Microdochium nivale as deposited under the depositionno CBS 100236. Subjecting the dairy base to a Microdochium oxidase results in the conversion of lactose in the dairy base to lactobionic acid.

Doses of enzyme added vary depending on e.g. dairy base used and the specific product to be produced. Doses of enzyme added may range from 4 20 units/100 ml dairy base, a preferred level being about 10 units/100 ml dairy base.

The dairy base including the starter culture and the oxidase is allowed to ferment under conditions generally known in the art. Examples of fermentation conditions are 40 46° C. for 3 6 hrs until a pH of 4.2 4.6 is reached. In somecases, it may be possible to use lower doses of culture (about 0.25%) and incubation at about 32° C. for as long as 12 14 hrs until the desired final pH is reached.

According to the present invention the oxidase is used to affect functional and/or organoleptic properties, such as firmness and sourness, of the dairy product to be produced. If necessary, additives, such as stabilizers and sweeteners, may beadded to the dairy product.

In a further embodiment of the present invention the oxidase treated dairy base sample is subjected to a heat treatment prior to fermentation. The dairy base is heat treated before the addition of starter culture thereto and as an example theheat treatment may be performed 20 40 min, such as 30 min after the addition of oxidase. The heat treatment per se may be a treatment of up to about 90° C., such as around 60 90° C., e.g. 60 75° C., for 35 sec 5 min. One exampleof heat treatment is 90° C. for 5 min. In one embodiment of the invention the heat treatment is sufficient to inactivate the oxidase enzyme.

One effect of this heat treatment is that the lowering of the firmness is less pronounced (as shown by sample no 4 in example 1), whereas the product still shows a reduction of the sourness.

Products Produced by the Method of the Invention

The product produced by the present invention may be any fermented dairy product, as defined above. Examples of such products are yoghurts, cream cheeses and cottage cheeses, some specific examples of which are further disclosed below.

Flavored and Plain Yoghurts

Milk mix is pre-heated or concentrated to pasteurisation temperature and 0.5% stabilizer added, if required. This is homogenized and pasteurised at 91° C. for 40 60 sec (HTST) or 85° C. for 30 min. The pasteurised mix is cooledto about 46° C. and after holding for about 15 min at this temperature; it is inoculated with appropriate dose of culture. For flavoured products, recommended amounts of essences are added at this point, packaged, and incubated at thistemperature for about 4 6 hrs or until firm smooth gel is formed. At this point, pH should be about 4.5. These are then transferred to 2° C. chill rooms where the fresh yoghurt is rapidly chilled to 7° C. in less than an hour. Theseare stored at 4° C. for 1 2 months.

Pasteurised or Heated Yoghurt

299

The freshly prepared yoghurt makes up the basic ingredient for heated or pasteurized yoghurt which is prepared by adding 0.15 0.2% stabilizer (e.g., locust bean gum or alginate). The stabilized product is heated at 62° C. or 75° C. for 35 sec for direct hot packaging or cooling prior to aseptic packaging.

Low Lactose Yoghurt

For low lactose yoghurt, lactase is added to milk and held overnight at 4° C. until about 60% lactose is hydrolyzed. Lactose reduction is sometimes achieved by ultrafiltration of the milk blend or a combination of ultrafiltration andlactase treatment. The mix is then pasteurized and incubated at 43° C. with appropriate culture until curd is properly set. This is then chilled as for plain or flavoured yoghurt.

In all examples mentioned above, the enzyme may be incorporated at the appropriate stages as outlined in the description and the examples.

The yoghurts produced by the method of the present invention comprise all varieties of yoghurts, such as, yoghurt mousse, Acidophilus and Bifidus yoghurt, low lactose yoghurt, low fat and non-fat yoghurts, heated or pasteurised yoghurt.

The cheeses produced by the process of the present invention comprise all varieties of cheese, such as, e.g., Manchego, Saint Paulin, Soft cheese, White cheese, including rennet-curd cheese produced by rennet-coagulation of the cheese curd;ripened cheeses such as Cheddar, Colby, Camembert, fresh cheeses such as Mozzarella and Feta; acid coagulated cheeses such as cream cheese, Neufchatel, Quarg, Cottage Cheese and Queso Blanco; and pasta filata cheese.

Discussion and Further Aspects of the Invention

According to the present invention a fermented dairy product having an improved firmness is provided. Specifically, a fermented dairy product having a reduced firmness is provided. One example of such a product is yoghurt and by means of thepresent invention a softer yoghurt is provided, which in many cases will be experienced as a product having better mouthfeel than a more firm product.

In another aspect of the invention a fermented acidified dairy product having an improved sourness is provided. Specifically, a fermented acidified dairy product having a reduced sourness is provided. One example of such a product is yoghurtand the characteristic yoghurt taste, specifically related to acetaldehyde, is surprisingly reduced by means of the present invention. This is shown in example 2.

In still another aspect of the invention a fermented acidified dairy product having an improved firmness is provided. Specifically, a fermented acidified dairy product having a reduced firmness is provided.

Thus, it is, by means of the invention, possible to affect the firmness and/or sourness of a fermented dairy product and in a preferred embodiment the dairy product produced by means of the invention has a firmness and/or a sourness which islower than the firmness and/or sourness achieved in such a product without the addition of oxidase.

In a further embodiment of the present invention the oxidase treated dairy base, as described above, is heat treated before the addition of a starter culture. This results, as shown in example 1, no 4, in a product where the lowering of thefirmness is less pronounced. However, the product still have a less sour taste.

A further aspect of the invention is the use of an oxidase, produced by a fungus belonging to the genus Microdochium, in combination with fermentation of a dairy base in the production of a fermented dairy product for conversion of lactose tolactobionic acid.

Preferably the fungus is Microdochium nivale, such as Microdochium nivale as deposited under the deposition no CBS 100236 or any other species as defined above.

Further aspects of the invention are fermented dairy products produced by the method according to the invention. The products of the invention have improved functional and/or organoleptic properties, such as improved firmness and sourness. Specifically there is provided a fermented dairy product having a firmness being lower than the firmness achieved in such a product without the addition of an oxidase.

In a further embodiment a fermented acidified dairy product is provided having a sourness being lower than the sourness achieved without the addition of an oxidase.

300

In still a further embodiment a fermented acidified dairy product is provided having a firmness as well as a sourness being lower than the firmness and sourness achieved in such a product without the addition of an oxidase.

The present invention is further illustrated in the following examples, which are not to be in any way limiting the scope of protection.

EXAMPLES

For the determination of the oxidase effect on firmness and sourness of a fermented dairy product, such as a yoghurt culture, the following examples were performed. Materials and procedure used were as stated below.

Materials

Culture prep.: DVS Thermophilic Lactic Culture, YC-350 (K) Package 50-U, Batch 5007571, a yoghurt culture from Chr. Hansen, Denmark 50 units diluted in 250 ml water 10 ml added/approx 180 ml milk

Enzyme prep: Microdochium nivale CBS 100236 (no 00720 MCO), 10 units/100 ml milk (For the definition of units reference is made to WO 99/31990).

The following milk samples were prepared: 1 Starter culture 2 Enz. no. 00720 MCO 3 Starter culture enz. no. 00720 MCO 4 Enz. no. 00720 MCO, heat treated after 30 min at 40° C., then addition of culture Procedure

A yoghurt was produced whereto enzyme was added during the fermentation. Firmness and taste evaluations were done and the achieved results are reported in examples 1 and 2, respectively. Full fat milk was heat treated at 90° C. for 5min, tempered to approx. 40° C. and the above enzyme and/or culture was added. The samples were allowed to ferment at 40° C. until pH 4.2 was reached. After 30 min enzyme reaction at 40° C. sample no. 4 was heat treated for 5min. at 90° C.

Example 1

Example 1 shows the effect of oxidase treatment on yoghurt firmness, comparing oxidase treated yoghurt with non-oxidase treated yoghurt.

Results

TPA (Texture Profile Analysis) was tested on a TA-XT2 Texture Analyser (Texture Technologies Corp, Scarsdale, N.Y.).

Parameters: 20 mm probe; 20% deformation; 2 sec. rest between each profile; 2 mm/sec pre test speed; 5 mm/sec post test speed

TABLE-US-00001 TABLE 1 Firmness (max force measured, N) Sample Test 1 Test 2 Standard no. Firmness Firmness Average deviation Starter culture 1 0.68 0.692 0.686 0.008 enz. no. 00720 2 0 0 0.000 0.000 MCO Starter culture 3 0.459 0.456 0.4580.002 enz. no. 00720 MCO enz. no. 00720 4 0.639 0.579 0.609 0.042 MCO heat treated after 30 min at 40° C. Then addition of culture

Discussion

The enzyme treated sample no 3 shows a substantially lower firmness than sample no 1, not being enzyme treated. Also sample no 4, where the enzyme has been heat treated before culture addition shows a significantly lower firmness than samplenol. The enzyme treated yoghurt no 3, though softer than the control, is able to hold its shape since TPA analysis requires the sample to have some defined shape.

Example 2

Example 2 shows the effect of oxidase treatment on yoghurt taste, comparing oxidase treated yoghurt with non-oxidase treated yoghurt.

301

Taste Evaluations

3 judges evaluated the 3 cooled yoghurts at day 7.

TABLE-US-00002 TABLE 2 Comments sample no. Judge 1 2 3 Judges 1 3 Sour liquid Less sour than no. 1. acetaldehyde Blue/sour smell

Discussion

The characteristic yoghurt taste (acetaldehyde) was less pronounced in the enzyme treated sample no 3. This application is a 371 of PCT/US00/33521, filed Dec. 11,2000.

1. Technical Field

This invention relates to milk products, processes for their preparation and use, particularly in cheese manufacture.

2. Background Art

A "milk protein concentrate" (MPC) is a milk protein product in which greater than 55%, preferably greater than 75% of the dry matter is milk protein and the ratio of casein to whey proteins is approximately that of milk. Such concentrates areknown in the art.

The term "milk protein isolate" (MPI) refers to a milk protein composition comprising a substantially unaltered proportion of casein to whey proteins wherein the dry matter consists of greater than 85% milk protein. Such isolates are known inthe art.

These products differ from milk concentrates in that they are high in protein and low in fat and lactose. They differ from skim milk concentrates in that they are high in protein and low in lactose.

One use for MPC and MPI is in cheese manufacture. By addition of these to increase the protein concentration of milk used in the manufacture of cheese, cheese making can be made more consistent and more efficient.

Using evaporation and drying, it is possible to obtain dried MPC and MPI. However these dried products suffer from the disadvantage that they are associated with the formation of "nuggets" in the cheese. Nuggets are thin protein gels of adifferent colour in the cheese. Nugget formation is consistently a problem when dried MPI with 85% dry matter as milk protein is used. Nugget formation occurs on some but not all occasions when a dried MPC with 70% dry matter as milk protein is used. These problems can be overcome by use of elevated temperatures after mixing the dried MPC or MPI with the milk. However, this adds an extra step to the cheese manufacturing process.

An object of the present invention is to prepare a dried milk protein product with a reduced tendency to cause nugget formation in cheesemaking relative to corresponding dried milk protein products of the prior art or at least to provide thepublic with a useful choice.

DISCLOSURE OF THE INVENTION

In one aspect, the invention provides a method of cheese manufacture comprising: (a) dispersing in milk a dried MPC or MPI having at least 70% dry matter as milk protein; (b) treating the resulting mixture with one or more coagulating enzymes toproduce a curd, and (c) processing the curd to make cheese; wherein the dried MPC or MPI is a calcium-depleted MPC or MPI and the extent of calcium depletion is sufficient to allow manufacture of substantially nugget-free cheese.

The extent of calcium-depletion required varies according to the protein content of the MPI or MPC. The higher the degree of calcium depletion required. For MPI having 85% dry matter as milk protein calcium depletion of 30 100% is required. Where the calcium depletion is only 25%, problems with nugget formation are present. By contrast if the protein content is 70% 80% of dry matter, a lower extent of calcium depletion is sufficient, for example 20% depletion.

In another aspect, the invention provides a method of cheese manufacture which includes the step of adding a 30 100%, preferably 40 100% more preferably 50 100% calcium depleted MPC or MPI powder to the milk

302

used as the starting material. Inparticular the invention provides a method of cheese manufacture comprising: (a) dispersing in milk a dried MPC or MPI having at least 70% dry matter as milk protein; (b) treating the resulting mixture with one or more coagulating enzymes to produce acurd, and (c) processing the curd to make cheese; wherein the dried MPC or MPI has calcium depletion of 30 100%.

In a further aspect the invention provides a method for preparing a dried MPC or MPI, product comprising: (a) providing an MPI or MPC having at least 70% dry matter as milk protein in aqueous solution/suspension; (b) removing a 30 100% of calciumions therein by a method chosen from at least one of (1) cation exchange on an ion exchanger in the sodium and/or potassium form (2) acidification to pH 4.6 6 with subsequent dialysis and/or ultrafiltration and/or diafiltration or (3) by addition of achelating agent; and/or binding a proportion of calcium ions with a chelating agent; (c) optionally mixing the product from step (b) with another milk solution while maintaining at least 30% calcium depletion; and (d) drying to prepare a dried product.

The term "cold solubility" or "cold soluble" refers to the property a product which on reconstitution into a 5% w/v solution at 20° C. provides less than 5% sediment on centrifugation for 10 minutes at 700 g.

The term calcium ions is used broadly and includes ionic calcium and colloidal calcium unless the context requires otherwise.

In another aspect the invention provides a method for preparing a dried MPC or MPI, product comprising: (a) providing an MPC or MPI, having at least 70% dry matter as milk protein in aqueous solution/suspension; (b) removing 40 100% of calciumions therein by a method chosen from at least one of (1) cation exchange on an ion exchanger in the sodium and/or potassium form, (2) acidification to pH 4.6 6 with subsequent dialysis and/or ultrafiltration and/or diafiltration or (3) by addition of achelating agent; and/or binding a proportion of calcium ions with a chelating agent; (c) optionally mixing the product from step (b) with another milk solution while maintaining the percentage calcium depletion in the range 40 100%; and (d) drying toprepare a dried product.

In another aspect processes analogous to those of the first two aspects are used but the starting material is a milk-derived solution containing casein and whey proteins in which whey proteins comprise 5 60% of the protein.

In those embodiments in which calcium removal is by acidification and subsequent dialysis and/or ultrafiltration and/or diafiltration, the pH is adjusted to be in the range 4.6 6, preferably 4.8 5.5. The membrane chosen generally has a nominalmolecular weight cut off of 10,000 Daltons or less. A preferred ultrafiltration membrane is a Koch S4 HFK 131 type membrane with a nominal molecular weight cut off at 10,000 Daltons. The adjustment of the pH may be made with any acid suitable foradjusting the pH of a food or drink eg, dilute HCl, dilute H2SO.sub.4, dilute acetic acid, dilute citric acid, preferably dilute citric acid.

When the calcium removal is by way of addition of a chelating agent, preferred chelating agents for use include citric acid, EDTA, food phosphates/polyphosphates, food acidulants, tartaric acid, citrates and tartrates. The preferred chelatingagents are food acidulating agents. Preferably the chelating agents are used in conjunction with dialysis and/or ultrafiltration and diafiltration.

The preferred cation exchangers are based on resins bearing strongly acidic groups, preferably sulphonate groups.

A preferred strong acid cation exchange resin for use in this and other embodiments of the invention is IMAC HP 111 E manufactured by Rohm & Haas. This resin has a styrene divinylbenzene copolymer matrix. The functional groups are sulphonicacid groups that can be obtained in the Na.sup. form or alternatively converted to the K.sup. form. The use of the Na.sup. or K.sup. form is preferred.

By manipulating the pH and the choice of sodium or potassium or a mixture of both, it is possible to vary the flavour of the product. For some circumstances it will be useful also to provide micronutrient cations in addition to sodium orpotassium.

One cation preferred for the use with sodium and/or potassium is magnesium.

The liquid product obtained at the end of step (d) or (c) may be dried by standard techniques including thermal falling film evaporation and spray drying. Drying may be preceded by dewatering.

The use of strong acid cation exchangers is preferred because with weakly acidic cation exchangers,

303

phosphate is also removed which lowers the nutritional value of the product. The product has particular advantages at high percentage protein (eg85%) in its relatively high solubility in cold water, milk and other aqueous solutions. This enables it to be stored in the dry form and then be reconstituted by addition of water then required for use in the liquid state. The reconstituted materialdoes not sediment out in the same manner as occurs with dried MPC and MPI without calcium depletion at higher percentage protein after storage. This provides advantages not only in cheese manufacture but also in other applications.

In another aspect the invention provides a method for the manufacture of cheese using calcium-depleted MPC or MPI prepared by the method of these aspects of the invention. The advantages of higher protein concentration in cheese manufacture areobtained but the problem of formation of "nuggets" is avoided.

The MPC or MPI applied to the cation exchanger preferably has the a pH in the range 5.6 7.0, more preferably 5.6 6.2. Once the MPC or MPI has passed through the column, its pH increases. If it increases above 7.0, it will generally be adjustedto about 6.5 7.0 to make it more palatable.

Cation exchange is the preferred method for removing calcium.

In another embodiment the invention provides a 30 100% calcium depleted MPI or MPC powder having at least 70% by weight of protein. Throughout the range of calcium depletion the powders are useful for preparing nutritional drinks and have theadvantage of superior solubility after storage relative to MPC or MPI powders which have no such calcium depletion particularly after storage.

In a preferred form of this embodiment of the invention, the MPC or MPI powder has 40 100%, preferably 50 100% calcium depletion wherein the calcium is substituted by sodium and/or potassium. These MPCs and MPIs have advantages in avoidance of"nugget" formation when added to milk to be used to prepare the cheese in contrast to the nugget formation observed with prior art MPCs and MPIs are used. A blend of dried MPC or MPI with 30 100% calcium depletion and whole milk powder may usefully beused for cheese making.

In a further preferred embodiment the invention provides a method of preparing a dried MPC or MPI comprising: (a) providing a low fat milk solution, for example skim milk, in liquid form; (b) removing 30 100% of calcium ions therein by a methodchosen from at least of (1) cation exchange on an ion exchanger in the sodium and/or potassium form, or (2) acidification to pH 4.6 6 optionally with subsequent dialysis; (c) optionally mixing the calcium-depleted milk with another milk solution whileretaining the percentage calcium depletion in the range 30 100%; (d) concentrating the solution obtained by ultrafiltration, optionally with diafiltration, to form an MPI or MPC having at least 70% dry weight as protein; and (e) drying to prepare a driedproduct.

In one variation the MPC or MPI formed at step (d) is mixed with an MPC or MPI of different percentage calcium depletion while retaining percentage calcium depletion in the range 30 100% before drying.

This method differs from the previously described method in that the material undergoing cation exchange is not an MPC or MPI, but is subsequently converted to be one in a step following the ion exchange.

The use of the cation exchange method is preferred.

Again the use of strong acid cation exchangers in preferred. The product is useful in the same applications as described above, including provision of a nutritious drink and use in addition to milk prior to cheese manufacture.

Likewise variations such as the preferred substitution of calcium by sodium or potassium or a mixture thereof are equally applicable in this aspect.

The ion exchange steps are preferably carried out at 4 12° C., but may be carried out at temperatures as high as 50° C.

The MPC and MPI products have the property of good stability on storage. This can be demonstrated by observation of the retention of good cold solubility on storage. 

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 is a schematic drawing of a process for preparing dried calcium

304

depleted MPI.

FIG. 2 shows the percentage solubility at 20° C. and 5% (w/v) in water of four dried MPI samples stored at (A) 20° C. and (B) 40° C.

FIG. 3 shows the percentage solubility at 20° C. and 5% (w/v) in water of two calcium-depleted MPC samples and control where calcium depletion was by low pH diafiltration.

EXAMPLES

The following Examples further illustrate practice of the invention.

Example 1

Preparation of Dried Calcium Depleted MPCs by Ion-Exchange

As illustrated in FIG. 1, skim milk is subjected to concentration on an ultrafiltration (or a microfiltration) membrane (Koch S4 HFK 131 type membranes having a nominal molecular weight cut-off of 10,000 daltons) to produce an MPC retentate. Depending on the concentration factor used, the MPC retentate will have a protein content in the range of 42 85% of the dry matter is milk protein.

For example when a skim milk of 1000 kg of concentration given in Table 1, is concentrated by 2.5 times, 400 kgs of MPC56 retentate and 600 kgs of permeate will be obtained.

A part of the 400 kg MPC56 retentate, which had a pH of 6.8 was reduced to 5.9, using 3.3% citric acid. The acid was added to the retentate at 10° C., while continuously agitating the retentate. For example, to produce 50% Ca-depletedMPC56, 200 Kg of the retentate was pH-adjusted to 5.9. After fifteen minutes, the pH of the retentate was measured again. Depending on the buffering capacity of the retentate, the pH of pH-adjusted retentate increases by 0.1 to 0.15 units. The pH wasadjusted again to 5.9 with some more 3.3% citric acid.

The 200 kg of MPC56 retentate contains 0.26% of calcium or a total calcium content of 530 g of calcium. To remove all this calcium approximately 70 L of strong cation-exchange resin in the sodium form was used. The resin was an IMAC HP 111 E, astrong acid cation exchange resin with a total exchange capacity of 2 eq/L of sodium. The resin is manufactured by Rohm & Haas and has sulphonic acid functional groups.

The resin was loaded into a stainless steel vessel of about 40 cm in diameter and a height of 110 cm or a total volume of 140 L. Seventy litres of the resin bed had a height of 55 cm. The 200 kg of the retentate was then passed through the resinat 2 bed volume an hour or 140 L/h. To process 200 kg of the retentate takes about one-and-a-half hours. The resulting retentate had about 0.005% of calcium and a pH of about 7.1. The calcium-depleted MPC56 was mixed with untreated MPC56 in equalproportions to produce a retentate containing 0.13% calcium. This retentate was then evaporated and dried to produce an MPC56 powder containing 0.8% calcium. The composition of the powder is shown in column A of Table 2. Evaporation is preferablycarried out at pH 6.4.

If an MPC70 or an MPC85 retentate is used as a feed stream instead of MPC56 retentate, then Ca-depleted MPC70 and MPC85 of the compositions given in columns B and C respectively Table 2 below can be produced. MPC 70 and MPC 85 retentates arediluted prior to passage through the ion-exchange column:

TABLE-US-00001 TABLE 1 Milk Composition Component Skim Milk (%) Ash 0.76 Lactose 5.17 Fat 0.06 Casein Protein 2.88 Whey Protein 0.58 Total Protein 3.67

TABLE-US-00002 TABLE 2 Compositions of Milk Protein Concentrates MPC A B C Total protein 56 70 85 Ash 7 9 7 9 6 8 Lactose 28 30 14 16 <5 Fat 0.9 1.1 1.5 1.6 >1.7 Calcium 0.8 0.9 1.1 Sodium (%) 2.0 2.1 2.4

All these MPCs are shown to have high cold solubility at the start as well as after storage. In contrast, the MPC made without ion-exchange process had a low cold water solubility which reduced to below 50% on storage.

The ion exchange resin when exhausted can be regenerated by passing 2 3 bed volumes of 2 molar NaCl solution. The eluate contains a high level of soluble calcium derived from exchange from the retentate.

305

Example 2

Solubility

Four dried MPI samples with 85% milk protein were tested for solubility after storage over a period of time. For each a 5% w/v solution was prepared in water after 1, 6, 15, 22 and 36 days. After reconstituting into a 5% w/v solution at20° C., the solutions were centrifuged for 10 minutes at 700 g. The results are shown in FIGS. 2A and 2B. The three calcium depleted samples (33%, 50% and 83% depletion) stored at 20° C. all showed approximately 100% solubility on eachoccasion. The control dried MPI samples showed about 70 80% solubility on days 1 6 and this declined to about 50% by days 15 to 36. Similar results were obtained with storage at 40° C.

Example 3

Cheese Preparation

Four MPC samples with 85% milk protein were tested in cheese making. 3.6 kg of fresh skim milk containing 3.55% protein and 0.05% fat was the starting material. Fresh cream (400 grams) was added under medium shear to the fresh skim milkpreviously brought to 32.5° C. The resulting milk solution contained 3.42% protein and 4.36 fat as determined by Milkoscan Analyses.

The milk solution was divided into four batches. To each batch a different MPC containing 85% protein was added. One batch received control MPC with no calcium depletion. The reconstitution temperature was 6.5 8.5° C. The other threebatches received calcium depleted MPCs each with 85% protein. The calcium depletion was 25%, 50% and 98%. The reconstitution was carried out at a temperature of 6.5 8.5° C. for the 33% calcium depleted MPC. For the 50% and 98% calcium depletedMPCs a temperature of 4.5 6.0° C. was used.

All powders dispersed into the milk well. No problems were noticed with powders lumping, not wetting or floating on top of the milk. The pH of all the reconstituted milks were similar pH between 6.5 and 6.7 when measured at 32.5° C.

Cheese manufacture was by a standard cheddar process. The rennet used was Australian DS.

After two days the cheese preparations were examined. In the four cheese preparations to which control MPC and 25% calcium depleted MPC had been added, many large grey translucent nuggets were obvious. No nuggets were observed for thosepreparations to which 50% calcium depleted MPC or 98% calcium depleted MPC had been added.

Observations made during the cheese making steps showed that the starters performed excellently in all the re-constituted milks and that the pH changed from 6.66 to pH 6.54 over the 15 minute incubation.

Except for the preparation to which 98% calcium depleted MPC had been added all preparations developed a coagulum at 40 minutes after rennet was added. No coagulum was formed with the 98% calcium depleted MPC sample until calcium (0.05%) wasadded. The coagulum with 50% calcium depleted MPC was fragile however the fragile curd firmed up well as cooking began. It was observed that the curd in the vat with 98% calcium depleted MPC cooked much faster than the rest. For all four samples thecooked curd character was excellent.

Whey casein, protein, fat, TS, a-lac, b-lg, BSA and Gmp were measured for each sample. No differences were identified between the wheys and at separation all the whey samples looked similarly turbid.

None of the curds presented any problems during the salting and pressing steps. The calcium depleted MPC powders support formation of nugget free cheddar cheese in the laboratory with powders having more than 25% calcium depletion beingrequired.

Example 4

Preparation of Cold Soluble MPC by low pH Diafiltration

Skim milk is subjected to concentration on an ultrafiltration membrane (Koch S4 HFK 131 type membranes

306

having a nominal molecular weight cut-off of 100,000 daltons) in the following way.

About 150 liters of skim milk is concentrated until the total solids in the retentate is about 15% to give about 50 L of retentate and 100 L of permeate. The protein in the retentate is further concentrated using continuous diafiltration, untilthe permeate solids were about 1.5%. The retentate was then pH-adjusted using 55 sulfuric acid to a pH below 5.8. The pH below 5.8. The pH-adjusted retentate is again continuously diafiltered with water (preferably demineralised) until the permeatesolids concentration reaches below 0.1%. The final retentate is then neutralized using 5% NaOH solution to a pH of 6.7 and then it was dried to produce MPC powder of the composition given in Table 3. Depending on the pH of the acidification, thecalcium in the final product can be reduced by 30% at pH=5.8 and about by 45% at pH=5.4.

TABLE-US-00003 TABLE 3 Composition of Milk Protein Concentrate of Example 4 Fat Moisture Protein Lactose Calcium pH of % w/w % w/w % w/w % w/w % acidification 2.97 4.59 86.13 0.26 1.3 5.8 2.09 3.98 88.682 0.13 1.9 control 2.16 3.66 88.682 0.271.0 5.6

The MPC powders were stored at 40° C. for many weeks and their solubilities are monitored. FIG. 3 clearly shows that the solubility of MPCs, which had undergone acid diafiltration, maintained their initial solubility, whereas thecontrol, made without the acid diafiltration, had a continuously reducing solubility.

Example 5

Cheese Preparation using MPC70

Four MPC samples with 70% milk protein were tested in cheese making. Cheese milk with a fat to protein of 1.2 was prepared by standardising fresh, fortified skim milk with fresh cream. Normally, 1 part cream was added to 7 parts milk. Thecream (at 30° C.) was added to the milk (also at 30° C.) under medium shear.

The standardised milk was divided into four batches. A different MPC containing 70% protein was added to each batch. Three batches received commercial MPCs with no calcium depletion. One batch MPC with 70% protein and 20% calcium depletion (bycation exchange). The reconstitution was carried out at a temperature of 1 8° C.

All powders dispersed into the milk well. No problems were noticed with powders lumping, not wetting or floating on top of the milk. The pH of all the reconstituted milks were similar and between 6.4 and 6.5 when measured at 32.5° C.

Cheese manufacture was by a standard cheddar process. Calcium chloride was added to all batches at a rate of 0.2 g/L of milk. The rennet used was Australian DS.

The cheese preparations were examined after being pressed overnight at 5° C. In the three cheese preparations to which commercial MPCs containing 70% protein had been added small, grey translucent nuggets were obvious. No nuggets wereobserved in the cheese preparation to which 20% calcium depleted MPC had been added.

Example 6

Cheese Preparation using Low pH UF MPC 85

Three MPC samples with 85% milk protein were tested in cheese making.

Cheese milk with a fat to protein ratio of 1.2 was prepared by standardising fresh, fortified skim milk with fresh cream. Normally, 1 part cream was added to 7 parts milk. The cream (at 30° C.) was added to the milk (at 30° C.)under medium shear.

The standardised milk was divided into three batches. A different MPC containing 85% protein was added to each batch. One batch received a control MPC with no calcium depletion. The other two batches received calcium depleted MPCs with 85%protein prepared as described in Example 4. Calcium depletion was effected by ultrafiltration at low pH. The levels of calcium depletion were 33% and 46%. The reconstitution was carried out at a temperature of 18° C.

All powders dispersed into the milk well. No problems were noticed with powders lumping, not wetting or floating on top of the milk. The pH of all the reconstituted milks were similar and between 6.4 and 6.5 when

307

measured at 32.5° C.

Cheese manufacture was by a standard cheddar process. Calcium chloride was added to all batches at a rate of 0.2 g/L of milk. The rennet used was Australian DS.

The cheese preparations were examined after being pressed overnight at 5° C. In the cheese preparation to which the control MPC had been added many medium-sized, grey translucent nuggets were obvious. No nuggets were observed in thecheese preparations to which the 33% or the 46% calcium depleted MPC had been added.

Example 7

Cheese Preparation using Calcium-Chelated MPC 85

Two MPC samples with 85% milk protein were tested in cheese making.

Cheese milk with a fat to protein ratio of 1.2 was prepared by standardising fresh, fortified skim milk with fresh cream. Normally, 1 part cream was added to 7 parts milk. The cream (at 30° C.) was added to the milk (also at 30° C.) under medium shear.

The standardised milk was divided into two batches. A different MPC containing 85% protein was added to each batch. One batch received a control MPC with no calcium depletion. The other batch received an MPC with 85% protein to which EDTA hadbeen added during manufacture (83 g EDTA per Kg MPC). According to calcium analyses, the EDTA sequestered 10% of the calcium. The reconstitution was caried out at a temperature of 18° C.

All powders dispersed into the milk well. No problems were noticed with powders lumping, not wetting or floating on top of the milk. The pH of all the reconstituted milks were similar and between 6.4 and 6.5 when measured at 32.5° C.

Cheese manufacture was by a standard cheddar process. Calcium chloride was added to all batches at a rate of 0.2 g/L of milk. The rennet used was Australian DS.

The cheese preparations were examined after being pressed overnight at 5° C. In the cheese preparation to which the control MPC had been added many medium-sized, grey translucent nuggets were obvious. A few, small nuggets were observedin the cheese preparation to which the EDTA-treated MPC had been added. The number and size of the nuggets observed was an expected for a 10% calcium depleted-MPC with 85% protein. It is believed that increasing the extent of calcium depletion to 30%would have eliminated the nugget problem entirely.

General

Observations made during the cheese making steps showed that the starters performed excellently in all the re-constituted milks.

All preparations developed a coagulum at 40 minutes after rennet was added. The cooked curd character was excellent for all samples. None of the curds presented any problems during the salting and pressing steps.

CONCLUSIONS

The calcium depleted MPC powders with 85% protein support formation of nugget free cheddar cheese in the laboratory with powders having more than 30% calcium depletion being required.

The calcium depleted MPC powders with 70% protein support formation of nugget free cheddar cheese in the laboratory with powders having more than 20% calcium depletion being required.

The above examples are illustrations of the practice of the invention. It will be appreciated by those skilled in the art that the invention can be carried out with numerous modifications and variations. For example, the material subjected tocalcium depletion can show variations in protein concentration and pH, the method of calcium depletion can be varied, the percentage calcium depletion and drying procedures can also be varied.

308

BACKGROUND OF THE INVENTION

The present invention relates to food products and to methods of their preparation. More particularly, the present invention relates to dried foods infused with inulin especially fruit and to their methods of preparation.

The present invention provides further improvements into dried infused foods especially fruits.

Drying wet foods such as fruits vegetables and meats for preservation has been practiced from ancient times. In modern technical terms, such products are dried to water activity values ("Aw") such s below 0.5 in order to provide driedfruits that are shelf stable at room temperatures. Dried fruits are commonly added to dry packaged food products such as dry mixes for layer cakes, muffins or pancakes, to trail mixes comprising mixtures of nuts, cereal pieces, to granola or cerealbars, and especially to Ready-To-Eat ("RTE") cereal products such as corn or wheat flakes. Bran flakes with raisins are well known.

However, such packaged food products are typically dry products having very low water activity values. RTE cereals, for example, often have water activity values of 0.2 or lower. It is a well known problem that moisture equilibration over timein dry packaged food products with added dried fruits dried to only a 0.5 water activity level can involve moisture transfer from the less dry fruit to the more dry food products. This moisture migration tends to further dry and thereby toughen thefruit, even those that are sugar infused. Also, the moisture increase in the packaged food can lead to its loss of freshness or crispness. In severe case, mold or other decay can occur.

To overcome such moisture migration problems, dried fruits can be dried more to equivalent moisture activity values. However, drying fruits to very low water levels indicated by low water activity values, e.g., below 0.3, to avoid moistureequilibration with dried cereal generally result in such dried fruits being extremely tough and leathery and thus difficult to consume.

In another approach to drying to low water activity values and/or to moderate the problems of fruit moisture loss and food product moisture gain, dried fruits have been infused with sugars and to provide sugar infused dried fruits.

Of coarse, infusing sugars such as honey into fruits, e.g., dates, prior to drying has been practiced from ancient times to lower the water activity while providing dried fruit products that are softer in texture. More recently, refined sugarssuch as sucrose, fructose and dextrose or corn syrups have been used to infuse dried fruits. (See, for example, U.S. Pat. No. 4,542,033 "Sugar and Acid Infused Fruit Products and Processes Therefor" issued Sep. 17, 1985 to Agarwala)

In variations dried infused fruit products has often involved fortifying the infusion solution with a humectant such as a polyhydric alcohol, usually glycerol, to improve the texture properties of such infused dried fruits.

While sugar and/or glycerin infused dried fruit products are well known and commonly added to dried food products such as RTE cereals, such products are not without longstanding problems. For example, some consumers find such sugar infusedfruits excessively sweet. Also, many consumers are sensitive to the taste of glycerol and complain of bitterness at higher glycerin levels.

Infusion methods generally involve steeping the fruit in concentrated infusion solutions over time often at elevated or boiling conditions and thereafter drying the infused fruits. Much effort has been directed at decreasing the infusion ordrying times, minimizing the waste or degradation of the spent infusion solution, the overall complexity and cost of drying and infusion operations as well as improving the texture or eating qualities of the infused fruit.

While fresh and dried fruit products provide high levels of nutrition and consumers are often recommended to increase their consumption of fresh fruit, neither fresh fruits nor dried fruits are excellent sources of fiber.

Thus, there is a continuing need for new and improved infused dried food products especially fruit that can be dried to water activity levels compatible with dry packaged food items that are not excessively tough, sweet nor burdened with thetaste of conventional humectants as well as their methods of preparation.

Thus, there is a continuing need for new and improved products that provide high levels of nutritionally desirable fiber and that provide desirable eating qualities.

309

Surprisingly, the present invention provides improvements in the provision of infused dried food products such as fruits by selecting inulin of a particular molecular weight, an oligosacharide, for infusion into fruits and drying to desiredmoisture levels. More surprisingly, such inulin infused dried food products are characterized by increased levels of fiber of a remarkable palatability. Such inulin infused dried fruits find particular suitability for use for addition to low wateractivity dry packaged food products such as RTE cereals. Also, methods for preparing such inulin infused dried fruit products are commercially practical and can employ commonly available apparatus and techniques.

More surprisingly, combining inulin infused dry fruit provides a convenient technique for increasing the fiber level of common food products that consumers expect to comprise dried fruits especially Ready-to-eat cereals.

Formulating ready to eat cereal products with inulin as well as topical application of inulin to a cereal coating is know (See, for example, U.S. Pat. No. 6,149,965 "Cereal Products With Inulin And Methods Of Preparation" issued Nov. 21, 2000to Larson). However, such fortification is not without difficulties. Addition of inulin to a cooked cereal dough from which dried ready-to-eat cereal products are fabricated can result in a cereal dough that is sticky and difficult to process incommercial cereal product manufacturing. Topical addition of inulin to RTE cereal products can result is a coated cereal that is hygroscopic. Surprisingly, providing inulin infused dried fruit provides a convenient technique for providing high levelsof fiber in an RTE cereal that minimizes the dough handling and hygroscopic problems of inulin addition to RTE cereals. The properties of the non or limited inulin bearing cereal base can remain unchanged. Also, by adding the inulin as part of ablended component to cereal base rather than in the cereal base, the manufacturing problems associated with handling a high inulin level cooked cereal dough can be minimized.

BRIEF SUMMARY OF THE INVENTION

In its product aspect, the present invention resides dried foods infused with inulin. Such products are characterized as food pieces having a water activity ranging from about 0.15 to 0.75. The foods can comprise about 1% to 30% inulin. Theinulin has a D.P ranging from about 2 9.

In its method aspect, the present invention is directed to methods of preparing dried inulin infused fruit products. The process comprises the steps of: providing a quantity of uncommunited food pieces having a moisture content ranging fromabout 40% to about 95%; infusing the food pieces with an inulin wherein the inulin has a degree of polymerization ranging from about 2 9 to form an at least partially inulin infused food piece; and. drying the inulin infused food piece to a finish wateractivity ranging from about 0.4 to 0.55. 

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to dried food product infused with inulin characterized by high inulin levels and to methods of their preparation and use. Each of the product components as well as product use and attributes and methods of theirpreparation are described in detail below.

Throughout the specification and claims, percentagages are by weight and temperatures in degrees Centigrade unless otherwise indicated. Each of the referenced patents and applications are hereby incorporated by reference.

While the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment, it is to be understood that the invention is not to be limited to the disclosed embodiment, but on thecontrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

The present invention provides dried food products infused with inulin or other non-digestible short chain carbohydrates with a low molecular weight and a high water-binding capacity. The dried products are characterized by a water activityvalue ranging from about 0.15 to 0.75, preferably about 0.4 to about 0.55, in certain embodiments more preferably about 0.45 to about 0.55.

The dried food products can be selected from the group consisting of fruits, garden vegetables, meats, and mixtures thereof. The present invention finds particularly suitability for use in the provision of dried fruit products especially driedwhole fruit pieces or slices of whole pieces. While any fruit can be employed, conveniently the fruit pieces can be of apple, apricots, avocado, banana, blueberries, cherries, cranberries, dates, kiwi, mango, pineapple, raisins, raspberries,strawberries, tomatoes, and mixtures thereof. Preferred for use herein are fruit selected from the group consisting of apple, blueberries, cherries, cranberries,

310

raisins, raspberries, strawberries, and mixtures thereof. Preferred whole fruit piecesinclude apples, blueberries, cherries, raisins, cranberries raspberries, and mixtures thereof. In other variations, infused dried blends of fruits and vegetables, such as of tomato's or onion or peppers or mixtures can be used to provide fiber to thoseproducts typically characterized by low fiber levels, e.g., frozen pizza, or picante sauce (seasoned tomato/onion/sweet pepper sauce) or meat or sauce filled products, e.g., pocket sandwiches, pizza rolls, ravioli, tortellini, etc.

Common garden vegetables include, for example, beans (green, waxy-yellow, fava, chick pea, red, dark red, pinto, etc.), beets, carrots, cucumber, sweet corn, celery, onion, mushroom, peppers (whether sweet or bell peppers or hot or chilipeppers), peas, potatoes, squash and mixtures thereof.

Suitable meats include common domestic food animals including beef, bison, chicken, duck, goose, lamb, pork, rabbit, as well as various common or exotic game meats including bear, deer, elk, pheasant, wild foul, moose and the like. The presentinvention finds particular suitability for use in connection with brine or cured meat products such as corned beef or ham. Fish pieces and fish fillets are also contemplated herein especially shrimp.

While in the balance of the present description particular attention is paid to dried infused fruit products, the skilled artisan will appreciate that the invention is suitable for use in the provision of dried infused food products using gardenvegetable or meat products. In the preferred embodiment, the present infused fruit pieces are characterized in part by retention of their native structure at least in part, i.e., are un-comminuted. Thus, the present dried whole fruit or piece fruitproducts are to be distinguished in the preferred embodiment from fabricated food pieces prepared from fruit purees or juices that included added materials including structuring agents and regardless of the shape of form of such fabricated fruit pieces. Likewise, the vegetable or meat products are in the form of individual pieces, e.g., whole peas or even whole pea pods, corn although pieces, e.g., beet slices or cubed carrots, are also contemplated. In less preferred embodiments, dried piecesfabricated from comminuted meats, e.g., sausage or vegetables, e.g., refried beans can be prepared by simple admixture with powdered inulin or inulin in solution form followed by dehydration and piece forming (or reversed).

The dried food products are also characterized by inulin levels ranging from about 1% to about 45%, preferably about 15% to 40% and for best results about 20% to 35%. The inulin levels include both native and infused or added inulin. However,as a practical matter, substantially all the measurable inulin in a particular infused dried fruit piece of common fruits will be the result of infusion.

Inulin is major constituent of some of the most famous of the "old-standby" herbs, such as burdock root, dandelion root, elecampane root, chicory root (Cichorium intybus), and the Chinese herb codonopsis. Botanically, inulin is a storage food inthe plants of the Composite family. The term "inulin" can be used to describe a wide variety of food ingredients most commonly derived from Chicory or Jerusalem artichokes. Inulin regardless of source can also be defined in part by molecular weighttypically characterized in terms of degree of polymerization. Generally, inulin is extracted from plant sources high in inulin levels typically by hot water extraction. Inulin is composed of linear chains of fructose molecules varying in length from 260 units. These chains are connected by beta (2-1) linkages and are often terminated by a glucose unit. Due to these linkages, inulin is not digested and therefore possesses a number of unique nutritional properties. Inulin is one of few known solubledietary fibers materials. Besides being a beneficial dietary fiber, inulin is considered a probiotic because it stimulates beneficial bifidobacteria in humans.

Useful herein as the inulin ingredient for infusion is that relatively low molecular weight inulin material characterized by a degree of polymerization ("DP") value ranging less than or about 9 (i.e., "DP)</=9"). Such materials includeoligofructose, a subgroup of inulin. Among all inulin materials, such low molecular weight inulin materials are selected herein due to their relative osmotic superiority compared to otherwise similar but to higher molecular weight inulin materials. Dueto their osmotic superiority, higher levels of inulin can be infused. Also such inulin ingredients are prepared by isolation of such low DP constituents from blends of higher and lower inulin or by partial enzymatic hydrolysis. When provided by partialenzymatic hydrolysis the resulting material is sometimes referred to as Oligofructose. Oligofructose typically has a DP ranging from about 2 7. Such materials are commercially available such as is available from Orafti Active Food Ingredients under thetrade name of RAFTILOSE. The inulin can be supplied in the form of a liquid solution comprising about 50 95% oligofructose (dry weight basis), and the balance sugars glucose, fructose and sucrose in varying combinations. In other preferred embodiments,the inulin can have a DP ranging from about 5 9.

While in the preferred embodiment, the present dried fruit products are infused with inulin, especially

311

oligofructse, inulin ingredient can be substituted in whole or in part with other non-digestible short chain carbohydrates with a lowmolecular weight and a high water-binding capacity. The ingredient are useful in producing "infused" fruits which have a reduced Aw, enhanced eating characteristics (moistness) and greatly elevated levels of soluble fiber. By low molecular weigh ismeant having a molecular weight ranging from about 8 to 800. By non digestible is meant that less than 10% of the material is typically metabolized.

The inulin infused dried fruit products can additionally comprise about 1% to about 40% by weight of a liquid humectant such as glycerin, propylene glycol and mixtures thereof. Glycerin infused dried fruits are beneficially characterized by asofter eating texture. However, infusion of glycerin can result in lower levels of inulin and in the dried infused fruit products.

In less preferred variations, the dried infused fruit products can comprise about 1% of about 15% of low molecular weight or common sugars such as sucrose, fructose, glucose and alike. Likewise, infusion with such low molecular weight commonsugars provide certain cost advantages since such is common simple sugars are much less expensive than inulin. However, such sugars infused dried fruit products will tend to have lower levels of inulin.

In certain preferred embodiments, the dried fruit products are infused with inulin alone. In other embodiments, the weight ratio of infused inulin to glycerin ranges from about 1:1 to about 3:1, preferably about 2:1. Such inulin-to-glycerinratios provided balance between the fiber benefits of inulin balanced with the eating qualities and texture of glycerin.

The dried products of the present invention will have levels of salt due to their native salt content. In preferred embodiments, especially for dried infused fruit products, the infusion solution is free of added salt (sodium chloride and/orpotassium chloride). However, for some dried infused food products, e.g., infused, dried meat products, for brine cured products or for vegetable products, the infusion solution can additionally comprise 0.1% to 25%, preferably 1% 8% salt. The salt canbe added for flavor or to reduce costs or to reduce the extent of post infusion drying required to provide finished dried products of desired water activity levels. However, the skilled artisan will recognize that salt addition to the infusion solutioncan result in some diminution of the added fiber content of the fished dried product by reducing the inulin concentration in the infusion solution.

The infusion solution can additionally comprise a variety of minor adjuvant materials to improve the appearance, taste or nutritional properties of the finished dried infused products herein. These adjuvant materials can include vitamin and/ormineral fortification, colors, flavors, high potency sweetener(s), preservatives and mixtures thereof. The precise ingredient concentration in the present dried composition will vary in known manner. Generally, however, such materials can each compriseabout 0.01% to about 2% dry weight of the finished dried infused product. One especially useful material is an acidulant such as an edible organic acid such as citric, tartaric, malic and mixtures thereof. High potency sweeteners, especially sucraloseand potassium acetylsulfame and mixtures thereof, can be added.

In preferred embodiments, especially those prepared from comminuted purees are preferably low in added grain or cereal ingredients such as flours or cereal grain starch derived ingredients such as corn starch. By low herein is meant less than 5%(dry weight basis) and preferably less than 1%.

The inulin infused dried fruit products of the present invention are useful foods per se and provide high levels of fiber provided by the inulin in addition to the other nutritional qualities of dried fruit. The dried fruit products can be usedas snack food products.

Also, while the present invention is directed in particular to un comminuted or whole fruit or vegetable pieces, the skilled artisan will appreciate that dried fruit pieces fabricated from a fruit pulp or puree formulated with equivalent levelsof inulin can also be prepared and usefully added as particulates. If desired, meat products such as sausages can also be prepared. In still other variations, fabricated seafood pieces can be fabricated from comminuted fish flesh or surimi.

In addition, these infused fruits will have a relatively reduced caloric due to their high inulin content and reduced sugar concentration.

Also, the present inulin infused dried fruit products find suitability for use as an ingredient in a wide variety of composite food products. Such composite food products can be in solid, plastic or semisolid form. In solid form, the productscan be in particulate form or in the form of a mass. For example, the present infused dried fruit products find particular suitability for use for inclusion as a functional food ingredient in ready to eat

312

cereals. Such ready to eat cereals are foodproducts in particulate solid form especially in is in the form of flakes, puffs, shreds, biscuits and mixtures thereof. The cereal base or portion can be a conventional cereal base piece with or without added inulin fortification or the cereal basepiece itself. Since inulin fortification to cereal base pieces can impair either finished product eating qualities or the ease or processing or making of such pieces, it is an advantage of the present invention that regular or unaltered or unfortifiedcereal base pieces can be employed with their desirable eating characteristics with the desired level of inulin fortification being provided by or at least in part by the present inulin infused dried fruit particulates.

Such composite food products can also be in the form of a mass, e.g., a cereal bar. The dried fruit pieces can be admixed with the cereal and formed into a bar such as with a binder. In other variations, the bars can include a separate layer orregion including the fruit pieces. The dried infused fruit pieces can be admixed, if desired with an unfortified or inulin bearing fruit paste or puree. Good results are obtained when the dried infused food product comprises about 1% to about 40%,preferably about 15% to about 35% of the ready to eat cereal while the cereal particulates or cereal base comprises about 60% to about 99% of the product. Other typical ready to eat cereal ingredients such as nut pieces, dried marshmallow pieces can beadditionally admixed with the blend of the present inulin infused dried fruit products and ready to eat cereal base.

In particular, the present infused dried fruit products can be admixed with a ready-to-eat cereal base to provide a blended product that provides high levels of fiber due to the inulin ingredient in the dried infused fruit. The cereal base canbe unfortified with inulin or can itself contain additional inulin to supplement that provided by the inulin infused fruit. Since consumers are already familiar with ready-to-eat cereals containing dried fruits, the present resulting blended fruit andcereal products will be familiar to consumers notwithstanding their higher levels of inulin. In certain embodiments, the cereal base will not be fortified with inulin and the cereal base can provide its familiar organoleptic properties. Also, nospecial cereal manufacturing is needed to prepare the base. In other variations, the cereal base can include modest levels of inulin fortification such as by topical application of inulin in a coating such as a sugar coating.

In other variations, the present inulin infused dried fruit products in piece form can be added to a variety of other shelf stable food products such as dry mixes for baked goods, snack or trail mixes (of pretzels, nuts, cereal pieces, driedmeats pieces, and mixtures thereof. For inulin infused vegetables, the dried pieces can be added to a variety of dried or shelf stable dry mixes to provide finished cooked products with higher fiber levels. For example, dried inulin infused vegetablescan be added to dry mixes for soups or to add-meat dinner dry mixes.

The present infused dried fruit products also find suitability for use for inclusion into a wide variety of dairy products both refrigerated and frozen. For example, the present infused dried fruit products can be added to the yogurt to provideproducts that not only provide the nutrition and taste appeal of fruit but also provide high levels of fiber without the adverse impacts on yogurt flavor and extension of yogurt fermentation times from the addition of fiber sources to the yogurt base. Also, the present inulin infused dried fruit products can be added to a variety of aerated frozen dairy products such as ice cream or soft serve frozen dairy products. The presence inulin infused dried fruit products can be added to other nondairyfrozen especially aerated frozen desserts such as sorbets. Good results are obtained when the added dried fruit comprises about 1% to about 35%, preferably about 10% to 30% of the dairy products.

METHOD OF PREPARATION

The present invention further provides methods for preparing such inulin infused dried food products. The methods comprise the steps providing a quantity of uncommunited food pieces having a moisture content; infusing the food pieces with aninulin wherein the inulin has a degree of polymerization ranging from about 2 9 to form an at least partially inulin infused food piece; and, in the preferred form, drying the inulin infused food pieces to a finish water activity ranging from about 0.4to 0.75 to provide a dried inulin bearing food pieces

In the preferred embodiment, in the first step the starting food product is in the form of discreet pieces, i.e., non comminuted to form a puree. The starting food product will have an initial moisture content and water activity value. Typically, in the preferred embodiment, fresh or frozen fruit will have a moisture content of about 90 to 95% and water activity value of 0.95. Frozen fruit can be used after thawing. In another variation, dried fruit can be used as a starting materialsuch as raisins. Such a dried ahead fruit product starting material's can have a initial water activity as well as 0.40. When a dried fruit is used as the staring material, then the finish drying step can be reduced or, ideally, eliminated. In lesspreferred embodiments, previously dried fruit can be rehydrated in whole or in part to moisture contents typical all of fresh fruit.

313

However, since the rehydrated infused fruit typically will require further dehydration after infusion, rehydration ofdried fruit is undesirable.

The food pieces can be of any convenient size and shape. Good results are obtained with whole fruit pieces such as cherries, raisins, strawberries, blueberries, cranberries and mixtures thereof. Conveniently, other food products to the infusedsuch as common garden variety vegetables or meat pieces can be likewise sized. Larger fruits or vegetables, e.g., carrots, can be sized into convenient size and shaped pieces.

The present infusion step can be conveniently practiced by treating a quantity of food pieces with a liquid inulin infusion solution. Thus, this infusion step can include one or more sub-steps. For example, this step can include a sub-step ofproviding an inulin bearing liquid infusion solution. The infusion step can include a sub-step of admixing a the un-comminuted with the liquid inulin infusion solution; heating the solution and food pieces for microbial control; and holding the piecesand the solution until most of the inulin has been infused; separating the infused food pieces from the solution before drying to provide a dried infused food product.

Inulin can be obtained as an ingredient in dry or, more conveniently, in solution form. The liquid inulin ingredient can then be admixed with desired amounts of glycerin and moisture to provide a clear inulin containing infusion solution. Ifall or a portion of the inulin is provided in dried form, the dry ingredients can be dissolved in water and heated for time sufficient to provide a clear solution in which the solids are completely dissolved. If desired, the infusion solution can be apH adjusted by addition of sufficient amounts of suitable edible organic acids to lower the pH to desired levels. If desired, the solution can also be adjusted in pH upwards by addition of edible alkaline ingredients such as sodium bicarbonate.

Good results are obtained when the infusion solution comprises:

TABLE-US-00001 Ingredient Weight % Preferred Weight % Inulin 60% 90% 65 to 85 Glycerin 0 percent to 30 percent 5% to 25% Water 1 percent 20 percent 5 10%

In variations, the inulin bearing infusion solution can additionally comprise low molecular weight nutritive carbohydrate sweeteners including conventional sugars such as sucrose, fructose, dextrose, maltose, honey and mixtures thereof. Suchsugar added infusion solutions are less preferred since the finished inulin infused dried fruit products will be characterized by lower levels or concentrations of inulin in the dried finished product. Such lower concentrations of inulin are due in partto the dilution effect of such sugars. However, in those variations wherein lower levels of fiber are acceptable, especially for low cost products, the infusion solution can additionally include about 0.1% to about 30% of such nutritive carbohydratesweeteners. In those variations, the dried finished fruits will comprise about 1% to 40% added sweeteners.

Thereafter, the starting food pieces especially fruit pieces are then combined with the inulin bearing infusion solution in any convenient manner. The weight ratio of infusion solution to food pieces can range from about 1:1 to about 20:1,preferably about 1.5: to 34:1 and for best results about 2:1. Preferably, sufficient amounts of infusion solution is combined were admixed with the food pieces to completely cover the food pieces with the infusion solution. In other variations, asubstantial excess of infusion solution is provided in the form of a bath in which the food pieces especially fruit pieces are immersed.

Continuous, batch, or semi batch operations are contemplated herein. Also, the skilled artisan will appreciate that variations of the treatment process such as by recirculation of the spent infusion solution or continuous resupply of theinfusion solution can be practiced for processing efficiencies.

Thereafter, the present methods can include treating the admixture of infusion solution and food pieces for microbial control. Conveniently, the infusion and food piece admixture can be heated to appropriate temperatures for microbial control. Good results, for example are obtained when the admixture is heated to a temperature of above about 70° C. (>175° F.). In other variations, addition of anti microbial ingredients can be the microbial treatment technique.

The present methods include holding the infusion solution and food piece admixture or blend or allowing to stand to allow for infusion of the infusion solution ingredients into the food piece to provide an infused food or fruit piece and a spentinfusion solution. The holding time does not need to be so long as to reach complete osmotic equilibrium but should be practiced to allow for at least partial infusion of the infusion solution into the food product. Of course, as the admixture is held,osmotic pressure will drive towards equilibration over time. Inulin being higher in concentration in the infusion solution will tend to infuse into the food pieces by osmotic pressure. Likewise, glycerin, if present in the infusion solution, will beinfused into the

314

food pieces. Sugars and moisture initially present in the food pieces will likewise equilibrate by osmotic pressure. For fresh fruits characterized by a higher initial moisture levels, moisture will be picked up by the infusionsolution as well as some native sugars.

The admixture can be maintained at elevated temperatures or heating can be discontinued and the admixture can be allowed to cool to ambient temperatures. Maintaining higher temperatures tends to accelerate reaching osmotic equilibrium and willincrease the rate of infusion and decrease the duration of require holding periods. Treatment times are not critical but good results are obtained for treatment or holding times ranging from about three to 24 hours depending in part upon such factors asbatch temperature, ratio of infusion solution to food pieces, initial moisture content of the food pieces, and desired levels of infused inulin in the finished products.

Thereafter, the inulin infused fruit products so prepared can then separated from the spent infusion solution. It will be appreciated that the infusion step results in at least some drying of the stating material by osmotic drying. Conveniently, the infused fruit pieces can be washed and allowed to drain to remove any residual topical infusion solution or otherwise be cleaned of excess infusion solution (e.g., spinning or centrifuging, air sprayed).

The present methods can additionally comprise a step of drying the infused food products to desired finished moisture content and water activity values ranging from about 0.15 to 0.75. Good results are obtained when the finished water activityranges from about 0.4 to about 0.55. In other embodiments, especially in the provision of dried infused fruit products suitable for addition to very dry blended products such as ready-to-eat cereal blends or dry mixes for baked goods, the drying stepcan be practiced to provide finished dried products herein having a water activity ranging from about 0.2 to 0.45. Fruit drying techniques are well known and any conventional technique can be used to practiced the drying step. For example, the dryingstep can be practiced employing thermal drying techniques including forced hot air, hot air, microwave and/or vacuum or freeze drying. Of course, combinations of these drying techniques are contemplated when one or more technique is used to practicepartial dehydration. In one preferred embodiment, all or at least a portion of the drying step is practiced using vacuum drying. Such vacuum drying is practiced at low temperatures thereby assisting in the provision of a high quality finished productby reducing the exposure to higher temperatures.

In the preferred embodiment wherein fresh fruit pieces, e.g., blueberries, are the starting food piece material, good results are obtained when the drying step is practiced using hot air drying practiced at a temperature of about 40° C.for about eight to 12 hours. For highest quality dried fruit products, vacuum drying is the preferred drying technique since exposure to elevated temperatures is reduce. Such vacuum drying can be used for high quality or high cost fruits such as freshblueberries, sliced strawberries or other whole fruit pieces especially raspberry, blueberries, blackberries and mixtures thereof.

The spent infusion solution can be reclaimed or recaptured and used to prepare additional batches or quantities of infusion solution. The infusion solution can be further dried or pure materials added thereto. In other variations, a portion ofthe spent infusion solution is added back into the make-up of a fresh batch or quantity of infusion solution.

In certain embodiments, the present methods can additionally comprise the step of admixing a quantity of the dried inulin bearing pieces so prepared with a quantity of a second food component to form a blend. In preferred form, the second foodcomponent is in dry and in a particulate form such as ready-to-eat cereal pieces or other dry mix ingredients. In a particular embodiment, the second food component is a ready-to-eat cereal having a water activity of about 0.1 to 0.3.

While the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment, it is to be understood that the invention is not to be limited to the disclosed embodiment, but on thecontrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. FIELD OF THE INVENTION

This invention relates generally to membrane cascades for separating constituents of a fluid solution. The invention is more specifically directed to membrane-based modules and the use of same in countercurrent cascade systems to separatesolute/solute pairs from a solvent.

BACKGROUND OF THE INVENTION

315

Process chromatography in its many variant forms has become the dominant downstream processing tool for difficult separations in biotechnology, but it is inherently expensive and is not used to a significant extent for commercial scaleseparations in any other industry. In particular, process chromatography is not used significantly in food processing or petrochemical technology. Chromatography depends upon concentration diffusion between stationary and mobile phases, and, ascommercial interest shifts toward larger substrates such as plasmids and viruses, diffusion tends to become slower and to make separations increasingly difficult.

At the same time, many other potentially competitive techniques have been developing, and engineers have finally begun to show real initiative for process development in a variety of biological applications. Lightfoot, E. N., and J. S.Moscariello, 2004, Bioseparations, Biotech. and Bioeng. 87: 259 273. Increasingly efficient renaturation of proteins from inclusion bodies shows promise of replacing the capture steps now performed by batch adsorption chromatography in a variety ofapplications, and crystallization appears to be increasing in importance for finer separations. Simulated moving beds are receiving increased attention.

Membrane filtrations are already providing increased competition to chromatography for the polishing stages of downstream processing, and they are becoming more and more selective, even for such large molecules as proteins. Cheang, B., and A. L.Zydney, 2004, A two-stage ultrafiltration process for fractionation of whey protein isolate, J. Mem. Sci. 231: 159 167. Several investigators report the use of simple two-stage cascades, but these cascades do not incorporate counterflow principles.

There is also increasing interest in continuous downstream processing for which chromatography is ill suited. Use of simulated moving beds, the only continuous process currently available, is both cumbersome and poorly suited to feedbackcontrol. To date, these devices have been limited to very clean stable systems, for example in the resolution of enantiomers from highly purified racemic mixtures. Finally, there is increasing interest in larger entities such as nucleic acids andviruses, and these have such low diffusivities that the choice of suitable adsorbents is severely limited. Pressure induced flow across selective membranes however can increase transport rates by convection relative to those for diffusion alone. Bird,R. B., W. E. Stewart, and E. N. Lightfoot. 2002, "Transport Phenomena", Wiley.

A new look at downstream processing is warranted, and membrane cascades may provide new and important methods for separating components from mixtures. Membrane selectivities are rapidly increasing, and there is now a wealth of practicaloperating experience available for purposes of preliminary design. Moreover, membranes are available for dealing with an extremely wide range of molecular weights, from small monomeric molecules to mammalian cells. Moreover, the technology of dealingwith membrane cascades was very highly developed during the 1940s in connection with the effusion process for uranium isotope fractionation. Von Halle, E, and J. Schachter, 1998, "Diffusion Separation Methods", in Kirk-Othmer Encyclopedia of ChemicalTechnology, 4th Ed., J. Kroschwitz, Ed., Wiley. Even very simple cascades have not been widely used in biotechnology, however, in large part because of control problems and lack of operating experience. Membrane cascades thus present a promising fieldfor research and development. A logical starting point for investigation will be the ideal cascade theory of isotope separations. As described below, isotope separations have much in common with potential biological applications.

It is desirable to start with simple prototype systems and then move by degrees to more complex systems in more promising situations. Fortunately, there are some simple applications where useful results can be obtained rather simply. One canthen gain experience and at the same time produce economic processes. There are guides in the literature to aid in this stepwise approach. There are several examples of essentially binary protein solutions (e.g., Cheang and Zydney, J. Mem. Sci 231(2004)). Another logical starting point would be the tryptophan resolution of Romero and Zydney as the components are inexpensive and stable, and assays are unusually simple. Moreover, one needs only an ultrafiltration membrane under situations wheresensitivity to minor changes in behavior is probably insignificant-one can concentrate here on solvent problems and development of a reliable control strategy. One can then proceed to other well-documented and simple separations such as removal ofdimers from monomeric bovine serum albumin (BSA). After that, one can begin in earnest on systems where a more complex cascade is particularly desired.

Many cascade separation systems have been proposed, but none apparently incorporating the ideal cascade approach where design strategy is divided into: (i) separation of the solutes of interest using a solvent-free description; and (ii) solventmanagement.

SUMMARY OF THE INVENTION

The present invention is directed to counter flow cascade separation systems for separating a solute/solute

316

pair in a solvent. A counter flow cascade separation system according to the invention comprises a series of interconnected stages inwhich each stage includes a diafilter that accepts a flow stream containing a solute/solute pair in a solvent. The diafilter is preferentially permeable for a first solute of the solute/solute pair and the diafilter preferentially passes the firstsolute to a permeate flow while preferentially retaining the remaining solute in a retentate flow. The stage further includes an ultrafilter that accepts from the diafilter the permeate flow wherein the ultrafilter is selectively permeable to thesolvent but not the remaining solute contained in the permeate flow. Stages of the system are interconnected so that each stage beyond an first stage accepts an intermixed flow stream formed by combining retentate flow and permeate flow from differentstages wherein intermixed retentate flow and permeate flow each have the solute/solute pair present in substantially the same molar ratio. The solute/solute pair is thusly separated by counter flow cascade through the interconnected series of stages.

In preferred embodiments, the system consists of three interconnected stages. Preferred systems according to the invention recycle solvent collected by ultrafilters and route that solvent back to a flow stream. In certain embodiments, a systemaccording to the invention includes at least one stage that further comprises a macroporous membrane capable of distributing solvent evenly over the diafilter.

In another embodiment, the invention provides a method for separating a solute/solute pair in a solvent. Such a method includes steps of routing a flow stream containing a solute/solute pair in a solvent to a diafilter that is preferentiallypermeable for a first solute of the solute/solute pair. The diafilter preferentially passes the first solute to a permeate flow while preferentially retaining the remaining solute in a retentate flow. The permeate flow is then routed to an ultrafilterthat is selectively permeable to the solvent but not the remaining solute contained in the permeate flow in order that excess solvent contained in solvent is removed from the permeate flow.

The permeate flow and retentate flow are routed to successive interconnected stages wherein the stages beyond a first stage accept an intermixed flow stream formed by combining retentate flow and permeate flow from different stages. Theintermixed retentate flow and permeate flow each have the solute/solute pair present in substantially the same molar ratio and operation of the system approaches an ideal cascade.

The invention is further directed to a stage in a counter flow cascade separation system for use in separating a solute/solute pair in a solvent. Such a stage includes a diafilter that accepts a flow stream containing a solute/solute pair in asolvent. The diafilter is preferentially permeable for a first solute of the solute/solute pair wherein the diafilter preferentially passes the first solute to a permeate flow while preferentially retaining the remaining solute in a retentate flow. Thestage further includes an ultrafilter that accepts from the diafilter the permeate flow wherein the ultrafilter is selectively permeable to the solvent but not the remaining solute contained in the permeate flow. The stage is capable of separating thesolute/solute pair into the permeate flow and retentate flow and the ultrafilter removes excess solvent from the permeate flow.

Other objects, features and advantages of the present invention will become apparent after review of the specification, claims and drawings. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1(A) depicts a conventional membrane separation of a feed stream into retentate and permeate streams using a single membrane 11 with the optional routing of solvent back to a feed stream. In contrast, FIG. 1(B) illustrates a membrane-basedseparation according to the present invention utilizing an additional macroporous membrane to distribute solvent over a volume of a retentate-containing compartment and underlying diafilter.

FIG. 2 illustrates the fundamental operation of stage 10 according to the invention that includes a diafilter 12 and ultrafilter 14 combination.

FIG. 3 shows an embodiment of a stage 10 according the invention which includes diafilter 12, ultrafilter 14 and optional macroporous membrane 16 in a single housing.

FIG. 4 depicts a diafilter 12/ultrafilter 14 combination according to the invention and related mathematical relationship of feed (F), moles of product (P) and waste (W) based on a solvent-free system.

FIG. 5 illustrates solute concentration dynamics for conventional separation versus separation based on the invention.

317

FIG. 6 shows a macroporous membrane 16 with equally spaced apertures 18 useful in certain embodiments of the invention.

FIG. 7 depicts the mathematical definition of separability in a separation system according to the invention.

FIG. 8 illustrates a three stage ideal cascade in which feedsteam F is separated by the three stages (1, 2 and 3) into a waste stream (W) and a permeate stream (P).

FIG. 9(A) depicts the general linear counterflow of a cascade separation according to the present invention. Stages 20, 22, 24, 26 and 28, shown in box form, each comprise diafilter and ultrafilter. FIG. 9(B) shows a graphical representation ofthe ideal solute separation achieved by the counterflow cascade of FIG. 9(A).

FIG. 10 depicts in tabular form values related to the fractionation of lactalbumin, as derived in the example section.

FIG. 11 illustrates a three stage cascade and factors for the separation of lactalbumins from whey, based on the values listed in FIG. 10.

FIG. 12 illustrates the calculation of a global separation factor (ΦA, global) and same plotted against fraction of solute A removed.

FIG. 13(A) depicts the batch operation of a cascade system for the separation of alpha and beta lactalbumins. FIG. 13(B) shows batch operation of a cascade system according to the invention in generalized form.

FIG. 14 illustrates cross-flow sieving in which a separating agent flows perpendicularly through a macroporous filter (16; upper dashed line) to a feed stream flow and solutes A and B contained in the feed stream flow permeate a diafilter (12;lower dashed line) in a selective manner.

DETAILED DESCRIPTION OF THE INVENTION

In the invention dislosed herein, membranes are combined to carry out dialfiltration (DF) and ultrafiltration (UF) operations in such manner to approach and/or achieve an ideal cascade. The reasons for using membranes are their rapidlyincreasing selectivity and productivity, as well as their insensitivity to diffusion. Various membranes known in the art may be utilized to carry out the present invention but will meet the following general design parameters. Diafilters useful in thepresent invention are selectively permeable to one solute of a selected solute/solute pair. Ultrafilters useful in the present invention are permeable to solvent but not to either solute of the selected solute/solute pair. The cascade method presentedhere is based on ideal counterflow. The major considerations are resolution and solvent conservation. The fundamental operation of diafiltration and ultrafiltration does not appear to have previously been recognized. A major advantage of the DF-UFcombination is that it facilitates the separate design of the solute-solute separation and solvent management. It thus reduces the number of possibilities that must be considered.

The design strategy used by the inventor in arriving at the present invention consisted of: (i) recognizing the dual solvent role, as both a convective transporter and as a separating agent; (ii) splitting the problem and the solution into twoparts--specifically into fractionation of solutes and solvent management. More specifically, the inventor has discovered a novel membrane-based separation cascade system wherein the solvent is used as both a convective transporter and as a separatingagent. This cascade-based system can be used for separating two solutes as a solute/solute pair (solute 1 and 2; retentate and permeate; waste and permeate) from a feed stream. FIG. 1(A) depicts a conventional membrane separation of a feed stream intoretentate and permeate streams using a single membrane 11 with the optional routing of solvent back to a feed stream. In contrast, FIG. 1(B) illustrates a membrane-based separation according to the present invention utilizing multiple membranes togenerate retentate and permeate streams. The solutes are initially contained in the feed stream, and the solvent can be added either to the entering feed stream or, as shown in FIG. 1(B), spatially distributed over a retentate-containing compartment. FIG. 2 illustrates the fundamental operation of stage 10 according to the invention that includes a diafilter 12 and ultrafilter 14 combination.

In a first filtration step shown in FIG. 2, a diafiltration membrane 12 is capable of separating the feed stream into permeate and retentate (waste). The retentate remains in the feed stream-containing compartment 13 and can be recovered. Thepermeate and the solvent pass into the permeate-containing compartment 15 and are subject to second filtration step.

318

Still referring to FIG. 2, an ultrafiltration membrane 14 is positioned between the permeate-containing compartment 15 and a second solvent-containing compartment 17. The purpose of ultrafiltration membrane 14 is to remove excess solvent fromthe permeate, and it should be essentially impermeable to either of the solutes to be separated from one another. As a result of this filtration step, the permeate becomes separated from the solvent. Ultrafilter 14 may be contained with diafilter 12 inthe same housing, as shown in FIG. 3, or, alternatively, ultrafilter 14 may provided in a separate housing from diafilter 12, as FIG. 4 depicts.

Configurations according to the invention lessen the amount of solvent consumed for a given amount of solute transported across the membrane and decreases the ranges of upstream solute concentrations. This is because all solvent consumed bydiafiltration must be supplied at the inlet, using the conventional design, rather than introduced locally for solute transport, as in the proposed new design. Since the ratio of water to solute transport increases with dilution, there is an excess ofsolvent initially, and perhaps too little toward the exit of conventional equipment. FIG. 5 illustrates solvent flow differences between conventional and the presently-disclosed system. In addition, FIG. 5 compares solute concentration along a membranefor conventional and the present system.

Solvents are typically highly purified sterile water blended with pH buffers and represent a major cost of diafiltration. Decreasing solvent use thus directly reduces the cost of the diafiltration process. In addition removal of excess solventeither increases required membrane area, raising capital costs directly, or requires higher trans-membrane pressures, raising operating costs. Finally, excess solvent must be removed from the filtrate, typically by ultrafiltration, and this representsan additional cost. In general some upstream compositions are more desirable than others, and it is desirable to depart as little as possible from these optimum levels.

Uniform conditions within a diafiltration stage can also be approached by rapid recirculation through a conventional apparatus, as shown by the dotted line in FIG. 1A, but this requires repeated pumping and can damage sensitive materials such asproteins.

In certain embodiments, a macroporous membrane 16 is included upstream of the described diafiltration membrane 12, as shown in FIG. 3. Macroporous membrane 16 is positioned between a first solvent-containing compartment 19 and the feedstream-containing compartment 13. Macroporous membrane 16 is capable of selectively-passing the solvent from the solvent-containing compartment 19 to the feed stream-containing compartment 13. The purpose of macroporous membrane 16 is to control thespatial distribution of solvent into the feed stream-containing compartment 13. The macroporous membrane 16 should not permit entrance of feed solution from the permeate compartment. This latter constraint can be met by ensuring that pressure at allpoints in the upper compartment is always greater than in the adjacent feed stream. It can for example be assured by using a positive displacement solvent pump and designing the system so that pressure drop across the upper surface is greater than thepressure drop in the feed stream. An exemplary macroporous membrane 16 with a plurality of apertures 18 is shown in FIG. 6. Macroporous membranes may be fabricated from a sintered granular plate, a tight screen, or other materials. One of ordinaryskill in the art will know to vary the number as well as the size of perforations without departing from the spirit of the invention. Important for practicing the invention is that the distances in the lateral and flow directions between perforationsshould be small compared to the corresponding dimensions of the stage.

An ideal counterflow cascade is illustrated in the flow diagram depicted in FIG. 9A in which the DF/UF units 20, 22, 24, 26 and 28 are shown as blocks. The flow diagram depicted is based on solvent free streams. In a fashion analogous to otherlinear counterflow cascades the permeate from each stage enters the retentate compartment of the next above stage while the retentate flow enters the retentate compartment of that immediately below. Thus, two streams enter each stage except those at thetwo ends of the cascade and three to the feed stage. The cascade is termed "ideal" if the solvent free compositions of the two entering streams are identical. This situation and its physical significance on separation are illustrated by the graph inFIG. 9(B).

Accordingly, the present invention is directed to counter flow cascade separation systems for separating a solute/solute pair in a solvent. A counter flow cascade separation system according to the invention comprises a series of interconnectedstages in which each stage includes a diafilter that accepts a flow stream containing a solute/solute pair in a solvent. The diafilter is preferentially permeable for a first solute of the solute/solute pair and the diafilter preferentially passes thefirst solute to a permeate flow while preferentially retaining the remaining solute in a retentate flow. The stage further includes an ultrafilter that accepts from the diafilter the permeate flow wherein the ultrafilter is selectively permeable to thesolvent but not the remaining solute contained in the permeate flow. Stages of the system are interconnected so that each stage beyond an first stage accepts an intermixed flow stream formed by combining retentate flow and

319

permeate flow from differentstages wherein intermixed retentate flow and permeate flow each have the solute/solute pair present in substantially the same molar ratio. The solute/solute pair is thusly separated by counter flow cascade through the interconnected series of stages. FIG. 9(A) provides a flow diagram illustrating the above-described system and, in addition, FIG. 9(B) illustrates the results of the present system on stage-to-stage solute concentration.

In preferred embodiments, the system consists of three interconnected stages. Preferred systems according to the invention recycle solvent collected by ultrafilters and route that solvent back to a flow stream. In certain embodiments, a systemaccording to the invention includes at least one stage that further comprises a macroporous membrane capable of distributing solvent evenly over the diafilter.

In another embodiment, the invention provides a method for separating a solute/solute pair in a solvent. Such a method includes steps of routing a flow stream containing a solute/solute pair in a solvent to a diafilter that is preferentiallypermeable for a first solute of the solute/solute pair. The diafilter preferentially passes the first solute to a permeate flow while preferentially retaining the remaining solute in a retentate flow. The permeate flow is then routed to an ultrafilterthat is selectively permeable to the solvent but not the remaining solute contained in the permeate flow in order that excess solvent contained in solvent is removed from the permeate flow.

The permeate flow and retentate flow are routed to successive interconnected stages wherein the stages beyond a first stage accept an intermixed flow stream formed by combining retentate flow and permeate flow from different stages. Theintermixed retentate flow and permeate flow each have the solute/solute pair present in substantially the same molar ratio and operation of the system approaches an ideal cascade.

The invention is further directed to a stage in a counter flow cascade separation system for use in separating a solute/solute pair in a solvent. Such a stage includes a diafilter that accepts a flow stream containing a solute/solute pair in asolvent. The diafilter is preferentially permeable for a first solute of the solute/solute pair wherein the diafilter preferentially passes the first solute to a permeate flow while preferentially retaining the remaining solute in a retentate flow. Thestage further includes an ultrafilter that accepts from the diafilter the permeate flow wherein the ultrafilter is selectively permeable to the solvent but not the remaining solute contained in the permeate flow. The stage is capable of separating thesolute/solute pair into the permeate flow and retentate flow and the ultrafilter removes excess solvent from the permeate flow.

In a following example, the inventor first explains how binary stages (also termed "splitters") can be modified to deal with protein mixtures in a solvent. The inventors then show how binary stages can be connected to form ideal cascades, mostlikely the most economical configuration for practicing the present invention. The inventor shows by numerical example how a cascade separation according to the present invention is performed.

EXAMPLE 1

Mathematical Description of Ideal Cascade System

Consider the simplest complete cascade shown in FIG. 8, consisting of three stages. For convenience, one may begin by working on a solvent-free basis and assume perfect mixing in the upstream compartment of each membrane module or stage. Forthis example, the state separation factor Φ is considered constant throughout the cascade. One may avoid blending streams of differing solute composition in accordance with ideal cascade theory and therefore require that X1=Y.sub.3=Z (1)

Here X is the mole ratio of solutes α and β (i.e. moles α/moles β) in the retentate; Y is the mole ratio of solutes αand β in the permeate, and Z is the mole ratio of solutes α and β in the feed. Also, x is the mole fraction α/(α β) in the retentate; y is the mole fraction α/(α β) in the permeate, and z is the mole fraction α/(α β) in the feed. The numerical subscripts refer to the stage withinthe cascade; the other symbols in the subscripts refer the definitions of the symbols in standard type. Using the definition of stage separation factor depicted in FIG. 7 (Φ, where Φ=sα/sβ and s is the sieving factor of theindicated solute), one can complete the specification of terminal stream compositions: YP=Y.sub.1=ΦZ; XW=X.sub.3=Z/Φ (2,3) and more generally Yn=ΦX.sub.n= {square root over (Φ)}Yn 1 (4,5). One may now go on tocomplete the mass balances for the system as a whole: F=P W; zF=ypP xwW (6,7) or z=θyp (1-θ)xw (8,9) where W=waste stream (retentate); F=total moles/time of feed; and P=moles of product, and θ=cut=P/F and1-θ=W/F

FIG. 4 illustrates W, F and P as they apply to a stage configuration. It now only remains to calculate the two remaining intermediate compositions by making similar balances about the top and bottom stages. These

320

procedures are illustrated bythe following specific example.

EXAMPLE 2

Fractionation of Lactalbumins

Assume by way of example the system described in the tabular form in FIG. 10 and use α-lactalbumin (αLA) as the product in a mixture with β-lactalbumin (βLA): Φ=21 and Z=0.1071/0.441=0.2429 (10)

These correspond to the system of Cheang and Zydney for their 30 kDa membrane example (Cheang, B., and A. L. Zydney, 2004, A two-stage ultrafiltration process for fractionation of whey protein isolate, J. Mem. Sci. 231, 159 167).

System Mass Balances

One may begin by defining the input to the system using a solvent-free feed rate of one millimole per minute. Then, in these units F=1; Z=0.1071/0.441=0.2429; z=0.2429/1.2429=0.1954 (11,12,13).

One may next note that for an ideal cascade Y3=X.sub.1=Z=0.2429; y3=x.sub.1=z=0.1954 (14,15,16) and Xw=X.sub.3=Y.sub.3/21=0.01157; x3=x.sub.w=0.01144 (17,18) while Yp=Y.sub.1=21X.sub.1=5.1009; yp=0.8361 (19,20).

One is now ready to calculate the α-lactalbumin yield, and this requires making two mass balances on the cascade. One should follow convention in writing one for total moles and the other for α-lactalbumin, all on a solvent-freebasis: F=P W; zF=ypP=x.sub.wW (21,22).

These equations can be combined to give z=ypθ xw(1-θ); θ=P/F (23) θ=(z-xw)/(yp-

x.sub.w)=(0.1954-0.0144)/(0.8361-0.0144)=0.2- 239=P=1-W (24).

This quantity is known as the fractional cut for the separation. The yield of β-lactalbumin is then Yβ=θy.sub.p/z=(0.22390.8361)/0.1954=0.958 (25a).

The yield of α-lactalbumin, obtained with a purity of 0.988 is Yα=(1-θ)x3/z=(1-0.2239)0.989/0.8046=0.954 (25b)

Stage Mass Balances

One may now calculate the intermediate stream rates and compositions that will be needed later in calculating solvent flows. One may begin by writing from Eq. 5 that X2={square root over (21)}Xw=4.580.01157=0.05302; x2=0.05035(26) while Y2=Y.sub.p/ {square root over (21)}=5.1009/4.5825=1.1131; y2=0.05268 (27).

Compositions are now complete, and it remains to calculate the (solvent-free) stream rates. One may begin with stage 1 and write U2=R.sub.1 P; y2U.sub.2=x.sub.1R.sub.1 ypP(28,29) where R=total moles/time of retentate and U=totalmoles/time of permeate (also referred to as ultrafiltrate).

It follows that 0.5628 U2,=0.1954(U2-0.2239) 0.83610.2239 (30) or (0.5268-0.1954)U2=0.1872-0.19540.2239 (31) U2=(0.1872-0.04375)/(0.5268-0.1954)=0.4327 (32).

Then, R1=0.4327-0.2239=0.2088 (33).

One may now turn to stage 3 and write R2=U.sub.3 W=U3 0.7761; (34) 0.05035R2=0.1954U.sub.3 0.011440.7761 (35) =0.1945(R2-0.7761) 0.00888 (36).

Then, R2=(0.19540.7761-0.0089)/(0.1954-0.05035)=0.984 (37) U3=0.984-0.7761=0.2080 (38).

The above-described system is graphically-applied to the corresponding cascade in FIG. 11. This completes specification of all streams on a solvent-free basis.

EXAMPLE 3

Solvent Flows

321

One may now reaches a point of great flexibility; there is no a priori requirement for using any particular solute concentration or even to use the same concentrations in all stages. Only the ratio of the two proteins is important. Moreover,since the only returns to the feed stage from the product, stage 1, and waste (retentate), stage 2, stages have the same solvent-free composition as the feed, one can even operate completely in a batch mode (see, e.g., FIG. 13(B)).

This flexibility relaxes constraints on solute concentrations, and one possible strategy presents itself immediately--and that is to always operate at the maximum concentration permitted by the nature of the system. This, in turn, can bedifferent for each stage, but there is of course an advantage to simplicity so one assumes identical concentrations for all streams in a numerical example.

The use of diafiltration is inherent in the method described herein and is an important purification step in that it removes low molecular weight impurities. Thus, one may be able to use higher than feed concentration in all stages, includingthe feed stage. This latter fact is because the composition within a well-mixed stage is that of the exit from the stage, x2, not the feed composition z. Diafiltration through this stage will have removed a large fraction of low molecular weightimpurities originating in the feed.

Solvent Flows for Uniform Solute Concentration

Assuming that the basis is one millimole of protein feed per minute, one may now calculate stream rates through the presently-described system. Beginning with the combined streams to the feed stage 2 of FIG. 11, one may write that the molar rateM of protein transport into stage 2 is MF=F U3 R1=1 0.2080 0.2088=1.4168 m-moles/min (39) and the total molar concentration is ctot=0.548 m-mols/L (40).

Then the volumetric flow rate, Q, of solution to stage 2 is QF=1.4168/0.548=2.585 L/min (41).

The corresponding flows of retentate and ultrafiltrate are QR=0.984/0.548=1.796 L/min (42) QU=0.437/0.548=0.797 L/min (43).

One may next write for the rate of protein transport across the stage 2 membrane M=Avc [XαLS.sub.αL (1-XαLS.sub.βL)]=0.4327 m-moles/min (44) where A=membrane area, v=transmembrane velocity, and c=concentration orQD=Av=0.4327/(0.5480.1264)=6.247 m-moles/min (45).

It follows that the amount of solvent that must be removed by the secondary membrane is QS=Q.sub.D-Q.sub.U=6.247-

0.797=5.5 L/min (46).

Flows across the other two stages can be calculated similarly. Note, however, that these are only representative numbers to illustrate the procedures that must be followed. Control of solvent flows must be determined by the designer to suit thesystem and process requirements.

EXAMPLE 3

Operation of a Model Diafilter with Continuous Solvent Feed

This example is directed to the operation of a model diafilter with continuous solvent feed This situation is equivalent mathematically to the classic diafiltration, but with continuous solvent replacement. A simple mass balance gives: -Vdci/dt=νASic.sub.i=QS.sub.ic.sub.i (47) -dci/dτ=Sic.sub.i; τ=V/Q (48) with ci=c.sub.io at t=0 (49) then ci/c(0)=e-S.sup.i.sup.τ (50).

It follows that the molar mass of "i" remaining in the volume element (retentate) at any time is M/M(0)=e-

S.sup.i.sup.τ (51) and that in the accumulated permeate is Mi/Mi(0)-Mi=M.sub.i(0)[1-e-S.sup.i.sup.τ] (52).

The ratio of "i" in permeate to retentate is then Mi/Mi=[1-e-S.sup.i.sup.τ]/e-S.sup.i.sup.τ=e.s- up.Si.sup.τ-1 (53).

Now the solvent-free mole ratios of species "A" in an "A"-"B" mixture for permeate and retentate are respectively XA=M.sub.A/MB; YA=M.sub.A/MB (54) and the global separation factor isΦIAglobal=Y.sub.A/XA=(eS.sup.A.sup.τ-

1)/(eS.s- up.Bτ-1) (55).

One may now consider limiting behavior: 1) τ, t→0: Here eSτ→1 Sτ and ΦA=S.sub.A/SB (56) 2) τ, t>>1: Here ΦA=e

S.sup.A.sup.τ/eS.sup.B.sup.τ (57)

This value can be large and representative examples of the global separation factor are shown in FIG. 12.

322

Separation factors vary strongly with fractional cut, and this variation must be considered in any design. This then means that for ideal cascades the proper criterion, only mixing streams of identical solvent-free composition, is difficult toselect. Qualitatively similar behavior can be expected when solvent is not replaced.

Cross-Flow Sieving

Analysis of the cross-flow sieving (FIG. 14) shows two causes of variability of the sieving coefficient. One cause is polarization, which results in increase of concentration at the barrier. This is unfavorable on balance because it isstrongest for the less permeable species of molecules. The other cause of variability is the cross-flow increase of effective stage separation factor. This is beneficial and militates against stirred retentate compartment.

EXAMPLE 4

Batch Operation

One may operate this system as a batch process in which feed from a storage tank 30 (at left in FIG. 13(A)) is introduced to an appropriately sized diafiltration/ultrafiltration (DF/UF) stage 10A and the two output streams are fed to twoadditional tanks, one tank 32 for the alpha lactalbumin (α-L) rich stream, the ultrafiltrate, and one tank 34 for the beta lactalbumin (β-L) rich stream, or retentate. One can then process these two intermediate streams and direct thefiltrate of the β-L rich tank 34 back to the feed tank 30 and sends the retentate out as purified β-L. Correspondingly, one sends the retentate from the α-L tank to the feed tank and the ultrafiltrate out as purified α-L. In thisway, the overall process is broken down into three simpler components each related to a standard diafiltration.

SUMMARY

In summary, the inventor demonstrates that binary ideal cascade theory can be extended to systems of two solutes in a single solvent. The basic unit or stage in the modified cascade comprises a first, diafiltration unit, combined with a second,ultrafiltration unit. The ultrafiltration unit operates on the permeate that is obtained from the diafilter. The diafiltration membrane is selective for one of the two solutes, and the ultrafiltration membrane passes only the solvent.

In the example section, the inventor demonstrates how the filtration rates through DF and UF membranes can be controlled so that individual stages can be combined and operated to conform to ideal cascade theory for fractionation of the twosolutes from one another. An example is provided using experimental data in the reviewed literature for the simplest case of a three-stage cascade. For the first time, the inventor shows that a three-stage cascade can be operated in batch mode.

The system and method described here can be used for separation of different kinds of soluble molecules. Even though the examples described refer to such biomolecules as proteins, one of ordinary skill will know how to use the technologydescribed herein for separation of both biological and non-biological materials, including but not limited to, petrochemicals, plasmids, viruses, organelles and whole cells.

Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. All references cited herein are hereby incorporated byreference in their entirety and for all purposes as if fully set forth herein. It is understood that the invention is not limited to the embodiments set forth herein for illustration, but embraces all such forms thereof as come within the scope of thedescription provided.eStructural biologywww.medicilon.com  Medicilon as the CRO,provides chemi stry,biology,preclinical services.

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to the field of cheese manufacturing, more particularly to the field of cheese shaping and packaging, and more particularly to the field of construction shaped cheese units out of partial cheese segments.

323

2. Background of the Art

The principal solid constituent of milk is casein, a protein. When raw or pasteurized milk is allowed to stand in a warm place, it sours, and the casein is precipitated by the action of lactic acid bacteria. For example, in the case ofpasteurized milk, in which these harmless bacteria have been killed, an acid "Starter" must be added. The thick precipitate (e.g., the curd) that results from the action of the lactic acid bacteria (a lacto bacillus) is separated from the thin, wateryresidue known as whey. This was the earliest method of producing cheese and it is still used to make pot cheese and cottage cheese, although curd prepared with rennet, which acts to speed the separation process, is generally a preferred method ofmanufacture today. The curd, however prepared, contains (in addition to the protein) most of the other food values of the milk, including butterfat, minerals, sugar, and vitamins. Cheese may be made from the milk of ewes, goats cows, or any otherlactating mammal, with the flavor and nutritional content varying among species.

The next steps in the making of cheese include at least salting (for flavor and eventually to aid in curing) and pressing (to shape the cheese and eliminate more whey). The curd is then ready for curing and is stored under temperature-andhumidity-controlled conditions for varying lengths of time. Some cheese, such as cream or cottage cheese, is not cured. In general, the longer the curing or aging process, the more pronounced the flavor of the finished product. During curing, gasesare formed within the cheese, and in some types they are unable to escape, forming large pores or holes within a block of cheese. This produces the holes, or eyes, characteristic of, for example, Swiss cheese. To aid the curing process in the formationof particular forms of cheese, harmless-to-human spores of mold (e.g., blue-mold spores) are introduced into cheese. The manufacture of the blue-veined cheeses (Roquefort or blue cheese) uses blue mold spores added to the vein structure, and white-moldspores are sprayed on the surface of such cheeses as Brie and Camembert. This surface treatment produces a "bloomy" rind, which may be eaten or not according to personal preference. The rinds of other cheese are washed with whey or brine. Still othervarieties of cheese that are sprayed with mold or have mold added to the underlying composition are rindless.

There are more than 2000 varieties of cheese known today, including variations of original types, such as American Swiss cheese. Regardless of their animal sources, all cheese are divided into two basic categories; natural cheese and processcheeses. The latter, a recent development, are blends of several kinds of natural cheeses with the addition of emulsifiers. While they may keep longer than natural cheeses, their nutritive value is the same.

The butterfat content of cheese, that is, the amount of butter fat remaining in the cheese solids after all moisture has been removed, varies according to whether the cheese has been made with whole milk, skim, or part-skim milk, or enrichedmilk. Skim-milk cheese has a butterfat content of 0.5 percent or less. Average cheeses, such as Cheddar, Gouda, or Camembert, have a fat content of from 45 to 50 percent. Double and triple creme cheeses have 60 to 75 percent butterfat. In addition totyping by fat content, cheese can be categorized by consistency or moisture content. Thus, there are hard-grating cheeses, ripened longer and with sharp flavor (for example, Parmesan), hard cheeses (for example, Cheddar), semisoft cheeses (for example,Roquefort or Limburger), and soft cheeses (for example Camembert or cottage cheese). The latter two categories are the more perishable, but storage times vary for all cheese. In general, cheese for home consumption should be kept under refrigeration atbetween 1.5° C. to 4.5° C. (35° F. to 40° F.) and securely wrapped to prevent drying out.

In cheese manufacturing, there is significant segmentation, waste, scrap and trim of the cured and processed cheese that can be lost during manufacturing and packaging steps. It is common practice to process the waste or scrap into sellableforms, such as processed cheese or cheese spreads.

In the manufacture of bulk forms of cheese by conventional means, a milled or stirred, salted curd is filled into a bulk form, such as either a 500 pound (227 kilo) "barrel" or a 640 pound (291 kilo) cube. After filling the form, vacuum probesare placed into the barrel or block of loose curd to remove residual whey. The bulk container may be tipped to allow excess whey to be drained away. The bulk containers are then placed in a vacuum chamber to finish the forming and draining of thecheese mass. This probing, tipping and vacuuming process is somewhat cumbersome and can be a point for contamination of the cheese with undesirable microorganisms and or foreign material.

One improvement of this process that is practiced in the industry with increasing prevalence is to convey the milled or stirred salted curd into a forming tower (e.g., a Wincanton tower) commonly used for the final draining and forming of cheeseinto 40 pound (18.2 kilo) blocks. The cheese exits the tower thoroughly drained and formed into a semi-solid block. The innovation has been to break this semi-solid block into smaller pieces, convey the smaller pieces into the 227 kilo barrels or 291kilo block, apply vacuum and/or

324

pressure, and sealing the liner or bulk container. The cheese then tends to re-knit into a solid form during a cooling and storage period (estimated 5-days for cooling and from days to weeks to months for cold storage).

Unless conditions of temperature, pH of the curd, rate of cooling of the curd, pressure/vacuum in the container, etc., are ideal, the cheese is formed with "mechanical openings and visible seams where the pieces of curd or cheese have been joinedinto the larger form of cheese. The cheese can easily fracture along these seams. Where much of the bulk cheese is used, these conditions are of little consequence, since the bulk cheese will be shredded or ground as an ingredients for laterprocessing.

As previously noted, however, in some applications, including procurement by the USDA, there are numerous factors that are built into the valuation and grading of cheese, including United States Standards for Grades of Bulk American Cheese,effective Aug. 2, 1991, Sections 58.2455 through 58.2462.

The compacted product has the same essential cheese compositional quality as the original blocks formed, but may not be graded as high as the original material. This lower grading is the result of an anomaly in the grading procedures that doesnot rely entirely upon the sensory qualities or nutritional composition of the cheese, but also relies on structural factors that do not impact the taste or nutritional quality of the cheese. In particular, samples of cheese are graded by taking coresor plugs of cheese, and inspecting the cheese core to determine features such as pore content and fracture lines in the cheese. The more numerous the spacing or pores, the more fragile segmentation lines, and the appearance of other physical defects inthe construction can dominate the grading, reducing the quality value of a cheese to a much lower grade, even though the actual content quality of the cheese is very high with respect to flavor and nutrition. The specifications for this testing arenoted above in the U.S.D.A. Standards for Grades of Bulk American Cheese.

EP 0 711 504 B1 describes a method for increasing the eight of a curd by the addition of a transglutaminase (alone or in combination with a milk clotting enzyme, a rennet) into a solution containing milk or a milk protein. The process is carriedout by adding the transglutaminase (with or without the rennet0 to a solution containing the milk or milk protein, heat-treating the solution to deactivate the transglutaminase (and optionally adding the milk clotting enzyme). The process may also beeffected by first adding the rennet and allowing the enzyme to act on the milk or milk protein solution, and then adding the transglutaminase. In all cases, the transglutaminase is added prior to forming of the cheese curd or composition.

WO 97/01961 describes a process for making cheese comprising: a) adding to a milkcheese a transglutaminase, incubating for a suitable period, b) incubating with a rennet to cause clotting, and c) separating whey from the coagulate, and d)processing the coagulate into cheese. The transglutaminase mainatins the proteins within the cheese material during conventional cheese-making processes. The transglutaminase may be deactivated at a desired stage of the process by heat or othercontrols.

U.S. Pat. No. 5,686,124 describes a method for restructuration of raw meat for production of restructured raw meat by addition to the meat of transglutaminase The method for restructuration of raw meat for production of restructured raw meat byaddition to the meat of transglutaminase comprises the further addition of phosphate (optional) and sodium chloride, with a subsequent temperature treatment. The cohesion and hardness of the restructured raw meat is improved, and it can be sold as arefrigerated meat product. EP 0201975 describes a method of the same general kind as the method of U.S. Pat. No. 5,686,124. However, in relation this prior art method a binding material of external fibrin must be used, which necessitates the use offibrinogen and expensive thrombin. A preferred embodiment of U.S. Pat. No. 5,686,124, is characterized by the fact that the phosphate (if added), the transglutaminase, and the sodium chloride is added as an aqueous solution. This solution shouldpreferably be as concentrated as possible. In this manner the subsequent mixing process for the raw meat components may be carried out without any difficulty.

U.S. Pat. No. 4,917,904 describes that the properties of meat can be modified by addition of transglutaminase, salt and a phosphate. This prior art, however, does not describe the use of an alkali metal phosphate, and furthermore, this priorart method is not a method for production of restructured raw meat, but a method for production of high temperature treated, smoked meat.

U.S. Pat. No. 5,518,742 describes the use of enzyme preparation for producing bound-formed food. An enzyme preparation for bound-formed food use which comprises transglutaminase, a casein and an edible surface active agent. The enzymepreparation strongly binds raw food materials, and the resulting bound-formed foods have an excellent taste and savor. The enzyme preparation for binding of raw food materials,

325

comprises:

20 99% by weight of a protein selected from the group consisting of casein, calcium caseinate, potassium caseinate, sodium caseinate, casein-containing milk powder and mixtures thereof;

0.01 15% by weight of an edible surface active agent selected from the group consisting of a sucrose fatty acid ester and a sorbitan fatty acid ester; and

1 50,000 units of transglutaminase per gram of said protein in said preparation. It is generally known that, when a bound beef is prepared, binding of meat pieces to one another cannot be effected without the use of a binding agent. Thereference has prepared prototype bound beef samples A, B and C by mixing such meat pieces with (A) 1% sodium caseinate only, (B) only transglutaminase in an amount of 1 unit per 1 g meat or (C) 1% sodium caseinate and transglutaminase in an amount of 1unit per 1 g meat and then allowing each of the resulting mixtures to stand still at ordinary temperature for 30 minutes. Tensile strength (g/cm2) of each of the thus prepared prototype samples was measured using a rheometer manufactured by FudoKogyo Co., Ltd. Tensile strengths (g/cm2) of the three prototype samples were found to be A=25, B=41 and C=185, thus showing a pronounced synergistic effect caused by the combined use of transglutaminase and a casein. In general, binding of rawmaterials or cooking and processing performance of the bound product cannot be regarded as effective or acceptable when the tensile strength is less than 100 g/cm2. The enzyme preparation of this reference may further contain various optionalingredients, in addition to the essential active ingredients transglutaminase and caseins. One of such optional ingredients is a food filler. Any of common food fillers can be used without particular limitation, which include for example lactose,sucrose, maltitol, mannitol, sorbitol, dextrin, branched dextrin, cyclodextrin, glucose, starches such as potato starch, polysaccharides, gums, emulsifiers, pectin, oils and fats and the like. Of these, starches such as potato starch and brancheddextrin are particularly preferred because they do not exert influence on the binding effect of raw food materials by transglutaminase and casein and they have no taste or odor. These food fillers may be used singly or as a mixture of two or more. Suchfood fillers are useful for giving characteristic properties to foods, especially those properties required in addition to the binding capacity, such as a juicy feeling, a good throat-passing feeling and a soft eating touch even when the food is cooled. In addition to these food fillers such as branched dextrin and the like, the enzyme preparation of the present invention may also contain proteins other than caseins, as other optional component, which include soybean proteins such as isolated soybeanprotein, concentrated soybean protein, extracted soybean protein, defatted soybean protein and the like; wheat proteins such as wheat gluten and the like and wheat flour which contains wheat proteins; corn protein; and egg proteins such as albumen, eggalbumin and the like. These proteins also impart a binding function. The only actual example of the use of cheese material in the process is Example 29 wherein slices of cheese, meat and cucumber are layer with intermediate layers of the glue bondingthe layers together. The transglutaminase bonds the casein in the mixture into essentially a glue that adheres the layers together, forming a definitive seam line and adding distinct contents component into the seam line (e.g., the casein or saltcaseinate, and other ingredients within the glue).

U.S. Pat. No. 5,928,690 is directed to a process for improving the quality of pale, soft and exudative meat by treating meat with transglutaminase enzyme. The invention is particularly well suited for manufactured pork and turkey breastproducts such as canned or packaged hams and turkey breasts. The manufactured meat products have reduced cooking purge, improved binding of the muscle pieces and firmer texture. A process is disclosed for lessening, repairing or reversing the PSE(pale, soft and exudative) characteristics in meat, the process comprising treating a meat source having PSE characteristics with an aqueous solution consisting essentially of a selected quantity of transglutaminase at a temperature and for a timesufficient to lessen, repair or reverse the PSE characteristics of the meat source, the treating being prior to a curing procedure which includes cooking and/or smoking the meat source.

A number of patents or publications teach the use of the enzyme transglutaminase (also referred to hereafter as "TG"), also known as glutamate transaminase, to improve the water retention and texture of fish, fowl and animal meats, particularlyground or minced meats, soybean protein, egg albumin and casein containing products. For example, U.S. Pat. No. 4,917,904 to Wakameda et al. describes a process whereby TG is added to various meats, soybean protein, egg albumin or casein-containingmixtures to improve the texture thereof. Specifically, Wakameda et al. describe adding TG to ground fish meat, minced fish meat, fillet and lyophilized fish powder, ground or minced animal meat, and fowl and block meat to improve the water retention ofthe final ground or minced meat product. However, Wakameda et al. state that while TG enhances the water retention in such animal meat and fowl, the texture thereof becomes hard to masticate or chew. This difficulty in chewing the product is anundesirable property. Wakameda et al. do not teach the use of TG to lessen, reverse or repair the PSE condition or the effects of the PSE condition.

326

Examples of publications discussing TG effects include "Transglutaminase Mediated Polymerization of Crude Actomyosin Refined From Mechanically Deboned Poultry Meat", Akamittath and Ball, Journal of Muscle Foods 3, 1992, 1 14; and "Strength ofProtein Gels Prepared With Microbial Transglutaminase as Related to Reaction Conditions", Sakamoto, Kumazawa and Motoki, Journal of Food Science, Volume 59, No. 4, 1994.

European published patent application 0 333 528 describes the genetic alteration of micro-organisms to produce TG and the addition of such genetically altered micro-organisms to ground meats to improve the texture of the ground meat when it iscooked. Generally, the genetically altered micro-organisms are described as being used with ground beef, soya, and casein, among other substances, to prepare ground meat products, sausages and cheeses. This publication does not teach the use of theTG-producing micro-organisms to lessen, reverse or repair the PSE condition or the effects of the PSE condition.

A number of approaches have been described in the art to prevent the development of the PSE condition. Exemplary references include U.S. Pat. Nos. 4,190,100 and 4,551,338 to Wallace; Borchet et al., "Prevention of Pale, Soft Exudative PorcineMuscle Through Partial Freezing with Liquid Nitrogen Post-Mortem", J. Food Science 29 (2): 203 209 (1964); and E. J. Briskey, "Etiological Status and Associated Studies of Pale, Soft, Exudative Porcine Musculature", Adv. Food Research, 13: 159 167(1964). More recently, U.S. Pat. No. 5,085,615 to Gundlach et al. described the use of solid carbon dioxide to reduce the development of PSE characteristics in freshly killed meat. While the above cited-art describes various methods of preventing thedevelopment of PSE characteristics in meat, none of them describe a procedure for lessening, reversing or repairing the effects of PSE once it has occurred. That is, the art does not describe a process whereby meat cuts or chunks or grinds which havedeveloped or begun to develop PSE characteristics may be treated to lessen, reverse or repair the PSE process or the effects of the PSE process such that the quality of pale, soft and exudative (PSE) meat improves and becomes more nearly like those ofnormal meat.

Japanese patent publications describing the use of TG are No. 06261692A (preparation of animal feeds by allowing TG to act upon the meat of animals, fish and/or their by-products which are used as such feeds); No. 6225729A (addition of TG toground fish or cattle meat); No. 6197738A (addition of TG to ground meat for making hamburgers); No. 6113796A (addition of TG to paste food for making sausages or hamburgers of fish meats); No. 6090710A (using thrombin in combination with plasma protein,fibrinogen concentrate, fibrinogen or transglutaminase plasma); No. 5207864A (use of transglutaminase to improve meat color); No. 3210144A (use of transglutaminase with canned, or potted meat, fish, crab and scallop products); No. 2255060A (addingtransglutaminase to minced meat or fish paste products); No. 2100655A (addition of transglutaminase to ground fish meat); and No. 2100654A (addition of transglutaminase to ground `okiama` (Euphausia superba) fish to improve the water retention andsmoothness of the finished ground product). Additional Japanese patent publications describing the use of transglutaminase are Nos. 2100653A, 2100651A, 2086748A and 2079956A, all of which describe the use of transglutaminase with ground fish or meatpastes.

BRIEF DESCRIPTION OF THE INVENTION

A process improves the quality of recombined curd, milled cheese curds and/or cheese components by reducing voids and apparent lines of fracture in the recombined cheese, without the necessity of adding such volumes or types of materials into theproduct as would affect other aspects of quality such as taste. The process comprises combining segments of curds or cheese with a selected quantity of transglutaminase that coats surfaces of curd or cheese segments to be combined. The curds may bemilled cheese curds, and may be taken directly off-line in the manufacturing process 9 with or without cooling), and then combined with the transglutaminase, then fed into a form. The segments with the transglutaminase are stored at a temperature (andpressure) and for a time sufficient to fuse, bond, lessen, repair or reverse the apparent lines and voids between interfaces where the segments are in contact with each other, the application of the transglutaminase to at least some cheese segmentsoccurring before sufficient pressure has been applied to segments of cheese to be compacted to eliminate at least 70% of the air by volume between the segments of cheese, at least 80% of the air volume, at least 90% of the air volume, at least 95%, atleast 97%, at least 98% or 99%, and approaching 100% of air/gas elimination between sections to be restructured. The process may allow the segments of cheese to react with the transglutaminase for at least 5 minutes in a temperature range of between 32to 125° F. It is preferred to allow the reaction to occur undisturbed for at least two hours, at least 4 hours, and up to weeks and months before grading. It should be apparent to those skilled in the art that the transglutaminase remains in thepresence of the cheese, is never removed, and the reaction binding the proteins in the cheese by the transglutaminase will continue to effective completion. The transglutaminase has been found to be useful in various forms, including, but not limited tosolid and liquid

327

application media. As a solid, the transglutaminase may be provided in any active form (e.g., solid compound, salt, complex, encapsulate, mixture or blend and may be used in a pure or diluted state. Because of the activity level of thetransglutaminase, it is preferred to provide the active ingredient in a diluted form. In a solid format, the transglutamines in an active form may be diluted with any biotolerable solid (e.g., non-toxic filler), particularly those with no taste orflavor, or those with desired taste and flavor. Among the types of fillers that would be tolerable or desirable would be salts (e.g., common NaCl), carbonates (e.g., CaCO3, MgCO3, etc.), inorganic oxides (e.g., silica), microcellulose fibers,pulp fiber, etc. Certain fillers would be useful and satisfactory from a functional or taste standpoint, but might not be acceptable under USDA standards, or might require additional labeling or the like. In a solid form, the transglutaminase may bepresent as from 0.001 to 100% by weight of the solid, more likely in an amount of from 0.05 to 50% by weight of solid in the applied transglutaminase composition, or from 0.1 to 30% by weight solid, or from 2 to 25% by weight solid. The solid must beadded so that an effective amount of the transglutaminase is added to assist in and effect the joining of the curd or cheese units, which will be in part dependent upon the surface area of the curd or cheese that is available for, and needed for joiningand bonding. As the size of the cheese segments diminishes, the surface area/weight increases, but because the pieces are smaller, less surface area might have to be bonded to assure a firm product. In general, the active ingredient (transglutaminase)may be present as from 0.0001% to 2% by weight of curd and cheese weight, from 0.0001% to 1.0%, from 0.0001% to 0.5%, and 0.005 to 0.1% by weight of curd or cheese solid weight.

The transglutaminase might also be used, for example, in a solution, as in an aqueous solution, in which the transglutaminase might be present in the solution range of about 0.00001 0.05 parts per weight (or as 10 to 100,000 units oftransglutaminase per liter) of transglutaminase per gram of cheese product. The volume and/or amount of transglutaminase used per weight of cheese depends, in part, upon the surface area available from the materials to be combined (e.g., based uponstandard geometric calculations where surface area tends to be inversely proportional to segment size) and in part on the strength of the bond desired and the nature of the cheese itself, with different hardness levels of cheese and lesser flexibility inthe cheese components possibly needing greater pressure and higher concentrations of transglutaminase. Even when in a liquid carrier medium, with the transglutaminase as a solute, suspension or dispersion, the transglutamines does not act in the mannerof a paste, and should not merely be a physical glue between units or segments of curd or cheese, as in U.S. Pat. No. 5,518,742. There, transglutaminase is combined with protein (including caseine and other materials) to react with the protein andsome of the other materials to effectively form a paste or glue. This method tends to create lines of demarcation between segments (which may not be as undesirable where, as in the single example of cheese with cucumber and meat, the lines of separationof materials are already clearly identifiable). Some minor amount of protein (e.g., less than 50% total weight of solids, less than 40% total weight of solids, less than 30%, less than 20%, less than 10%, or less than 5% total weight of solids or totalweight of solids that may react with the transglutaminase, whether in solid or liquid form).

As is universally known, transglutaminase is an enzyme so-called "amine introducing system" which catalyzes introduction of primary amines, ammonia, hydroxylamine, diamino acids, monoamino acids, esters and the like into receptor proteins andpeptides such as casein, beta.-lactoglobulin, insulin and the like. In a system in which a protein to be used in the present invention is contained, it is known that this enzyme catalyzes a crosslink formation reaction in which the epsilon.-amino groupsof the lysine residues in the protein replace the glutamine amino groups (cf. Japanese Patent Publication (Kokoku) No. Hei 1-50382 and Japanese Patent Application Laying-Open (Kokai) No. Hei 1-27471, corresponding to U.S. Pat. No. 5,156,956).

It is known that transglutaminase is found with high activity in the liver of mammals such as guinea pigs and the like, as well as in several types of microorganisms, plants and fishes. Transglutaminase to be used in the present invention is notparticularly limited in its origin. That is, its origin is not restricted provided that the enzyme has a transglutaminase activity. Examples of useful transglutaminase include those originating from the guinea pig liver (Japanese Patent Publication(Kokoku) No. Hei 1-50382), from plants, from fishes (for example, those reported by N. Seki et al. in Abstract of Papers, 1988 Autumn Meeting of the Japanese Society of Scientific Fisheries, page 167, and in Abstract of Papers, 1990 Spring Meeting of theJapanese Society of Scientific Fisheries, page 219), and from microorganisms (Japanese Patent Application Laying-Open (Kokai) No. Hei 1-27471, op. cit.), as well as those prepared by means of recombinant DNA techniques (Japanese Patent ApplicationLaying-Open (Kokai) No. Hei 1-300889).

Transglutaminase can be classified into calcium-independent and calcium-dependent types. Examples of the former type include the aforementioned ones of microbial origin. Examples of the latter type include the aforementioned ones of guinea pigliver origin and of fish origin. Though both types of transglutaminase can

328

be used, the calcium-independent type is preferable from the viewpoint of application to a wide range of foods. Transglutaminase originating from a microorganism belonging tothe genus Streptoverticillium is particularly preferred, because it is calcium-independent and can be obtained easily at a low cost (Japanese Patent Application Laying-Open (Kokai) No. Hei 1-27471).

Though not particularly limited, an enzyme preparation of the present invention may generally contain transglutaminase in an amount of from 0.1 or from 1 to 50,000 units, preferably from 1 to 5,000 units of transglutaminase per 10 cm2 ofcurd or cheese surface area in the masses of curd or cheese to be combined. The transglutaminase should be applied in concentrations (e.g., essentially neat (pure component) or high concentrations greater than 1%, 5%, 10% by weight, greater than 20%,greater than 40%, greater than 50%, greater than 75%, greater than 80% by weight as compared to the total weight of the solids or solutions/mixture applied) that can assure even and sufficient distribution over the cheese segment surface. Thetransglutaminase may be spread over the surface of the curd in a number of different manners, as by mixing, tumbling, spraying, shaking, stirring, agitating, or any other physical method or associating the transglutaminase with the curd or cheese solid. As a matter of course, it is preferable to use highly purified transglutaminase in the present invention, whether in solid mixture or with a liquid carrier.

The process of the present invention generally comprises providing pieces, segments, or other partial sizes of curd or cheese (cured cheese) that are intended to be packaged into a larger size of curd or cheese material, combining the curds orcheese parts with sufficient transglutaminase as to provide a binding (crosslinking, coupling intermolecular chemical bonding) effective amount of transglutaminase per unit area of curd or cheese, then shaping the curd or cheese with sufficient reductionof air pressure (e.g., vacuum draw-down) pressure to compact the curds or cheese and remove gas (e.g., at least 90%, at least 95%, and near 100% removal of air from between surfaces being brought together for bonding). The gas (usually air) is removedfrom between adjacent surfaces when they are being joined. The level of pressure tends to be significantly lower than the traditional pressing (high pressure, shape compacting) used in cheese molding or pressing whey out of the intermediate cheeseprocessing. The pressure for example my be on the order of 1 15 pounds per square inch, or 1 10 pounds per square inch, or the like. Reduced air pressure or increased vacuum pressure is also a very convenient method for compacting the curds or cheese,alone, or in combination with physical pressure, as with draw-down and shrink wrap. The level of pressure used may be with a pressure reduction to 0.8 Torr (0.8 atmospheres), 0.7 Torr (0.7 Atm.), 0.6 Torr (0.6 atm.), 0.5 Torr (0.5 atm.), 0.4 or 0.3 Torr(0.4 or 0.3 Atm.) and the like or less.

The enzyme preparation of the present invention is used for example by directly applying it to the curds pieces, milled curd pieces, cheese pieces, and the like to be treated or by dissolving or suspending it in water and then mixing theresultant solution or suspension with the raw material. Especially, if the enzyme preparation is used by dissolving, dispersing or suspending it in water and then mixing the resulting solution or suspension with the curd pieces or cheese pieces, partialinactivation of the transglutaminase may occur due to its denaturation when the pH value of the solution or suspension is outside the stable pH range of transglutaminase or when the ionic strength of the solution or suspension is outside the stable ionicstrength range of the enzyme.

As for the former case, denaturation of transglutaminase can be prevented by incorporating into the enzyme preparation of the present invention a pH adjusting agent such as sodium hydrogencarbonate, sodium citrate, sodium phosphate or the like insuch an amount that the final pH of the enzyme preparation when dissolved or suspended in water is adjusted to within the stable pH range of transglutaminase. As for the latter case, denaturation of transglutaminase can be prevented by incorporatinginto the enzyme preparation of the present invention an electrolyte such as sodium chloride, potassium chloride or the like in such an amount that the final ionic strength of the enzyme preparation when dissolved or suspended in water is adjusted towithin the stable ionic strength range of transglutaminase. It is especially preferable to incorporating an electrolyte such as sodium chloride, potassium chloride or the like in advance into the enzyme preparation from the viewpoint of preventingdenaturation of transglutaminase. If desired, the enzyme preparation of the present invention, whether in solid or liquid form, may further contain appropriately seasonings, sugar, coloring agents, color fixing agents, ascorbic acid or salts thereof,emulsifiers, oils and fats and the like, as well as enzyme stabilizers such as calcium chloride, sodium sulfite, sodium bicarbonate and the like (Japanese Patent Application Laying-Open (Kokai) No. Hei 4-207194). The amount of any of these ingredientsshould not be sufficient to adversely alter the appearance, flavor, texture or other characteristics of the curds or cheese. 

DETAILED DESCRIPTION OF THE INVENTION

The present invention describes a process for forming relatively smaller pieces or segments of cheese into

329

relatively larger sizes of cheese by constructing or reconstructing or structuring a relatively large volume of cheese. The smaller piecesof cheese are associated with a solution containing a transaminase enzyme to form a pre-block of unbonded cheese segments and transglutaminase. That pre-block is then formed into a block or form of a marketable volume of cheese. The resulting block ormarketable volume has low air content (e.g., less than 5% total volume of air), with very few visible join lines, with stable binding between joined surfaces, and other stable physical characteristics in the resulting block or marketable volume. Theprocess is particularly beneficial in utilization with the newer processes of the art, particularly where taking intermediate size blocks of curds or cheese (e.g., at least 5 pounds (11.1 kg), at least 10 pounds (22 kg), at least 20 pounds (44 kg), atleast 30 pounds (66 kg), or at least 40 pounds (88 kg) of curds or cheese.

The invention may be described according to the following variations as a process for the structuring of a cheese portion comprising: providing portions of curd or cheese of a first average dimension and having a total surface area; adding acomposition comprising transglutaminase to at least five percent of said total surface area, said composition providing a bonding-sufficient amount of transglutaminase to said total surface area; pressing said portions together to eliminate air betweensaid portions while forming a volume of curds or cheese that is larger than an single portion of said portions of curds or cheese; and allowing said transglutaminase to bond said portions of curds or cheese together to form a unit of cheese. Thecomposition may comprise transglutaminase in the presence of less than a 1:1 weight ratio of casein or caseinate to transglutaminase, as the transglutaminase itself chemically bonds the proteins between curd or chese segments and does not requireadditional material to be present to form a paste. For example, the composition may comprise transglutaminase with less than 10% by weight of said transglutaminase composition comprising casein or caseinate. The transglutaminase may be provided to thecurds or cheese in an amount of about 0.01 10.0 units per gram of curd protein or cheese protein. The process, as noted above in greater detail, may operate in a time frame in which said curds or cheese are allowed to bond is in the range of about 10 80hours at a temperature is between 40° F. and 125° F. It is convenient to have the transglutaminase provided as a solid mixture of transglutaminase and inorganic filler at a concentration in the range of about 0.02 5 units oftransglutaminase per gram of curds or cheese protein.

Another way of generally describing a process of the invention for the structuring of a cheese portion comprises breaking a single curd portion having a weight of between 2 and 40 kilograms into smaller segments of curd; adding a compositioncomprising transglutaminase to the smaller segments of curd in an amount of transglutaminase sufficient to chemically bond the smaller segments of curd together; pressing the segments of curd together to compact and/or shape (e.g., with elimination ofair between the portions) the curds while forming a volume of curds that is larger than 50 kilograms; and allowing said transglutaminase to bond said segments of curds together. The process may allow the transglutaminase to bond segments of curdstogether during a storage (curing, aging, reaction, or holding process step) for at least two hours (up to weeks and months) at a temperature between 40° F. and 125° F. The process causes segments of curd cure to form cheese during saidtransglutaminase to bond said segments of curds together during the storage step, the step enabling the formation of chemical bonds between smaller portions of curd linked by the transglutaminase. The process may have the transglutaminase added as asolid composition to said smaller segments of curds, although a liquid carrier may be used. The solid composition of transglutaminase may comprise a mixture of transglutaminase and inorganic solid. The transglutaminase may be added to said smallersegments of curd in an amount of 0.001 to 0.5% by weight of transglutaminase to said smaller curd segments, as noted above. The process may have the transglutaminase added to the smaller curd segments by a physical process including at least one stepselected from the group consisting of tumbling, stirring, agitation, spraying, stirring, and shaking. The process may use, for example, a composition comprising transglutaminase with from 0 10% by weight of transglutaminase of protein. Where thecomposition comprising transglutaminase comprises transglutaminase in an aqueous carrier, the composition may be free of ingredients that will chemically bond with said transglutaminase, or have less than an amount that would bond with 50%, or have lessthan an amount that would bond with 20% of available bonding sites on the transglutaminase. The process allows the smaller segments of curd to be chemically bonded by said transglutaminase reacting solely with protein in said smaller curd segments,rather than with a material added in the transglutaminase composition to form a paste or glue.

The enzyme transglutaminase (glutamate transaminase; R-glutaminyl peptide amine gamma-glutamyl transferase; protein-glutamine, amine-gamma-glutamyltransferase) or TG is a Ca2 dependent enzyme which catalyzes crosslinking reactions in meatand plant proteins. These reactions lead to the formation of intra- and inter-molecular covalent bonds which are significantly stronger than normal hydrogen bonding between proteins. The protein crosslinking process which occurs with the use of TGresults in bonding the smaller segments of cheese without cooking or high pressure, thus restoring normal functionality and appearance and USDA gradability to cheese parts, segments, trim or waste. This process thereby improves the characteristics andtherefore the value of the substantial volume of waste, trim, parts or segments of cheese

330

that is produces in conventional cheese manufacture.

Although it is preferable that the transglutaminase (TG) used in practicing the invention be a highly purified product, crude products such as those obtained from bovine, equine and swine plasma or liver extracts may also be used. Thoseobtainable as bacterial preparations or fermentations may be used as well. The transglutaminase used in the examples given herein could be obtained from Sigma Chemical Company, St. Louis, Mo. (catalogue number T5398; Enzyme Commission (EC Number EC2.3.2.13, guinea pig liver). The enzyme could be purchased as vials containing 0.5 unit TG per vial. The TG containing solutions used herein could be prepared by combining 21 ml distilled water with the contents of each vial to give a transglutaminasesolution containing 0.0238 units of TG per ml of solution.

The amount of transglutaminase used in practicing the invention may range between an effective amount and an amount that is economically justified, with increasing amounts tending to decrease the treatment time in a substantially linear manner. Typical concentrations of transglutaminase can range from at least about 0.001 or 0.005 unit/g of curd or cheese protein being processed to about 10 50 units/g of curd or cheese protein. A typical range of transglutaminase is between about 0.02 andabout 5 units/g of curd or cheese protein. When costs are not prohibitive, an advantageous amount is between about 1 and about 5 units/g of cheese protein. The time for which the meat is cured or incubated in a TG containing solution may range fromabout 160 hours to about 5 minutes. The exact time will be dependent of the amount or concentration of transglutaminase in the added solid material or added processing solution, the temperature of the cheese mass and the total surface area of cheesealong which bonding is to be effected. Generally, when the transglutaminase is present in an amount of about 0.02 unit/g cheese (or curd) protein being processed, a curing or incubating time of about 24 48 hours is used in practicing the invention. Thecuring or incubating temperature may be in the range of about 32 125° F. A temperature of about 38 110° F. or 60 110, or 70 100 is especially useful. Transglutaminase treatments can incorporate known procedures for facilitating physicaldistribution of the transglutaminase to the surface of the curds or cheese parts, as by spraying, tumbling, dusting, mixing, agitating, or the like.

FIELD OF THE INVENTION

This invention relates to a process for preparing a protein based acid beverage by the use of an ultra high pressure homogenization which causes the formation of smaller particles. The acid beverage obtained is smooth, tasteful, palatable andhas good storage stability.

BACKGROUND OF THE INVENTION

The use of vegetable protein, especially soy protein, is receiving greater attention due to its health benefit claims. There is an increased interest to develop technology to incorporate soy protein into juice type acid beverages. The concern,however, is the suspendibility of soy protein in acidic beverages at or near its isoelectric point where the solubility of soy protein is at a minimum. Soy protein will naturally precipitate over time due to gravitational forces based on Stokes' Law. The rate of the formed sediment is proportional to the diameter of the soy protein, coupled with the viscosity of the acid beverage. High viscosity and smaller particles will suppress the development of sediment. A process method, in addition to theuse of a stabilizer, will greatly suppress the rate of sediment formation. The processing method employed is homogenization of the fully formulated acid beverage by the use of an ultra high pressure homogenization of up to 30,000 pounds per square inch

Stokes' Law is an equation relating the terminal settling velocity of a smooth, rigid sphere in a viscous fluid of known density and viscosity to the diameter of the sphere, when subjected to a known force. Stokes' Law will correctly predictthat for two small steel balls, one having a radius exactly twice the other, the bigger ball will fall through a fluid of known viscosity four times faster than the smaller ball does through a fluid of the same viscosity. The bigger ball has eight timesthe weight and twice the drag force for the same velocity, and the drag force is proportional to the velocity.

Juices and other acidic juice-like beverages are popular commercial products. Consumer demand for nutritional healthy beverages has led to the development of nutritional juice or juice-like beverages containing protein. The protein providesnutrition in addition to the nutrients provided by the components of the beverage. Recently it has been discovered that certain proteins have specific health benefits beyond providing nutrition. For example, soy protein has been recognized by theUnited States Food and Drug Administration as being effective to lower blood cholesterol concentrations in conjunction with a healthy diet. In response, there has been a growing consumer demand for acidic juice-like beverages containing proteins thatprovide such specific health benefits.

331

A hurdle to adding protein to acidic beverages, however, is the relative insolubility of proteins in an aqueous acidic environment. Most commonly used proteins, such as soy proteins and casein, have an isoelectric point at an acidic pH. Thus,the proteins are least soluble in an aqueous liquid at or near the pH of acidic beverages. For example, soy protein has an isoelectric point at pH 4.5 and casein has an isoelectric point at a pH of 4.7, while most common juices have a pH in the range of3.7 to 4.0. As a result, protein tends to settle out as a sediment in an acidic protein-containing beverage-an undesirable quality in a beverage.

Protein stabilizing agents that stabilize proteins as a suspension in an aqueous acidic environment are used to overcome some of the problems presented by protein insolubility. Pectin is a commonly used protein stabilizing agent.

Pectin, however, is an expensive food ingredient, and manufacturers of aqueous acidic beverages containing protein desire less expensive stabilizers, where the amount of required pectin is either reduced or removed in favor of less expensivestabilizing agents.

U.S. Pat. No. 5,232,726 (Clark et al., Aug. 3, 1993) relates to a method for extending the shelf life of juices, particularly citrus juice such as orange juice, without pasteurization, by subjecting the juice to an ultra high pressurehomogenization step of 15,000 pounds per square inch or greater.

U.S. Pat. No. 5,286,511 (Klavons et al., Feb. 15, 1994) provides a beverage such as orange juice that is clouded by a suspension of soy protein particles, where the protein particles are prevented from aggregating to the point of settling outby pectin. Pectin inhibits the protein from settling by adsorbing to individual protein particles and imparting an overall negative charge to the protein particles, resulting in repulsion of the particles from one another, and thereby preventing theprotein particles from aggregating and settling out of the suspension. Pectin also increases the viscosity of the beverage, which helps stabilize protein particles against gravitational forces.

U.S. Pat. No 6,696,084 (Pace et al., Feb. 24, 2004) relates to a spray drying process for the preparation of pharmaceutical compositions containing small particles of phospholipid-stabilized fenofibrate. Prior to spray drying, a heatedsuspension of molten fenofibrate is subjected to a two stage homogenization. The first pressure stage is from 2000 to 30,000 pounds per square inch.

U.S. Pat. No 6,221,419 (Gerrish, Apr. 24, 2001) relates to a pectin for stabilizing proteins particularly for use in stabilizing proteins present in aqueous acidified milk drinks. It must be understood that the inclusion of pectin has bothdesirable and undesirable effects on the properties of acidified milk drinks. While pectin can act as a stabilizer against sedimentation of casein particles or whey separation, it can have the disadvantage of increasing the viscosity of the drink due toits cross-linking with naturally co-present calcium cations rendering the drink unpalatable. It will be seen that in the absence of pectin, there is significant sedimentation in the case of both drinks caused by the instability of the casein particleswhich also results in relatively high viscosity. After a certain concentration of pectin has been added, the casein particles become stabilized against sedimentation after which increasing the pectin concentration has little effect on sedimentation. Turning to the viscosity of the drinks, this also significantly drops on stabilisation of the casein particles but then almost immediately begins to rise again due to cross-linking of the excess pectin added by the co-present calcium cations. Thisincreased viscosity is undesirable as it leads to the beverage having poor organoleptic properties. This range may be as narrow as only 0.06% by weight of pectin based upon the beverage weight as a whole. Below this working range, sedimentation is asignificant problem, whereas above it, the viscosity of the beverage is undesirably high.

SUMMARY OF THE INVENTION

This invention is directed to a process for preparing a stable suspension of a protein material in an acidic beverage, comprising;

forming a preblend (I) by mixing

(A) a hydrated protein stabilizing agent and

(B) at least one flavoring material comprising a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid, glucono delta lactone or phosphoric acid; and

mixing preblend (I) and

332

(C) a hydrated and homogenized protein material slurry wherein the homogenization is carried out in two stages comprising a high pressure stage of from 1500 5000 pounds per square inch and a low pressure stage of from 300 1000 pounds per squareinch; to form a blend; and

pasteurizing and homogenizing the blend wherein the homogenization of the blend is carried out in two stages comprising a high pressure stage of from 8000 30,000 pounds per square inch and a low pressure stage of from 300 1000 pounds per squareinch;

wherein the acid beverage composition has a pH of from 3.0 to 4.5.

In a second embodiment, the invention is directed to a process for preparing a stable suspension of a protein material in an acidic beverage, comprising;

forming a preblend (I) by mixing

(A) a hydrated protein stabilizing agent and

(B) at least one flavoring material comprising a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid, glucono delta lactone or phosphoric acid; and

forming a preblend (II) by mixing

(A) a hydrated protein stabilizing agent; and

(C) a hydrated and homogenized protein material slurry wherein the homogenization is carried out in two stages comprising a high pressure stage of from 1500 5000 pounds per square inch and a low pressure stage of from 300 1000 pounds per squareinch; and

mixing preblend (I) and preblend (II) to form a blend; and

pasteurizing and homogenizing the blend wherein the homogenization of the blend is carried out in two stages comprising a high pressure stage of from 8000 30,000 pounds per square inch and a low pressure stage of from 300 1000 pounds per squareinch;

wherein the acid beverage composition has a pH of from 3.0 to 4.5. 

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a block flow diagram of an industry wide process for producing a typical protein containing acid beverage wherein a dry protein is hydrated as a protein slurry and a dry stabilizing agent is hydrated as a stabilizing agent slurry andthe two slurries are blended together and the remaining ingredients added followed by pasteurization and homogenization.

FIG. 2 is a block flow diagram of one embodiment of the invention for producing a protein containing acid beverage wherein a dry stabilizing agent is hydrated as a stabilizing agent slurry and a flavoring material added to the stabilizing agentslurry to form a preblend (I) slurry. A protein slurry is hydrated and homogenized to form Component (C). The preblend (I) slurry and Component (C) are blended together followed by pasteurization and homogenization in accordance with the principles ofthe invention.

FIG. 3 is a block flow diagram of another embodiment of the invention for producing a protein containing acid beverage wherein a dry stabilizing agent is hydrated as a stabilizing agent slurry and a flavoring material is added to the stabilizingagent slurry to form a preblend (I) slurry and a dried protein is hydrated to a protein slurry and a dry stabilizing agent is added and homogenized to form a preblend (II) slurry. The preblend (I) slurry and the preblend (II) slurry are blended togetherfollowed by pasteurization and homogenization in accordance with the principles of the invention.

DETAILED DESCRIPTION OF THE INVENTION

A protein based acid beverage is normally stabilized by a stabilizing agent that provides a stable suspension through possible steric stabilization and electrostatic repulsive mechanism. FIG. 1 refers to the normal processing conditions ofprotein stabilized acid beverages. At 1, a stabilizing agent is either hydrated

333

separately into a 2 3% slurry or blended with sugar to give a stabilizing agent slurry having a pH of 3.5. At 5, dry protein powder is first dispersed in water at ambienttemperature and hydrated at an elevated temperature for a period of time. The pH at 5 is about neutral. The hydrated stabilizing agent slurry from 1 and the hydrated protein slurry from 5 are mixed together at 10 for 10 minutes under agitation. The pHat 10 is about 7. Other ingredients such as additional sugar, fruit juices or vegetable juice, and various acids such as phosphoric acid, ascorbic acid citric acid, etc., are added at 20 to bring the pH to about 3.8. The contents are pasteurized at195° F. for 30 seconds and then homogenized first at 2500 pounds per square inch and then at 500 pounds per square inch at 30. Containers are hot filled and cooled at 40 to give the product at 50 with a pH of 3.8. The problem with this methodis that after the stabilizing agent is mixed with the protein, the pH of the blend is close to neutral, and the stabilizing agent is potentially degraded by beta-elimination, especially under heat. This causes a decrease in the molecular weight of thestabilizing agent and the ability of the stabilizing agent to stabilize the proteins when the pH is later lowered even more is greatly reduced. The stabilizing agent is only stable at room temperature. As the temperature increases, beta eliminationbegins, which results in chain cleavage and a very rapid loss of the ability of the stabilizing agent to provide a stable suspension.

In the present invention, a hydrated protein stabilizing agent (A) and a flavoring material (B) are combined as a preblend (I) and combined with either a slurry of a homogenized protein material (C) or a homogenized preblend (II) of a hydratedprotein stabilizing agent (A) and a slurry of a protein material (C). FIG. 2 and FIG. 3 refer to the processing conditions of the present invention.

FIG. 2 outlines the first process of this invention. A stabilizing agent is hydrated into a 0.5 10% dispersion with or without sugar at 101. The pH at 101 is 3.5. At 102, the flavoring material (B) such as additional sugar, fruit juices,vegetable juices, various acids such as phosphoric acid, ascorbic acid, citric acid, etc. are added and the contents mixed at an elevated temperature to form preblend (I). A protein slurry is prepared at 104 from a dry protein material. The slurry ishomogenized at 105 to give component (C), wherein the homogenization is carried out in two stages comprising a high pressure stage of from 1500 5000 pounds per square inch and a low pressure stage of from 300 1000 pounds per square inch. The pH at 105is about neutral. The homogenized slurry from 5 and preblend (I) from 102 are blended together at 110 with additional acid to a pH of 3.8. At 130, the contents are pasteurized at a temperature of 180° F. for 30 seconds and homogenized in twostages--a high pressure stage of from 8000 30,000 pounds per square inch and a low pressure stage of from 300 1000 pounds per square inch. Containers are hot filled and cooled at 140 to give the product at 150 with a pH of 3.8.

FIG. 3 outlines the second process of this invention. In FIG. 3, a stabilizing agent is hydrated into a 0.5 10% dispersion with or without sugar at 201. The pH at 201 is 3.5. At 202, the flavoring material (B) such as additional sugar, fruitjuices, vegetable juices, various acids such as phosphoric acid, ascorbic acid, citric acid, etc. are added and the contents mixed at an elevated temperature to form preblend (I). A protein slurry from a dry protein material is hydrated at 204 andhomogenized at 205, wherein the homogenization is carried out in two stages comprising a high pressure stage of from 1500 5000 pounds per square inch and a low pressure stage of from 300 1000 pounds per square inch. The pH at 205 is about neutral. Astabilizing agent slurry is prepared at 203 and combined with the homogenized slurry from 205 to give preblend (II) at 206. Preblend (I) from 202 and preblend (II) from 206 are blended together at 210 with additional acid to a pH of 3.8. At 230, thecontents are pasteurized at a temperature of 180° F. for 30 seconds and homogenized in two stages--a high pressure stage of from 8000 30,000 pounds per square inch and a low pressure stage of from 300 1000 pounds per square inch. Containers arehot filled and cooled at 240 to give the product at 250 with a pH of 3.8.

Component (A)

The present invention employs a stabilizing agent and the stabilizing agent is a hydrocolloid comprising alginate, microcrystalline cellulose, jellan gum, tara gum, carrageenan, guar gum, locust bean gum, xanthan gum, cellulose gum and pectin. Apreferred hydrocolloid is pectin. As used herein, the term "pectin" means a neutral hydrocolloid that consists mainly of partly methoxylated polygalacturonic acid. The term "high methoxyl pectin" as used herein means a pectin having a degree ofmethoxyl esterification of fifty percent (50%) or greater. High methoxyl (HM) pectins useful in the present invention are commercially available. One supplier is Copenhagen Pectin A/S, a division of Hercules Incorporated, DK-4623, Lille Skensved,Denmark. Their products are identified as Hercules YM100L, Hercules YM100H, Hercules YM115L, Hercules YM115H and Hercules YM150H. Hercules YM100L contains about 56% galacturonic acid, where about 72% (. -.2%) of the galacturonic acid is methylated. Another supplier is Danisco A/S of Copenhagen, Denmark and they supply AMD783.

334

It is necessary to hydrate the stabilizing agent (A), prior to preparing the acid beverage. Water is added in sufficient quantity to form a slurry in order to hydrate the stabilizing agent. The slurry is mixed at room temperature under highshear and heated to 140 180° F. for an additional 10 minutes. At this solids concentration, the most complete hydration is obtained in the stabilizing agent. Thus, the water in the slurry is used most efficiently at this concentration. Asweetener may be added at this point or later or a portion of the sweetener added here and also added later. Preferred sweeteners comprise sucrose, corn syrup, and may include dextrose and high fructose corn syrup and artificial sweeteners.

Component (B)

A protein material by itself can have an undesired aftertaste or undesired flavors. The function of the flavoring material (B) is to mask any adverse flavors of the protein material (C) and to give a pleasant taste to the acid beveragecomposition. The flavoring material (B) comprises a fruit juice, a vegetable juice, citric acid, malic acid, tartaric acid, lactic acid, ascorbic acid, glucone delta lactone, phosphoric acid or combinations thereof.

As a juice, the fruit and/or vegetable may be added in whole, as a liquid, a liquid concentrate, a puree or in another modified form. The liquid from the fruit and/or vegetable may be filtered prior to being used in the juice product. The fruitjuice can include juice from tomatoes, berries, citrus fruit, melons and/or tropical fruits. A single fruit juice or fruit juice blends may be used. The vegetable juice can include a number of different vegetable juices. Examples of a few of the manyspecific juices which may be utilized in the present invention include juice from berries of all types, currants, apricots, peaches, nectarines, plums, cherries, apples, pears, oranges, grapefruits, lemons, limes, tangerines, mandarin, tangelo, bananas,pineapples, grapes, tomatoes, rhubarbs, prunes, figs, pomegranates, passion fruit, guava, kiwi, kumquat, mango, avocados, all types of melon, papaya, turnips, rutabagas, carrots, cabbage, cucumbers, squash, celery, radishes, bean sprouts, alfalfasprouts, bamboo shoots, beans and/or seaweed. As can be appreciated, one or more fruits, one or more vegetables, and/or one or more fruits and vegetables, can be included in the acid beverage to obtain the desired flavor of the acid beverage.

Fruit and vegetable flavors can also function as the flavoring material (B). Fruit flavoring has been found to neutralize the aftertaste of protein materials. The fruit flavoring may be a natural and/or artificial flavoring. As can beappreciated, the fruit flavoring is best when used with other flavoring materials such as vegetable flavoring to enhance the characterizing flavor of the acid beverage and also to mask any undesirable flavor notes that may derive from the proteinmaterial.

Component (C)

The protein material of the process of the present invention may be any vegetable or animal protein that is at least partially insoluble in an aqueous acidic liquid, preferably in an aqueous acidic liquid having a pH of from 3.0 to 5.5, and mostpreferably in an aqueous acidic liquid having a pH of from 3.5 to 4.5. As used herein a "partially insoluble" protein material is a protein material that contains at least 10% insoluble material, by weight of the protein material, at a specified pH. Preferred protein materials useful in the composition of the present invention include soy protein materials, casein or caseinates, corn protein materials--particularly zein, and wheat gluten. Preferred proteins also include dairy whey protein(especially sweet dairy whey protein), and non-dairy-whey proteins such as bovine serum albumin, egg white albumin, and vegetable whey proteins (i.e., non-dairy whey protein) such as soy protein.

Soybean protein materials which are useful with the present invention are soy flour, soy concentrate, and, most preferably, soy protein isolate. The soy flour, soy concentrate, and soy protein isolate are formed from a soybean starting materialwhich may be soybeans or a soybean derivative. Preferably the soybean starting material is either soybean cake, soybean chips, soybean meal, soybean flakes, or a mixture of these materials. The soybean cake, chips, meal, or flakes may be formed fromsoybeans according to conventional procedures in the art, where soybean cake and soybean chips are formed by extraction of part of the oil in soybeans by pressure or solvents, soybean flakes are formed by cracking, heating, and flaking soybeans andreducing the oil content of the soybeans by solvent extraction, and soybean meal is formed by grinding soybean cake, chips, or flakes.

The soy flour, soy concentrate and soy protein isolate are described below as containing a protein range based upon a "moisture free basis" (mfb).

Soy flour, as that term is used herein, refers to a comminuted form of defatted soybean material, preferably containing less than 1% oil, formed of particles having a size such that the particles can pass through a No.

335

100 mesh (U.S. Standard)screen. The soy cake, chips, flakes, meal, or mixture of the materials are comminuted into a soy flour using conventional soy grinding processes. Soy flour has a soy protein content of about 49% to about 65% on a moisture free basis (mfb). Preferablythe flour is very finely ground, most preferably so that less than about 1% of the flour is retained on a 300 mesh (U.S. Standard) screen.

Soy concentrate, as the term is used herein, refers to a soy protein material containing about 65% to about 72% of soy protein (mfb). Soy concentrate is preferably formed from a commercially available defatted soy flake material from which theoil has been removed by solvent extraction. The soy concentrate is produced by an acid leaching process or by an alcohol leaching process. In the acid leaching process, the soy flake material is washed with an aqueous solvent having a pH at about theisoelectric point of soy protein, preferably at a pH of about 4.0 to about 5.0, and most preferably at a pH of about 4.4 to about 4.6. The isoelectric wash removes a large amount of water soluble carbohydrates and other water soluble components from theflakes, but removes little of the protein and fiber, thereby forming a soy concentrate. The soy concentrate is dried after the isoelectric wash. In the alcohol leaching process, the soy flake material is washed with an aqueous ethyl alcohol solutionwherein ethyl alcohol is present at about 60% by weight. The protein and fiber remain insoluble while the carbohydrate soy sugars of sucrose, stachyose and raffinose are leached from the defatted flakes. The soy soluble sugars in the aqueous alcoholare separated from the insoluble protein and fiber. The insoluble protein and fiber in the aqueous alcohol phase are dried.

Soy protein isolate, as the term is used herein, refers to a soy protein material containing at least about 90% or greater protein content, and preferably from about 92% or greater protein content (mfb). Soy protein isolate is typically producedfrom a starting material, such as defatted soybean material, in which the oil is extracted to leave soybean meal or flakes. More specifically, the soybeans may be initially crushed or ground and then passed through a conventional oil expeller. It ispreferable, however, to remove the oil contained in the soybeans by solvent extraction with aliphatic hydrocarbons, such as hexane or azeotropes thereof, and these represent conventional techniques employed for the removal of oil. The defatted soyprotein material or soybean flakes are then placed in an aqueous bath to provide a mixture having a pH of at least about 6.5 and preferably between about 7.0 and 10.0 in order to extract the protein. Typically, if it is desired to elevate the pH above6.7, various alkaline reagents such as sodium hydroxide, potassium hydroxide and calcium hydroxide or other commonly accepted food grade alkaline reagents may be employed to elevate the pH. A pH of above about 7.0 is generally preferred, since analkaline extraction facilitates solubilization of the protein. Typically, the pH of the aqueous extract of protein will be at least about 6.5 and preferably about 7.0 to 10.0. The ratio by weight of the aqueous extractant to the vegetable proteinmaterial is usually between about 20 to 1 and preferably a ratio of about 10 to 1. In an alternative embodiment, the vegetable protein is extracted from the milled, defatted flakes with water, that is, without a pH adjustment.

It is also desirable in obtaining the soy protein isolate used in the present invention, that an elevated temperature be employed during the aqueous extraction step, either with or without a pH adjustment, to facilitate solubilization of theprotein, although ambient temperatures are equally satisfactory if desired. The extraction temperatures which may be employed can range from ambient up to about 120° F. with a preferred temperature of 90° F. The period of extraction isfurther non-limiting and a period of time between about 5 to 120 minutes may be conveniently employed with a preferred time of about 30 minutes. Following extraction of the vegetable protein material, the aqueous extract of protein can be stored in aholding tank or suitable container while a second extraction is performed on the insoluble solids from the first aqueous extraction step. This improves the efficiency and yield of the extraction process by exhaustively extracting the protein from theresidual solids from the first step.

The combined, aqueous protein extracts from both extraction steps, without the pH adjustment or having a pH of at least 6.5, or preferably about 7.0 to 10, are then precipitated by adjustment of the pH of the extracts to, at or near theisoelectric point of the protein to form an insoluble curd precipitate. The actual pH to which the protein extracts are adjusted will vary depending upon the vegetable protein material employed but insofar as soy protein, this typically is between about4.0 and 5.0. The precipitation step may be conveniently carried out by the addition of a common food grade acidic reagent such as acetic acid, sulfuric acid, phosphoric acid, hydrochloric acid or with any other suitable acidic reagent. The soy proteinprecipitates from the acidified extract, and is then separated from the extract. The separated protein may be washed with water to remove residual soluble carbohydrates and ash from the protein material. The separated protein is then dried usingconventional drying means to form a soy protein isolate. Soy protein isolates are commercially available from Solae.RTM. LLC, for example, as SUPRO.RTM. PLUS 675, FXP 950, FXP H0120, SURPO.RTM. XT 40, SUPRO.RTM. 710 and SUPRO.RTM. 720.

Preferably the protein material used in the present invention, is modified to enhance the characteristics of

336

the protein material. The modifications are modifications which are known in the art to improve the utility or characteristics of aprotein material and include, but are not limited to, denaturation and hydrolysis of the protein material.

The protein material may be denatured and hydrolyzed to lower the viscosity. Chemical denaturation and hydrolysis of protein materials is well known in the art and typically consists of treating a protein material with one or more alkalinereagents in an aqueous solution under controlled conditions of pH and temperature for a period of time sufficient to denature and hydrolyze the protein material to a desired extent. Typical conditions utilized for chemical denaturing and hydrolyzing aprotein material are: a pH of up to about 10, preferably up to about 9.7; a temperature of about 50° C. to about 80° C. and a time period of about 15 minutes to about 3 hours, where the denaturation and hydrolysis of the protein materialoccurs more rapidly at higher pH and temperature conditions.

Hydrolysis of the protein material may also be effected by treating the protein material with an enzyme capable of hydrolyzing the protein. Many enzymes are known in the art which hydrolyze protein materials, including, but not limited to,fungal proteases, pectinases, lactases, and chymotrypsin. Enzyme hydrolysis is effected by adding a sufficient amount of enzyme to an aqueous dispersion of protein material, typically from about 0.1% to about 10% enzyme by weight of the proteinmaterial, and treating the enzyme and protein dispersion at a temperature, typically from about 5° C. to about 75° C., and a pH, typically from about 3 to about 9, at which the enzyme is active for a period of time sufficient to hydrolyzethe protein material. After sufficient hydrolysis has occurred the enzyme is deactivated by heating, and the protein material is precipitated from the solution by adjusting the pH of the solution to about the isoelectric point of the protein material. Enzymes having utility for hydrolysis in the present invention include, but are not limited to, bromelain and alcalase.

Casein protein materials useful in the process of the present invention are prepared by coagulation of a curd from skim milk. The casein is coagulated by acid coagulation, natural souring, or rennet coagulation. To effect acid coagulation ofcasein, a suitable acid, preferably hydrochloric acid, is added to milk to lower the pH of the milk to around the isoelectric point of the casein, preferably to a pH of from 4.0 to 5.0, and most preferably to a pH of from 4.6 to 4.8. To effectcoagulation by natural souring, milk is held in vats to ferment, causing lactic acid to form. The milk is fermented for a sufficient period of time to allow the formed lactic acid to coagulate a substantial portion of the casein in the milk. To effectcoagulation of casein with rennet, sufficient rennet is added to the milk to precipitate a substantial portion of the casein in the milk. Acid coagulated, naturally soured, and rennet precipitated casein are all commercially available from numerousmanufacturers or supply houses.

Corn protein materials that are useful in the present invention include corn gluten meal, and most preferably, zein. Corn gluten meal is obtained from conventional corn refining processes, and is commercially available. Corn gluten mealcontains about 50% to about 60% corn protein and about 40% to about 50% starch. Zein is a commercially available purified corn protein which is produced by extracting corn gluten meal with a dilute alcohol, preferably dilute isopropyl alcohol.

Wheat protein materials that are useful in the process of the present invention include wheat gluten. Wheat gluten is obtained from conventional wheat refining processes, and is commercially available.

A particularly preferred modified soy protein material is a soy protein isolate that has been enzymatically hydrolyzed and deamidated under conditions that expose the core of the proteins to enzymatic action as described in European Patent No. 0480 104 B 1, which is incorporated herein by reference. Briefly, the modified protein isolate material disclosed in European Patent No. 0 480 104 B1 is formed by: 1) forming an aqueous slurry of a soy protein isolate; 2) adjusting the pH of the slurryto a pH of from 9.0 to 11.0; 3) adding between 0.01 and 5% of a proteolytic enzyme to the slurry (by weight of the dry protein in the slurry); 4) treating the alkaline slurry at a temperature of 10° C. to 75° C. for a time periodeffective to produce a modified protein material having a molecular weight distribution (Mn) between 800 and 4000 and a deamidation level of between 5% to 48% (typically between 10 minutes to 4 hours); and deactivating the proteolytic enzyme by heatingthe slurry above 75° C. The modified protein material disclosed in European Patent No. 0 480 104 B1 is commercially available from Solae, LLC of St. Louis, Mo.

It is necessary to hydrate the protein material (C), prior to preparing the acid beverage. Water is added in sufficient quantity to form a slurry in order to hydrate the protein material. The slurry contains from 5 20% by weight solids based onthe weight of the slurry, with the remainder being water. More preferably, the slurry (C) contains from 8 18 by weight solids. Most preferably the slurry (C) contains from 10 15% by weight solids. The slurry is mixed at room temperature under highshear and heated to 140 180° F. for an additional

337

10 minutes to hydrate the protein. At this solids concentration, the most complete hydration is obtained in the protein. Thus, the water in the slurry is used most efficiently at thisconcentration.

Once the protein material is hydrated, it then is homogenized. Homogenization serves to decrease the particle size of the protein in the protein slurry (C). Preferably the slurry is transferred to a Gaulin homogenizer (model 15MR) and ishomogenized in two stages, a high pressure stage and a low pressure stage. The high pressure stage is from 1500 5000 pounds per square inch and preferably from 2000 3000 pounds per square inch. The low pressure stage is from 300 1000 pounds per squareinch and preferably from 400 700 pounds per square inch.

Acid Beverage Compositions

Examples A and B are baseline process examples as defined within FIG. 1. Example A is a 6.25 grams protein per 8 oz serving fortified juice beverage. Example B is a 3.0 grams protein per 8 oz serving fortified juice beverage.

EXAMPLE A

A 6.25 g protein per 8 oz serving fortified juice beverage is made using Supro.RTM. Plus 675 made by Solae.RTM. LLC.

Added to a vessel are 5494 g of distilled water followed by 332 g of Supro Plus 675. The contents at 5.70% solids are dispersed under medium shear, mixed for 5 minutes, followed by heating to 170° F. for 10 minutes to give a proteinsuspension slurry. In a separate vessel, 60 grams of pectin (YM-100L) are dispersed into 2940 grams of distilled water under high shear to give a 2% pectin dispersion. The dispersion is heated to 170° F. until no lumps are observed. The pectindispersion is added into the protein suspension slurry and mixed for 5 minutes under medium shear. This is followed by the addition of 27 grams of citric acid, 27 grams of phosphoric acid, 210 grams of concentrated apple juice and 1000 grams of sugar. The contents are mixed for 5 minutes under medium shear. The pH of this mixture at room temperature is in the range of 3.8 4.0. The contents are pasteurized at 195° F. for 30 seconds, and homogenized at 3000 pounds per square inch in the firststage and 500 pounds per square inch in the second stage to give a protein stabilized acid beverage. Bottles are hot filled with the beverage at 180 185° F. The bottles are inverted, held for 2 minutes and then placed in ice water to bring thetemperature of the contents to about room temperature. After the contents of the bottles are brought to about room temperature, the bottles are stored at room temperature for 6 months.

EXAMPLE B

A 3.0 g protein per 8 oz serving fortified juice beverage is made using Supro.RTM. Plus 675 made by Solae.RTM. LLC.

The procedure of Example A is repeated except that 332g Supro Plus 675 is replaced with 153 g Supro Plus 675 and 7 g of citric acid. The remaining ingredients are utilized at the same amount.

Acid beverages are prepared using the above components (A), (B) and (C) according to the two processes of this invention based on the below generic example.

The stabilizing agent is hydrated in deionized water under high shear for 5 minutes, heated to 170° F. and held for 10 minutes to form (A). A flavoring material (B) is added to the hydrated stabilizing agent (A) to form preblend (I). Asweetener may be added this point or later or a portion of the sweetener added here and also added later. Preferred sweeteners comprise sucrose, corn syrup, and may include dextrose and high fructose corn syrup and artificial sweeteners. It isnecessary in the present invention to keep preblend (I) at a pH lower than 7 to eliminate pectin being degraded by beta-elimination. To this end, the pH of preblend (I) is maintained at between 2.0 5.5. A protein material is hydrated in a separatevessel in deionized water under high shear for 5 minutes, minutes, heated to 170° F. and held for 10 minutes. The contents are then subjected to a 2 stage homogenization to form (C). In one embodiment of this invention, preblend (I) andcomponent (C) are combined to form a blend. In another embodiment of the invention, the hydrated stabilizing agent (A) and the hydrated protein material are combined to form preblend (II). Preblend (I) and preblend (II) are combined to form a blend. The blend, by either process is pasteurized at a relatively high temperature for a short period of time. This pasteurization step kills microorganisms in the blend. For example, an effective treatment for killing microorganisms in the blend involvesheating the blend to a temperature of about 180° F. for about 10 seconds, preferably to a temperature of at least 190° F. for at

338

least 30 seconds and most preferably at a temperature of 195° F. for 60 seconds. While a temperaturelower than 180° F. may work, a temperature of at least 180° F. provides a safety factor. Temperatures greater than 200° F. also have an effect on the killing of microorganisms. However, the cost associated with the highertemperature does not translate to a product that contains appreciably fewer harmful microorganisms. Further, pasteurizing at too high a temperature for too long a period of time may cause the protein to further denature, which generates more sedimentdue to the insolubility of the further denatured protein.

The (A):(B) weight ratio for forming preblend (I) is generally from 15 45:5 30, preferably from 20 40:8 25 and most preferably from 25 35-10 20. The weight ratio of preblend (I):(C) for forming the acid beverage composition by the first processis generally from 30 60:40 70, preferably from 35 55:45 65 and most preferably from 40 50 50 60. The (A):(C) weight ratio for forming preblend (II) is generally from 60 80:20 40, preferably from 65 75:25 35 and most preferably from 65 73 27 32. Further, the preblend (I):preblend (II) weight ratio is generally from 25 55:45 75, preferably from 30 50:50 70 and most preferably from 35 45 55 65.

Following pasteurization, the blend is subjected to a two stage homogenization. In the first stage, the homogenization pressure is from 8000 30,000 pounds per square inch, preferably from 12,000 25,000 pounds per square inch and most preferablyfrom 15,000 20,000 pounds per square inch. In the second homogenization stage, the first stage product of the acid beverage, after the ultra high pressure stage, is from 300 1000 pounds per square inch and preferably from 400 700 pounds per square inch. During the first homogenization stage of the acid beverage at the ultra-high pressure of up to 30,000 pounds per square inch, a great amount of heat is generated. This heat causes the protein particles to aggregate. The second homogenization stage ofthe acid beverage serves to break up the aggregation. The homogenized suspension thus formed, is a stable suspension of a protein material in an acidic beverage.

The purpose of an ultra high homogenization is to decrease the particle size of the protein in the finished acid beverage. A decreased protein particle size as well as a decreased stabilizing agent particle size causes the viscosity of the acidbeverage to increase. This causes the decreased particle sizes of protein and stabilizing agent to increase in buoyancy. The smaller particle size in conjunction with the increased viscosity causes a decrease in sediment development.

A commercially available homogenizer for use in ultra high pressure homogenization for the present invention is a NIRO NS 3006. The NIRO NS 3006 is especially designed so as to achieve homogenizing valve inlet pressures of up to 30,000 poundsper square inch. Other homogenizers are commercially available that create pressures of in excess of 18,000 pounds per square inch, as well as pressures of up to 30,000 pounds per square inch.

After pasteurization of the acid beverages, but before the ultra-high homogenization step, the mean particle size is greater than 10 μm and the viscosity is 6.8 cps. The ultra high homogenization causes the particle size to be below 3 μmand the viscosity to be above 8 cps.

The blend, by either process, has a pH of from 3.0 4.5, preferably from 3.2 4.0 and most preferably from 3.6 3.8. The bottles are hot filled, inverted for 2 minutes and then placed in ice water to bring the temperature of the contents to aboutroom temperature. The bottles are stored and particle size and viscosity values are determined at 1 month. Sediment values are determined at 1, 2, 4 and 6 months.

The invention having been generally described above, may be better understood by reference to the examples described below. The following examples represent specific but non-limiting embodiments of the present invention.

Examples 1 6 are directed to the preparation of a stabilized acid beverage using components (A) and (B) as defined within FIG. 2.

EXAMPLE 1

A 6.25 g protein per 8 oz serving fortified juice beverage is made using Supro Plus 675 made by Solae LLC.

Added to a vessel are 5400 g of distilled water followed by 332 g of Supro Plus 675. The contents at 6.15% solids are dispersed under medium shear, mixed for 5 minutes followed by heating to 170° F. for 10 minutes to give a proteinslurry (C). In a separate vessel, 60 grams of pectin (YM-100L) and 300 grams of sugar are dispersed into 2940 grams of distilled water under high shear to give a 2% pectin slurry (A). The dispersion is heated to 170° F. When the pectin istotally dispersed (without lump), added as (B) are 27 grams of citric

339

acid, 27 grams of phosphoric acid, 210 grams of concentrated apple juice and 700 grams of sugar to form preblend (I). These contents are combined under medium shear, and then mixedfor 5 minutes. The solids level of the preblend (I) slurry is at 30%. The protein slurry (C) and preblend (I) are combined and mixed for 5 minutes. The pH at room temperature is in the range of 3.8 4.0. The contents are pasteurized at 195° F.for 30 seconds, and homogenized at 9000 psi in the first stage and 500 psi in the second stage to give a protein stabilized acid beverage. Bottles are hot filled with the beverage at 180 185° F. The bottles are inverted, held for 2 minutes andthen placed in ice water to bring the temperature of the contents to about room temperature. After the contents of the bottles are brought to about room temperature, the bottles are stored.

EXAMPLE 2

A 6.25 g protein per 8 oz serving fortified juice beverage is made using Supro Plus 675 made by Solae LLC.

The procedure of Example 1 is repeated except that the first stage homogenization of the acid beverage is increased from 9000 pounds per square inch to 12,000 pounds per square inch.

EXAMPLE 3

A 6.25 g protein per 8 oz serving fortified juice beverage is made using Supro Plus 675 made by Solae LLC.

The procedure of Example 1 is repeated except that the first stage homogenization of the acid beverage is increased from 9000 pounds per square inch to 15,000 pounds per square inch.

EXAMPLE 4

A 3.0 g protein per 8 oz serving fortified juice beverage is made using Supro.RTM. Plus 675 made by Solae.RTM. LLC.

The procedure for Example 1 is repeated with the following changes: 332 g Supro Plus 675 is replaced with 153 g Supro Plus 675 and 27 g citric acid is replaced with 7 g of citric acid. The remaining ingredients are utilized at the same amount. The first stage homogenization of the blend is 9000 pounds per square inch.

EXAMPLE 5

A 3.0 g protein per 8 oz serving fortified juice beverage is made using Supro.RTM. Plus 675 made by Solae.RTM. LLC.

The procedure of Example 4 is repeated except that the first stage homogenization of the acid beverage is increased from 9000 pounds per square inch to 12,000 pounds per square inch.

EXAMPLE 6

A 3.0 g protein per 8 oz serving fortified juice beverage is made using Supro Plus 675 made by Solae LLC.

The procedure of Example 4 is repeated except that the first stage homogenization of the acid beverage is increased from 9000 pounds per square inch to 15,000 pounds per square inch.

The baseline process beverage Example A and the inventive process beverage Examples 1 3, all at a 6.25 g protein/8oz serving are compared to each other, in storage sediment values, particle size and viscosity in Tables I IV. The baseline processbeverage Example B and the inventive process beverage Examples 4 6, all at a 3.0 g protein/8oz serving are compared to each other, in storage sediment values, particle size and viscosity in Tables I IV.

TABLE-US-00001 TABLE I Pressure Effect at One Month Sediment Example Particle Size Viscosity 4° C. 25° C. A 4.5 μm 9.0 cps 4.6 5.7 1 2.3 8.4 4.5 2.9 2 2.8 10.5 3.3 4.0 3 1.6 12.7 1.2 0.0 B 3.8 4.7 4.6 4.7 4 2.4 4.4 3.4 3.5 52.0 4.4 2.8 4.00 6 1.6 4.3 2.3 3.5

TABLE-US-00002 TABLE II Pressure Effect at Two Months Sediment Example 4° C. 25° C. A 6.5 9.2 1 4.7 4.3 2 3.7 4.2 3 1.7 1.1 B 7.9 6.0 4 4.3 4.4 5 3.8 3.8 6 3.8 3.3

TABLE-US-00003 TABLE III Pressure Effect at Four Months Sediment Example 4° C. 25° C. A 9.0 12.9 1 5.2 5.9 2 4.7 4.7 3 2.2 2.1 B 6.4 8.7 4 4.8 4.8 5 5.3 5.4 6 4.3 4.8

340

TABLE-US-00004 TABLE IV Pressure Effect at Six Months Sediment Example 4° C. 25° C. A 7.6 13.2 1 4.3 4.4 2 3.2 3.2 3 1.1 1.1 B 5.5 6.7 4 4.3 5.5 5 4.3 4.4 6 2.2 2.2

It is observed from the storage sediment data of the above examples that the embodiments encompassing the process of this invention offer an improvement in smaller particle size, increased viscosity and less sediment in preparing a protein basedacid beverage over the normal process for preparing the beverage.

While the invention has been explained in relation to its preferred embodiments, it is to be understood that various modifications thereof will become apparent to those skilled in the art upon reading the description. Therefore, it is to beunderstood that the invention disclosed herein is intended to cover such modifications as fall within the scope of the appended claims.

341