Transcriptional Regulation of Mortalin and the Hexosamine Biosynthetic 

Pathway by the Orphan Nuclear Receptor ERRα 

               

Guillaume Sylvain‐Drolet 

Department of Biochemistry 

McGill University 

Montréal, Québec, Canada 

August 2010 

 

 

 

 

 

 

 

 

 

 

A thesis submitted to the Faculty of Graduate Studies and Research in partial 

fulfilment of the requirements for the degree Master of Science 

@ Guillaume Sylvain­Drolet, 2010 

  2

ABSTRACT 

 

The  orphan  nuclear  receptor  estrogen‐related  receptor α  (ERRα,  NR3B1)  plays  a 

major  role  in  transcription  regulation  of  metabolic  genes.  Its  role  in  glycolysis 

regulation  is  well  known.  However,  we  ignore  yet  if  it  could  be  implicated  in  a 

signaling  pathway  connected  to  glycolysis,  the  Hexosamine  Biosynthetic  Pathway 

(HBP).  The  HBP  is  an  important  energy  and  nutrient‐sensing  pathway,  which 

modulates  O‐linked  N‐acetylglucosamine  (O‐GlcNAc)  post‐translational 

modification.  We  demonstrate  here  that  ERRα  is  involved  in  transcriptional 

regulation of HBP genes. ERRα can be localized to promoters of several HBP genes, 

such as Ogt and Oga. Both encode two enzymes that directly modulate the O‐GlcNAc 

cycling. Moreover, ERRα activates HBP genes transcription in collaboration with its 

coactivator PGC‐1α. In ERRα‐null mice, the HBP genes expression is downregulated. 

However, we can observe more O‐GlcNAcylated proteins  in absence of ERRα. This 

was  demonstrated  more  specifically  on  the  mitochondrial  chaperone  Mortalin. 

Mortalin  is  encoded  by  Hspa9,  and  we  show  that  this  gene  is  an  ERRα  target. 

Moreover,  Mortalin  is  much  more  O‐GlcNAcylated  in  absence  of  the  ERRα.    This 

suggests that in addition to Mortalin transcriptional regulation, ERRα is involved in 

Mortalin post‐translational modification through regulation of the HBP. 

  3

RÉSUMÉ 

 

Le  récepteur  nucléaire  orphelin  relié  à  l’estrogène (ERRα, NR3Β1)  joue  un  rôle 

majeur dans la régulation de gènes métaboliques. Son rôle dans  la régulation de la 

glycolyse  est  très  bien  connu.  Cependant,  nous  ignorons  encore  s’il  pourrait  être 

impliqué  dans  la  régulation  d’une  voie  de  signalisation  directement  liée  à  la 

glycolyse,  la  voie  de  signalisation  des  hexosamines  (HBP).  La  HBP  est  une 

importante voie de signalisation servant de détecteur d’énergie et de nutriments et 

régulant  la modification post‐traductionelle O‐lié N‐acétylglucosamine  (O‐GlcNAc). 

Nous démontrons qu’ERRα est impliqué dans la régulation des gènes de HBP. ERRα 

se  lie aux promoteurs de plusieurs gènes de HBP, comme Ogt  et Oga,  codant pour 

deux enzymes qui régulent directement le cycle des O‐GlcNAc. De plus, ERRα active 

la  transcription des  gènes de HBP en  collaboration  avec  son  coactivateur PGC‐1α. 

Dans  les  souris  déficientes  pour  le  gène  ERRα,  l’expression  des  gènes  de  HBP  se 

trouve réduite. Cependant, nous pouvons observer plus de protéines O‐GlcNAcylées 

en  absence  d’ERRα.  Ceci  a  été  démontré  plus  spécifiquement  sur  la  chaperone 

mitochondriale Mortalin. Mortalin est codée par le gène Hspa9 et nous démontrons 

que ce gène est une cible d’ERRα. De plus, Mortalin est beaucoup plus O‐GlcNAcylée 

en absence d’ERRα. Ceci suggère qu’en plus de réguler la transcription de Mortalin, 

ERRα  est  impliqué  dans  la  régulation  des  modifications  post‐traductionelles  de 

Mortalin, en régulant la voie de signalisation des hexosamines.  

  4

PREFACE – CONTRIBUTION OF AUTHORS 

 

The  writing  of  this  thesis  is  entirely  my  own  with  corrections  and  editorial 

comments by Dr. Vincent Giguère. The work and research presented in this thesis is 

also  entirely  my  own  with  the  following  exceptions.  The  ERRα  ChIP‐on‐chip  and 

standard ChIP were optimized and conducted by Catherine Rosa Dufour. 

  5

ACKNOWLEDGEMENTS 

 

I  would  like  to  thank  my  supervisor,  Dr.  Vincent  Giguère,  for  giving  me  the 

opportunity  to  work  in  his  laboratory  and  for  the  really  stimulating  project  he 

offered me. 

 

I  also  thank  all  the  present  and  past  lab  members.  A  special  thank  to  Annie 

Tremblay,  who was  really  helpful  at  the  beginnig  of my Master.  Thank  to Majid 

Ghahremani, for hockey conversations and all the work done in lab management. I 

appreciated the help I received from Catherine Rosa Dufour. I am grateful to Carlo 

Ouellet for his work with mice. I would like to sincerely thank Geneviève Deblois, 

Marie­Pier Levasseur  and Marie­Claude Perry, who offered me great  support,  I 

appreciated  their  help  and  all  the  discussions  we  had.  Finaly,  thank  to  Lillian 

Eichner, Xing Xing Liu, Aymen Shatnawi and Xinhao Zhao, for conversations and 

scientific criticisms. 

 

Je veux aussi remercier sincèrement mes parents qui m’ont encouragé tout au long 

de mon parcours universitaire, sans leur aide et leur support, je n’aurais pas atteint 

le même niveau. Un gros merci à ma fiancée, Valérie De Rop, qui a été d’un grand 

support  et  m’a  beaucoup  aidé  lors  de  ma  maîtrise.  Je  remercie  aussi  tous  mes 

ami(e)s qui m’ont permis de déstresser un peu et de partager mes hauts et mes bas. 

 

  6

 

TABLE OF CONTENTS 

ABSTRACT ................................................................................................................................... 2 

RÉSUMÉ ........................................................................................................................................ 3 

PREFACE­CONTRIBUTION OF AUTHORS .......................................................................... 4 

ACKNOWLEDGEMENTS........................................................................................................... 5 

TABLE OF CONTENTS............................................................................................................... 6 

LIST OF FIGURES ....................................................................................................................... 8 

ABBREVIATIONS ....................................................................................................................... 9 

CHAPTER 1­ LITTERATURE REVIEW................................................................................11 

1.1 NUCLEAR RECEPTORS ................................................................................................... 11 

1.1.1 Structure............................................................................................................. 11 

1.1.2 Mechanism of action...................................................................................... 12 

1.1.3 Subfamilies ........................................................................................................ 13 

1.2 ESTROGEN‐RELATED RECEPTOR ISOFORMS...................................................... 14 

1.2.1 ERRα action....................................................................................................... 14 

1.2.2 ERRα coregulators ......................................................................................... 16 

          1.2.2.1 PGC‐1α  ................................................................................................. 17   

1.2.3 ERRα targets..................................................................................................... 18 

1.2.4 ERRα functions ................................................................................................ 19 

1.3 HEXOSAMINE BIOSYNTHETIC PATHWAY............................................................. 20 

1.3.1 O‐GlcNAc Post‐Translational Modification.......................................... 21 

1.3.2 Ogt enzyme........................................................................................................ 23 

1.3.3 Ogt interacting proteins............................................................................... 24 

1.3.4 Ogt and physiological functions ............................................................... 25 

1.4 MORTALIN ........................................................................................................................... 26 

1.4.1 Mortalin mitochondrial functions ........................................................... 27 

1.4.2 Mortalin and cell proliferation.................................................................. 27 

1.4.3 Mortalin and physiological dysfunctions ............................................. 28 

  7

GOAL OF THE STUDY..............................................................................................................30 

CHAPTER II ­ MANUSCRIPT .................................................................................................31 

INTRODUCTION.......................................................................................................................32 

MATERIELS AND METHODS ................................................................................................34 

RESULTS.....................................................................................................................................40 

              Identification of HBP genes targeted by ERRα in livers.......................................... 40 

              Transcriptional regulation of Mgea5, Ogt and Uap1 by ERRα ............................. 41 

              Expression of HBP genes in liver, in presence or absence of ERRα ................... 44 

ERRα affects proteins O‐GlcNAcylation ......................................................................... 45 

Mortalin is more O‐GlcNAcylated in absence of ERRα............................................. 47 

Mortalin is an ERRα target ................................................................................................... 49 

DISCUSSION...............................................................................................................................51 

CONCLUSION.............................................................................................................................56 

REFERENCES .............................................................................................................................57 

   

   

  8

LIST OF FIGURES 

 

Figure I. Nuclear Receptor Structure.............................................................................................. 12 

Figure  1.  ERRα  localization  on  HBP  gene  by  ChIP‐on  chip  and  standard  ChIP 

validation in mouse livers ................................................................................................................... 41 

Figure 2. ERRα and PGC‐1α enhance transcription of Uap1, Mgea5 and Ogt............... 43 

Figure 3. HBP RNA quantification in ERRα‐null mice ............................................................. 45 

Figure 4. Evaluation of HBP activity by O‐GlcNAcylated proteins..................................... 47 

Figure 5. Mortalin O‐GlcNAcylation validation .......................................................................... 49 

Figure 6. ERRα is involved in Mortalin transcription regulation....................................... 50 

 

  9

ABBREVIATIONS 

ACTR  activator of thyroid and retinoic acid receptors 

AIB1  amplified in breast cancer‐1  

CaMKIV  calcium/calmodulin‐dependant protein kinase IV  

CARM1  Coactivator‐associated arginine methyltransferase 1  

ChIP  chromatin immunoprecipication  

ChIP‐on‐chip  Hybridization of chromatin immunoprecipication on a chip 

CRTC2  CREB regulated transcription coactivator 2 

CTD  C‐terminal domain  

DBD  DNA‐binding domain  

EMSA  electrophoretic mobility shift assay  

ER  estrogen receptor 

ERR  estrogen‐related receptor  

ERRE  ERR response element  

FAO  fatty acid oxidation  

GABPA  GA repeat‐binding protein α  

Gfat  L‐glutamine:D‐fructose‐6‐phosphate amidotransferase 

GR  Glucocorticoid receptor 

GRIP1  glucocorticoid receptor interacting protein‐1  

GRP75  glucose‐related protein 75  

HBP  Hexosamine biosynthetic pathway  

HDAC  histone deacetylase 

HRE  hormone response elements  

HSP  heat shock proteins  

IFN‐γ   interferon‐γ  

IRS‐1  insulin receptor substrate 1  

LBD  ligand‐binding domain  

LBP  ligand binding pocket  

LM‐PCR  ligation‐mediated PCR  

LXR  liver X receptors  

  10

MS  Mass spectrometry  

MYPT1  myosin phosphatase targeting subunit 1  

NCoR  nuclear receptor corepressor  

NF‐κB  nuclear factor‐kappaB  

NR  nuclear receptor 

Oga  O‐GlcNAcase  

O‐GlcNAc  O‐linked N‐acetylglucosamine  

Ogt  O‐GlcNAc transferase 

OXPHOS  oxidative phosphorylation  

PCR  polymerase chain reaction 

PD  Parkinson’s disease 

PKC  Protein kinase C 

PGC‐1  peroxisome proliferator‐activated receptor gamma coactivator‐1 

PNRC  proline‐rich nuclear receptor co‐regulatory protein  

PPAR  peroxisome proliferator‐activated receptors 

PR  progesterone receptor 

Prox1  prospero‐related homeobox 1  

PTM  post‐translational modifications  

qPCR  quantitative PCR  

RAR  Retinoic acid receptor 

RIP140  receptor interacting protein of 140 kDa 

RT‐PCR  real‐time PCR 

SMRT  silencing mediator of retinoid and thyroid hormone receptor  

SRC  steroid receptor co‐activators  

TCA  tricarboxylic acid  

TF  transcription factor 

TPR  tetratricopeptide repeat  

TR  thyroid receptor  

TBS‐T  Tris‐buffered saline‐Tween 

VDAC  voltage‐dependent anion channel 

  11

CHAPTER I – LITTERATURE REVIEW 

 

1.1 NUCLEAR RECEPTORS 

 

Nuclear  receptors  (NRs)  are  the  largest  family  of  transcription  factors  (TFs)  in 

metazoans (Mangelsdorf et al. 1995). First, they were characterized as TFs, that bind 

DNA to regulate gene expression when bound by their small lipophilic ligands, like 

thyroid  hormone  or  retinoic  acid  (Evans  1988).  NRs  are  implicated  in  several 

diseases  when  deregulated.  For  example,  peroxisome  proliferator‐activated 

receptors (PPARs, NR1Cs) are involved in diabetes and obesity (Evans et al. 2004) 

and estrogen receptors (ERs, NR3As) are involved in different cancer types (Deroo 

and Korach 2006). NRs are considered good targets for drug discovery because they 

respond  to  small  lipophilic  molecules.  In  fact,  after  the  rhodopsin‐like  G‐protein‐

coupled receptor, the NRs represent the family of proteins which is most targeted by 

drugs  (Overington  et  al.  2006).  Considering  their major  roles  in  the  regulation  of 

gene expression and the development of several diseases, it is essential to study the 

various  mechanisms  that  regulate  NRs  and  how  they  are  involved  in  multiple 

physiological functions. 

 

1.1.1 Nuclear receptors structure 

 

Most NRs share the same structure which is divided in four independent modules: a 

modulator  domain,  a  DNA‐binding  domain  (DBD),  an  hinge  region  and  a  ligand‐

binding domain (LBD) (Giguere 1999) (figure I). The modulator domain,  is  located 

in the N‐terminal region of the receptor and the least conserved region among the 

NRs (Warnmark et al. 2003). It contains a transcriptional activation function, called 

AF‐1,  which  activity  is  not  ligand‐dependant  and  can  interact  with  coregulators, 

such  as  steroid  receptor  coactivators  (SRCs)  (Tremblay  et  al.  1999).  The  DBD  is 

composed of two zinc finger modules and is the most conserved domain of NRs. It 

binds  DNA  to  specific  sequence  called  hormone  response  elements  (HRE)  that 

usually corresponds to the half motif AGGTCA.   This motif can be repeated once or 

  12

twice  and,  in  the  later  case,  be  directed  or  inverted  (Giguere  1999)  (figure  Ib). 

Similar to the modulator domain, the hinge region differs a lot between the different 

NRs. It is a flexible region located between the DBD and the LBD that can rotate to 

allow  dimerization  between  different  DBDs.  Finally,  the  LBD  as  its  name  implies, 

serves to bind ligand. However, it also mediates dimerization,  interaction with heat 

shock proteins (HSP), nuclear localization and contains a transactivation functions, 

AF‐2.  The  LBD  sequence  is  moderately  conserved  between  the  NRs,  but  the 

structure is highly conserved.  

 

                Figure I. Nuclear Receptor structure.  

(a) Schematic representation of a NR structure.  

(b)  Representation  of  NR  dimers  bound  to  direct  (top  arrows)  or  inverted  HREs 

(bottom arrows). 

 

1.1.2 Mechanism of action 

 

NRs are regulated by different mechanisms. One mechanism is the maintenance of 

NRs in the cytoplasm by HSP. When a NR is bound by its specific ligand, it is released 

by  the  HSP,  and  then  translocates  to  the  nucleus  where  it  activates  gene 

transcription (Pratt and Toft 1997). This mechanism can be observed with steroid 

receptors, but not with all NRs. In fact, the majority of the NRs are constitutively in 

the nucleus, even in absence of their ligands. They bind to DNA and act as activators 

when bound by their  ligands, and as repressors when ligand free. This mechanism 

was  demonstrated  with  multiple  NRs,  of  which  thyroid  hormone  receptor  (TRs, 

NR1As)  and  retinoic  acid  receptor  (RARs,  NR1Bs)  are  good  examples  (Chen  and 

  13

Evans  1995;  Horlein  et  al.  1995).  Moreover,  interactions  with  coactivator  or 

corepressor  proteins  can  modulate  NRs  activity.  The  first  NR  coactivator  to  be 

identified  is  SRC‐1,  which  was  shown  to  enhance  progesterone  receptor  (PR, 

NR3C3)  activity  and  other  steroid  receptors  (Onate  et  al.  1995). Also,  the  nuclear 

receptor corepressor (NCoR) (Horlein et al. 1995) and silencing mediator of retinoid 

and  thyroid  hormone  receptor  (SMRT)  (Chen  and  Evans  1995)  were  the  first 

corepressors to be identified. Since, other important coregulators of NRs have been 

discovered, like the peroxisome proliferator‐activated receptor gamma coactivator‐

1α  (PGC‐1α), which activates specific NRs, such as PPARγ  (Puigserver et al. 1999). 

Coregulators are recruited to targeted genes by the NRs and they perform enzymatic 

reactions  needed  to  regulate  gene  expression,  such  as  chromatin  remodeling  and 

histone  modifications.  Finally,  NRs  activity  can  also  be  modulated  by  post‐

translational  modifications  (PTMs),  such  as  phosphorylation,  acetylation, 

SUMOylation, methylation, ect. For example, the liver X receptors (LXRs, NR1Hs) are 

acetylated  proteins  and  their  deacetylation  corresponds  to  an  increase  in  their 

activity  (Li  et  al.  2007).  In  contrast,  LXRα  phosphorylation  by  Protein  kinase  Cα 

(PKCα) decreases its transcriptional activity (Delvecchio and Capone 2008). 

 

1.1.3 NR subfamilies 

 

As described previously, all NRs share similar structures and mechanisms of action. 

However,  they differ  in  their  specific  ligand and  this  is what  categorizes NRs. The 

NRs  family  can  be  divided  into  three  subfamilies:  endocrine  receptors,  adopted 

orphan  receptors  and orphan  receptors  (Alaynick 2008). The endocrine  receptors 

subfamily is regulated by hormonal ligands, for which they have high affinity. In the 

second  subfamily,  the  adopted  orphan  receptors  were  discorvered  before  their 

ligand, for which they have usually low affinity. Finally, the  last NR subfamily does 

not correspond to the first definition given to NR. In fact, NRs were described as TFs 

which regulate transcription upon ligand binding (Evans 1988).  Yet, no ligand was 

identified  for  the  orphan  receptor  subfamily  and  it  is  thought  that  some may  not 

  14

have  a  natural  ligand.  However,  their  activities  can  be  modulated  by  synthetic 

ligands.  At  physiological  level,  they  are  essentially  regulated  by  interactions with 

coactivators or corepressors and by PTMs. 

 

1.2 ESTROGEN­RELATED RECEPTOR ISOFORMS 

 

The  estrogen‐related  receptor  α  (ERRα,  NR3B1)  is  a  member  of  the  latest  NR 

subfamily  described  above,  an  orphan  receptor.  It  was  the  first  orphan  NR  to  be 

identified  along  with  its  isoform  ERRβ (NR3B2).  ERRα  was  attibuted  this  name 

because of its high similarity with the ER’s DBD (Giguere et al. 1988). However, the 

similarity between ERα and ERRα LBD is relatively low, and it is clear that estrogen 

is not an ERRα ligand. The ERR subfamily has two other isoforms: ERRβ (Giguere et 

al.  1988), which was described  in  the  same  study and ERRγ (NR3B3)  identified  in 

the late 90s, the last orphan NR identified to date (Eudy et al. 1998; Hong et al. 1999; 

Heard et al. 2000). ERRα is the most widely expressed, followed by ERRγ and ERRβ. 

Their expressions are ubiquitous, but at a higher  level  in  tissues with high energy 

demand, like kidney and heart. All of them are also highly expressed in the central 

nervous system (Gofflot et al. 2007).  

 

1.2.1 ERRα action 

 

Since ERRα does not have any physiological  ligand,  its activity  is mostly  regulated 

by PTMs and  interactions with coregulators. Several PTMs have been described to 

affect ERRα activity and they mostly occur in the modulator domain, but also in the 

DBD. Although  the modulator domain  is  a  region which  is not  conserved between 

the various NRs, the ERR isoforms make an exception, because the degree of amino 

acid identity in this region is high between the three isoforms. 

 

ERRα  can  be modified  by  phosphorylation  in  its modulator  domain,  on  serine  19 

and 22. Serine 19 seems to be important for ERRα activity because inhibition of its 

  15

phosphorylation  leads  to  an  increase  in  ERRα’s  transcriptional  activity  due  to 

recruitment  of  ERRα’s  coactivators  (Vu  et  al.  2007;  Tremblay  et  al.  2008). 

Furthermore, ERRα  can be SUMOylated  in  its modulator domain on  lysine 14 and 

inhibition of  SUMOylation also  increases  its  transcriptional  activity. Whereas PTM 

on  serine  19  is  associated  with  repression  of  ERRα,  phosphorylation  at  other 

residues  can  also  lead  to  an  increase  in  its  activity.  In  fact,  ERRα  can  be 

phosphorylated  in  its DBD by PKCγ  and  this  increases  its DNA‐binding activity,  as 

well  its  interaction  with  coactivators  (Barry  and  Giguere  2005).  Another  PTM  is 

associated to ERRα’s DNA‐binding activity. It was recently reported that ERRα can 

be acetylated by p300 coactivator associated factor. ERRα acetylation decreases its 

DNA‐binding  activity,  which  can  be  restored  when  ERRα  is  deacetylated  by  the 

histone deacetylase (HDAC) 8 and sirtuin 1 (Wilson et al. 2010).  

 

The ERRα’s DBD is composed of two zinc fingers module, like the other NRs. It binds 

to  the HRE, AGGTCA half‐site, with an extended TCA at  the 5’  region (Sladek et al. 

1997).  This  site,  named ERR  response  element  (ERRE), was  first  identified  as  the 

consensus sequence recognized by ERRα using an unbiased approach (Sladek et al. 

1997) and confirmed to be ERRα binding motif using genome wide  localization of 

ERRα  by  chromatin  immunoprecipication  (ChIP)  followed  by  hydridization  of  the 

chromatin  on  a  chip  (ChIP‐on‐chip)  (Dufour  et  al.  2007).  ERRα  can  act  as  a 

heterodimer  with  ERRγ,  and  a  monomer  or  homodimer  (Tremblay  and  Giguere 

2007).  In  addition  to  the  ERRE,  ERRα can  bind  in  some  cases  to  the  estrogen 

response  element.  It  was  proposed  and  demonstrated  in  vitro  that  ERRα  could 

interfere with  the ER pathway and bind to  the same sites as ER  (Yang et al. 1996; 

Vanacker  et  al.  1999),  and  this  was  demonstrated  about  10  years  later  at 

physiological  level. The comparison of genome wide  localization of ERα and ERRα 

revealed  that  they  mainly  have  strict  binding  site  and  regulate  the  transcription 

independently  of  each  other.  However,  they  target  a  small  subset  of  common 

promoters in breast cancer cells (Stein et al. 2008; Deblois et al. 2009).  

 

  16

Usually, the LBD of a NR will dictate its activity. In absence of its ligand, the LBD will 

be  in  an  inactive  conformation  and  the  binding  of  a  ligand  will  change  the 

conformation  of  the  NR, making  it  an  activated  TF.  However,  the  orphan  nuclear 

receptor  ERRα  does  not  conform  to  this  rule.  In  fact,  ERRα  activates  gene 

transcription in a constitutive manner. A phenylalanine in its ligand binding pocket 

(LBP)  is  necessary  to  keep  ERRα  constitutively  active  since  mutation  of  the 

phenylalanine  329  suppresses  this  activity  (Chen  et  al.  2001).  Moreover,  the  3D 

structure  of  ERRα and  its  isoform  ERRγ  revealed  that,  even  in  absence  of  ligand, 

their LBDs are in an active configuration and they would not have enough space for 

a  ligand with more  than 4  carbon atoms,  because  the  space  is  occupied by  amino 

acid side chains (Greschik et al. 2002; Kallen et al. 2004). However, it was recently 

demonstrated that the LBP of ERRα can change its conformation to bind to a large 

synthetic  inverse  agonist  (Kallen  et  al.  2007).  Moreover,  ERRα  activity  can  be 

modulated  by  some  synthetic  ligands.  The  most  specific  for  ERRα  is  the  inverse 

agonist XCT790, which inhibits ERRα activity by disrupting the interaction between 

the orphan NR and its coactivator PGC‐1α (Busch et al. 2004; Willy et al. 2004). At 

physiological level, ERRα is in an active conformation as soon as it is expressed and 

its activity will depend on the presence of its coregulators. 

 

1.2.2 ERRα coregulators 

 

As  described  above,  ERRα  activity  is  mostly  dependent  on  the  presence  of 

coregulators.  Several  coactivators  enhance  ERRα’s  transcriptional  activity.  By 

luciferase  assays,  it  was  shown  that  the  activator  of  thyroid  and  retinoic  acid 

receptors  (ACTR),  the  glucocorticoid  receptor  interacting  protein  1  (GRIP1)  and 

SRC‐1, can all increase the transcriptional activity of ERRα (Xie et al. 1999), whereas 

PGC‐1α was  shown  to  interact with ERRα  by yeast  two‐hydrid  screen  (Huss et  al. 

2002) and synergistically activate transcription (Laganiere et al. 2004). PGC‐1β, the 

proline‐rich  nuclear  receptor  co‐regulatory  protein  (PNRC)  and  PNRC2 were  also 

shown to be ERRα’s coactivators (Zhou et al. 2000; Zhou and Chen 2001; Kamei et 

  17

al.  2003).  In  ERα  negative  breast  cancer  cells,  the  coregulator  amplified  in  breast 

cancer‐1  (AIB1)  was  demonstrated  to  interact  with  ERRα  and  enhance  its 

transcriptional  activity  (Heck  et  al.  2009).  On  the  other  hand,  the  receptor 

interacting protein of 140 kDa (RIP140)  is a corepressor of ERRα (Augereau et al. 

2006;  Castet  et  al.  2006).  Recently,  the  homeobox  protein  prospero‐related 

homeobox 1 (Prox1) was demonstrated to be a negative modulator of ERRα. Prox1 

can interact with ERRα and PGC‐1α to inhibit their activity and can be located on the 

same promoters as ERRα (Charest‐Marcotte et al. 2010).  

 

1.2.2.1 PGC­1α

 

PGC‐1α was first identified in brown adipose tissue and was shown to be involved in 

adaptive  thermogenesis,  due  to  an  increase  in  its  expression  upon  cold  exposure 

(Puigserver  et  al.  1998).  Its  expression  is  mostly  regulated  by  nutritional  and 

hormonal signal, and it acts as a coactivator by enhancing transcriptional activity of 

several TFs, such as PPARγ, TR (Puigserver et al. 1998) and glucocorticoid receptor 

(GR,  NR3C1)  (Knutti  et  al.  2000).  PGC‐1α  has  a  major  role  in  mitochondrial 

biogenesis  and  respiration  (Wu  et  al.  1999),  but  it  is  also  implicated  in  hepatic 

gluconeogenesis  and  lipoprotein metabolism,  skeletal muscle  fiber  determination, 

cicardian clock function, angiogenesis, and macrophage polarization (Lin 2009).  

 

As  mention  above,  PGC‐1α  is  an  ERRα  coactivator  and  both  proteins  physically 

interact  resulting  in  increasing  ERRα transcriptional  activity (Huss  et  al.  2002; 

Laganiere  et  al.  2004;  Giguere  2008).  In  absence  of  PGC‐1α,  the  transcriptional 

activity  of  ERRα  is  weak.  The  presence  of  this  coactivator  increases  its  activity, 

making  it  a  potent  regulator  of  gene  expression  (Schreiber  et  al.  2003). 

Furthermore, both are  involved  in  the  regulation of genes  linked  to mitochondrial 

function, like oxidative phosphorylation (OXPHOS) and fatty acid oxidation (FAO). It 

should  be  noted  that  PGC‐1β  can  also  act  as  an  ERRα’s  coactivator.  The  ERRα’s 

  18

targets  and  functions  will  be  discussed  later,  but  its  coactivator  PGC‐1α is  an 

important tool to study this orphan NR.  

 

1.2.3 ERRα targets 

 

Since the discovery of ERRα, the techniques used to identify target genes of nuclear 

receptors changed a lot. Initially, identification of target genes was mainly based on 

the  presence  of  an  ERRE  in  their  promoter.  Using  electrophoretic  mobility  shift 

assay  (EMSA)  or  transfection  reporter  assays,  medium‐chain  acyl  coenzyme  A 

dehydrogenase  (Sladek  et  al.  1997),  aromatase  (Yang  et  al.  1998),  pyruvate 

dehydrogenase  kinase  4  (Wende  et  al.  2005),  PPARα (Huss  et  al.  2004), 

apolipoprotein A4, TRα (Vanacker et al. 1998), and many others were identified as 

ERRα  targets.  The  discovery  of  new  target  genes  became more  efficient  with  the 

arrival of new techniques, for example gene expression microarrays. However, since 

ERRα  is  an  orphan  NR,  it  was  not  possible  to  just  activate  it  with  a  ligand  and 

compare gene expression between activated and non‐activated ERRα. Therefore, the 

coactivator  PGC‐1α  became  an  essential  tool  to  identify  new  ERRα  targets.  With 

several  approaches,  but  using  all  PGC‐1α  as  a  coactivator  of  ERRα,  a  few  studies 

revealed that just like PGC‐1α, ERRα is implicated in the regulation of genes involve 

in OXPHOS and mitochondrial biogenesis (Mootha et al. 2004; Schreiber et al. 2004; 

Gaillard et al. 2006). Also, ERRα was demonstrated as a key regulator of cytochrome 

c,  cartinine  palmytoytransferase  1a,  cytochrome  c  oxidase  4,  ATP  synthase  b  and 

many other genes involve in bioenergy homeostasis. Moreover, ERRα  is implicated 

in a feedback loop. Indeed, it targets its own promoter to activate its transcription, 

as well GA repeat‐binding protein α (GABPA) promoter to activate its transcription. 

GABPA  also  targets  ERRα  promoter  and  its  own  promoter  to  increase  their 

transcription (Laganiere et al. 2004; Mootha et al. 2004; Dufour et al. 2007).  

 

Recently,  the  identification  of  ERRα  targets  became  more  powerful  with  the 

incoming  of  the  ChIP‐on‐chip  technology,  which  allowed  study  of  protein‐DNA 

  19

interaction.  It  is  a  large‐scale  identification  of  genomic  targets  of  specific  TFs 

(Deblois  and  Giguere  2008).  Several  studies  were  done  to  identify  new  ERRα 

targets. Genome‐wide location analysis of ERRα and its isomer ERRγ in heart tissue 

revealed that they are key regulators of bioenergy homeostasis (Dufour et al. 2007). 

It was already postulated, mainly through  its known interaction with PGC‐1α,  that 

ERRα might  be  implicated  in OXPHOS and mitochondrial  biogenesis  (Sladek  et  al. 

1997; Laganiere et al. 2004; Mootha et al. 2004; Schreiber et al. 2004; Gaillard et al. 

2006).  However,  this  study  revealed  that  ERRα  does  not  only  target  a  few  genes 

with mitochondrial functions, but a large number of genes involved in tricarboxylic 

acid (TCA) cycle and OXPHOS, as well in FAO and glucose metabolism (Dufour et al. 

2007). It was also demonstrated that ERRα  targets multiple genes involved in TCA 

cycle, OXPHOS, FAO and glucose metabolism in liver (Charest‐Marcotte et al. 2010). 

In macrophages, ERRα was shown to be downstream effector for interferon‐γ (IFN‐

γ) and to be required for mitochondrial gene expression and reactive oxygen species 

production  (Sonoda  et  al.  2007).  This  agrees  with  a  previous  study  that 

demonstrated that ERRα is induced by IFN‐γ (Barish et al. 2005). The role of ERRα 

is not limited to mitochondrial functions and bioenergy homeostasis. Indeed, ERRα 

ChIP‐on‐chip  in  breast  cancer  cells  revealed  that  ERRα  targets  genes  involved  in 

process  linked  to  tumor  growth  and  proliferation,  as  well  the  oncogene  ERBB2 

(Deblois  et  al.  2009).  Furthermore,  ERRα  is  also  important  in  regulation  of  gene 

expression  in  kidney.  Thus,  in  this  tissue  it  targets  ionic  channels,  as  well  as 

receptors  implicated  in  systemic  blood  pressure  and  genes  involved  in  the 

angiotension pathway (Tremblay et al. 2010), 

 

1.2.4 ERRα function 

 

The identification of ERRα targets gives a good idea of its physiological functions. Its 

role in energy metabolism was confirmed by the generation of ERRα‐null mice. They 

are  viable,  fertile  and, with  the  exception  of  a  reduction  in  their  body weight  and 

peripheral fat deposits, display no obvious anatomical alterations (Luo et al. 2003). 

  20

However,  the  ERRα‐null  mice  are  resistant  to  high‐fat  diet‐induced  obesity.  The 

expression of genes involved in lipid metabolism and adipogenesis were modified in 

adipose  tissue  of  those  mice.  The  vital  functions  of  ERRα  become  more  evident 

when the mice are submitted to different physiological stresses. Corresponding with 

ERRα’s  role  in  macrophages  for  host  defense,  the  null  mice  are  defective  for 

bacterial clearance (Sonoda et al. 2007). Also, the ERRα‐null mice present a failure 

in cardiac adaptation to chronic pressure overload and a decrease in ATP synthesis 

(Huss  et  al.  2007).  They  also  display  a  hypotensive  phenotype,  which  can  be 

explained by  the  fact  that ERRα  is a  regulator of  channels  involved  in  renal Na(+) 

and K(+) handling, and some genes in the renin‐angiotensin pathway (Tremblay et 

al.  2010).  Furthermore,  the  absence  of  ERRα  results  in  a  defect  in  adaptive 

thermogenesis  in  brown  adipose  tissue,  due  to  a  reduction  of  mitochondrial 

biogenesis  and  oxidative  capacity,  which  prevents  mice  to  maintain  body 

temperature  when  exposed  to  cold  (Villena  et  al.  2007).  In  addition  to  these 

functions, ERRα has a role in tumor growth and cell proliferation in breast cancer, as 

mentions  above  (Deblois  et  al.  2009).  Accordingly,  the  expression  of  this  NR was 

demonstrated to be a potent prognostic factor in breast tumors  (Ariazi et al. 2002; 

Suzuki et al. 2004).  

 

 

1.3 HEXOSAMINE BIOSYNTHETIC PATHWAY 

 

The  hexosamine  biosynthetic  pathway  (HBP)  modulates  the  PTM  O‐linked  N‐

acetylglucosamine (O‐GlcNAc) in cells. Between 2% and 5% of glucose uptake goes 

into  the  HBP  (McClain  and  Crook  1996).  The  enzyme  L‐glutamine:D‐fructose‐6‐

phosphate  amidotransferase  (Gfat)  drives  the  fructose‐6‐phosphate  generated  by 

the glycolysis into this pathway. This is the rate‐limiting step of the HBP (Love and 

Hanover 2005). In addition to glucose, the pathway uses glutamine, acetyl‐CoA and 

UTP  to  generate  UDP‐GlcNAc, which  is  used  by  the  enzyme O‐GlcNAc  transferase 

(Ogt),  to modify proteins on serine and threonine residues with  the addition of O‐

  21

GlcNAc  (Love  et  al.  2010).  On  the  other  hand,  the  enzyme  O‐GlcNAcase  (Oga) 

removes  the  O‐GlcNAc.  Moreover,  the  O‐GlcNAc  PTM  can  be  compared  with 

phosphorylation  since  it  happens  on  hydroxyl  groups  of  serine  and  threonine 

residues.  To  date,  over  1,000  proteins  have  been  identified  to  be O‐GlcNAcylated. 

However,  contrary  to  phosphorylation which  is  regulated  by  hundreds  of  kinases 

and phosphatases, only two enzymes regulate O‐GlcNAcylation: Ogt and Oga. Most of 

proteins that are modified by O‐GlcNAc can also be phosphorylated and it can even 

have  a  competition  between  O‐GlcNAcylation  and  phosphorylation  on  the  same 

residue (Hart et al. 2007; Wang et al. 2008). The HBP serves as a nutrient and stress 

sensor and response by the addition of O‐GlcNAc on proteins involve mostly in gene 

expression  regulation  and  metabolism,  but  also  in  signal  transduction,  transport, 

translation and structure (Teo et al. 2010a).  

 

Deregulation of the HBP is  linked to several diseases. First, an upregulation of this 

pathway  results  in  insulin  resistance, which  leads  to  type  II  diabetes  (Crook et  al. 

1993;  Park  et  al.  2010;  Teo  et  al.  2010b).  Also,  the  HBP  is  deregulated  in 

neurodegenerative  diseases,  such  as  Alzheimer’s  disease  and  Parkinson’s  disease 

(PD) (Love and Hanover 2005; Dias and Hart 2007; Liu et al. 2009). Recently,  this 

pathway was  reported  to be upregulated  in breast  cancer and necessary  to  tumor 

growth through the enzyme Ogt (Caldwell et al. 2010). The effect of O‐GlcNAcylation 

on several proteins has been studied and it is clear that this PTM is linked to some 

physiological dysfunction. However, little is known about how the occurrence of this 

modification is control. 

  

1.3.1 O­GlcNAcylated Post­translational modification 

 

Initially,  proteins  glycolysation  was  thought  to  be  exclusive  to  the  luminal 

compartments of the secretory machinery and to the cell surface, and extracellular 

matrix  (Hart  et  al.  1989).  The  identification  of  a  novel  saccharide  that  can  be  O‐

linked  to  protein,  GlcNAc,  revolutionized  this  dogma.  In  fact,  O‐GlcNAcylated 

proteins were found at cell surface as expected with glycosylated proteins. However, 

  22

this  modification  also  localized  in  the  cytoplasm  and  in  several  organelles,  like 

microsomes, nuclei and the nuclear envelop (Torres and Hart 1984; Holt and Hart 

1986;  Holt  et  al.  1987).  It  became  rapidly  clear  that  this  O‐GlcNAcylation  was 

different  from  classical  protein  glycosylation,  because  it  has  a  nucleocytoplasmic 

distribution and cannot be elongated.  

 

What happens to O‐GlcNacylated proteins is not well defined. The consequences of 

this  PTM will  largely  depend  on  the  initial  function  of  the modified  protein.  One 

important group of proteins for which O‐GlcNAcylation has been well characterized 

is TF. Several TFs were shown to be O‐GlcNAcylated, such as Sp1 (Han and Kudlow 

1997; Goldberg et al. 2006),  c‐myc (Chou et al. 1995a; Chou et  al. 1995b), nuclear 

factor‐kappaB (NF‐κB) (James et al. 2002; Yang et al. 2008a), p53 (Yang et al. 2006), 

STAT5A  (Nanashima  et  al.  2005),  and  the  NR  LXR  (Anthonisen  et  al.  2010).  For 

example,  Sp1  O‐GlcNAcylation  delays  its  degradation  by  the  proteasome  and 

enhances  its  transcriptional  activity,  whereas  NF‐κB  O‐GlcNAcylation  disrupts  its 

interaction with  its  inhibitor  IκB, which  consequently  enhances  its  transcriptional 

activity.  Similarly  to  Sp1  O‐GlcNAcylation,  p53  degradation  is  delayed  when 

modified by O‐GlcNAc, due to inhibition of its phosphorylation.  

 

Like TFs, some coactivators were shown to be O‐GlcNAcylated. The CREB regulated 

transcription  coactivator  2  (CRTC2)  can  be  O‐GlcNAcylated,  which  inhibits  its 

phosphorylation and induces its nuclear translocation (Dentin et al. 2008). PGC‐1α 

was  also  demonstrated  to  be  O‐GlcNAcylated,  but  it  is  not  clear  how  this 

modification  affects  its  activity  (Housley  et  al.  2009).  To  stay  in  the  transcription 

field,  RNA  polymerase  II  is  also  O‐GlcNAcylated.  In  fact,  RNA  polymerase  II  is 

activated when phosphorylated in its C‐terminal domain (CTD). But its CTD can also 

be  O‐GlcNAcylated  and  cannot  be  in  the  same  time  phosphorylated  and  O‐

GlcNAcylated (Comer and Hart 2001). This was demonstrated  in vitro, but  it  is not 

clear  how  this modification  affects  RNA  polymerase  II  activity  and  if  it  competes 

with its phosphorylation sites in vivo. 

  23

 

As  mention  previously,  proteins  involved  in  metabolism  also  represent  another 

group where O‐GlcNAcylation has been well studied. Generally, this modification on 

enzymes  involved  in metabolism  leads  to  inhibition  of  their  phosphorylation.  For 

example,  the  enzyme  glycogen  synthase  can  be  O‐GlcNAcylated  in  hyperglycemia 

conditions,  reducing  its  activity  due  to  inhibition  of  its  phosphorylation  and 

contributing  to  insulin resistance (Parker et al. 2003). As  for  the enzyme glycogen 

synthase, O‐GlcNAcylation of  the  calcium/calmodulin‐dependant protein kinase  IV 

(CaMKIV) inhibits its phosphorylation, leading to activation of this kinase (Dias et al. 

2009).  Several  proteins  in  the  insulin  signaling  pathway  are  also  O‐GlcNAcylated, 

such as insulin receptor substrate 1 (IRS‐1), phosphoinositide‐3 kinase and Akt. An 

increase  in  their  O‐GlcNAcylation  results  in  a  decrease  in  response  to  insulin 

signaling due to inhibition of Akt activity or upstream kinases (Vosseller et al. 2002; 

Zachara and Hart 2006; Yang et al. 2008b). Finally, O‐GlcNAcylation affects activity 

of proteins with other functions, like the cytoskeletal proteins vimentin (Slawson et 

al. 2008) and tau (Li et al. 2006), the chaperone HSP60 (Kim et al. 2006), the protein 

involves in intracellular adhesion beta‐catenin (Sayat et al. 2008) and many others. 

 

1.3.2 Ogt enzyme 

 

The  HBP  is  essential  to  achieve  the  O‐GlcNAc  PTM,  but  only  one  enzyme  is 

responsible for the addition of this sugar: Ogt. This enzyme was first identified and 

purified from rat liver (Haltiwanger et al. 1992). Since, Ogt gene has been cloned in 

other  organisms,  such  as  human, C.  elegans,  plants,  and  others. Ogt gene  localizes 

near the centromere at Xq13 in the human genome. Its expression is ubiquitous, but 

Ogt is more abundant in brain and pancreas in comparison to other tissues (Kreppel 

et  al.  1997;  Lubas  et  al.  1997).  This  agrees with  the  fact  that  Ogt  could  act  has  a 

glucose‐sensor,  because  glucose  level monitoring  is  really  important  in  those  two 

organs. The Ogt gene encodes a major isoform of 116 kD which is named ncOgt, and 

this is because it localizes to the cytoplasm and the nucleus. Alternative splicing and 

a  second  promoter  in  intron  5  give  rise  to  two  different  isoforms,  one  of  103  kD 

  24

which localizes in the mitochondria, mOgt, and the shortest isoform of 70 kD, sOgt 

(Hanover et al. 2003). All three of them have the same catalytic domain in their CTD, 

but  differ  in  the  number  of  tetratricopeptide  repeat  (TPR)  in  their  N‐terminal 

domain.  TPRs  are  found  in  several  proteins  and  are  repetitions  of  34  amino  acid 

sequence  important  for  protein‐protein  interaction  (Blatch  and  Lassle  1999).  It  is 

through this domain that Ogt can recognize its substrates, thus it is essential for its 

activity. Deletion of all TPRs results in a total loss of Ogt activity and when only the 

first  3‐6  TPRs  are  deleted,  Ogt  can modify  small  peptides,  but  not  intact  proteins 

(Lubas and Hanover 2000; Iyer and Hart 2003). Those observations show that TPR 

domain  could be  important  for Ogt  specificity  and  this  could explain why  there  is 

only one enzyme to modify over 1,000 proteins with O‐GlcNAc. In addition to Ogt’s 

substrates,  the  TPR  domain  allows  Ogt  to  interact  with  multiple  partners.  It  is 

thought  that  the  identity  of  its  partners  is  important,  since  it  will  define  which 

substrates Ogt modifies. The general mechanism of how its partners provide the Ogt 

specificity  for  its  target  is not well  understand, but  a  few Ogt  interacting proteins 

have been identified.  

 

1.3.3 Ogt interacting proteins 

 

As mention previously, PGC‐1α can be O‐GlcNAcylated. It has been shown that PGC‐

1α interacts with Ogt to favor the interaction with forkhead box O1 TF, which leads 

to  its  O‐GlcNAcylation  and  activation  (Housley  et  al.  2009),  in  response  to  high 

glucose. PGC‐1α  is not  the only transcriptional coregulator  that was demonstrated 

to interact with Ogt. The corepressor Sin3a can form a complex with Ogt and HDACs 

to repress transcription, particularly at estrogen‐responsive gene promoters (Yang 

et al. 2002). Furthermore, OIP106, also known as trafficking protein kinesin binding 

1,  also  has  a  role  in  Ogt  recruitment  for  transcriptional  regulation  by  forming  a 

complex with Ogt and RNA polymerase II  in the nucleus. This interaction probably 

brings  Ogt  to  transcriptional  complexes  for  O‐GlcNAcylation  of  TFs  or  RNA 

polymerase II (Iyer et al. 2003). Recently, it was demonstrated that Ogt could also be 

  25

recruited to MIP‐1α promoter, leading to an increase in the expression of this gene 

(Chikanishi  et  al.  2010).  This  study  identified  several  potential  Ogt  interacting 

proteins  that  could mediate  its  recruitment  to MIP‐1α  promoter,  but  they did not 

succeed to  identify one specifically. However,  it  is possible  that  the recruitment of 

Ogt to promoters does not lead to O‐GlcNAc modification. This hypothesis relies on a 

study which demonstrated that Ogt loses its activity in presence of chromatin, since 

chromatin  binds  UDP‐GlcNAc,  leading  to  the  inhibition  of  Ogt  (Okuyama  and 

Marshall  2004).  A  lot  of  TFs  were  demonstrated  to  be  O‐GlcNAcylated,  but 

considering this study, the modification must occur in the cytoplasm even if Ogt can 

localize  to  the  nucleus.  Some  other  proteins  also  interact  with  Ogt  and  seem  to 

participate  in  its  activity  or  specificity.  Coactivator‐associated  arginine 

methyltransferase 1 (CARM1) and myosin phosphatase targeting subunit 1 (MYPT1) 

are  targets  of  Ogt  and  regulate  its  specificity  (Cheung  et  al.  2008).  In  absence  of 

MYPT1,  there  are  less  O‐GlcNAcylated  proteins  even  if  Ogt  expression  does  not 

change, and overexpression of CARM1 modifies Ogt selectivity, leading to a different 

profile  of  O‐GlcNAcylated  proteins.  Finally,  there  are  not  only  proteins  that  can 

mediate Ogt specificity, but also lipids. The phospholipid phosphatidylinositol 3,4,5‐

triphosphate recruits Ogt upon insulin activation,  in order to modify Akt and IRS1, 

leading  to  activation  of  the  gluconeogenesis  and  inhibition  of  glycolysis  and 

glycogen  synthesis  (Yang  et  al.  2008b).  The  fact  that  Ogt  interacts  with  several 

proteins could explain why even  if  there are more  than 1,000 proteins  that are O‐

GlcNAcylated,  only  one‐enzyme  catalyses  this  modification.  Ogt  specificity  would 

rely on interaction with its partners and it could explain why no consensus motif of 

O‐GlcNAcylation has been identified yet.  

 

1.3.4 Ogt and physiological functions 

 

The principal  function of Ogt  is  to catalyze the addition of O‐GlcNAc on serine and 

threonine  residues.  The  effect  of  Ogt  on  physiological  functions  will  normally 

depend  on  which  target  it  modifies.  Its  role  was  assessed  by  deletion  and 

  26

overexpression in mice and cells. First, deletion of Ogt gene leads to embryonic stem 

cell lethality in mouse (Shafi et al. 2000). Due to the impossibility to generate viable 

mice deficient for Ogt,  the same group generated mice  lacking this gene in specific 

cells  type,  such  as  neurons,  thymocytes  and  fibroblasts.  As  expected,  lack  of  Ogt 

results  in  the  loss  of  O‐GlcNAcylated  proteins,  but  also  causes  T‐cell  apoptosis, 

hyperphosphorylation  of  tau  protein  in  neurons,  and  growth  arrest  of  fibroblasts 

(O'Donnell et al. 2004). On the other hand, Ogt overexpression showed that it has a 

role in cell cycle progression, since its overexpression results in a polyploidy caused 

by default  in  cytokinesis  (Slawson et al. 2005).  It  is  clear  that Ogt  is an  important 

player  in regulating several physiological  functions and its activity depends on the 

presence of its substrate UDP‐GlcNAc, which will increase Ogt activity according to 

its concentration (Lubas and Hanover 2000). UDP‐GlcNAc is generated by the HBP 

and little is known about the regulation of this pathway, except that between 2‐5% 

of glucose uptake goes  into  it.  It  is  important to study further how this pathway is 

regulated to be able to modulate Ogt activity and O‐GlcNAc cycling 

 

1.4  MORTALIN 

 

Mortalin,  also  known  as  glucose‐related  protein  75  (GRP75)  or  mitochondrial 

HSP70, is a member of the HSP70 family proteins. It is encoded by Hspa9. Like other 

members  of  the  HSP70  family,  Mortalin  is  heat  uninducible  but  also  responds  to 

glucose  deprivation,  oxidative  injury,  low‐level  of  radiations  and  some  cytotoxins 

(Kaul et al. 2007). The localization of this chaperone is a bit controversial. Initially, 

Mortalin was reported to  localize in the cytoplasm and act as an anti‐proliferative, 

senescence‐inductive protein (Wadhwa et al. 1993). However, with the cloning of its 

gene,  it  became  clear  that  the  principal  localization  of  Mortalin  is  in  the 

mitochondria, where it plays a role in import of proteins, chaperoning of misfolded 

proteins,  and  energy  generation  (Webster  et  al.  1994; Bhattacharyya  et  al.  1995). 

Further  studies  revealed  that  Mortalin  can  also  be  found  in  the  endoplasmic 

reticulum, plasma membrane and vesicles (Domanico et al. 1993; Ran et al. 2000). 

  27

Thus, the consensus for Mortalin localization in the cell is in the mitochondria, and it 

can be found in other organelles of immortal cell lines.  

 

1.4.1 Mortalin mitochondrial functions 

 

Mortalin  is encoded by  the nuclear genome and  is  recruited  to  the protein  import 

machinery  in  the  mitochondrial  matrix  by  TIM44.  Mortalin  is  the  only  ATPase 

component  of  the  mitochondrial  import  complex  (Schneider  et  al.  1994).  The 

importance  of  Mortalin  was  demonstrated  in  yeast,  when  deletion  of  its  yeast 

homologue Ssc1  resulted  in death  (Craig et al. 1987).  It  acts with HSP60  to  refold 

proteins,  which  can  be  considered  the  last  step  of  protein  translocation  to 

mitochondria  (Wadhwa  et  al.  2005;  Deocaris  et  al.  2006).  In  addition  to  protein 

folding,  Mortalin  is  implicated  in  the  degradation  of  misfolded  proteins,  which 

cannot be achieved in absence of this chaperone (Savel'ev et al. 1998). Mortalin has 

also  a  role  in  mitochondrial  calcium  regulation  by  mediating  the  interaction 

between  the  voltage‐dependent  anion  channel  (VDAC)  and  the  Ca(2+)‐release 

channel inositol 1,4,5‐triphosphate receptor, two important components in calcium 

exchange between  the endoplasmic  reticulum and  the mitochondria  (Szabadkai  et 

al. 2006). Finally, in the mitochondria, Mortalin can act as an antagonist of cell death. 

Indeed,  p53  is  an  important  tumor  supressor  and  can  induce  apoptosis  in 

transformed  cells.  However,  by  binding  to  p53,  Mortalin  can  inhibit  p53‐induced 

apoptosis and target it to proteasomal degradation (Deocaris et al. 2008b).  

 

1.4.2 Mortalin and cell proliferation 

 

Mortalin influences p53 activity outside of the mitochondria as well. First, cytosolic 

Mortalin  interacts with  p53  and  increases  the  ability  of  this  tumor  suppressor  to 

bind DNA  (Iosefson  and Azem 2010). Also,  it  can  associate with  centrosomes  and 

remove  p53  from  them  to  allow  centrosomes  duplication  (Ma  et  al.  2006). 

Localization of Mortalin to the centrosomes is dependent on the kinase Msp1, which 

phosphorylates  Mortalin  on  threonine  62  and  serine  65.  In  absence  of  this  PTM, 

  28

Mortalin  cannot  promote  centrosomes  duplication,  leading  to  a  decrease  in  cell 

proliferation  (Kanai  et  al.  2007). Mortalin  also plays  a  role  in  cell  proliferation by 

interacting with the protein mevalonate pyrophosphate decarboxylase, leading to a 

decrease in the activation of the Ras‐Raf pathway when it is in excess (Wadhwa et al. 

2003). In addition to that, its protein level decreases in senescent human fibroblasts 

and in aged worms, demonstrating its  importance in cell proliferation (Deocaris et 

al.  2008a).  Furthermore,  its  overexpression  results  in  lifespan  extension  in 

fibroblasts  and  C.  elegans,  and  its  knockdown  leads  to  cellular  growth  arrest 

(Wadhwa et al. 2004). 

 

1.4.3 Mortalin and physiological dysfunctions 

 

As  a major mitochondrial  protein, Mortalin  is  also  linked  to  several  physiological 

dysfunctions.  It  is  not  clear  if  it  is  a  cause  or  a  consequence,  but  Mortalin 

distribution  in  normal  cells  versus  transformed  cells  is  different.  In  the  last  one, 

Mortalin is restricted to the perinuclear region, wheras in normal cells it localizes in 

the  cytoplasm  and  mitochondria.  Considering  its  different  distribution  between 

normal and transformed cells and its role in cell proliferation, it is not surprising to 

observe  that  Mortalin  protein  is  overexpressed  in  hepatocellular  carcinoma  and 

liver cancer metastasis  (Yi et al. 2008). A study  in colorectal cancer concluded the 

same thing,  i.e.  that Mortalin  is overexpressed  in  this cancer  and correlates with a 

poor survival (Dundas et al. 2005). A recent study suggests that Mortalin supports 

cancer cells resistance to therapy, because its inhibition in leukemia cells results in 

an increase in cell death induces by membrane attack complex (Pilzer et al. 2010). 

Mortalin  seems  to  be  involved  in  prostate  cancer  as  well.  It  interacts  with  the 

tetraspanin protein CD9 in prostate cancer cells and participates in the induction of 

mitotic catastrophe, which leads to prostate cancer progression (Zvereff et al. 2007). 

 

Cancer is not the only disease that Mortalin is linked to. It has been shown that the 

expression of Mortalin decreases  in mitochondria of  the brain of patients with PD 

and in mitochondria of a cellular model of PD. In this particular cellular model, the 

  29

overexpression of Mortalin enhances the PD phenotype by mitochondrial inhibition, 

oxidative  stress  and  proteasomal  dysfunction  (Jin  et  al.  2006).  Furthermore, 

Mortalin  is  one of  the  five major proteins  that binds  to α‐synuclein  and DJ‐1,  two 

critical proteins in PD (Jin et al. 2007). Also, some mutations in Mortalin gene were 

reported in patients with PD (De Mena et al. 2009). The role of Mortalin in PD is not 

well understood, but one explanation could be a dysfunction in its chaperoning role. 

In  fact,  misfolded  proteins  have  a  strong  tendency  to  form  neurotoxic  insoluble 

protein aggregates and could explain why there are so much links between Mortalin 

and this disease.  

  30

GOAL OF THE STUDY 

 

The  initial  goal  of  the  study was  to  study  the  role  of  the  orphan NR ERRα  in  the 

regulation of the HBP. ERRα is known to regulate the transcription of several genes 

involved in glucose metabolism and bioenergy regulation. Since the HBP uses 2‐5% 

of  glucose  uptake,  we  were  interested  to  study  if  ERRα  could  have  a  role  in  the 

regulation of this pathway. The hypothesis is that ERRα regulates the addition of O‐

GlcNAc on certain proteins, by controlling the transcription of genes involved in the 

HBP. The goal is to find how ERRα regulates this pathway; if it needs an inducer and 

if it can modulate the HBP through its action. The HBP has been studied a lot in the 

last decade, but almost all the studies were downstream, i.e. the effect of O‐GlcNAc 

addition on proteins  activity. However,  little  is  known about  the  regulation of  the 

HBP at upstream level. 

 

During  the  study,  I  found  that  in  general,  proteins  are  more  O‐GlcNAcylated  in 

absence of ERRα. This was more obvious for one specific protein, Mortalin. With this 

interesting  data,  the  goal  of  the  study  became  to  assess  the  regulation  of  the 

mitochondrial protein Mortalin by ERRα through the HBP. 

  31

CHAPTER II – MANUSCRIPT 

 

Transcriptional Regulation of Mortalin and the Hexosamine Biosynthetic 

Pathway by the Orphan Nuclear Receptor ERRα 

 

This chapter forms the basis of the manuscript: “Transcriptional Regulation of 

Mortalin and the Hexosamine Biosynthetic Pathway by the Orphan Nuclear 

Receptor ERRα” by Guillaume Sylvain‐Drolet, Catherine Rosa Dufour and Vincent 

Giguère 

 

 

 

The writing  of  this manuscript  is  entirely my  own with  corrections  and  editorial 

comments by Dr. Vincent Giguère. 

  32

INTRODUCTION 

 

Nuclear  receptors  (NRs)  are  a  group  of  transcription  factors  (TFs)  that modulate 

gene expression when bound by their small lipophilic ligands (Evans 1988). Some of 

the NRs are called orphan because no natural  ligand have been  identified yet. The 

first orphan NR to be identified is the estrogen‐related receptor α (ERRα, NR3B1), 

which was found by its high similarity with the estrogen receptor (ER, NR3A) DNA‐

binding  domain  (DBD)  (Giguere  et  al.  1988).  Even  if  ERRα  has  a  high  structural 

homology with ER,  it became rapidly clear  that estrogen or any  other endogenous 

small molecule could not activate ERRα. At physiological level, since ERRα does not 

have any  ligand,  its activity  is mostly regulated by post‐translational modifications 

(PTMs), such as acetylation, phosphorylation and SUMOylation (Barry and Giguere 

2005; Vu et al. 2007; Tremblay et al. 2008; Wilson et al. 2010), and by interactions 

with  coregulators.  For  example,  the  peroxisome  proliferator‐activated  receptor  γ 

coactivator‐1α  (PGC‐1α)  is  an  important  ERRα’s  coactivator,  which  physically 

interacts  with  ERRα  to  increase  its  transcriptional  activity,  making  it  a  potent 

regulator of gene expression (Huss et al. 2002; Schreiber et al. 2003; Laganiere et al. 

2004).  On  the  other  hand,  the  homeobox  protein  prospero‐related  homeobox  1 

(Prox1)  is  a  corepressor,  inhibiting  ERRα/PGC‐1α  complex  activity  (Charest‐

Marcotte et al. 2010). ERRα is involved in transcription control of several metabolic 

genes,  such  as  genes  implicated  in  tricarboxylic  acid  (TCA)  cycle,  oxidative 

phosphorylation  (OXPHOS),  fatty  acid  oxidation  (FAO)  and  glucose  metabolism 

(Dufour  et  al.  2007;  Giguere  2008;  Tremblay  et  al.  2008;  Charest‐Marcotte  et  al. 

2010).  Considering  its  important  role  in  energy  metabolism,  it  would  not  be 

surprising that ERRα is involved in the hexosamine biosynthetic pathway (HBP), an 

energy sensing pathway directly connected to glucose metabolism. 

 

The HBP modulates  the  PTM O‐linked N‐Acetylation  (O‐GlcNAc)  in  cells.  Between 

2% and 5% of glucose uptake is driven from the glycolysis to the HBP by the enzyme 

L‐glutamine:D‐fructose‐6‐phosphate  amidotransferase  (Gfat), which  is  encoded  by 

  33

the  glutamine  fructose‐6‐phosphate  transaminase  1  (Gfpt1)  gene  (McClain  and 

Crook  1996).  This  pathway  generates  UDP‐GlcNAc,  the  substrate  used  by  the 

enzyme  O‐GlcNAc  transferase  (Ogt),  to  modify  proteins  with  the  addition  of  O‐

GlcNAc  (Love  and  Hanover  2005).  On  the  other  hand,  the  enzyme  O‐GlcNAcase 

(Oga),  encoded  by  meningioma  expressed  antigen  5  (Mgea5)  gene,  removes  this 

PTM.  Like  phosphorylation,  O‐GlcNAcylation  occurs  on  hydroxyl  groups  of  serine 

and  threonine  residues,  and  often  there  is  a  competition  between  the  2 

modifications for the same residue (Hart et al. 2007; Wang et al. 2008). However, in 

contrast to phosphorylation which involves hundreds of kinases and phosphatases, 

only  two  enzymes  modulates  O‐GlcNAcylation:  Ogt  and  Oga.  O‐GlcNAc  cycling  is 

involved  in many processes of cell physiology, such as gene expression regulation, 

metabolism,  signal  transduction,  transport,  translation  and  structure  (Teo  et  al. 

2010a).  To  date,  over  1,000  proteins  have  been  reported  to  be  O‐GlcNAcylated. 

Moreover,  this  PTM  is  essential  for  embryonic  development,  since  deletion  of Ogt 

gene  leads  to  embryonic  stem  cell  lethality  in mouse  (Shafi  et  al.  2000).  Also,  the 

HBP is linked to type II diabetes and is essential for tumor growth in breast cancer 

(Butkinaree  et  al.  ;  Crook  et  al.  1993;  Caldwell  et  al.  2010).  The  HBP  has  been 

studied  a  lot  to  determine  the  effect  of  O‐GlcNAcylation  on  specific  protein. 

However, little is known about the regulation of this pathway. 

 

This study reveals that several genes of the HBP are ERRα’s targets. This orphan NR 

is  involved  in  transcription  regulation  of  the  HBP,  which  is  downregulated  in 

absence  of  ERRα.  However,  in  its  absence,  proteins  are  more  O‐GlcNAcylated  in 

general. This can be observed more specifically when we  look  to specific proteins, 

such  as  Mortalin,  a  major  chaperone  involved  in  protein  translocation  to 

mitochondria (Wadhwa et al. 2005; Deocaris et al. 2006). Interestingly, Mortalin is 

also an ERRα’s target. This suggests that ERRα could modulate proteins activity at 

two  levels. First, by modulating  their gene expression, second by modulating  their 

PTMs, through the control of the HBP.  

  34

MATERIALS AND METHODS 

 

Plasmids 

 

pCMX  and  pCMX‐ERRα  were  described  previously  (Laganiere  et  al.  2004).  The 

expression  vector  pcDNA3/HA‐hPGC1α  was  provided  by  A.  Kralli  (Kressler  et  al. 

2002).  The  reporter  plasmids  pGL3‐mOgt  promoter,  pGL3‐mMgea5  promoter  and 

pGL3‐mUap1  promoter  were  obtained  by  high‐fidelity  PCR  on  C57BL/6J  mouse 

genomic DNA with the following primers:  

mOgT:  CGCCTCGAGCTGGGCTTGAAACCGTAAGAGG  and 

CGCAAGCTTGCCGCCACTACTGACAAGAATG;  

mMgea5:  CTAGCTAGCTAGGCACACTCTCCATCGCCATAACAAAC  and 

CCCAAGCTTGGGCCCTTCCCCCTTCCTCTCGG;  

mUap1:  CGACGCGTCGGCCTGCACATGCACATCTGCTGCC  and 

GAAGATCTTCCAGCGACCGAGAACAGCCAAAG,  

and  insert  into  pGL3  plasmids  as  XhoI/HindIII  fragment;  NheI/HindIII  fragment; 

MluI/BglII  fragment,  respectively. Mouse promoter sequences were obtained  from 

UCSC genome browser database. The integrity of all plasmids described was verified 

by DNA sequencing. 

 

Reporter Assays 

 

Hepa 1‐6 and HEK293 cells, cultured in DMEM (Invitrogen) supplemented with 10% 

fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin,  in a 5% CO2 

environment, were seeded the night before the transfection. Transfection was done 

using  FUGENE  6  (Roche  Diagnostics, Mannheim,  Germany)  in  12‐well  plates with 

250  ng  luciferase  reporter,  200  ng  pCMX‐ERRα,  500  ng  pcDNA3/HA‐hPGC1α  and 

200  ng  CMV  β‐galactosidase  transfection  efficiency  control  plasmid.  Cells  were 

harvested  and  assayed  for  luciferase  activity  24h  post‐transfection.  Luciferase 

counts were normalized to β‐galactosidase activity. Experiments were performed in 

  35

duplicate  and  the  data  presented  here  are  from  one  representative  on  three 

independent experiments.  

 

ChIP and ChIP­on­chip 

 

ChIP assays and ChIP‐on‐chip experiments were performed as previously described 

(Charest‐Marcotte et al. 2010) but only with ERRα antibody. Chromatin used for the 

ChIP‐on‐chip corresponds to 3.3 g of initial liver mass taken from a pool of 24 livers. 

Duplicate  ERRα  ChIP‐on‐chip  experiments  were  performed.  Samples  were 

hybridized  to  microarray  slides  containing  ~17,000  of  the  best‐defined  mouse 

transcripts  represented  as  defined  by  RefSeq  spanning  from  ‐5.5kb  upstream  to 

+2.5kb  downstream  of  the  transcriptional  start  sites  (Agilent  244K  microarray) 

according to the Agilent mammalian ChIP‐on‐chip protocol version 9.2.  

 

Quantitative Real­Time PCR 

 

To assess  the enrichment of ERRα  at promoters  from the HBP  identified  from the 

ChIP‐on‐chip experiments, quantitative PCR (qPCR) was performed using the same 

ChIP material used for hydridizations as described previously (Dufour et al. 2007). 

The  abundance  of  enriched  DNA  was  assessed  by  LightCycler  2.0  (Roche)  and 

QuantiTect® SYBR®Green PCR Kit. Enrichment of DNA fragments was normalized 

against one amplified region using the control primers,  located approximately 4kb 

upstream of the ERRα transcriptional start site. Enrichment at HBP gene promoters 

was quantified with the following primers:   

Uap1: CCAGCTTGGAAAGTACCGAGTC and GAGAATGCTTCTACCCCAGGGAC; 

Glyat: GGTTTTGGGGAACAGAGTGCAGAG and GTGTTGAAGGTTGGCATACAAGTT; 

Mgea5: GCCTTTCCTTGGGATAAGCC and CGAGCCAAAATGGTACGTCC; 

Ogtpromoter: GGAGTTGCCTAGACAGGGTTGTC and GCGTAACAAGACTACCGACCAAG; 

Ogtintron1:  GTGGTTAGCTGTGCAGAAATTGCTCTGG  and 

CCTAAGGCTCGGCTGTAAACATTTATCTCC; 

  36

Hspa9:  GAGAGAAGAGAGGTGGACAGGCATCGC  and 

CGCAACTGACGCAAGGAGACTGTAATC 

Control  primers:  TTGGCATTGATATTGGGGGTGGGAGCAACT and

GACTTCTTACTTTGACGCTTTCCTCCATCG. 

 

Mice 

 

The ERRα  null mice  (C57/BL6 background) were previously described  (Luo  et  al. 

2003). Male mice (2‐3 months old) were used throughout the study. The mice were 

euthanized, and the  livers were removed, rinsed  in cold PBS, snap frozen  in  liquid 

nitrogen, and stored at ‐80°C until subsequent analysis. The livers were pulverized 

using motor and pestle pre‐cold  in dry ice. Liquid nitrogen was added regularly to 

the powder during the pulverization procedure to prevent thawing. The pulverized 

tissues were aliquot for protein and RNA extraction and stored at ‐80°C. 

 

RNA isolation, reverse transcription, and qRT­PCR 

 

Using the RNeasy miniprep (QIAGEN) according to the manufacturer’s instructions, 

total  RNA  was  isolated  from  ground  mouse  livers  or  from  cells  grown  in  a 

monolayer,  lysed  directly  in  the  cell‐culture  vessel.  RNA  was  quantified  by 

spectrophotometry.  For  each  sample,  1  μg  of  total  RNA was  used  for  the  reverse 

transcription.  RNA  was  reverse  transcribed  to  cDNA  using  the  SuperScript  First‐

Strand Synthesis system (Invitrogen) according  the manufacturer’s protocol. qPCR 

reactions were performed with LightCycler 480 (Roche) and LightCycler 480 SYBR 

Green  I Master mix  (Roche).  A  standard  curve was  performed with  the  following 

dilutions:  1/5;  1/10;  1/20;  1/40  and 1/80. The  cDNA  samples were diluted 1/20 

and ran in triplicates, as the standard curve. Values were normalized to Arbp control 

gene. 

Arbp: GCAGCAGATCCGCATGTCGCTCCG and GAGCTGGCACAGTGACCTCACACGG 

Nagk: GGATGCAGTGAGGCTCCTGATTG and GTTCCAGAGATGAGCACAATCCC 

  37

Uap1: GGCAGTGCTACCAGAGATCAAGAGC and GAAAAAGCGTCTTGTGGGATGGC 

Pgm3: CCCAGCATCTCGATCATATCATGTTTCG and GTCCTGCTCCTCCGCACTGG 

Ogt: GACATAGCTGTGAAACTGGGAACCG and CATGTGGTCAGGTTTGTTGCCAG 

Mgea5: GGGAGAGCCAGAAACCTTCCTC and CTGTCCAAAGCACCTCAATTCCAG 

Glyat:  CCTGGAGTCCTCAGAAGTCATTAACTGG  and 

GTTTGATTTGAAAAGATTGGATGCTTGC 

Gfpt1: GACAAGAAAGGAAGCTGCGGTC and CCACCACTGCTGCAACATCATC 

Esrra : CTCAGCTCTCTACCCAAACGC and CCGCTTGGTGATCTCACACTC 

 

Protein extraction from mice 

 

For  each  sample,  ~100  μl  of  grinded  livers  were  transferred  to  a  15 ml  tube,  to 

which was added 1.5 ml of modified RIPA buffer (50 mM Tris‐HCl pH7.4, 1 % NP‐40, 

0,25  %  sodium  deoxycholate,  150  mM  NaCl,  1  mM  EDTA,  1  mM  PMSF,  100  μM 

PUGNAc and 1 pellet COMPLETE mini‐EDTA free ROCHE, per 10 ml of buffer). The 

livers  were  homogenized  with  a  polytron‐type  homogenizer  (IKA®  T10  basic 

ULTRA‐TURRAX®) for 3x15 sec. After 1 h incubation at 4°C under constant rotation, 

the  crude  homogenate  was  centrifuged  at  4°C  for  10  min  at  13,000  rpm.  The 

concentration of the total liver extract (supernatant) was determined by Micro BCA 

Protein Assay Kit (Thermo Scientific), according to the manufacturer’s instructions. 

 

Western blot 

 

Protein  extracts  (40  μg)  were  separated  on  a  SDS‐8%PAGE  gel,  transferred  onto 

PVDF membranes  (Amersham Biosciences) and blocked overnight at  4°C  in TBS‐T 

(Tris‐buffered  saline,  20 mM Tris,  150 mM NaCl  and 0,1% Tween)  containing 5% 

skim  milk.  For  Western  blot  analysis  membranes  were  incubated  1  h  at  room 

temperature  with  either  an  in‐house  rabbit  polyclonal  anti‐ERRα  antibody 

(Laganiere  et  al.  2004)  (1:10,000),  mouse  monoclonal  anti‐O‐GlcNAc  CTD110,6 

antibody  (Santa  Cruz:  sc59623,  1:200),  mouse  monoclonal  anti‐O‐Linked‐N‐

  38

Acetylglucosamine RL2 antibody (Abcam: ab2739, 1:1,000), mouse monoclonal anti‐

Ogt  antibody  (Santa  Cruz:  sc74547,  1:200),  mouse  monoclonal  anti‐α‐Tubulin 

antibody  (Cederlane:  CLT9002,  1:1,000),  rabbit  polyclonal  anti‐HA‐probe  Y‐11 

(Santa  Cruz:  sc805,  1:200),  rabbit  polyclonal  anti‐Akt1/2/3  (Santa  Cruz:  sc8312, 

1:200)  or  rabbit  polyclonal  anti‐Grp75  antibody  (Santa  Cruz:sc13967,  1:200) 

diluted in TBS‐T containing 1% BSA and 0,02% sodium azide. Following 3 washes in 

TBS‐T  containing  5%  skim  milk,  the  membranes  were  incubated  for  1  h  in 

secondary  antibody,  donkey  anti‐rabbit  IgG‐HRP  (GEHealthCare:  NA9340V, 

1:10,000 in TBS‐T containing 5% skim milk), goat anti‐mouse IgM‐HRP (Santa Cruz: 

sc2064,  1:500  in  TBS‐T  containing  5%  skim  milk)  or  sheep  anti‐mouse  IgG‐HRP 

(GEHealthCare:  NA931V,  1:10,000  in  TBS‐T  containing  5%  skim  milk).  The 

membranes  were  washed  4  times  in  TBS‐T  and  subsequently  the  proteins  were 

detected  using  Lumi‐Light  Western  Blotting  Substrate  (Roche)  or  Lumi‐LightPLUS 

Western Blotting Substrate (Roche). 

 

Coimmunoprecipitations assays 

 

Proteins were  isolated  from mouse  livers  as  described  above.  Equal  amount  of  4 

liver lysates from 4 WT or 4 KO mice were pooled together to have 2 mg of proteins 

of  each  group.  Immunoprecipitations  were  pre‐cleared  with  protein  G‐sepharose 

(GEHealtCare: 11‐0618‐02) for 30 min at 4°C with rotation. After centrifugation at 

5,000 rpm for 2 min at 4°C, supernatants were collected and  incubated 2 hours at 

4°C  with  rotation  with  4  μg  of  anti‐HA‐probe,  anti‐Akt  or  anti‐Grp75,  described 

above.  Protein  G‐sepharose  was  added  to  the  lysates  and  the  samples  were 

incubated 1 h at 4°C with rotation. The samples were centrifuged at 5,000 rpm for 2 

min at 4°C and  the pellets were washed 4  times with buffer K  (20 mM phosphate 

buffer pH 7, 150 mM NaCl, 0,1% NP‐40, 5 mM EDTA and 1 pellet COMPLETE mini‐

EDTA  free ROCHE, per 10 ml of buffer). The  immunoprecipitations were eluted  in 

western loading buffer (62,5 mM Tris/HCl pH6.8, 10% Glycerol, 2% sodium dodecyl 

sulfate, 5% β‐mercaptoethanol, 0,00625% bromophenol blue), and boiled for 5 min. 

  39

Samples were stored at ‐80°C and Western blotting analysis were conducted later as 

described above. 

 

Mass spectrometry analysis 

 

2 mg of lysates from 4 WT livers mouse and 2 mg of lysates from 4 KO livers mouse 

were  immunoprecipitated  with  anti‐Akt1/2/3  antibody  as  described  above.  The 

immunoprecipitations were separated on an acrylamide SDS‐8%PAGE gel. All tools 

used for the electrophoresis were soaked in 20% acetic acid overnight.  The gel was 

stained with Bio‐Safe Coomassie G50 (BioRad 161‐0786) overnight and destained in 

ultrapure water 5 hours. The band corresponding to 70 kDa was cut and analysied 

by mass spectrometry (MS). The band was digested with trypsin. The peptides were 

separated  with  ESI‐TRAP  MS/MS  Ion  search  and  analyzed  with  the  Mascot  and 

Scaffold software. 

  40

RESULTS 

 

Identification of HBP genes targeted by ERRα in livers 

 

ERRα  regulates  multiple  genes  involve  in  glucose  metabolism  and  we  want  to 

evaluate if it targets as well HBP genes. Localization of TFs on promoters of interest 

is a good way to assess a potential role in transcription regulation of specific genes. 

First, regulation of the HBP by the orphan NR ERRα in mouse livers was assessed by 

chromatin immunoprecipication (ChIP) followed by hydridization of the chromatin 

on  a  chip  (ChIP‐on‐chip).  Analysis  of  genome‐wide  localization  of  ERRα  revealed 

that  it binds  to  several genes  involved  in  the HBP (figure 1A).  In  fact, ERRα binds 

Mgea5, and Ogt on their promoters, the two genes encoding the enzymes controlling 

O‐GlcNAc  cycling,  Oga  and  Ogt.  Moreover,  ERRα  binds  UDP‐N‐acetylglucosamine 

pyrophosphorylase  (Uap1)  promoter,  as  well  as  glycine‐N‐acyltransferase  (Glyat) 

and Ogt introns 1. In all these cases, ERRα localization is closed to the transcription 

start  site  by  less  than  1,000  bp.  However,  these  targets  must  be  validated  by 

standard  ChIP  analysis.  Thus,  using  an  ERRα  antibody,  we  proceeded  to  a  ChIP 

experiment  in  mouse  livers,  followed  by  quantification  of  the  enriched  DNA  by 

quantitative PCR (qPCR). Compare to the control ChIP, there is an enrichment of 3.8 

fold at Mgea5 promoter, 3.5  fold at Uap1 promoter, 13.4  fold at Ogt promoter, 4.1 

fold at Ogt  intron 1 and 2.8 fold at Glyat intron 1 in ERRα ChIP (figure 1B,C). ChIP‐

on‐chip  is  a  large‐scale  tool  to  identify  targets  of  TFs,  but  some  targets  can  be 

missed. So, following the ERRα ChIP, we looked also if ERRα could bind to the other 

HBP  genes;  N‐Acetylglucosamine  kinase  (Nagk),  phosphomutase  3  (Pgm3)  and 

Gfpt1. Chromatin enrichment from these genes in ERRα ChIP was at the same level 

of  the  control  ChIP,  revealing  that  they  are  not  ERRα  targets  in  those  conditions 

(figure  1B).  The  mouse  livers  ChIP‐on‐chip  and  ChIP  results  demonstrated  that 

ERRα binds  to several genes  involved  in the HBP,  including Ogt and Mgea5, which 

encode the enzyme that directly regulate the addition and the removal of O‐GlcNAc 

on proteins. 

  41

                           Figure  1.  ERRα  localization  on  HBP  gene  by  ChIP‐on  chip  and  standard  ChIP 

validation in mouse livers.  

(A) Enrichment  ratio  profiles  for  ERRα  at  a  few  promoters  of  the  HBP:  Glyat, 

Uap1, Ogt and Mgea5. 

(B) Standard ChIP validation of ERRα bound segments in mouse livers. 

(C) Scheme demonstrating the HBP with ERRα targets indicated in blue. 

 

 

Transcriptional regulation of Mgea5, Ogt and Uap1 by ERRα 

 

ERRα binding to HBP genes suggests that it is probably involved in control of their 

transcription.  To  confirm  that  and  evaluate  its  role  in  their  transcriptional 

  42

regulation, we proceeded  to  luciferase  assays.  Promoters  of Uap1, Ogt  and Mgea5 

genes were  cloned upstream  to  a  luciferase  reporter  gene.  For Uap1  reporter,  the 

region  is  ‐646bp  to  ‐4bp  of  the  transcription  start  site.  The  Mgea5  reporter 

corresponds  to  ‐1020bp  to  +40bp  and  Ogt  reporter  corresponds  to  ‐1085bp  to 

+148bp.  These  reporters  were  individually  transfected  in  Hepa1‐6  cells,  a 

hepatocytes  cell  lines  derived  from  mouse  tumors.  At  basal  level,  transcriptional 

activity  of Uap1  pormoter  is  about  20,000  RLUs  (relative  luciferase  units),  while 

110,000 RLUs for Mgea5 promoter and 71,000 RLUs for Ogt promoter. ERRα alone 

activates transcription of Uap1 reporter by about 3 fold (figure 2A). Mgea5 and Ogt 

reporters’ respond in the same way to ERRα, with around 2 fold activation (figure 

2B,C).  In  addition,  PGC‐1α  is  an  ERRα’s  coactivator,  which  enhances  its 

transcriptional  activity  (Laganiere  et  al.  2004).  This  can  be  observed when  ERRα 

and PGC‐1α are cotransfected with Uap1 reporter, transcription is activated by 5.3 

fold,  while  without  ERRα,  PGC‐1α  can  not  activate  transcription  of  this  reporter 

(figure 2A). Also, Mgea5 and Ogt reporters are not activated by PGC‐1α alone, while 

cotransfection  of  the  coactivator  and  the  NR  weakly  increases  transcriptional 

activity, compared to ERRα alone (figure 2B, C). 

 

The binding of ERRα and its role in transcription was assessed in liver tissues and 

cultured cells. In order to see if it is a tissue specific regulation, the luciferase assays 

were  reproduced  in HEK293  cells,  a  human  embryonic  kidney  cell  line.  The basal 

activities  of Uap1, Mgea5  and Ogt  promoters  are  43,000 RLUs,  225,000 RLUs  and 

47,000  RLUs  respectively.  As  Hepa  1‐6  cells,  PGC‐1α  is  not  sufficient  to  activate 

transcription  of  Uap1,  Mgea5  and  Ogt  reporters  (figure  2D,E,F).  However,  Uap1 

reporter  is  not  activated when  only  ERRα  is  transfected,  it  needs  the  presence  of 

both, the NR and its coactivator (figure 2D). For Mgea5 and Ogt reporters, ERRα can 

activate  their  transcriptions, which  is weakly  increased by  the addition of PGC‐1α 

(figure 2E,F). The results  show  that ERRα does not only bind  to Uap1, Mgea5  and 

Ogt  promoters,  but  can  also  regulates  their  transcription,  by  enhancing  their 

expressions.  

  43

                   

Figure 2. ERRα and PGC‐1α enhance transcription of Uap1, Mgea5 and Ogt.  

(A,B,C)  Hepa  1‐6  cells  were  transfected  with  the  (A)  Uap1  promoter,  (B) Mgea5 

promoter and (C) Ogt promoter reporter construct and 200 ng of ERRα expression 

plasmids in the presence or absence of 500 ng PGC‐1α expression plasmids.  

(D,E,F)  HEK293  cells  were  transfected  with  the  (D)  Uap1  promoter,  (E)  Mgea5 

promoter and (F) Ogt promoter reporter contruct and 200 ng of ERRα expression 

plasmids in the presence or absence of 500 ng PGC‐1α expression plasmids. 200 ng 

CMV β‐galactosidase transfection efficiency control plasmid was transfected as well 

in each conditions and luciferase counts were normalized to β‐galactosidase activity. 

Error bars  correspond  to  standard deviation of  the duplicates.  This  experiment  is 

one representative of three independent experiments.  

  44

 

Expression of HBP genes in liver, in presence or absence of ERRα 

 

The ChIP‐on‐chip and ChIP datas revealed that ERRα binds to HBP gene promoters. 

In order to assess its role in their regulation, we proceeded to RNA quantification in 

the  presence  or  absence  of  ERRα  in mouse  livers.  The ERRα‐null mice  are  viable, 

fertile and with the exception of a reduction in their body weight and peripheral fat 

deposits, have no obvious anatomical alterations (Luo et al. 2003). RNA was isolated 

from 8 WT mouse livers and 8 KO mouse livers, reverse transcripted in cDNA, and 

quantified by qPCR. Thus, it was possible to compare the expression of the different 

HBP  genes  in  presence  and  absence  of  ERRα.  We  observe  a  significant 

downregulation  of  Glyat,  Uap1,  Ogt  and  Mgea5  expressions  in  ERRα‐null  mice 

compare  to WT  (figure  3A,  B,  C,  D).  Interestingly,  the  genes  that  are  significantly 

dowregulated in the absence of ERRα correspond to the same that were shown to be 

targeted by ERRα  in the ChIP‐on‐chip and ChIP analysis (figure 1A, B, C). Mgea5  is 

dowregulated  by  about  45%  in  absence  of  ERRα,  hence  Glyat,  Uap1  and  Ogt 

expressions  are  all  dowregulated  by  about  20%.  Furthermore,  in  agreement with 

the fact that they were not bound by ERRα,  there are no significant changes in the 

other HBP genes expression between the WT and KO mice. Quantification of Pgm3, 

Gfpt1 and Nagk messenger RNA revealed that they are expressed at the same level 

between  the  WT  and  KO  (figure  3E,  F,  G).  So,  at  basal  level,  ERRα  seems  to  be 

required to maintain expression of several HBP genes, but not all of them. Thus, in 

absence of ERRα, Ogt, Mgea5, Glyat and Uap1, all targeted by this orphan NR, are still 

expressed, but at a lower level. 

 

  45

Figure 3. HBP RNA quantification in ERRα‐null mice.  

Reverse  Transcription  followed  by  qPCR  performed  on  RNA  isolated  from mouse 

livers (n = 8 WT and 8 KO). Relative expression levels between ERRα null mice and 

wild‐type were  normalized  to  acidic  ribosomal  phosphoprotein  (Arbp)  levels  and 

bars represent mean (±SEM). (A) Glyat, (B) Uap1, (C) Ogt, (D) Mgea5, (E) Pgm3, (F) 

Gfpt1 and (G) Nagk. *, P < 0.05, **, P < 0.01, ***, P < 0.001; Student’s test. 

 

 

ERRα affects proteins O­GlcNAcylation 

 

The  HBP  ends  by  the  addition  of  O‐GlcNAc  on  serine  and  threonine  residues  of 

multiple  proteins  (Love  and Hanover  2005).  So, measurements  of  O‐GlcNAcylated 

proteins  can  provide  informations  on  the  activity  of  the  pathway  in  presence  or 

absence  of  ERRα.  With  an  antibody  that  specifically  recognizes  proteins  O‐

GlcNAcylated, it was possible to assess HBP activity in presence or absence of ERRα. 

Proteins  were  isolated  from  4  WT  or  4  KO  mouse  livers,  and  O‐GlcNAcylated 

proteins were detected by Western Blot. As the HBP is downregulated in absence of 

ERRα as shown in figure 3, we could expect to see less O‐GlcNAcylated proteins in 

the KO mice. Interestingly, we observed the opposite. In general, proteins are more 

  46

O‐GlcNAcylated  in  mice  lacking  ERRα  compared  to  the  WT  (figure  4A).  It  is 

important to remember that RNA expression does not always correspond to protein 

expression  due  to  differences  in  translational  control  or  micro‐RNA  expression 

activity. So, we looked for Ogt protein expressions, to evaluate if it could explain the 

difference we observe between HBP RNA expression and O‐GlcNAcylated proteins. 

Contrary  to RNA  level, which  is downregulated by about 20% in absence of ERRα 

(figure  3  C),  Ogt  protein  expression  does  not  change  between  WT  and  KO  mice 

(figure 4B). Unfortunately, no commercial antibody againt Oga was avaible during 

the  time  of  the  study.  Thus,  the  fact  that  proteins  are  more  O‐GlcNAcylated  in 

absence of ERRα  cannot be explained by an  increase  in Ogt protein expression.  It 

should be noted that even if Western Blot allows O‐GlcNAc detection, this is not the 

highest sensitive method. In fact, over 1,000 proteins have been identified to be O‐

GlcNAcylated and most of them were identified using mass spectrometry (Hart et al. 

2007; Teo et al. 2010a). Further studies using mass spectrometry shoul be perform 

in  order  to  identify  the  proteins  that  are  O‐GlcNAcylated  in  the  ERRα  KO  mice, 

compare to the WT. 

 

Since  proteins  seem  to  be more  O‐GlcNAcylated  in  absence  of  ERRα,  we  tried  to 

observe  this  pattern  on  specific  proteins.  We  choosed  to  look  for  Akt  O‐

GlcNAcylation  because  this  PTM  is  well  known  and  documented  on  this  protein. 

Also,  it  is  an  interesting  link  to  insulin  signaling  and  glucose  metabolism,  which 

involved  several  ERRα’s  targets  (Vosseller  et  al.  2002;  Yang  et  al.  2008b).  To 

proceed, we immunoprecipiated (IP) Akt from mouse livers WT and KO and blot for 

O‐GlcNAc. In the KO IP, it is possible to observe a weak band at 60 kDa that should 

correspond to Akt, but not in the WT IP, suggesting that Akt is more O‐GlcNAcylated 

in absence of ERRα (figure 4C). Moreover, an unknown protein having a mass of 75 

kDa  co‐IP with Akt  and  is much more O‐GlcNAcylated  in  absence  of  ERRα  (figure 

4C). To identify the unknown protein, we proceeded to mass spectrometry analysis. 

Analysis of the different peptides obtained revealed that 139 amino acids matched 

with the 679 amino acids of Mortalin protein (figure 4D). Interestingly, Mortalin was 

  47

already reported to interact with Akt and to be O‐GlcNAcylated (Walgren et al. 2003; 

Vandermoere et al. 2007). The results show that  in absence of ERRα, proteins are 

generally  more  O‐GlcNAcylated.  This  can  be  observed  specifically  on  particular 

proteins like Akt and Mortalin. 

 

Figure 4. Evaluation of HBP activity by O‐GlcNAcylated proteins.  

(A) Western blot of mouse liver proteins showing O‐GlcNAcylated proteins and (B) 

Ogt expression. Equal loading was assessed with α‐Tubulin.  

(C)  Mouse  livers  WT  (4)  and  KO  (4)  total  extracts  were  subjected  to 

immunoprecipitation with  the  anti‐Akt  antibody  (αAkt)  followed  by Western  blot 

analysis  with  the  anti‐O‐GlcNAc  (αO‐GlcNAc).  The  left  panel  corresponds  to  the 

input, while the right panel corresponds to the immunoprecipitation. Both were run 

on the same gel and are at the same exposition time. 

(D) Peptides obtained by mass spectrometry analysis to identify the protein that Co‐

IP with Akt. 

 

 

Mortalin is more O­GlcNAcylated in absence of ERRα 

  48

 

Mortalin is one of the major chaperones in mitochondria and is  involved in protein 

import from the cytoplasm to the mitochondria (Schneider et al. 1994; Wadhwa et 

al. 2005; Deocaris et al. 2006). Since several ERRα’s targets localize to mitochondria, 

we  decided  to  focus  on  Mortalin  O‐GlcNAcylation,  instead  of  Akt.  The  mass 

spectrometry  analysis  identified  Mortalin  as  the  Akt  partner  that  was  more  O‐

GlcNAcylated  in  ERRα‐null mice  (figure  4C,  D).  To  validate  this,  we  proceeded  to 

Mortalin  IP,  followed  by  O‐GlcNAc  revelation  by  Western  blot.  Using  the  same 

protocol  as  the  Akt  IP, we  immunoprecipitated Mortalin  from WT  and KO mouse 

livers. As expected, detection of O‐GlcNAcylated proteins revealed a protein with a 

mass  of  75  kDa  that  is  more  O‐GlcNAcylated  in  the  KO  compare  to  the  WT,  in 

Mortalin IP only, not in the control IP (figure 5A). Moreover, by doing an O‐GlcNAc 

IP, followed with a Motalin blot, the same profile is revealed. In fact, we used Wheat 

Germ Agglutinin (WGA) lectin, which allows isolation of glycoproteins modified with 

an O‐linked GlcNAc, to confirm that Mortalin is more O‐GlcNAcylated in absence of 

ERRα. As  for  the  IPs, we pooled an equal amount of proteins  from 4 mouse  livers 

WT and 4 KO. With the WGA lectin, we isolated O‐GlcNAcylated proteins from not O‐

GlcNAcylated and proceeded to detection of Mortalin by Western Blot. In the enrich 

O‐GlcNAc fraction, we can observe more Mortalin in the ERRα‐null mice, compare to 

the  WT  mice  (figure  5B).  On  the  other  hand,  it  is  the  opposite  in  the  not  O‐

GlcNAcylated fraction; Mortalin signal is stronger in the WT mice compare to the KO 

(figure 5B). Thus, these results confirm those obtained with the Akt IP. In absence of 

ERRα, Mortalin is more O‐GlcNAcylated. 

 

  49

                             Figure 5. Mortalin O‐GlcNAcylation validation.  

(A)  Mouse  livers  WT  (4)  and  KO  (4)  total  extracts  were  subjected  to 

immunoprecipitation  with  anti‐Mortalin  antibody  (αMortalin)  followed  by  a 

Western  blot  against  O‐GlcNAc.  Membranes  were  stripped  and  re‐blot  with 

αMortalin.  (B)  Isolation  of  O‐GlcNAcylated  and  not  O‐GlcNAcylated  proteins  from 

mouse  livers  WT  (4)  and  KO  (4)  total  extracts  with  WGA  lectins  followed  by  a 

Western blot against O‐GlcNAc. 

 

 

Mortalin is an ERRα target 

 

At  this  point,  we  have  established  that  the  O‐GlcNAc  PTM  occurs  more  often  in 

absence  of  the  NR  ERRα  and  this  was  demonstrated  more  specifically  with  the 

mitochondrial protein, Mortalin. However, we were also interested to see if Mortalin 

could be as well  transcriptionaly regulated by ERRα. As we did  for HBP genes, we 

looked  if ERRα  binds  to  the Hspa9  promoter  in  the ChIP‐on‐chip dataset.  In basal 

mouse  livers,  ERRα  localized  to  Hspa9  promoter,  in  a  region  closed  to  the 

transcription start site (figure 6A). Standard ChIP was used to validate this target. In 

comparaison  to  the  control ChIP,  the enrichment with ERRα  antibody  is  about 39 

fold (figure 6C). As for the HBP gene, the role of ERRα in transcription regulation of 

Mortalin was  assessed  by  RNA  quantification  in WT  and  ERRα‐null mouse  livers. 

  50

Compare to WT, expression of Mortalin is downregulated by about 20% in absence 

of  ERRα  (figure  6B).  Therefore, Mortalin  can  be  considered  an  ERRα  target.  This 

suggests that ERRα is involved in Mortalin regulation in two different ways, first at 

transcriptional  level,  by  binding  to  its  promoter  to  enhance  its  transcription,  and 

second at PTM, by regulating its O‐GlcNAcylation through the HBP. 

 

                         Figure 6. ERRα is involved in Mortalin transcription regulation.  

(A) Enrichment ratio profiles for ERRα at Hspa9 promoter.  

(B)  Reverse  Transcription  followed  by  qPCR  performed  on  RNA  isolated  from 

mouse  livers  (n  =  8  WT  and  8  KO).  Mortalin  relative  expression  levels  between 

ERRα null mice and wild‐type was normalized to acidic ribosomal phosphoprotein 

(Arbp) levels and bar represents mean (±SEM). **, P < 0.01; Student’s test. 

(C) Standard ChIP validation of ERRα bound segments to Hspa9 promoter. 

 

  51

DISCUSSION 

 

The  orphan  NR  ERRα  is  highly  important  in  bioenergy  regulation.  In  fact,  it  is 

involved  in  transcription  regulation  of  numerous  genes  related  to  glycolysis,  TCA 

cycle, FAO and OXPHOS (Giguere 2008; Charest‐Marcotte et al. 2010). As we were 

expecting, ERRα ChIP‐on chip revealed that it is also involved in HBP transcription 

regulation, another important pathway in bioenergy regulation. Localization of this 

NR closed to Uap1, Ogt, Mgea5 and Glyat transcription start site suggests a role for 

ERRα  in the control of HBP transcription. This was confirmed by luciferase assays, 

which  demonstrated  that  ERRα,  in  collobaration  with  its  coactivator  PGC‐1α, 

activates  their  transcription.  Therefore,  it  shows  that  ERRα  binding  to  HBP 

promoters  allows  upregulation  of  their  transcription.  Moreover,  in  its  absence, 

Glyat, Uap1, Ogt  and Mgea5  expressions  are  downregulated  between  20  to  45%. 

Hence, ERRα  acts as a  transcriptional enhancer of HBP, but  is not essential  for  its 

expression. The HBP uses 2 to 5% of all glucose uptakes to produce UDP‐GlcNAc, the 

essential  substrate  for  Ogt  to  proceed  to  the  PTM  O‐GlcNAc.  There  are  strong 

evidences  that  the  HBP  is  an  important  pathway  for  nutrient  and  energy  sensing 

(Wells et al. 2003; Love and Hanover 2005; Hanover et al. 2010). Hence,  the UDP‐

GlcNAc  abundancy  contributes  to  cell  signaling  in  different  processes,  such  as 

metabolism.  So  in  addition  to  the  long  list  of  genes  involved  in  metabolism  and 

bioenergy regulation targeted by ERRα, we can add HBP’s genes.  

 

As mentioned above, the HBP gene expression decreases from 20 to 45% in absence 

of  ERRα.  However,  it  should  be  noted  that  this  downregulation was measured  in 

ERRα‐null mice, which probably compensate the lack of ERRα, by an upregulation of 

another TF.  In  fact,  the ERRα‐null mice are viable, which demonstrate  that even  if 

ERRα  is  involved  in  transcription  regulation  of  important  gene  for  bioenergy 

regulation, it is not essential (Luo et al. 2003). It has been suggested that its isoform 

ERRγ could compensate, since it shares several target genes with ERRα (Alaynick et 

al. 2007; Dufour et al. 2007). However, there is a significant downregulation of HBP 

  52

genes expression in the absence of ERRα. Even if it is not drastic, considering that it 

is at basal level and that this downregulation is on a long period of time, at the end, 

it can have important consequences at physiological level. 

 

In  previous  studies,  the  role  of  ERRα  became  more  obvious  under  different 

stimulations  or  stresses.  In  fact,  at  basal  level,  it  is  possible  to  observe  a  small 

decrease  in  activity  of  its  targets,  but  when  there  is  an  important  environmental 

change, the absence of ERRα  is drastic. For example, the ERRα‐null mice present a 

failure  in  cardiac  adaptation  to  chronic  pressure  overload  and  decrease  in  ATP 

synthesis,  and  they  are  not  able  to  adapt  to  cold  exposure  due  to  a  reduction  in 

mitochondrial  biogenesis  and  oxidative  capacity  (Huss  et  al.  2007;  Villena  et  al. 

2007). It would be interesting to stress the ERRα‐null mice regarding the HBP and 

assess how they respond. Induction of the HBP has been done in cells, by glucose or 

glucosamine treatment, but it  is hard to transpose this to mice (Dentin et al. 2008; 

Kang  et  al.  2008).  However,  McClain  et  al.  have  generated  transgenic  mice  that 

overexpressed the enzyme Gfat, which increases the HBP flux (Hebert et al. 1996). 

Those mice become resistant to  insulin signaling. One possibility could be to cross 

the ERRα‐null mice with the mice overexpressing Gfat, to evaluate the role of ERRα 

in  the  HBP  activity.  Since  ERRα  targets  Uap1,  Glyat,  Ogt  and  Mgea5  genes,  all 

downstream to Gfat, it would be interesting to see if the HBP flux is stopped due to a 

low  level  in  their  expressions.  Another  possibility  is  to  try  a  high  glucose  or 

glucosamine diet with the ERRα‐null mice and assess if the HBP is more affected in 

the presence or the absence of ERRα. 

 

As a regulator of Ogt and Oga, the two enzymes directly involve in O‐GlcNAc cycling, 

we could expect to see a difference in proteins O‐GlcNAcylation in ERRα‐null mice. 

Interestingly,  even  if  the  absence  of  ERRα  results  in  a  decrease  in  HBP  gene 

expression,  there  are  more  O‐GlcNAcylated  proteins.  This  suggests  that  other 

players may be involved in O‐GlcNAc cycling. In fact, Ogt enzyme does not act alone 

to regulate the addition of O‐GlcNAc on thousands of proteins. It is well known that 

  53

Ogt  specificity  and  activity  occurs  through  its  partners.  In  fact,  Ogt  has  9  to  12 

tetratricopeptide repeat (TPR) in its N‐terminal domain and they are essential for its 

activity,  because  they  allow  interactions with  other  proteins  (Lubas  and  Hanover 

2000;  Iyer  and  Hart  2003).  Several  proteins  interact  with  Ogt  through  its  TPRs 

domain,  and  some  recent  publications  listed  Ogt‐interacting  proteins  and 

demonstrated their importance in Ogt activity (Yang et al. 2002; Cheung et al. 2008; 

Chikanishi et al. 2010). Interestingly, a few of the Ogt‐interacting proteins are ERRα 

targets,  such  as  Basigin,  Pard6  and  Sin3a  (Charest‐Marcotte  et  al.  2010).  It  is  a 

possibility  that one of  the Ogt‐interacting proteins  is drastically downregulated  in 

ERRα‐null mice,  resulting  in a decrease  in Ogt activity. This could explain why we 

observe  more  O‐GlcNAcylated  proteins  in  absence  of  ERRα,  even  if  the  HBP 

expression  decreases.  Briefly,  it  should  be  noted  that  the  regulation  of  O‐GlcNAc 

cycling is more complicated than only expression of Ogt or Oga. Their activities are 

dependent  on  the  presence  of  other  proteins.  We  identified  here  the  orphan  NR 

ERRα as a regulator of Ogt and Oga expression, but it seems to also regulate other 

proteins involved in O‐GlcNAc cycling. 

 

The  increase  in  O‐GlcNAcylated  proteins  can  be  observed  when  we  look  to  an 

overview of  proteins  in  ERRα‐null mice,  but  also  on  specific  proteins.  In  fact,  Akt 

immunoprecipitation revealed that it is more O‐GlcNAcylated in the ERRα‐null mice 

compare to the WT. However, this phenotype was really more obvious with one Akt‐

interacting protein, Mortalin.  It was already established  that Mortalin and Akt  can 

interact  together,  but  the  significance  of  this  interaction  is  poorly  documented 

(Vandermoere  et  al.  2007).  Moreover,  Mortalin  was  also  reported  to  be  O‐

GlcNAcylated,  but  the  effect  of  this  PTM  was  not  studied  further  (Walgren  et  al. 

2003).  Mortalin  is  a  major  chaperone  involved  in  import  of  proteins  from  the 

cytoplasm to the mitochondria (Schneider et al. 1994; Wadhwa et al. 2005; Deocaris 

et al. 2006). Interestingly, numerous ERRα target genes are encoded by the nuclear 

genome,  but  act  into  the mitochondria,  such  as  OXPHOS  and  TCA  cycle  enzymes. 

Further studies need to be done, but downregulation of metabolic gene due to lack 

  54

of  ERRα  could  be  compensated  by  a  change  in Mortalin  activity.  Even  if we don’t 

know yet about what happens  to Mortalin when O‐GlcNAcylated, we can raise  the 

hypothesis that as an important regulator of metabolic gene acting in mitochondria, 

ERRα also modulates, through PTM, the activity of Mortalin, the protein in charge of 

the import of its targets into the mitochondria. 

 

In  addition  to  O‐GlcNAcylation,  Mortalin  can  also  be  phosphorylated.  Mortalin 

phosphorylation has been characterized in a  few studies, but on tyrosine residues, 

which  cannot be modified by O‐GlcNAc  (Mizukoshi  et  al.  2001). Recently,  a  group 

reported that Mortalin can also be phosphorylated on Thr 62 and Ser 65, and those 

phosphorylations  are  important  for  Mortalin  localization  to  the  centrosome  and 

induction  of  its  duplication  (Kanai  et  al.  2007).  Since  there  is  often  a  competition 

between  phosphorylation  and  O‐GlcNAcylation,  it  would  be  of  high  interest  to 

eveluate  if  this  site  can be modified by O‐GlcNAc  and assess  the  consequences on 

Mortalin  activity  (Hart  et  al.  2007;  Wang  et  al.  2008).  Since  ERRα  regulates 

transcription of  important metabolic genes  that are  required  for  cell proliferation, 

Mortalin O‐GlcNAcylation could be a way to signal the energetic status of the cells, 

thus  limiting the proliferation. As mentioned previously,  the HBP is an energy and 

nutrient  sensor.  So,  the  absence  of  ERRα  could  be  signal  through  Mortalin  O‐

GlcNAcylation, to modulate cell proliferation or mitochondria activity. 

 

In  addition  to  HBP,  ERRα  targets  the  Hspa9  promoter,  the  gene  encoding  for 

Mortalin.  Moreover,  in  absence  of  ERRα,  Mortalin  mRNA  expression  decreased, 

suggesting  a  role  for  ERRα  in  Motalin  transcriptional  regulation.  In  fact,  ERRα 

targets  Hspa9  expression  and  regulates  O‐GlcNAcylation,  suggesting  a  biphasic 

regulation of Mortalin by ERRα. As an HBP regulator, ERRα can control PTM of  its 

targets through O‐GlcNAcylation. This can be observed with an increase in Mortalin 

O‐GlcNAcylation  in  absence  of  ERRα.  Moreover,  Mortalin  is  not  the  only  ERRα 

targets to be O‐GlcNAcylated. For example, nucleoporin 153, lactate dehydrogenase 

B  and  atrophin‐1,  all  ERRα  targets,  are  also  O‐GlcNAcylated  proteins  (Teo  et  al. 

  55

2010a).  Therefore,  the  role  of  ERRα  seems  to  not  be  limited  to  transcription 

regulation, but also  to  induction of O‐GlcNAc PTM,  through  regulation of  the HBP. 

More studies need to be done to evaluate if it is the case for other ERRα targets, but 

we demonstrate here that one of ERRα’s target, Mortalin, is more O‐GlcNAcylated in 

its absence. Since O‐GlcNAcylation affects the activity of the modified proteins, ERRα 

could  enhance  transcription  of  its  targets,  as well  as  HBP  genes,  to modulate  the 

activity of its targets through PTM. 

 

Taken together, the results confirm ERRα as a major regulator of bioenergy genes. 

This orphan NR modulates the HBP expression and activity. Furthermore, it targets 

Mortalin, a mitochondrial chaperone involved in protein import, and is implicated in 

its O‐GlcNAcylation. 

 

  56

CONCLUSION 

 

In  this  study,  we  have  demonstrated  that  the  energy  sensing  pathway  HBP  is  an 

ERRα’s target. In fact, ERRα regulates expression of several enzymes involved in this 

pathway, which shows the importance of ERRα in bioenergy regulation. In addition 

to  the  HBP,  ERRα also  regulates  the  expression  of  the  mitochondrial  chaperone 

Mortalin, through binding to  its promoter. Moreover,  in absence of ERRα, proteins 

are  less O‐GlcNAcylated, which was particularly observed on Mortalin. This shows 

that ERRα  can regulates Mortalin status  in synergy, by enhancing  its  transcription 

through binding to its promoter and by regulation its O‐GlcNAcylation, by regulation 

of expression of the HBP.  

 

 

 

 

 

 

 

     

  57

REFERENCE  

Alaynick, W.A. 2008. Nuclear receptors, mitochondria and lipid metabolism. Mitochondrion 8(4): 329‐337. 

Alaynick, W.A., Kondo, R.P., Xie, W., He, W., Dufour, C.R., Downes, M., Jonker, J.W., Giles, W., Naviaux, R.K., Giguere, V. et al. 2007. ERRgamma directs and maintains the transition to oxidative metabolism in the postnatal heart. Cell Metab 6(1): 13‐24. 

Anthonisen, E.H., Berven, L., Holm, S., Nygard, M., Nebb, H.I., and Gronning‐Wang, L.M. 2010. Nuclear receptor liver X receptor is O‐GlcNAc‐modified in response to glucose. J Biol Chem 285(3): 1607‐1615. 

Ariazi, E.A., Clark, G.M., and Mertz, J.E. 2002. Estrogen‐related receptor alpha and estrogen‐related receptor gamma associate with unfavorable and favorable biomarkers, respectively, in human breast cancer. Cancer Res 62(22): 6510‐6518. 

Augereau, P., Badia, E., Carascossa, S., Castet, A., Fritsch, S., Harmand, P.O., Jalaguier, S., and Cavailles, V. 2006. The nuclear receptor transcriptional coregulator RIP140. Nucl Recept Signal 4: e024. 

Barish, G.D., Downes, M., Alaynick, W.A., Yu, R.T., Ocampo, C.B., Bookout, A.L., Mangelsdorf, D.J., and Evans, R.M. 2005. A Nuclear Receptor Atlas: macrophage activation. Mol Endocrinol 19(10): 2466‐2477. 

Barry, J.B. and Giguere, V. 2005. Epidermal growth factor‐induced signaling in breast cancer cells results in selective target gene activation by orphan nuclear receptor estrogen‐related receptor alpha. Cancer Res 65(14): 6120‐6129. 

Bhattacharyya, T., Karnezis, A.N., Murphy, S.P., Hoang, T., Freeman, B.C., Phillips, B., and Morimoto, R.I. 1995. Cloning and subcellular localization of human mitochondrial hsp70. J Biol Chem 270(4): 1705‐1710. 

Blatch, G.L. and Lassle, M. 1999. The tetratricopeptide repeat: a structural motif mediating protein‐protein interactions. Bioessays 21(11): 932‐939. 

Busch, B.B., Stevens, W.C., Jr., Martin, R., Ordentlich, P., Zhou, S., Sapp, D.W., Horlick, R.A., and Mohan, R. 2004. Identification of a selective inverse agonist for the orphan nuclear receptor estrogen‐related receptor alpha. J Med Chem 47(23): 5593‐5596. 

Butkinaree, C., Park, K., and Hart, G.W. O‐linked beta‐N‐acetylglucosamine (O‐GlcNAc): Extensive crosstalk with phosphorylation to regulate signaling and transcription in response to nutrients and stress. Biochim Biophys Acta 1800(2): 96‐106. 

Caldwell, S.A., Jackson, S.R., Shahriari, K.S., Lynch, T.P., Sethi, G., Walker, S., Vosseller, K., and Reginato, M.J. 2010. Nutrient sensor O‐GlcNAc transferase regulates breast cancer tumorigenesis through targeting of the oncogenic transcription factor FoxM1. Oncogene. 

Castet, A., Herledan, A., Bonnet, S., Jalaguier, S., Vanacker, J.M., and Cavailles, V. 2006. Receptor‐interacting protein 140 differentially regulates estrogen receptor‐related receptor transactivation depending on target genes. Mol Endocrinol 20(5): 1035‐1047. 

  58

Charest‐Marcotte, A., Dufour, C.R., Wilson, B.J., Tremblay, A.M., Eichner, L.J., Arlow, D.H., Mootha, V.K., and Giguere, V. 2010. The homeobox protein Prox1 is a negative modulator of ERR{alpha}/PGC‐1{alpha} bioenergetic functions. Genes Dev 24(6): 537‐542. 

Chen, J.D. and Evans, R.M. 1995. A transcriptional co‐repressor that interacts with nuclear hormone receptors. Nature 377(6548): 454‐457. 

Chen, S., Zhou, D., Yang, C., and Sherman, M. 2001. Molecular basis for the constitutive activity of estrogen‐related receptor alpha‐1. J Biol Chem 276(30): 28465‐28470. 

Cheung, W.D., Sakabe, K., Housley, M.P., Dias, W.B., and Hart, G.W. 2008. O‐linked beta‐N‐acetylglucosaminyltransferase substrate specificity is regulated by myosin phosphatase targeting and other interacting proteins. J Biol Chem 283(49): 33935‐33941. 

Chikanishi, T., Fujiki, R., Hashiba, W., Sekine, H., Yokoyama, A., and Kato, S. 2010. Glucose‐induced expression of MIP‐1 genes requires O‐GlcNAc transferase in monocytes. Biochem Biophys Res Commun 394(4): 865‐870. 

Chou, T.Y., Dang, C.V., and Hart, G.W. 1995a. Glycosylation of the c‐Myc transactivation domain. Proc Natl Acad Sci U S A 92(10): 4417‐4421. 

Chou, T.Y., Hart, G.W., and Dang, C.V. 1995b. c‐Myc is glycosylated at threonine 58, a known phosphorylation site and a mutational hot spot in lymphomas. J Biol Chem 270(32): 18961‐18965. 

Comer, F.I. and Hart, G.W. 2001. Reciprocity between O‐GlcNAc and O‐phosphate on the carboxyl terminal domain of RNA polymerase II. Biochemistry 40(26): 7845‐7852. 

Craig, E.A., Kramer, J., and Kosic‐Smithers, J. 1987. SSC1, a member of the 70‐kDa heat shock protein multigene family of Saccharomyces cerevisiae, is essential for growth. Proc Natl Acad Sci U S A 84(12): 4156‐4160. 

Crook, E.D., Daniels, M.C., Smith, T.M., and McClain, D.A. 1993. Regulation of insulin‐stimulated glycogen synthase activity by overexpression of glutamine: fructose‐6‐phosphate amidotransferase in rat‐1 fibroblasts. Diabetes 42(9): 1289‐1296. 

De Mena, L., Coto, E., Sanchez‐Ferrero, E., Ribacoba, R., Guisasola, L.M., Salvador, C., Blazquez, M., and Alvarez, V. 2009. Mutational screening of the mortalin gene (HSPA9) in Parkinson's disease. J Neural Transm 116(10): 1289‐1293. 

Deblois, G. and Giguere, V. 2008. Nuclear receptor location analyses in mammalian genomes: from gene regulation to regulatory networks. Mol Endocrinol 22(9): 1999‐2011. 

Deblois, G., Hall, J.A., Perry, M.C., Laganiere, J., Ghahremani, M., Park, M., Hallett, M., and Giguere, V. 2009. Genome‐wide identification of direct target genes implicates estrogen‐related receptor alpha as a determinant of breast cancer heterogeneity. Cancer Res 69(15): 6149‐6157. 

Delvecchio, C.J. and Capone, J.P. 2008. Protein kinase C alpha modulates liver X receptor alpha transactivation. J Endocrinol 197(1): 121‐130. 

Dentin, R., Hedrick, S., Xie, J., Yates, J., 3rd, and Montminy, M. 2008. Hepatic glucose sensing via the CREB coactivator CRTC2. Science 319(5868): 1402‐1405. 

  59

Deocaris, C.C., Kaul, S.C., and Wadhwa, R. 2006. On the brotherhood of the mitochondrial chaperones mortalin and heat shock protein 60. Cell Stress Chaperones 11(2): 116‐128. 

‐. 2008a. From proliferative to neurological role of an hsp70 stress chaperone, mortalin. Biogerontology 9(6): 391‐403. 

Deocaris, C.C., Takano, S., Priyandoko, D., Kaul, Z., Yaguchi, T., Kraft, D.C., Yamasaki, K., Kaul, S.C., and Wadhwa, R. 2008b. Glycerol stimulates innate chaperoning, proteasomal and stress‐resistance functions: implications for geronto‐manipulation. Biogerontology 9(4): 269‐282. 

Deroo, B.J. and Korach, K.S. 2006. Estrogen receptors and human disease. J Clin Invest 116(3): 561‐570. 

Dias, W.B., Cheung, W.D., Wang, Z., and Hart, G.W. 2009. Regulation of calcium/calmodulin‐dependent kinase IV by O‐GlcNAc modification. J Biol Chem 284(32): 21327‐21337. 

Dias, W.B. and Hart, G.W. 2007. O‐GlcNAc modification in diabetes and Alzheimer's disease. Mol Biosyst 3(11): 766‐772. 

Domanico, S.Z., DeNagel, D.C., Dahlseid, J.N., Green, J.M., and Pierce, S.K. 1993. Cloning of the gene encoding peptide‐binding protein 74 shows that it is a new member of the heat shock protein 70 family. Mol Cell Biol 13(6): 3598‐3610. 

Dufour, C.R., Wilson, B.J., Huss, J.M., Kelly, D.P., Alaynick, W.A., Downes, M., Evans, R.M., Blanchette, M., and Giguere, V. 2007. Genome‐wide orchestration of cardiac functions by the orphan nuclear receptors ERRalpha and gamma. Cell Metab 5(5): 345‐356. 

Dundas, S.R., Lawrie, L.C., Rooney, P.H., and Murray, G.I. 2005. Mortalin is over‐expressed by colorectal adenocarcinomas and correlates with poor survival. J Pathol 205(1): 74‐81. 

Eudy, J.D., Yao, S., Weston, M.D., Ma‐Edmonds, M., Talmadge, C.B., Cheng, J.J., Kimberling, W.J., and Sumegi, J. 1998. Isolation of a gene encoding a novel member of the nuclear receptor superfamily from the critical region of Usher syndrome type IIa at 1q41. Genomics 50(3): 382‐384. 

Evans, R.M. 1988. The steroid and thyroid hormone receptor superfamily. Science 240(4854): 889‐895. 

Evans, R.M., Barish, G.D., and Wang, Y.X. 2004. PPARs and the complex journey to obesity. Nat Med 10(4): 355‐361. 

Gaillard, S., Grasfeder, L.L., Haeffele, C.L., Lobenhofer, E.K., Chu, T.M., Wolfinger, R., Kazmin, D., Koves, T.R., Muoio, D.M., Chang, C.Y. et al. 2006. Receptor‐selective coactivators as tools to define the biology of specific receptor‐coactivator pairs. Mol Cell 24(5): 797‐803. 

Giguere, V. 1999. Orphan nuclear receptors: from gene to function. Endocr Rev 20(5): 689‐725. 

‐. 2008. Transcriptional control of energy homeostasis by the estrogen‐related receptors. Endocr Rev 29(6): 677‐696. 

Giguere, V., Yang, N., Segui, P., and Evans, R.M. 1988. Identification of a new class of steroid hormone receptors. Nature 331(6151): 91‐94. 

  60

Gofflot, F., Chartoire, N., Vasseur, L., Heikkinen, S., Dembele, D., Le Merrer, J., and Auwerx, J. 2007. Systematic gene expression mapping clusters nuclear receptors according to their function in the brain. Cell 131(2): 405‐418. 

Goldberg, H.J., Whiteside, C.I., Hart, G.W., and Fantus, I.G. 2006. Posttranslational, reversible O‐glycosylation is stimulated by high glucose and mediates plasminogen activator inhibitor‐1 gene expression and Sp1 transcriptional activity in glomerular mesangial cells. Endocrinology 147(1): 222‐231. 

Greschik, H., Wurtz, J.M., Sanglier, S., Bourguet, W., van Dorsselaer, A., Moras, D., and Renaud, J.P. 2002. Structural and functional evidence for ligand‐independent transcriptional activation by the estrogen‐related receptor 3. Mol Cell 9(2): 303‐313. 

Haltiwanger, R.S., Blomberg, M.A., and Hart, G.W. 1992. Glycosylation of nuclear and cytoplasmic proteins. Purification and characterization of a uridine diphospho‐N‐acetylglucosamine:polypeptide beta‐N‐acetylglucosaminyltransferase. J Biol Chem 267(13): 9005‐9013. 

Han, I. and Kudlow, J.E. 1997. Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility. Mol Cell Biol 17(5): 2550‐2558. 

Hanover, J.A., Krause, M.W., and Love, D.C. 2010. The hexosamine signaling pathway: O‐GlcNAc cycling in feast or famine. Biochim Biophys Acta 1800(2): 80‐95. 

Hanover, J.A., Yu, S., Lubas, W.B., Shin, S.H., Ragano‐Caracciola, M., Kochran, J., and Love, D.C. 2003. Mitochondrial and nucleocytoplasmic isoforms of O‐linked GlcNAc transferase encoded by a single mammalian gene. Arch Biochem Biophys 409(2): 287‐297. 

Hart, G.W., Haltiwanger, R.S., Holt, G.D., and Kelly, W.G. 1989. Glycosylation in the nucleus and cytoplasm. Annu Rev Biochem 58: 841‐874. 

Hart, G.W., Housley, M.P., and Slawson, C. 2007. Cycling of O‐linked beta‐N‐acetylglucosamine on nucleocytoplasmic proteins. Nature 446(7139): 1017‐1022. 

Heard, D.J., Norby, P.L., Holloway, J., and Vissing, H. 2000. Human ERRgamma, a third member of the estrogen receptor‐related receptor (ERR) subfamily of orphan nuclear receptors: tissue‐specific isoforms are expressed during development and in the adult. Mol Endocrinol 14(3): 382‐392. 

Hebert, L.F., Jr., Daniels, M.C., Zhou, J., Crook, E.D., Turner, R.L., Simmons, S.T., Neidigh, J.L., Zhu, J.S., Baron, A.D., and McClain, D.A. 1996. Overexpression of glutamine:fructose‐6‐phosphate amidotransferase in transgenic mice leads to insulin resistance. J Clin Invest 98(4): 930‐936. 

Heck, S., Rom, J., Thewes, V., Becker, N., Blume, B., Sinn, H.P., Deuschle, U., Sohn, C., Schneeweiss, A., and Lichter, P. 2009. Estrogen‐related receptor alpha expression and function is associated with the transcriptional coregulator AIB1 in breast carcinoma. Cancer Res 69(12): 5186‐5193. 

Holt, G.D. and Hart, G.W. 1986. The subcellular distribution of terminal N‐acetylglucosamine moieties. Localization of a novel protein‐saccharide linkage, O‐linked GlcNAc. J Biol Chem 261(17): 8049‐8057. 

Holt, G.D., Snow, C.M., Senior, A., Haltiwanger, R.S., Gerace, L., and Hart, G.W. 1987. Nuclear pore complex glycoproteins contain cytoplasmically disposed O‐linked N‐acetylglucosamine. J Cell Biol 104(5): 1157‐1164. 

  61

Hong, H., Yang, L., and Stallcup, M.R. 1999. Hormone‐independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. J Biol Chem 274(32): 22618‐22626. 

Horlein, A.J., Naar, A.M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., Glass, C.K. et al. 1995. Ligand‐independent repression by the thyroid hormone receptor mediated by a nuclear receptor co‐repressor. Nature 377(6548): 397‐404. 

Housley, M.P., Udeshi, N.D., Rodgers, J.T., Shabanowitz, J., Puigserver, P., Hunt, D.F., and Hart, G.W. 2009. A PGC‐1alpha‐O‐GlcNAc transferase complex regulates FoxO transcription factor activity in response to glucose. J Biol Chem 284(8): 5148‐5157. 

Huss, J.M., Imahashi, K., Dufour, C.R., Weinheimer, C.J., Courtois, M., Kovacs, A., Giguere, V., Murphy, E., and Kelly, D.P. 2007. The nuclear receptor ERRalpha is required for the bioenergetic and functional adaptation to cardiac pressure overload. Cell Metab 6(1): 25‐37. 

Huss, J.M., Kopp, R.P., and Kelly, D.P. 2002. Peroxisome proliferator‐activated receptor coactivator‐1alpha (PGC‐1alpha) coactivates the cardiac‐enriched nuclear receptors estrogen‐related receptor‐alpha and ‐gamma. Identification of novel leucine‐rich interaction motif within PGC‐1alpha. J Biol Chem 277(43): 40265‐40274. 

Huss, J.M., Torra, I.P., Staels, B., Giguere, V., and Kelly, D.P. 2004. Estrogen‐related receptor alpha directs peroxisome proliferator‐activated receptor alpha signaling in the transcriptional control of energy metabolism in cardiac and skeletal muscle. Mol Cell Biol 24(20): 9079‐9091. 

Iosefson, O. and Azem, A. 2010. Reconstitution of the mitochondrial Hsp70 (mortalin)‐p53 interaction using purified proteins‐‐identification of additional interacting regions. FEBS Lett 584(6): 1080‐1084. 

Iyer, S.P., Akimoto, Y., and Hart, G.W. 2003. Identification and cloning of a novel family of coiled‐coil domain proteins that interact with O‐GlcNAc transferase. J Biol Chem 278(7): 5399‐5409. 

Iyer, S.P. and Hart, G.W. 2003. Roles of the tetratricopeptide repeat domain in O‐GlcNAc transferase targeting and protein substrate specificity. J Biol Chem 278(27): 24608‐24616. 

James, L.R., Tang, D., Ingram, A., Ly, H., Thai, K., Cai, L., and Scholey, J.W. 2002. Flux through the hexosamine pathway is a determinant of nuclear factor kappaB‐ dependent promoter activation. Diabetes 51(4): 1146‐1156. 

Jin, J., Hulette, C., Wang, Y., Zhang, T., Pan, C., Wadhwa, R., and Zhang, J. 2006. Proteomic identification of a stress protein, mortalin/mthsp70/GRP75: relevance to Parkinson disease. Mol Cell Proteomics 5(7): 1193‐1204. 

Jin, J., Li, G.J., Davis, J., Zhu, D., Wang, Y., Pan, C., and Zhang, J. 2007. Identification of novel proteins associated with both alpha‐synuclein and DJ‐1. Mol Cell Proteomics 6(5): 845‐859. 

Kallen, J., Lattmann, R., Beerli, R., Blechschmidt, A., Blommers, M.J., Geiser, M., Ottl, J., Schlaeppi, J.M., Strauss, A., and Fournier, B. 2007. Crystal structure of human estrogen‐related receptor alpha in complex with a synthetic inverse agonist reveals its novel molecular mechanism. J Biol Chem 282(32): 23231‐23239. 

  62

Kallen, J., Schlaeppi, J.M., Bitsch, F., Filipuzzi, I., Schilb, A., Riou, V., Graham, A., Strauss, A., Geiser, M., and Fournier, B. 2004. Evidence for ligand‐independent transcriptional activation of the human estrogen‐related receptor alpha (ERRalpha): crystal structure of ERRalpha ligand binding domain in complex with peroxisome proliferator‐activated receptor coactivator‐1alpha. J Biol Chem 279(47): 49330‐49337. 

Kamei, Y., Ohizumi, H., Fujitani, Y., Nemoto, T., Tanaka, T., Takahashi, N., Kawada, T., Miyoshi, M., Ezaki, O., and Kakizuka, A. 2003. PPARgamma coactivator 1beta/ERR ligand 1 is an ERR protein ligand, whose expression induces a high‐energy expenditure and antagonizes obesity. Proc Natl Acad Sci U S A 100(21): 12378‐12383. 

Kanai, M., Ma, Z., Izumi, H., Kim, S.H., Mattison, C.P., Winey, M., and Fukasawa, K. 2007. Physical and functional interaction between mortalin and Mps1 kinase. Genes Cells 12(6): 797‐810. 

Kang, E.S., Han, D., Park, J., Kwak, T.K., Oh, M.A., Lee, S.A., Choi, S., Park, Z.Y., Kim, Y., and Lee, J.W. 2008. O‐GlcNAc modulation at Akt1 Ser473 correlates with apoptosis of murine pancreatic beta cells. Exp Cell Res 314(11‐12): 2238‐2248. 

Kaul, S.C., Deocaris, C.C., and Wadhwa, R. 2007. Three faces of mortalin: a housekeeper, guardian and killer. Exp Gerontol 42(4): 263‐274. 

Kim, H.S., Kim, E.M., Lee, J., Yang, W.H., Park, T.Y., Kim, Y.M., and Cho, J.W. 2006. Heat shock protein 60 modified with O‐linked N‐acetylglucosamine is involved in pancreatic beta‐cell death under hyperglycemic conditions. FEBS Lett 580(9): 2311‐2316. 

Knutti, D., Kaul, A., and Kralli, A. 2000. A tissue‐specific coactivator of steroid receptors, identified in a functional genetic screen. Mol Cell Biol 20(7): 2411‐2422. 

Kreppel, L.K., Blomberg, M.A., and Hart, G.W. 1997. Dynamic glycosylation of nuclear and cytosolic proteins. Cloning and characterization of a unique O‐GlcNAc transferase with multiple tetratricopeptide repeats. J Biol Chem 272(14): 9308‐9315. 

Kressler, D., Schreiber, S.N., Knutti, D., and Kralli, A. 2002. The PGC‐1‐related protein PERC is a selective coactivator of estrogen receptor alpha. J Biol Chem 277(16): 13918‐13925. 

Laganiere, J., Tremblay, G.B., Dufour, C.R., Giroux, S., Rousseau, F., and Giguere, V. 2004. A polymorphic autoregulatory hormone response element in the human estrogen‐related receptor alpha (ERRalpha) promoter dictates peroxisome proliferator‐activated receptor gamma coactivator‐1alpha control of ERRalpha expression. J Biol Chem 279(18): 18504‐18510. 

Li, X., Lu, F., Wang, J.Z., and Gong, C.X. 2006. Concurrent alterations of O‐GlcNAcylation and phosphorylation of tau in mouse brains during fasting. Eur J Neurosci 23(8): 2078‐2086. 

Li, X., Zhang, S., Blander, G., Tse, J.G., Krieger, M., and Guarente, L. 2007. SIRT1 deacetylates and positively regulates the nuclear receptor LXR. Mol Cell 28(1): 91‐106. 

  63

Lin, J.D. 2009. Minireview: the PGC‐1 coactivator networks: chromatin‐remodeling and mitochondrial energy metabolism. Mol Endocrinol 23(1): 2‐10. 

Liu, F., Shi, J., Tanimukai, H., Gu, J., Grundke‐Iqbal, I., Iqbal, K., and Gong, C.X. 2009. Reduced O‐GlcNAcylation links lower brain glucose metabolism and tau pathology in Alzheimer's disease. Brain 132(Pt 7): 1820‐1832. 

Love, D.C. and Hanover, J.A. 2005. The hexosamine signaling pathway: deciphering the "O‐GlcNAc code". Sci STKE 2005(312): re13. 

Love, D.C., Krause, M.W., and Hanover, J.A. 2010. O‐GlcNAc cycling: Emerging Roles in Development and Epigenetics. Semin Cell Dev Biol. 

Lubas, W.A., Frank, D.W., Krause, M., and Hanover, J.A. 1997. O‐Linked GlcNAc transferase is a conserved nucleocytoplasmic protein containing tetratricopeptide repeats. J Biol Chem 272(14): 9316‐9324. 

Lubas, W.A. and Hanover, J.A. 2000. Functional expression of O‐linked GlcNAc transferase. Domain structure and substrate specificity. J Biol Chem 275(15): 10983‐10988. 

Luo, J., Sladek, R., Carrier, J., Bader, J.A., Richard, D., and Giguere, V. 2003. Reduced fat mass in mice lacking orphan nuclear receptor estrogen‐related receptor alpha. Mol Cell Biol 23(22): 7947‐7956. 

Ma, Z., Izumi, H., Kanai, M., Kabuyama, Y., Ahn, N.G., and Fukasawa, K. 2006. Mortalin controls centrosome duplication via modulating centrosomal localization of p53. Oncogene 25(39): 5377‐5390. 

Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P. et al. 1995. The nuclear receptor superfamily: the second decade. Cell 83(6): 835‐839. 

McClain, D.A. and Crook, E.D. 1996. Hexosamines and insulin resistance. Diabetes 45(8): 1003‐1009. 

Mizukoshi, E., Suzuki, M., Misono, T., Loupatov, A., Munekata, E., Kaul, S.C., Wadhwa, R., and Imamura, T. 2001. Cell‐cycle dependent tyrosine phosphorylation on mortalin regulates its interaction with fibroblast growth factor‐1. Biochem Biophys Res Commun 280(4): 1203‐1209. 

Mootha, V.K., Handschin, C., Arlow, D., Xie, X., St Pierre, J., Sihag, S., Yang, W., Altshuler, D., Puigserver, P., Patterson, N. et al. 2004. Erralpha and Gabpa/b specify PGC‐1alpha‐dependent oxidative phosphorylation gene expression that is altered in diabetic muscle. Proc Natl Acad Sci U S A 101(17): 6570‐6575. 

Nanashima, N., Asano, J., Hayakari, M., Nakamura, T., Nakano, H., Yamada, T., Shimizu, T., Akita, M., Fan, Y., and Tsuchida, S. 2005. Nuclear localization of STAT5A modified with O‐linked N‐acetylglucosamine and early involution in the mammary gland of Hirosaki hairless rat. J Biol Chem 280(52): 43010‐43016. 

O'Donnell, N., Zachara, N.E., Hart, G.W., and Marth, J.D. 2004. Ogt‐dependent X‐chromosome‐linked protein glycosylation is a requisite modification in somatic cell function and embryo viability. Mol Cell Biol 24(4): 1680‐1690. 

Okuyama, R. and Marshall, S. 2004. Potential regulation of nuclear UDP‐N‐acetylglucosaminyl transferase (OGT) by substrate availability: ability of 

  64

chromatin protein to bind UDP‐N‐acetylglucosamine and reduce OGT‐mediated O‐Linked glycosylation. Biol Pharm Bull 27(8): 1293‐1296. 

Onate, S.A., Tsai, S.Y., Tsai, M.J., and O'Malley, B.W. 1995. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270(5240): 1354‐1357. 

Overington, J.P., Al‐Lazikani, B., and Hopkins, A.L. 2006. How many drug targets are there? Nat Rev Drug Discov 5(12): 993‐996. 

Park, K., Saudek, C.D., and Hart, G.W. 2010. Increased Expression of {beta}‐N‐Acetylglucosamindase (O‐GlcNAcase) in Erythrocytes from Individuals with Pre‐diabetes and Diabetes. Diabetes. 

Parker, G.J., Lund, K.C., Taylor, R.P., and McClain, D.A. 2003. Insulin resistance of glycogen synthase mediated by o‐linked N‐acetylglucosamine. J Biol Chem 278(12): 10022‐10027. 

Pilzer, D., Saar, M., Koya, K., and Fishelson, Z. 2010. Mortalin inhibitors sensitize K562 leukemia cells to complement‐dependent cytotoxicity. Int J Cancer 126(6): 1428‐1435. 

Pratt, W.B. and Toft, D.O. 1997. Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocr Rev 18(3): 306‐360. 

Puigserver, P., Adelmant, G., Wu, Z., Fan, M., Xu, J., O'Malley, B., and Spiegelman, B.M. 1999. Activation of PPARgamma coactivator‐1 through transcription factor docking. Science 286(5443): 1368‐1371. 

Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., and Spiegelman, B.M. 1998. A cold‐inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92(6): 829‐839. 

Ran, Q., Wadhwa, R., Kawai, R., Kaul, S.C., Sifers, R.N., Bick, R.J., Smith, J.R., and Pereira‐Smith, O.M. 2000. Extramitochondrial localization of mortalin/mthsp70/PBP74/GRP75. Biochem Biophys Res Commun 275(1): 174‐179. 

Savel'ev, A.S., Novikova, L.A., Kovaleva, I.E., Luzikov, V.N., Neupert, W., and Langer, T. 1998. ATP‐dependent proteolysis in mitochondria. m‐AAA protease and PIM1 protease exert overlapping substrate specificities and cooperate with the mtHsp70 system. J Biol Chem 273(32): 20596‐20602. 

Sayat, R., Leber, B., Grubac, V., Wiltshire, L., and Persad, S. 2008. O‐GlcNAc‐glycosylation of beta‐catenin regulates its nuclear localization and transcriptional activity. Exp Cell Res 314(15): 2774‐2787. 

Schneider, H.C., Berthold, J., Bauer, M.F., Dietmeier, K., Guiard, B., Brunner, M., and Neupert, W. 1994. Mitochondrial Hsp70/MIM44 complex facilitates protein import. Nature 371(6500): 768‐774. 

Schreiber, S.N., Emter, R., Hock, M.B., Knutti, D., Cardenas, J., Podvinec, M., Oakeley, E.J., and Kralli, A. 2004. The estrogen‐related receptor alpha (ERRalpha) functions in PPARgamma coactivator 1alpha (PGC‐1alpha)‐induced mitochondrial biogenesis. Proc Natl Acad Sci U S A 101(17): 6472‐6477. 

Schreiber, S.N., Knutti, D., Brogli, K., Uhlmann, T., and Kralli, A. 2003. The transcriptional coactivator PGC‐1 regulates the expression and activity of the orphan nuclear receptor estrogen‐related receptor alpha (ERRalpha). J Biol Chem 278(11): 9013‐9018. 

  65

Shafi, R., Iyer, S.P., Ellies, L.G., O'Donnell, N., Marek, K.W., Chui, D., Hart, G.W., and Marth, J.D. 2000. The O‐GlcNAc transferase gene resides on the X chromosome and is essential for embryonic stem cell viability and mouse ontogeny. Proc Natl Acad Sci U S A 97(11): 5735‐5739. 

Sladek, R., Bader, J.A., and Giguere, V. 1997. The orphan nuclear receptor estrogen‐related receptor alpha is a transcriptional regulator of the human medium‐chain acyl coenzyme A dehydrogenase gene. Mol Cell Biol 17(9): 5400‐5409. 

Slawson, C., Lakshmanan, T., Knapp, S., and Hart, G.W. 2008. A mitotic GlcNAcylation/phosphorylation signaling complex alters the posttranslational state of the cytoskeletal protein vimentin. Mol Biol Cell 19(10): 4130‐4140. 

Slawson, C., Zachara, N.E., Vosseller, K., Cheung, W.D., Lane, M.D., and Hart, G.W. 2005. Perturbations in O‐linked beta‐N‐acetylglucosamine protein modification cause severe defects in mitotic progression and cytokinesis. J Biol Chem 280(38): 32944‐32956. 

Sonoda, J., Laganiere, J., Mehl, I.R., Barish, G.D., Chong, L.W., Li, X., Scheffler, I.E., Mock, D.C., Bataille, A.R., Robert, F. et al. 2007. Nuclear receptor ERR alpha and coactivator PGC‐1 beta are effectors of IFN‐gamma‐induced host defense. Genes Dev 21(15): 1909‐1920. 

Stein, R.A., Chang, C.Y., Kazmin, D.A., Way, J., Schroeder, T., Wergin, M., Dewhirst, M.W., and McDonnell, D.P. 2008. Estrogen‐related receptor alpha is critical for the growth of estrogen receptor‐negative breast cancer. Cancer Res 68(21): 8805‐8812. 

Suzuki, T., Miki, Y., Moriya, T., Shimada, N., Ishida, T., Hirakawa, H., Ohuchi, N., and Sasano, H. 2004. Estrogen‐related receptor alpha in human breast carcinoma as a potent prognostic factor. Cancer Res 64(13): 4670‐4676. 

Szabadkai, G., Bianchi, K., Varnai, P., De Stefani, D., Wieckowski, M.R., Cavagna, D., Nagy, A.I., Balla, T., and Rizzuto, R. 2006. Chaperone‐mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels. J Cell Biol 175(6): 901‐911. 

Teo, C.F., Ingale, S., Wolfert, M.A., Elsayed, G.A., Not, L.G., Chatham, J.C., Wells, L., and Boons, G.J. 2010a. Glycopeptide‐specific monoclonal antibodies suggest new roles for O‐GlcNAc. Nat Chem Biol 6(5): 338‐343. 

Teo, C.F., Wollaston‐Hayden, E.E., and Wells, L. 2010b. Hexosamine flux, the O‐GlcNAc modification, and the development of insulin resistance in adipocytes. Mol Cell Endocrinol 318(1‐2): 44‐53. 

Torres, C.R. and Hart, G.W. 1984. Topography and polypeptide distribution of terminal N‐acetylglucosamine residues on the surfaces of intact lymphocytes. Evidence for O‐linked GlcNAc. J Biol Chem 259(5): 3308‐3317. 

Tremblay, A., Tremblay, G.B., Labrie, F., and Giguere, V. 1999. Ligand‐independent recruitment of SRC‐1 to estrogen receptor beta through phosphorylation of activation function AF‐1. Mol Cell 3(4): 513‐519. 

Tremblay, A.M., Dufour, C.R., Ghahremani, M., Reudelhuber, T.L., and Giguere, V. 2010. Physiological genomics identifies estrogen‐related receptor alpha as a regulator of renal sodium and potassium homeostasis and the renin‐angiotensin pathway. Mol Endocrinol 24(1): 22‐32. 

  66

Tremblay, A.M. and Giguere, V. 2007. The NR3B subgroup: an ovERRview. Nucl Recept Signal 5: e009. 

Tremblay, A.M., Wilson, B.J., Yang, X.J., and Giguere, V. 2008. Phosphorylation‐dependent sumoylation regulates estrogen‐related receptor‐alpha and ‐gamma transcriptional activity through a synergy control motif. Mol Endocrinol 22(3): 570‐584. 

Vanacker, J.M., Bonnelye, E., Delmarre, C., and Laudet, V. 1998. Activation of the thyroid hormone receptor alpha gene promoter by the orphan nuclear receptor ERR alpha. Oncogene 17(19): 2429‐2435. 

Vanacker, J.M., Pettersson, K., Gustafsson, J.A., and Laudet, V. 1999. Transcriptional targets shared by estrogen receptor‐ related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta. EMBO J 18(15): 4270‐4279. 

Vandermoere, F., El Yazidi‐Belkoura, I., Demont, Y., Slomianny, C., Antol, J., Lemoine, J., and Hondermarck, H. 2007. Proteomics exploration reveals that actin is a signaling target of the kinase Akt. Mol Cell Proteomics 6(1): 114‐124. 

Villena, J.A., Hock, M.B., Chang, W.Y., Barcas, J.E., Giguere, V., and Kralli, A. 2007. Orphan nuclear receptor estrogen‐related receptor alpha is essential for adaptive thermogenesis. Proc Natl Acad Sci U S A 104(4): 1418‐1423. 

Vosseller, K., Wells, L., Lane, M.D., and Hart, G.W. 2002. Elevated nucleocytoplasmic glycosylation by O‐GlcNAc results in insulin resistance associated with defects in Akt activation in 3T3‐L1 adipocytes. Proc Natl Acad Sci U S A 99(8): 5313‐5318. 

Vu, E.H., Kraus, R.J., and Mertz, J.E. 2007. Phosphorylation‐dependent sumoylation of estrogen‐related receptor alpha1. Biochemistry 46(34): 9795‐9804. 

Wadhwa, R., Kaul, S.C., Ikawa, Y., and Sugimoto, Y. 1993. Identification of a novel member of mouse hsp70 family. Its association with cellular mortal phenotype. J Biol Chem 268(9): 6615‐6621. 

Wadhwa, R., Takano, S., Kaur, K., Aida, S., Yaguchi, T., Kaul, Z., Hirano, T., Taira, K., and Kaul, S.C. 2005. Identification and characterization of molecular interactions between mortalin/mtHsp70 and HSP60. Biochem J 391(Pt 2): 185‐190. 

Wadhwa, R., Takano, S., Taira, K., and Kaul, S.C. 2004. Reduction in mortalin level by its antisense expression causes senescence‐like growth arrest in human immortalized cells. J Gene Med 6(4): 439‐444. 

Wadhwa, R., Yaguchi, T., Hasan, M.K., Taira, K., and Kaul, S.C. 2003. Mortalin‐MPD (mevalonate pyrophosphate decarboxylase) interactions and their role in control of cellular proliferation. Biochem Biophys Res Commun 302(4): 735‐742. 

Walgren, J.L., Vincent, T.S., Schey, K.L., and Buse, M.G. 2003. High glucose and insulin promote O‐GlcNAc modification of proteins, including alpha‐tubulin. Am J Physiol Endocrinol Metab 284(2): E424‐434. 

Wang, Z., Gucek, M., and Hart, G.W. 2008. Cross‐talk between GlcNAcylation and phosphorylation: site‐specific phosphorylation dynamics in response to globally elevated O‐GlcNAc. Proc Natl Acad Sci U S A 105(37): 13793‐13798. 

  67

Warnmark, A., Treuter, E., Wright, A.P., and Gustafsson, J.A. 2003. Activation functions 1 and 2 of nuclear receptors: molecular strategies for transcriptional activation. Mol Endocrinol 17(10): 1901‐1909. 

Webster, T.J., Naylor, D.J., Hartman, D.J., Hoj, P.B., and Hoogenraad, N.J. 1994. cDNA cloning and efficient mitochondrial import of pre‐mtHSP70 from rat liver. DNA Cell Biol 13(12): 1213‐1220. 

Wells, L., Vosseller, K., and Hart, G.W. 2003. A role for N‐acetylglucosamine as a nutrient sensor and mediator of insulin resistance. Cell Mol Life Sci 60(2): 222‐228. 

Wende, A.R., Huss, J.M., Schaeffer, P.J., Giguere, V., and Kelly, D.P. 2005. PGC‐1alpha coactivates PDK4 gene expression via the orphan nuclear receptor ERRalpha: a mechanism for transcriptional control of muscle glucose metabolism. Mol Cell Biol 25(24): 10684‐10694. 

Willy, P.J., Murray, I.R., Qian, J., Busch, B.B., Stevens, W.C., Jr., Martin, R., Mohan, R., Zhou, S., Ordentlich, P., Wei, P. et al. 2004. Regulation of PPARgamma coactivator 1alpha (PGC‐1alpha) signaling by an estrogen‐related receptor alpha (ERRalpha) ligand. Proc Natl Acad Sci U S A 101(24): 8912‐8917. 

Wilson, B.J., Tremblay, A.M., Deblois, G., Sylvain‐Drolet, G., and Giguere, V. 2010. An Acetylation Switch Modulates the Transcriptional Activity of Estrogen‐Related Receptor {alpha}. Mol Endocrinol. 

Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C. et al. 1999. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC‐1. Cell 98(1): 115‐124. 

Xie, W., Hong, H., Yang, N.N., Lin, R.J., Simon, C.M., Stallcup, M.R., and Evans, R.M. 1999. Constitutive activation of transcription and binding of coactivator by estrogen‐related receptors 1 and 2. Mol Endocrinol 13(12): 2151‐2162. 

Yang, C., Zhou, D., and Chen, S. 1998. Modulation of aromatase expression in the breast tissue by ERR alpha‐1 orphan receptor. Cancer Res 58(24): 5695‐5700. 

Yang, N., Shigeta, H., Shi, H., and Teng, C.T. 1996. Estrogen‐related receptor, hERR1, modulates estrogen receptor‐mediated response of human lactoferrin gene promoter. J Biol Chem 271(10): 5795‐5804. 

Yang, W.H., Kim, J.E., Nam, H.W., Ju, J.W., Kim, H.S., Kim, Y.S., and Cho, J.W. 2006. Modification of p53 with O‐linked N‐acetylglucosamine regulates p53 activity and stability. Nat Cell Biol 8(10): 1074‐1083. 

Yang, W.H., Park, S.Y., Nam, H.W., Kim do, H., Kang, J.G., Kang, E.S., Kim, Y.S., Lee, H.C., Kim, K.S., and Cho, J.W. 2008a. NFkappaB activation is associated with its O‐GlcNAcylation state under hyperglycemic conditions. Proc Natl Acad Sci U S A 105(45): 17345‐17350. 

Yang, X., Ongusaha, P.P., Miles, P.D., Havstad, J.C., Zhang, F., So, W.V., Kudlow, J.E., Michell, R.H., Olefsky, J.M., Field, S.J. et al. 2008b. Phosphoinositide signalling links O‐GlcNAc transferase to insulin resistance. Nature 451(7181): 964‐969. 

Yang, X., Zhang, F., and Kudlow, J.E. 2002. Recruitment of O‐GlcNAc transferase to promoters by corepressor mSin3A: coupling protein O‐GlcNAcylation to transcriptional repression. Cell 110(1): 69‐80. 

  68

Yi, X., Luk, J.M., Lee, N.P., Peng, J., Leng, X., Guan, X.Y., Lau, G.K., Beretta, L., and Fan, S.T. 2008. Association of mortalin (HSPA9) with liver cancer metastasis and prediction for early tumor recurrence. Mol Cell Proteomics 7(2): 315‐325. 

Zachara, N.E. and Hart, G.W. 2006. Cell signaling, the essential role of O‐GlcNAc! Biochim Biophys Acta 1761(5‐6): 599‐617. 

Zhou, D. and Chen, S. 2001. PNRC2 is a 16 kDa coactivator that interacts with nuclear receptors through an SH3‐binding motif. Nucleic Acids Res 29(19): 3939‐3948. 

Zhou, D., Quach, K.M., Yang, C., Lee, S.Y., Pohajdak, B., and Chen, S. 2000. PNRC: a proline‐rich nuclear receptor coregulatory protein that modulates transcriptional activation of multiple nuclear receptors including orphan receptors SF1 (steroidogenic factor 1) and ERRalpha1 (estrogen related receptor alpha‐1). Mol Endocrinol 14(7): 986‐998. 

Zvereff, V., Wang, J.C., Shun, K., Lacoste, J., and Chevrette, M. 2007. Colocalisation of CD9 and mortalin in CD9‐induced mitotic catastrophe in human prostate cancer cells. Br J Cancer 97(7): 941‐948.