p blood catholic church - john patrick publishing co · lucas, martin luna, mr. sandy martin,...

6
PRECIOUS BLOOD CATHOLIC CHURCH PARISH OFFICE HOURS & CONTACT INFORMATION: 114 EAST EDMONDSON ST., CULPEPER, VA Monday – Friday: 9:00 am – 5:00 pm www.pbcconline.com/ (540)825-8945 [email protected] [email protected] [email protected] [email protected] Fax: 540-825-8987 Symbols of the Precious Blood Adam is sleeping an ecstatic sleep. God opens his side, removes a rib and forms Eve, the mother of all the living. But our view transcends this action and in spirit we behold the second, the divine Adam, Christ. He is sleeping the sleep of death. From His opened side blood and water flow, symbols of baptism and the Eucharist, symbols of the second Eve, the Church, the Mother of all the living. Through blood and water Christ willed to redeem God's many children and to lead them to an eternal home. At Jerusalem a service in Yahweh's honor is taking place on the Day of Atonement. The high priest is making his annual entrance into the holy of holies to sprinkle the blood of bucks and bulls upon the covenant in expiation for the sins of the people. The Church shows us the higher meaning of this rite. Our divine High Priest Christ on the first Good Friday entered that Holy of Holies which is not made with hands nor sprinkled with the blood of bucks and bulls; there He effects, once and for all, with His own Blood man's eternal redemption. A finale. Holy Church transports us to the end. The heavenly liturgy is in progress. Upon the altar is the Lamb, slain yet alive, crimsoned by His own Blood. Round about stand the countless army of the redeemed in garments washed white in the Blood of the Lamb. Hosts of the blessed are singing the new canticle of redemption: "You have redeemed us out of every tribe and tongue and nation by Your Blood." Now from vision to present reality. How fortunate we are to have divine Blood so near to us, to offer it to the heavenly Father for the sins of the whole world! (Excerpted from The Church's Year of Grace , Pius Parsch) July 5, 2020: FOURTEENTH SUNDAY IN ORDINARY TIME DÉCIMO CUARTO DOMINGO EN TIEMPO ORDINARIO SACRAMENT OF MARRIAGE ...and the two shall become one is celebrated after a period of preparation of not less than six months. Registered parishioners who wish to marry at Precious Blood should contact the parish office to begin arrangements. SACRAMENT OF BAPTISM : We welcome your child to our family at Precious Blood! Registered parishioners who are requesting baptism for their child should contact the parish office to sign up for the required pre-baptismal classes: In English: 1st Saturday class/2nd Saturday celebration In Spanish: 3rd Saturday class/4th Saturday celebration Classes are for ADULT attendance only; las clases son solo para ADULTOS SACRAMENT OF RECONCILIATION: Experience the joy of forgiveness... Wednesdays 6:30-7:30PM & Saturdays 3:30-4:30PM and any time upon request. Weekday Masses at Precious Blood: i Mon to Fri : 8:30AM and Office of Readings & Morning prayer i Thursdays: after Mass is Adoration 9am-9pm * (*subject to change due to weather/special events) Weekend Masses at Precious Blood: i Saturdays at 5:00pm (Vigil) i Sundays: 8:30am, 11:30am, 2:00pm(Spanish) i Live streaming 11:30am & 2:00 pm i Holy Days: 8:30am, 7:00pm, 8:30pm(Spanish) (and 7:00pm vigil the preceding evening) Rev. Kevin B. Walsh……………………………………Pastor Deacon Ramon Tirado…………Deacon/Director of R.I.C.A. Chris Dellinger………….……….Business Manager/Notary* Kelly Wilton…………...….Director of Religious Education Miriam Medina………Director of Liturgy/Hispanic Liaison Hannah Masson………...…………………Director of Music Julie Canavan……………….……………Office Staff/Notary* Robert Dwyer…………………………………I.T. coordinator Julie Dawley.……………..……………….Director of R.C.I.A. Austin Poole………..…………Principal, Epiphany School Monica Parsons………..…Director, Epiphany Pre-School (*for parish/school/diocesan related documents) REGISTRATION A warm welcome is extended to new parishioners and guests. New members can register with the parish office during office hours. Registration forms are also available in the Church vestibule and can be dropped in the collection basket during Mass. Parish registration is required for reception of the Sacraments (Baptism, Confirmation and Matrimony) and letters of eligibility to serve as a Godparent or sponsor.

Upload: others

Post on 22-Jun-2020

3 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: P BLOOD CATHOLIC CHURCH - John Patrick Publishing Co · Lucas, Martin Luna, Mr. Sandy Martin, Estella Martinez, Jean Moretti, Diane Mosely, John Mott, Mary Neureither, ... channel

PRECIOUS BLOOD CATHOLIC CHURCH PARISH OFFICE HOURS & CONTACT INFORMATION: 114 EAST EDMONDSON ST., CULPEPER, VA Monday – Friday: 9:00 am – 5:00 pm www.pbcconline.com/ (540)825-8945 [email protected] [email protected] [email protected] [email protected] Fax: 540-825-8987

Symbols of the Precious Blood Adam is sleeping an ecstatic sleep. God opens his side, removes a rib

and forms Eve, the mother of all the living. But our view transcends this action and in spirit we behold the second, the divine Adam, Christ.

He is sleeping the sleep of death. From His opened side blood and water flow, symbols of baptism and the Eucharist, symbols of the

second Eve, the Church, the Mother of all the living. Through blood and water Christ willed to redeem God's many children and to lead

them to an eternal home. At Jerusalem a service in Yahweh's honor is taking place on the Day of Atonement. The high priest is making his annual entrance into the

holy of holies to sprinkle the blood of bucks and bulls upon the covenant in expiation for the sins of the people. The Church shows us the higher meaning of this rite. Our divine High Priest Christ on the first Good Friday entered that Holy of Holies which is not made with hands nor sprinkled with the blood of bucks and bulls; there He effects, once

and for all, with His own Blood man's eternal redemption. A finale. Holy Church transports us to the end. The heavenly liturgy is in progress. Upon the altar is the Lamb, slain yet alive, crimsoned by

His own Blood. Round about stand the countless army of the redeemed in garments washed white in the Blood of the Lamb. Hosts of the blessed are singing the new canticle of redemption: "You have

redeemed us out of every tribe and tongue and nation by Your Blood." Now from vision to present reality. How fortunate we are to have divine Blood so near to us, to offer it to the heavenly Father for the sins of the

whole world! (Excerpted from The Church's Year of Grace , Pius Parsch)

July 5, 2020: FOURTEENTH SUNDAY IN ORDINARY TIME

DÉCIMO CUARTO DOMINGO EN TIEMPO ORDINARIO

SACRAMENT OF MARRIAGE ...and the two shall become one

is celebrated after a period of

preparation of not less than six months. Registered parishioners who wish to

marry at Precious Blood should contact the parish office to begin

arrangements.

SACRAMENT OF BAPTISM : We welcome your child to our family at Precious Blood! Registered parishioners who are requesting baptism for their child should contact the parish office to sign

up for the required pre-baptismal classes: In English: 1st Saturday class/2nd Saturday

celebration In Spanish: 3rd Saturday class/4th Saturday

celebration Classes are for ADULT attendance only; las clases

son solo para ADULTOS

SACRAMENT OF RECONCILIATION:

Experience the joy of forgiveness...

Wednesdays 6:30-7:30PM & Saturdays 3:30-4:30PM and

any time upon request.

Weekday Masses at Precious Blood: Mon to Fri : 8:30AM and Office of Readings & Morning prayer Thursdays: after Mass is Adoration 9am-9pm * (*subject to change due to weather/special events)

Weekend Masses at Precious Blood: Saturdays at 5:00pm (Vigil) Sundays: 8:30am, 11:30am, 2:00pm(Spanish) Live streaming 11:30am & 2:00 pm Holy Days: 8:30am, 7:00pm, 8:30pm(Spanish)

(and 7:00pm vigil the preceding evening)

Rev. Kevin B. Walsh……………………………………Pastor

Deacon Ramon Tirado…………Deacon/Director of R.I.C.A.

Chris Dellinger………….……….Business Manager/Notary* Kelly Wilton…………...….Director of Religious Education Miriam Medina………Director of Liturgy/Hispanic Liaison Hannah Masson………...…………………Director of Music Julie Canavan……………….……………Office Staff/Notary* Robert Dwyer…………………………………I.T. coordinator Julie Dawley.……………..……………….Director of R.C.I.A. Austin Poole………..…………Principal, Epiphany School Monica Parsons………..…Director, Epiphany Pre-School (*for parish/school/diocesan related documents)

REGISTRATION A warm welcome is extended to new parishioners and guests. New members can register with the parish office during office hours. Registration forms are also available in the Church vestibule and can be dropped in the collection basket during Mass. Parish registration is required for reception of the Sacraments (Baptism, Confirmation and Matrimony) and letters of eligibility to serve as a Godparent or sponsor.

Page 2: P BLOOD CATHOLIC CHURCH - John Patrick Publishing Co · Lucas, Martin Luna, Mr. Sandy Martin, Estella Martinez, Jean Moretti, Diane Mosely, John Mott, Mary Neureither, ... channel

Mass readings and intentions for FOURTEENTH week of Ordinary Time: 7/5/20-7/11/20, year A

Monday, 7/6: (m) Saint Maria Goretti, Virgin, Martyr Readings: Hos 2:16, 17-18, 21-22; Mt 9:18-26 8:30AM: Marcella Royse (+)

Tuesday, 7/7 Readings: Hos 8:4-7, 11-13, Mt 9:32-38 8:30AM: “Toodie” White (+)

Wednesday, 7/8 Readings: Hos 10:1-3, 7-8, 12; Mt 10:1-7 8:30AM: Josephine Newton family (special intentions)

Thursday, 7/9: (m) Saint Augustine Zhao Rong, Priest, and Companion, Martyrs Readings: Hos 11:1-4, 8-9; Mt 10:7-15 8:30AM: Jean Mae Masson (+)

Friday, 7/10 Readings: Hos 14:2-10; Mt 10:16-23 8:30AM: O Precious Blood of Jesus grant humility and fidelity to all Catholic priests

Saturday, 7/11: (M) Saint Benedict, Abbot Readings: Is 6:1-8; Mt 10:24-33 5:00PM: “Dot” Stockli (+)

Act of Spiritual Communion:

My Jesus, I believe that you are in the Blessed Sacrament. I love you above all things, and I long for you in my soul. Since

I cannot now receive you sacramentally, come at least spiritually into my heart. As though you have already come, I

embrace you and unite myself entirely to you never permit me to be separated from you. Amen.

If you would like one of the priests to visit someone who is sick, please notify the office. Arrangements should also be made with the office for an Extraordinary Minister of Holy Communion to bring the Eucharist to the homebound on a regular basis.

Sacramental Emergency Only: #540-812-6325

LORD, HEAR THE PRAYER FOR OUR SICK ESPECIALLY: Pat Aitken, Lidia and Farah Al Husain, Gus Alomari, Adeeb Abo Roman, Edith Anderson, Maria Caldera de Araya, Wayne Bentz, Sheila Bertrand, Susie Bessette, Edward Borris, Mike Bosma, baby Addison Braswell, Rudolph Bronesky, Oliver Brown, Mike Buckley, Christopher Byrne, Jim Byrne, Phillip Byrne, Kriss Cordero, Noah and Catherine Dellinger, James Crocker, Donna Diaz, Fr. Michael Dobbins, Richard Driscoll, Jr., Cathy Foret, Jeraldine Frye, Henry Galio, Ann Gile, Kevin Gile, Thelma and Vladimir Gonzalez, April Hair, Raymond J. Hall, Toni Hall, Hibah and Hamada, Alton Haskins III, Doris Houdesheldt, Alex Hyde, Sherry Judy, Emma Kaylor, Freda Kratochvil, Richard Kitts, Fr. Larry Kutz, Caroline and Harold, Lawrence, Susan Lambert, Alicia Lopez, Ellen McCarthy, Amy Lucas, Martin Luna, Scott Madison, Mr. Sandy Martin, Estella Martinez, Jean Moretti, Diane Mosely, John Mott, Mary Neureither, Barbara Noonan, Marian O’Brien, Bernardo Antonio Orellano, Luis Padilla, Shawn Peet, Esmeralda Potosme, Betty Powers, Ginger Roccapriore, Luigina Sebastian, Alice Schorr, Avery Scott, David Squeglia, Meg and Steve Szabolscky, August Joi Tucker, Jóse Vicuña, Kelly Zimmerman and for all those who ask for our prayers and wish to remain anonymous, may they feel God’s protective hand and return to good health.

(THE LORD’S DAY, JULY 5): LAY DOWN YOUR BURDENS

Reading I: Zec 9: 9-10 (restoration under the Messiah) Reading II: Rom 8: 9, 11-13 (indwelling of the Spirit) Gospel Mt 11: 25-30 (Jesus and his Father) Key Passage: Jesus said, “Come to me, all you that are weary and are carrying heavy burdens, and I will give you rest. Take my yoke upon you, and learn from me; for I am gentle and humble of heart, and you will find rest for your souls.” (Mt 11:28-29) Adult: When has Jesus refreshed you when you felt burdened by problems? Child: What burden do you need Jesus to help you carry? 8:30AM: Joel Black (final perseverance) 11:30AM: Bishop Burbidge (spiritual bouquet)/Natalie Castro (16th birthday blessings) 2:00PM: John “Jack” Hall (+)

OFFERTORY COLLECTIONS

www.faithdirect.net 1-866-507-8757

parish code: VA226 NOTE: Peter’s Pence collec on has been

moved to October 4, 2020

For our dearly departed, may eternal rest be granted unto them, O Lord, and let perpetual light shine upon them.

Anniversary, Memorial, Birthday, coming up? A contribution to the flower fund is a meaningful way to

honor someone special or remember a loved one.

“Father and maker of all, you adorn all creation with splendor and beauty, and fashion human lives in your image and likeness. Awaken in every heart reverence for the work of your hands, and renew among your people a readiness to nurture and sustain your precious gift of life.” Catholic Household Blessings & Prayers: “A Prayer for Life”

Page 3: P BLOOD CATHOLIC CHURCH - John Patrick Publishing Co · Lucas, Martin Luna, Mr. Sandy Martin, Estella Martinez, Jean Moretti, Diane Mosely, John Mott, Mary Neureither, ... channel

THIS WEEK AT PRECIOUS BLOOD:

See our full calendar: www.pbcconline.com SUNDAY (7/5): Public Masses: 8:30 AM/11:30/2:00PM

live streaming the Masses:11:30 AM & 2 PM MONDAY (7/6):

8:30am: Mass/Morning Prayer/Office of Readings TUESDAY (7/7):

8:30am: Mass/Morning Prayer/Office of Readings WEDNESDAY (7/8):

8:30am: Mass/Morning Prayer/Office of Readings CONFESSIONS 6:30-7:30PM

THURSDAY (7/9): 8:30am: Mass/Morning Prayer/Office of Readings and

Adoration, 9AM-9PM FRIDAY (7/10):

8:30am: Mass/Morning Prayer/Office of Readings SATURDAY(7/11)

8:30am: Morning Prayer/Office of Readings CONFESSIONS 3:30-4:30PM

UPCOMING EVENTS & RESOURCES

MUSIC MINISTRY: Calling all middle and high schoolers! If you sing or play an instrument, the best thing you can do for your talents is to give them in service to God! Join our teen group, One Voice and watch our Lord multiple your skills to bless our parish family! Practices in the summer are every Friday from 9:30-11 am in the parish hall and we serve once a month. Please contact [email protected] for any questions or information. LOOKING TO VOLUNTEER IN THE PRECIOUS

BLOOD CHURCH COMMUNITY? Come by the rectory office! Find out about many of the ministries that NEED YOU! USHER? ALTAR SOCIETY? ST. JOSEPH’S TABLE? SACRAMENTAL SATURDAYS? SACRISTAN? EUCHARISTIC ADORER?

LECTOR? YOUTH GROUP? Workshops and training are available; check with the office for details! NEW: Apply Online: In an effort to streamline the background check application process, the Office of Child Protection is now offering the ability to apply online. Please check with the rectory office first with your interest in serving!

THAT MAN IS YOU: To all men 18 and up...MEET ON SATURDAYS, 7AM in the parish hall!

REGISTRATION OPEN FOR CCD 2020/2021:

check the rectory office or the CCD office or online for the forms!

Bilingual catechists are needed Class fees for July/August incur a late fee

of $20. Registration ends: August 16.

“If then my people, upon whom my name has been pronounced, humble themselves and pray, and seek my face

and turn from their evil ways, I will hear them from heaven and pardon their sins and heal their land.“

-2 Chronicles 7: 14

Our Lady requests: “Reform of life is what I ask as the sign and proof of my children's love for me. God looks

at the heart, and if it resembles the Heart of

His Divine Son, it is with the greatest

pleasure He regards it…But to make your

hearts grow more and more like to the Heart of the Son, you must

go to the Mother, whose heart is most like His. From this

Pure and Immaculate Heart you will learn all

that will make you more pleasing to the Divine Heart of the

Son of God. “

Page 4: P BLOOD CATHOLIC CHURCH - John Patrick Publishing Co · Lucas, Martin Luna, Mr. Sandy Martin, Estella Martinez, Jean Moretti, Diane Mosely, John Mott, Mary Neureither, ... channel

ANNOUNCEMENTS:

THE CATHOLIC DIOCESE OF ARLINGTON WEBSITE includes a resource page where parishioners can access information regarding the recent events affecting the Church. Read the policies on child protection and responses to the crisis from Bishop Burbidge and the United States Conference of Catholic Bishops at www.arlingtondiocese.org/childprotection.

SIGN UP FOR THE DIOCESAN E-NEWSLETTER! Receive special video messages from our bishop, learn about unique opportunities to get involved, and be the first to know the news about our Diocese - straight to your inbox. Sign up here: http://bit.ly/CDAsignup

PLEASE CONSIDER ADDING 'SEARCHING FOR MORE' TO YOUR PODCAST LIST! 'Searching for More' features interviews and discussions on a range of topics affecting Catholics in today's world. Guests include clergy, local Catholics, doctors, technology experts, Catholic news anchors, and even Hollywood actors starring in epic biblical dramas. In addition to interviews, some podcasts will emanate from inspiring talks, speeches, homilies, and lectures given throughout the Diocese. The podcast is dedicated to the patronage of our diocesan saint, St. Thomas More. 'Searching for More' joins the 'Walk Humbly' and 'Catholic Herald' podcasts as diocesan audio offerings.

PRAYER FOR SOLIDARITY: Almighty and ever-living God, empower your one human family to join hands on our journey of faith. Send us your spirit of hope, so that we may work to alleviate human suffering and foster charity and justice in our world. Amen.

CONGRATULATIONS VIRGINIA: WE ARE NOW IN PHASE 3 as of July 1, 2020: checkout this link for a pdf guidelines: https://www.governor.virginia.gov/media/governorvirginiagov/governor-of-virginia/pdf/Virginia-Forward-Phase-Three-Guidelines.pdf

STEWARDSHIP REFLECTION: “For my yoke is easy, and my burden light.” (Matthew 11:30) When we think of being good stewards, we may think that God is asking too much of us when He calls us to generously share our time, talent, and treasure. However, we

must remember that we are not “owners” of anything, we are merely “stewards” of the gifts God has given us. All He is asking is that we give back a small portion, in gratitude, of what He has already given to us.“

VOCATIONS: ...I have called you by name Is 43:1 You are in the spirit, since the Spirit of God dwells in you.” Is the Holy Spirit leading you or someone you know to serve Christ and His Church as a priest or in the consecrated life? Call Fr. Michael Isenberg, (703) 841-2514, or write: [email protected].

EPIPHANY CATHOLIC SCHOOL 1211 E. Grandview Ave 540-825-9017 epiphanycatholicschool.org

Pre-school: 3-4 yr olds; elementary k-5; middle 6-8 Summer hours: Mon-Fri, 9-1pm (and by appt.)

FULLY ACCREDITED COME GROW WITH US! A CATHOLIC EDUCATION IS WITHIN YOUR REACH

Experience the difference that God can make in your child’s learning environment

TUITION ASSISTANCE AVAILABLE!www.epiphanycatholicschool.org/admissions

Epiphany Catholic School is now accepting applications for the 2020-2021 school year (Pre-K 3 through 8th grade).

If you are interested in learning more about what Epiphany has to offer your child, please email Debbie Hoffman:

[email protected]

Epiphany Catholic School has the following PART-TIME job openings for the 2020-2021 school year:

Resource teacher, Spanish teacher, Science teacher, P.E. teacher,

Extended Day Care assistants (AM & PM), and bus drivers (AM & PM).

If interested, email your resume to : [email protected]

Page 5: P BLOOD CATHOLIC CHURCH - John Patrick Publishing Co · Lucas, Martin Luna, Mr. Sandy Martin, Estella Martinez, Jean Moretti, Diane Mosely, John Mott, Mary Neureither, ... channel

Dear Brothers and Sisters, Today we celebrate our parish feast day – the feast of the Precious Blood of Jesus. The month of July is dedicated to the Precious Blood and we will be honoring It by joining in a communal prayer of the Litany of the Most Precious Blood of Christ which focuses on the real presence of Jesus in the Precious Blood. Another way we hope to celebrate this feast day will be with an ice-cream social after all the Masses. If we get enough volunteers, everyone will be welcome to visit the upper parking lot under the tents after ALL the Masses for enjoyment and fellowship with physical distancing. There are seats available at our Sunday Masses (including the Saturday Vigil Mass at 5 PM). There is no need to sign up; please just come if your health allows it. There are many places to sit in the balcony and in the Parish Hall and maintain physical distancing. To help lessen any fears please know that we sanitize the pews, the door handles/knobs, and other surfaces after every Mass, and we have extra disposable face masks if people ask for one. We are doing all that we can to minimize the transfer of germs. Of course, please use your best judgment if you have a compromised immune system as you decide when to return to Sunday Mass. Our parish food pantry, “St. Joseph’s Table”, continues at our Old Rectory and is open from 10 AM to 12 PM on Saturdays and 4 to 6 PM on Wednesdays. If you would like to volunteer to help out, please contact the rectory. We need bilingual speakers to help our visitors. We also need to build up our inventory of donations of non-perishable food (and some perishable food – we have limited refrigeration) or gift cards. Donations can be made in the rectory office from 9 AM to 5 PM, Monday through Friday. St. Joseph’s Table helps all members of our parish, both English and Spanish speaking. If you need any assistance, please come by. The dates for our First Communions are: Saturdays, July 11, 18 and (with a bilingual Mass) July 25. The rehearsals for each Mass will be the Friday night before at 7:00PM: July 10, 17 and 24. Please contact the CCD Office with your preferred date. We need to spread the children out equally among the three dates, and the number of guests might be limited to maintain physical distancing. I’d like to thank Kelly Wilton, Pat Reed, Dora Castro and all the catechists who teamed up to prepare the children and their families during the pandemic for these special days.

Vacation Bible Camp is coming July 27-30TH. Under the direction of Kelly Bennett, the children will be able to participate in a program called, Totally Catholic: Rocky Railway! Through life’s ups and downs, Jesus' Power Pulls Us! See the bulletin for more details and volunteering opportunities: we need 5 adults and 10 youth Middle School and High School age. I’d like to remind you that there are many resources available to help you with your faith formation. Some resources are:

Www.formed.org: there are thousands of Catholic movies, video programs, audios and e-books at your fingertips! Many of these programs are in Spanish and English; our parish code is V2XJNR; create your personal account with your email and password for future use! There are lots of kid videos, games, Catholic Lego sets at www.holyheroes.com. There are also CDs, movies about saints, and books of apologetics, fiction, and biographies available in our par-ish library. You can check out the key from the office and find the treasures inside to check out!

We are grateful to our parishioners who are able to continue to support the parish during this time as we still have all of our payroll expenses. Thanks to your generosity, we are up to about 40% of our usual income. If you can help us get closer to reaching our budget, it would help us very much. Let us continue to pray for our Lord’s protection and help during this pandemic and for peace and justice and the overcoming of all forms of hatred, including racial hatred, during the social unrest we have been going through in our country. Shalom, Fr. Kevin

Page 6: P BLOOD CATHOLIC CHURCH - John Patrick Publishing Co · Lucas, Martin Luna, Mr. Sandy Martin, Estella Martinez, Jean Moretti, Diane Mosely, John Mott, Mary Neureither, ... channel

704 Precious Blood Catholic Church, Culpeper, VA (b) John Patrick Publishing Co. (800)333-3166 • www.jppc.net

Scott Found“Family Owned and Operated”

Our Locations:850 SPERRYVILLE PIKE

CULPEPER, VA 22701(540) 825-3530

•10719 COURTHOUSE ROAD

FREDERICKSBURG, VA 22407(540) 891-9735

www.foundandsons.com

FOUND AND SONSFUNERAL CHAPELS • CREMATION SERVICE

Interior/Exterior • Residential • Commercial434-466-1925www.certapro.comBill Canavan, Parishioner

MICHAEL KLEMANN, DDS • E. LEE SIMPSON II, DMD800 Sunset Lane, Suite B • Culpeper, VA

540.825.2444 • www.culpeperdentalassociates.com

CARWORKS AUTO BODY 540-727-9671 AUTOMOTIVE 540-727-9673

DAVE THE MOVER LLC(540) 829-0505

Honest & Capable Since 1492!

David P. Wassenaarwww.davethemover.com

Ana Maria RochaOwner/Manager

Cell: 540-423-8363Email: [email protected]

Julie Maybach Royal, PT, MSPT, CWS540.347.4005www.innovativeptllc.com

560 Broadview AveSuite 201Warrenton, VA 20186

Therapy • Massage • Yoga • Tai Chi for Rehab

CERTIFIEDPUBLIC

ACCOUNTANTS301 S. West StreetCulpeper VA 22701

540.825.8005www.nicholasjones.com

Our staff strives to provide the best service and fi nancial management in the investment industry

Brown HarrisBrown HarrisWealth ManagementWealth Management

Alan K. Place, CICOwner & Parishioner

605 S. Main StreetComplete Insurance Services

540.825.8511 • centralvirginiainsurance.com

Mike DubyPersonal Trainer

Voted Culpeper’s 2018BEST OF THE BESTApplied Science Fitness Studio

540-812-5532

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see

if we can help Save you money with your monthly payments on your commercial property.

Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

WELL CARE COACHINGDawn Klemann, PsyD, Owner & [email protected]

540.404.5959Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O

To all thosenforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tetttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

Mallory’s Army Foundation

United Together In The Fight Against Bullying...

Don’t Just Teach Kindness...

B E K I N D N E S S !www.MallorysArmy.com

(973) [email protected]

It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle

to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson#WHATSMYNAME