osteogenic studies of drug eluting nanotubular laser...

Osteogenic Studies of Drug Eluting Nanotubular

Laser Additive Manufactured Commercially Pure

Titanium.

Thesis submitted by

LEKHA R.

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE

DEGREE OF

MASTER OF PHILOSOPHY

SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCES

AND TECHNOLOGY

THIRUVANANTHAPURAM – 695011

(An institute of national importance under Govt. of India with the status of

University by an Act of Parliament in 1980)

Declaration

I, Lekha R., hereby declare that the thesis work entitled “Osteogenic Studies of

Drug Eluting Nanotubular Laser Additive Manufactured Commercially Pure

Titanium” was done by me under the direct guidance of Dr. Sabareeswaran

A., Scientist E, Histopathology Lab, Biomedical technology wing, Sree Chitra

Tirunal Institute for Medical Sciences and Technology, Thiruvananthapuram,

Kerala, India. External help sought are acknowledged.

LEKHA R.

2015/M.Phil/05

SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCES AND

TECHNOLOGY

THIRUVANANTHAPURAM – 695011, INDIA

(An institute of national importance under Govt. of India with the status of

University by an Act of Parliament in 1980)

Certificate

This is to certify that the thesis work entitiled ‘“Osteogenic Studies of Drug

Eluting Nanotubular Laser Additive Manufactured Commercially Pure

Titanium” submitted by Lekha R (2015/MPhil/05) in partial fulfillment for the

Degree of Mater of Philosophy in Biomedical Technology was done under my

supervision and guidance at Histopathology lab, Biomedical technology wing,

Sree Chitra Tirunal Institute for Medical Sciences and Technology,

Thiruvananthapuram, Kerala, India.

Place: Thiruvananthapuram Dr. Sabareeswaran A.

Date: Scientist E

Histopathology lab

Biomedical Technology Wing

The thesis entitiled

Osteogenic Studies of Drug Eluting Nanotubular Laser

Additive Manufactured Commercially Pure Titanium.

Submitted by

LEKHA R.

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE

DEGREE OF

MASTER OF PHILOSOPHY

Of

SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCES AND

TECHNOLOGY, THIRUVANANTHAPURAM – 695011, INDIA

Evaluated and approved by

Signature Signature

Name of supervisor Examiner’s name and designation

Acknowledgement This study was carried out under the supervision and valuable guidance of my guide Dr.

Sabareeshwarn A., Scientist E, Histopathology Lab, Biomedical Technology Wing, SCTIMST,

Trivandrum. I gratefully acknowledge the excellent and incessant help given by her, and, for her

valuable guidance and encouragement throughout this study and for the correction of the thesis.

I am greatly obliged to Dr. Anilkumar T.V., Scientist “G”, Scientist in Charge, Experimental

Pathology lab, BMT Wing, for her generosity and sincere help rendered for the completion of the

project as well as the Course.

I am greatly obliged to Dr. Kumari, Scientist “G”, Scientist in Charge, Division of Tissue

culture, Head of the Department (TRI), BMT Wing, for her generosity and sincere help rendered for

the completion of the project as well as the Course.

My deep gratitude goes to Dr. Harikrishna Varma P. R., Engineer “F” Scientist-in-Charge

G, Scientist in Charge, Division of Bioceramics, BMT Wing, for his generosity and sincere help

rendered for the completion of the project as well as the Course.

I would like to express my gratitude to The Director (SCTIMST), Head (BMT Wing), Dean,

Deputy Registrar and M.Phil. coordinators for their co-operation, encouragement and providing all

the facilities during the work.

I would like to express my sincere thanks to Mrs. Deepa.K.Raj (TIC) for her valuable advice

and help provided during the entire tenure of work.

It is my great pleasure to express my gratitude to Mr. Balu V Gopal, PhD Student for his

timely advice, support, patience and the pain he took for helping in the completion of work.

I am thankful to Mr. Nishad K.V. (SEM lab) for the technical help and support he provided in

doing the project.I am greatful to Dr.Rajesh (Former P.hD. student,),Mrs.Nimmi (P.hD. student)of

Bioceramics division for his valuable help and support he provided in doing the project.

I am greatly obliged to Dr. Joy Mitra (Assistant Professor) and Dr. Dr Mayanglambam

Suheshkumar Singh (Assistant Professor) of School of Physics IISER, Trivandrum for helping me to

undertake FESEM analysis.

Expressing special thanks to Raja Ramanna Centre for Advanced Technology and

Department of Atomic Energy, Government of India for their service and funding of this project.

I express my sincere thanks and gratitude to Mrs. Sulekha Baby (Senior Scientific Officer),

Mr. Thulaseedharan N.K. (Junior Scientific Officer), Mr. Joseph Sebastian (Technical assistant)

and all others in my lab for their help, technical advice and patience.

Special thanks are due to Dr. Manjula V James and Dr. Soumya Vijayakumar Scientist –

Temporary, for their care and support.

I am at a loss of words to express my heartfelt thankfulness to all my friends for their valuable

friendship, affection and care. I am gratefully remembering the care, love and support of my beloved

father, mother, sister and all my relatives which enabled me endeavoring all the achievements in my

life. Above all I would like to thank God Almighty, for showering his blessings to complete my work

successfully

Abbreviations

% Percentage

µg Microgram

µl Microlitre

µm Micrometer

2D Two dimensional

3D Three dimensional

ALP Alkaline Phosphatase

AM Additive manufactured

BM Bone marrow

BMD Bone mineral density

BM-MSC Bone marrow mesenchymal stem cell

BMP 2 Bone morphogenetic protein 2

BSA Bovine serum albumin

C Carbon

CCD Cleidocranial dysplasia

CD 105 Cluster of differentiation 105

CD 90 Cluster of differentiation 90

COL-1 Collagen 1

Cp Ti Commercially pure Titanium

DAPI 4',6-diamidino-2-phenylindole

ECM Extra cellular matrix

ELI Extra low interstitial

ESEM Environmental scanning electron microscope

FBS Fetal bovine serum

FDA Fluorescene di acetate

FESEM Field 6mission scanning electron microscope

FTIR Fourier transform infrared spectroscopy

G1 phase Growth phase 1

GADPH Glyceraldehyde 3-phosphate dehydrogenase

hMSC Human Mesenchymal stem cell

I pass lower passive current density

KCl Potassium Chloride

KH2Po4 Monopotassium phosphate

L Litre

LAM Laser additive manufactured

LAM-CP-Ti Laser additive manufactured porous

commercially pure Titanium

mg Milligram

ml Millilitre

MPA Monocyte platelet aggregates

mRNA Messenger Ribo nucleic acid

MSC Mesenchymal stem cell

N Nitrogen

Na2HPo4 Disodium hydrogen phosphate

NaCl Sodium chloride

NaHCo3 Sodium bicarbonate

NaOH Sodium hydroxide

NT Nanotubes

NT-LAM-Cp-Ti Nanotubular Laser additive manufactured

porous commercially pure Titanium

NT-Ti Nanotubular Titanium

OCN Osteocalcin

OPN Osteopontin

OSE2 Osteoblast specific cis-acting element

PBS Phosphate buffered saline

PI Propedium iodide

RUNX2 Runt-related transcription factor 2

SD Standard deviation

SV Simvastatin

Ti Titanium

TiO2 Titanium oxide

TNT Titanium nanotubes

tris HCl Tris Hydrochloride

UV Ultra violet

V Volt

α MEM Minimum Essential Medium Eagle - Alpha

Modification

Β-actin Human gene and protein symbol

ACTB/ACTB

Table of contents

Section No. Title Page No.

Synopsis 1-4

1 Chapter 1 Introduction 5

1.1 Bone 6-8

1.2 Titanium 9

1.3 Simvastatin 9

1.4 Bone marrow mesenchymal stem cells 9-10

1.5 Hypothesis and Objectives 10

1.6 Review of Literature 11

1.6.1 Titanium and Biomedical applications 11-12

1.6.2 Commercially pure Titanium 12-13

1.6.3 Titanium and its structural modifications 13-14

1.6.4 Laser Additive Manufacturing of Titanium 14

1.6.5 Nanotubular structural modification of Titanium 14-17

1.6.6

Nanotubes and osteogenic induction potential 17-18

1.6.7 Drug delivery using nanotubes 18

1.6.7.1 Simvastatin 18-19

1.6.8 Defects of Titanium and its modification 19-20

1.6.9 Cells for studying osteogenic potential 20-21

1.6.9.1 Bone marrow mesenchymal stem cells 21-24

1.6.9.2 Gene expression studies 24-26

2 Chapter 2 Materials and methods 27

2 Materials 27

2.1 Chemicals 27-29

2.1.1 Primers 29

2.2 Methods 30

2.2.1 Laser Additive Manufactured Commercially Pure Titanium (LAM-

Cp-Ti)

30

2.2.2 Anodization 30

2.2.3 Surface characterization 30-31

2.2.4 Dilution of Simvastatin solution 31

2.2.5 Loading of Simvastatin Drug and elution study 31

2.2.6 FTIR Analysis 31-32

2.2.7 Isolation and culture of rat bone marrow MSC 32

2.2.8 MTT assay of cells using LAM-Cp-Ti 32-33

2.2.9 Live-Dead staining of BM-MSC on NT-LAM-Cp-Ti 34

2.2.10 Characterization of rat bone marrow MSC 34

1.2.11 Multilineage differentiation of rat bone marrow MSC 34-35

2.2.12 Cell adhesion assay 35

2.2.13 Osteogenic study 35-36

2.2.13.1 Alkaline phosphatase Assay (ALP assay) 36

2.2.13.2 Special staining

A. Von Kossa staining

B. Alizarin Red S staining

C. Masson’s Trichome staining

36-37

2.2.13.3 Osteogenic gene expression study 37-38

2.2.14 Statistical analysis 38

3 Chapter 3 Results and Discussion 39

3.1 Material Characterisation 39

3.1.1 Structure analysis of LAM-Cp-Ti 39

3.2 Nanotubular structural modification 40

3.2.1 Effect of electrolyte, Voltage and time in formation of nanotubes 40

3.3 Simvastatin drug loading 44

3.3.1 Incorporation of simvastatin into Nanotubes of LAM-Cp-Ti 44

3.3.2 Fourier transform infrared spectroscopy (FTIR) 44

3.3.3 The morphology of the simvastain loaded NT-LAM-Cp-Ti 45-46

3.4 In-vitro Simvastatin drug release study 48

3.4.1 UV-Spectroscopy analysis of drug elution 48-49

3.5 Rat Bone Marrow Mesenchymal Stem cells (BM-MSC) 49

3.5.1 Culture of rat BM-MSC 49

3.5.2 Characterization of Rat BM-MSC 51

3.5.2.1 Direct Immunofluorescence staining 51

3.5.2.2 Cytoskeleton staining 51

3.6 Cytocompatability of LAM-Cp-Ti 55

3.6.1 Cell Adhesion studies 56

3.6.1.1 Rat BM-MSC culture with porous LAM-Cp-Ti 56

3.6.2 Differentiation potential of Rat BM-MSC 58

3.6.2.1 Osteogenic and Adipogenic potential of Rat BM-MSC 58

3.6.3 Rat BM-MSC cultured on NT-LAM-Cp-Ti 60

3.6.3.1 Cytoskeleton staining 60

3.6.3.2 Live-Dead assay 60

3.6.3.3 Morphology and adherence 60

3.7 Osteogenic study of LAM-Cp-Ti 61

3.7.1 Special staining 63

3.7.2 Alkaline phosphatase assay 73

3.7.3 Osteogenic Gene expression study 74-76

3.8 Discussion 77

3.8.1 Material Characterisation 77

3.8.1.1 Structure analysis of LAM-Cp-Ti 77

3.8.2 Nanotubular structural modification 78-79

3.8.2.1 Effect of electrolyte,Voltage and time in formation of nanotubes 79-80

3.8.3 Simvastatin drug loading and elution studies 80-81

3.8.3.1 Fourier transform infrared spectroscopy (FTIR) Analysis 81

3.8.3.2 The morphology of the Simvastain loaded NT-LAM-Cp-Ti

82

3.8.3.3 UV-Spectroscopy analysis of drug elution 82

3.8.4 In vitro cell culture studies 82

3.8.4.1 Culture of rat bone marrow MSC 82-83

3.8.4.2 Characterisation of Rat Bone Marrow Mesenchymal stem cells 83

3.8.4.3 Cytocompatability analysis 84-88

3.8.4.4 Osteogenic studies 88-89

3.8.4.5 Osteogenic gene expression studies 89-91

4 Chapter 4 Summary and Conclusion 93

4.1 Summary 93

4.2 Conclusion 94

4.3 Future aspects 94

4.5 References 95-101

List of figures

Figure

Title

Page no

1 Showing the collection of Femur from the Rat for Isolation of Rat BM-MSC

33

2 ESEM image of the porous LAM-CpTi showing its topographic

microstructure

39

3 ESEM image of the CpTi showing its topographic microstructure

40

4 FESEM images showing the difference of nanotubular structures on the Cp Ti

(A) and porous LAM-Cp-Ti (B)

41

5 ESEM images Showing the length (A) and diameter (B) of nanotubular

structures on the porous LAM-Cp-Ti

42

6 FESEM images showing the nanotubular structures formed on the porous

LAM-Cp-Ti in 20 v and 10 v.

43

7 FTIR spectra of Simvastatin dissolved in ethanol in 1mg/ml concentration

44

8 FTIR spectra of 200µg of simvastati ethanol mixture sample

45

9 FTIR spectra of eluted mixture sample containing simvastatin from

nanotubes on LAM-Cp-Ti.

45

10 ESEM image showing the drug coated (A)and ethanol(B) loaded NT-LAM-

CP-Ti disc

46

11 ESEM image A and Bshowing the drug coated disc after elution

47

12 The release profile of Simvastatin (SV) from drug-loaded NT-LAM-Cp-Ti

48

13 The cumulative release profiles of Simvastatin (SV) from drug-loaded NT-

LAM-Cp-Ti

49

14 Inverted phase contrast images (A& B) showing the cultured Rat BM-MSC

50

15 Fluorescence microscope images showing Immunostaining of mesenchymal

stem cells using CD90.

52

16 Fluorescence microscope images showing Immunostaining of mesenchymal


53

17 Nuclei are stained blue with DAPI, and βactin filaments are labelled with β

Actin. The merged images showing the cell with nucleus is depicted above

54

18 Inverted phase contrast micrographs showing the monolayer of MSC on the

bottom of the well

55

19 Inverted phase contrast micrographs showing the adherence and growth of

MSC on the marginal area of the LAM-Cp-Ti discs.

56

20 ESEM images showing the adherence and growth of MSC on the surface (A)

and macropore(B) of the LAM-Cp-Ti discs

57

21 ESEM images showing the extending filopodia connecting macropore margins

(A)and growth of MSC inside macropore of the LAM-Cp-Ti discs(B)

57

22 Von Kossa stainingof BM-MSC showing Mineralisation

59

23 Alizarin Red staining of BM-MSC showing calcification

59

24 Oil red O staining of BM-MSC showing oil droplets

59

25 Nuclei are stained blue with DAPI,, and actin filaments are labelled with β

Actin. The merged images showing the cell with nucleus is depicted above.

Cytoskeletal staining of BM-MSC grown on NT-LAM-Cp-TI

61

26 Live dead assay of the BM-MSC grown on the surface of NT-LAM-Cp-TI

62

27 ESEM images showing the difference in population of BM- MSC on porous

LAM-Cp-Ti(A) and nanotubular surface of LAM-Cp-Ti discs(B)

62

28 ESEM images showing the aggregation of MSC on nanotubular surface of

NT-LAM-Cp-Ti discs

63

29 ESEM images Showing the filopodia of BM-MSC extending into the

nanotubes formed on the NT-LAM-Cp-Ti .

63

30 Alizarin Red staining of BM-MSC cultured with LAM-Cp-Ti showing

calcification during 7th

day.

64



day.

65


calcification during 21st day

66

33 Trichome staining of BM-MSC cultured with LAM-Cp-Ti showing collagen

during 7th

day.

67


during 14th

day.

68


during 21st day.

69

36 Von kossa staining of BM-MSC cultured with LAM-Cp-Ti showing

calcification durinm 7th day

70



day.

71


calcification during 21st day.

72

39 Graph showing the ALP activity of the cell culture with LAM-Cp-Ti 7,14 and

21 days respectively.

73

40 Graph showing the relative gene expression on the 7th

and 14th

day analysis

74

41 Graph showing the fold change of COL1 and OPN gene expressed on the 7th

day by Simvastatin loaded disc

75

42 Graph showing the fold change of COL1 and OPN gene expressed

on the 14th

day by nanotube modified disc

76

1 | P a g e

Synopsis

The biological response of an implanted biomaterial is related to its cell- material

interaction. This work focuses on the evaluation of drug eluting nanotubular surface

modified Laser additive manufactured commercially pure Titanium (LAM- Cp-Ti) for its

cytocompatibility and osteogenic properties in relation to its porous structure and topography.

Nanotubular surface modification was done using anodisation method and incorporation of

Simvastatin drug is made possible followed by biological evaluation of the LAM- Cp-Ti in

relation to its osteogenic induction potential using rat bone marrow mesenchymal stem cells

in vitro (BM-MSC).

Chapter One Introduces the back ground of the study; reviews literature on the previous

studies conducted and hypothesis of the present study. The selection of an ideal biomaterial,

its modification and optimization is the most important factor. Although performance of the

biomaterial according to the need remains a challenge in many implant scenarios. This is due

to complex relationships between intrinsic material properties and the cell -tissue response.

As the aging population increases various bone defects due to trauma and disease conditions

are raising day by day and the need for ideal orthopedic biomaterial is in great need. Bone is

a complex tissue which acts as a supporting framework of the body, characterized by its

rigidity, hardness, and power of regeneration and repair. Ossification (or osteogenesis) is the

process of formation of new bone by cells called osteoblasts. These cells and the bone matrix

are the two most crucial elements involved in the formation of bone. Titanium and Titanium

based alloys as biomaterials are a suitable for biomedical applications in orthopedics. Of

these, medical grade commercially pure titanium (CpTi) plays an effective role as an

orthopedic biomaterial. By modifying the structural topographies like laser additive

manufacturing and formation of nanotubes can upgrade the biocompatible nature of Titanium

2 | P a g e

and can act as a drug loaded vehicle. Statins including Simvastatin are category of potentially

promising drugs for treatment of osteoporosis. In addition to its lipid-lowering effects,

Simvastatin can also elicit some pleiotropic effects, leading to the modulation of the process

of bone regeneration at the molecular and cellular levels. It has long been recognized that

adult bone marrow stem cells (BMSC) form multiple mesenchymal tissues in vivo including

bone and have utility for engineering skeletal tissues. This seems to be beneficial for in vitro

studies to evaluate the osteogenic potential of LAM-Cp-Ti.

Chapter Two describes the methods and the materials used in conducting the experimental

study. The material and drug samples included in the study are LAM-Cp-Ti and Simvastatin.

Rat bone marrow mesenchymal stem cells has been used for biological evaluation studies.

Isolation and culture of rat bone marrow MSC is done as per the published protocol.

Characterization of rat BM-MSC was done by phalloidin-FITC, CD90 and CD105

immunofluresence staining. Multilineage differentiation of BM-BMSC was evaluated by

differentiating cells in induction media followed by staining. Anodization is the process by

which the nanotiubular structures has been created on the material surface.. The surface

characterization studies are done by using the field emission scanning electron microscopy

(FE-SEM) and Environmental scanning electron microscopy (ESEM). Simvastatin drug

solution was prepared using absolute ethanol. The Simvastatin loading was carried out by dip

coating and vacuum drying process. FTIR analysis was done to confirm the drug

incorporation into the nanotubular structures.. MTT assay was performed in rat bone marrow

MSC to evaluate cytotoxicity of LAM-Cp-Ti .. Viability of cells were evaluated by live-dead

staining of rat BM-MSC on NT-LAM-Cp-Ti. Cell adhesion assay was analyzed using ESEM.

Osteogenic potential was evaluated by alkaline phosphatase assay and using specific staining

like Alizarin Red, Von Kossa and Trichome. Osteogenic gene expression study was

3 | P a g e

conducted and osteocalcin, osteopontin, collagen type I and RUNX2 genes expression by

BM-MSCs was quantitatively measured.

Chapter Three details the results of each analysis and briefly discuss the same with

reference to already published scientific literature. Anodization process resulted in the

formation of Titanium nanotubes on the surfaces of LAM-Cp-Ti. The Surface

characterization studies revealed the topography, structure, and characteristic features of the

nanotubes formed. The Simvastatin loading carried out by dip coating method and vacuum

drying process was successful resulted in the incorporation of the drug into the nanotubes.

FTIR analysis revealed Simvastatin on the LAM-Cp-Ti surface and denaturing of the drug

was not found. Elution studies revealed stable release of Simvastatin continuously over a

period of 15 days. Isolation and culture of rat Bone marrow MSC is done and sub cultured

effectively throughout the studies. Characterization of rat BM-MSC revealed CD90 and

CD105 immunofluresence staining positive results. MTT assay of bone marrow MSC using

LAM-Cp-Ti and Simvastatin was done which revealed the noncytotoxic nature of LAM-Cp-

Ti and Simvastatin. High viability was shown by the cells in live-dead staining of BM-MSC

on NT-LAM-Cp-Ti. Multilineage differentiation was shown by rat BM-MSC special staining.

ESEM analysis provided evidence for the cell adhesion. Osteogenic study revealed alkaline

phosphatase synthsisi by cells. and osteogenic special staining by Alizarin Red, Von Kossa

and Trichome evidenced the osteogenic induction potential of LAM-Cp-Ti. Gene expression

studies using quantitative real time PCR to study the osteogenic gene expression namely

osteocalcin, osteopontin, collagen and Runx2 revealed upregulaation osteocalcin,

osteopontin, collagen and down regulation of Runx2.

4 | P a g e

Chapter Four Summarizes and concludes the present study briefly and gives an outline on

future prospects. Nanotubular surface modified and Laser additive manufactured

Commercially pure Titanium (CpTi) is non cytotoxic and is having osteogenic induction

potential on rat bone marrow mesenchymal stem cells in vitro.

5 | P a g e

Introduction

The diverse interactions between the cells with the biomaterials will directly influence

the success and the failure of biomaterial. The specific nature and extent of biological response

will be influenced by the nature of biomaterial surface and the cell or tissue with which it

interacts. The selection of an ideal biomaterial, its modification and optimization is the most

important factor. Although performance of the biomaterial according to the need remains a

challenge in many implant scenarios. This is due to complex relationships between intrinsic

material properties and the cell response. Orthopedic biomaterials and implants impart

therapeutic benefit through adhesion to the tissue or cell, thus exhibiting a direct functional

dependence on cell or tissue-material reactivity.

According to the current scenario as the aging population increases various bone

defects due to trauma and disease conditions are raising day by day and the need for ideal

orthopedic biomaterial for numerous clinical applications is in turmoil. In order to develop an

ideal bone construct, it is far more important to understand the mechanisms of native bone

mechanics, osteogenesis, and development and fracture healing, as these processes should

ideally guide the selection of optimal conditions for tissue culture and implantation of

suitable biomaterial in relation to bone mechanics, development and healing properties.

It is essential that the biomaterial for bone construct should have the capacity for

osteogenesis, osteoconduction, osteoinduction and osteointegration - functional connection

between the host bone and the biomaterial. The promise of tissue engineering is to combine

the advances in the fields of biomaterials and cell biology towards making a suitable implant,

graft or scaffold that matches most or all of these characteristics.

6 | P a g e

1.1 Bone

Bone is a highly specialized supporting framework of the body, characterized by its

rigidity, hardness, and power of regeneration and repair. It protects the vital organs, provides

an environment for marrow and acts as a mineral reservoir for calcium homeostasis and a

reservoir of growth factors and cytokines. Bone constantly undergoes modification during life

to help it adapt to changing biomechanical forces, as well as remodification to remove old,

micro damaged bone and replace it with new, mechanically stronger bone to help preserve

bone strength. The bones have two components – the cortical bone which is dense, solid, and

surrounds the marrow space and the trabecular bone which is composed of a honeycomb-like

network of trabecular plates and rods interspersed in the bone marrow compartment.

The structure of bone is constituted by: (a) Inorganic (69 %) component, consisting of

hydroxyapatite (99 %) (b) Organic (22 %), constituted by collagen (90 %) and noncollagen

structural proteins which include proteoglycans, sialoproteins and glycoproteins. The

functional component of the bone includes growth factors and cytokines. The hardness and

rigidity of bone is due to the presence of mineral salt in the osteoid matrix, which is a

crystalline complex of calcium and phosphate (hydroxyapatite). Calcified bone contains

about 25 % organic matrix, 5 % water, and 70 % inorganic mineral (hydroxyapatite). Bone

provides mechanical support for anchoring muscles and facilitating movement, while

protecting vital organs. The primary functions of bone are based on its structural

characteristics. The mechanical properties of bone generally depend on its structure and

orientation.

As we know that the bone is composed of supporting cells like osteoblasts and

osteocytes and remodeling cells called osteoclasts along with non-mineral matrix of collagen

and noncollagenous proteins called osteoid. During life, the bones undergo processes of

longitudinal and radial growth, modeling (reshaping), and remodeling. Longitudinal growth

7 | P a g e

occurs at the growth plates, where cartilage proliferates in the epiphyseal and metaphyseal

areas of long bones, before subsequently undergoing mineralization to form primary new

bone. Ossification (or osteogenesis) is the process of formation of new bone by cells called

osteoblasts. These cells and the bone matrix are the two most crucial elements involved in the

formation of bone. This process of formation of normal healthy bone is carried out by two

important processes, namely the intramembranous ossification characterized by laying down

of bone into the primitive connective tissue (mesenchyme) resulting in the formation of bones

(skull, clavicle, mandible) and Endochondral ossification where a cartilage model acts as a

precursor (e.g., femur, tibia, humerus, radius). This is the most important process occurring

during fracture healing when treated by cast immobilization. If the process of formation of

bone tissue occurs at an extra skeletal location, it is termed as heterotrophic ossification

Osteoblasts originate from mesenchymal stem cells (osteoprogenitor cells) of the bone

marrow stroma. They are responsible for bone matrix synthesis and its subsequent

mineralization. Commitment of mesenchymal stem cells to the osteoblast lineage requires the

canonical Wnt/ j3-catenin pathway and associated proteins. Osteoblasts are mononucleotide,

and their shape varies from flat to plump, reflecting their level of cellular activity, and, in

later stages of maturity, lines up along bone-forming surfaces. Osteoblasts are responsible for

regulation of osteoclasts and deposition of bone matrix. As they differentiate, they acquire the

ability to secrete bone matrix. Osteocytes are the most abundant cells in bone; these cells

communicate with each other and with the surrounding medium through extensions of their

plasma membrane. The osteoblasts, rich in alkaline phosphatase, an organic phosphate-

splitting enzyme, possess receptors for parathyroid hormone and estrogen.

Intramembranous ossification is one of the two essential processes during fetal

development of the mammalian skeletal system resulting in the formation of bone tissue.

Intramembranous ossification mainly occurs during formation of the flat bones of the skull

8 | P a g e

but also the mandible, maxilla, and clavicles; it is also an essential process during the natural

healing of bone fractures and the rudimentary formation of bones of the head. The bone is

formed from connective tissue such as mesenchyme tissue rather than from cartilage.

The important cell in the creation of bone tissue by membrane ossification is a

mesenchymal stem cell. Mesenchymal stem cells (MSCs) within human mesenchyme or the

medullary cavity of a bone fracture initiate the process of intramembranous ossification. An

MSC is an unspecialized cell whose morphology undergoes characteristic changes as it

develops into an osteoblast. The process of membranous ossification, which is essentially the

direct mineralization of a highly vascular connective tissue, commences at certain constant

points known as centers of ossification. The remodeling process is required for the maintenance of

normal healthy bone. Initial bone formation results in an irregular distribution of disorganized fiber

bundles known as woven bone. This is subsequently remodeled via the coordinated interaction of

osteocytes, osteoclasts and osteoblasts into lamellar (layered) structures. Osteoclasts are of

hematopoietic origin and are the main cells responsible for bone resorption. They are critical for

remodeling processes that occur in response to mechanical stimulation during bone development as

well as fracture healing. Upon activation, osteoclasts resorb bone at the endosteal surface. This is

followed by bone formation by osteoblasts. The process between resorption and formation is tightly

coordinated and balanced in healthy bone.

Bone, when damaged, is unique in its ability to heal without the formation of scar

tissue. Fracture healing of long bones occurs via several stages and involves coordinated

responses of the bone marrow, bone cortex, periosteum and the surrounding soft tissues,

including regulation of cellular proliferation, migration and differentiation. The process

combines elements of endochondral and intramembranous ossification recapitulating many of

the developmental steps.

9 | P a g e

1.2. Titanium

Titanium and its alloys posses good mechanical property, biocompatibility and have

enhanced wear and corrosion resistance in biological environment. In the current scenario,

Titanium and Titanium based alloys as biomaterials is suitable for biomedical applications in

orthopedics. Titanium and its alloys are noted primarily for outstanding strength-to-strength

ratios elevated temperature properties and corrosion resistance. They also possess high

rigidity-to-weight ratios, good fatigue strength and toughness and, in some cases, excellent

cryogenic properties. Because of these characteristics along with improved fabrication

techniques titanium and its alloys as a biomaterial is ideal for orthopedic biomedical

applications.

1.3. Simvastatin

Simvastatin is one of the most commonly prescribed drugs for the treatment of

hypercholesterolemia and cardiovascular diseases. Major characteristics of Simvastatin is that

it regulates the synthesis of cholesterol .In addition to its lipid-lowering effects, Simvastatin

can also elicit some pleiotropic effects, leading to the modulation of the process of bone

regeneration at the molecular and cellular levels. Simvastatin seems to play an important role

in bone regeneration by participating directly in osteoblast activation by increasing bone

morphogenetic protein 2 (BMP-2) expressions and by inhibiting osteoclast. Simvastatin can

promote the differentiation of osteoblasts to regulate bone anabolic metabolism.

1.4. Bone Marrow Mesenchymal stem cells

Large numbers of cells capable of producing bone extracellular matrix are needed for

the production of clinically-sized engineered tissues. Mesenchymal stem cells, which

differentiate and form bone during normal development, have long been the primary cell

source for engineering bone grafts. It has long been recognized that adult bone marrow stem

10 | P a g e

cells (BMSC) form multiple mesenchymal tissues in vivo including bone and have utility for

engineering skeletal tissues. For engineering and regeneration of bone, the properties of

choice include high biosynthetic activity expression of osteogenic markers and phenotypic

stability.

In this present work procured Laser additive manufactured commercially pure

Titanium disc is evaluated for biocompatibility, adhesion and proliferation properties in

relation to its porous structure and topography. Nanotubular surface modification was done

using anodisation method and incorporation of Simvastatin is made possible followed by

biological evaluation of the surface modified disc whas been done to evaluate its osteogenic

induction potential using rat bone marrow mesenchymal stem cells-in vitro.

1.5. Hypothesis and Objectives

The Hypothesis of this research work is that surface modified and Laser additive

manufactured Commercially pure Titanium(CpTi) with drug eluting property have

osteogenic induction potential on rat bone marrow mesenchymal stem cells in vitro and can

be used in bone tissue engineering applications in the near future.

The Major objectives of the study include,

1. Nanotubular surface modification of LAM-CpTi.

2. Isolation and characterization of Rat BM-MSC and its differentiation.

3. To study drug loading and elution capacity of Nanotubes.

4. To find out the biocompatibility of LAM CpTi.

5. To study the osteogenic induction potential of LAM-CpTi.

6. To know the influence of surface modified and drug eluting LAM-CpTi on rat BM-

MSC differentiation.

11 | P a g e

Review of Literature

2.1. Titanium and biomedical applications

Over the past few decades, titanium (Ti) and it alloys have been used as implant

materials for biomedical applications (Park et al., 2010). The highly biocompatible nature

(Vega et al., 2008), the excellent mechanical properties and chemical stability (Lee et al.,

2009) of Ti makes it a perfect candidate to be used in biomedical implant applications.

Because of favorable nature of the mechanical and biocompatible properties of Titanium and

its alloys compared in relation with the biological characteristics and mechanical features of

bone, they showed as an excellent competition among the biomaterials for orthopedic and

orthodontic implants. However, most of the implant materials for clinical applications tend to

fail because of their poor surfaces characteristic that enable to support new bone growth and

this will lead insufficient bonding to juxtaposed bone (Ma et al., 2008), thus slow

osteoconductivity (Thian et al., 2006) and healing process. Numerous studies have shown

that the early events of bone healing around implants are related to their long-term clinical

success (Davies, 2003; Marco et al., 2005.

In recent years, great progress has been made in designing implants using metals,

ceramics and polymers. Comparing these three types of materials, the excellent mechanical

properties of metals make them the first choice as orthopedic implants to restore the load

bearing functions of the bone tissue. On the other hand, ceramics or polymers are frequently

used as parts in an integrated orthopedic implant system, such as bearing balls in artificial

joints, or coatings on the surface of metallic implants (Bauer et al., 2013, Hench, 1991).

Among the metallic implants, the routinely used implant materials are Ti and its alloys (Chen

and Thouas, 2015).

12 | P a g e

To achieve and promote the osteogenic induction osseointegration and

osteoconduction of implants materials for orthopedics various surface treatments have been

proposed and lately considerable attention has been focused on Ti surface modification

(Chang et al., 2009) such as plasma coating (Hauser et al., 2009 and Wei et al., 2008), etching

(Das et al., 2007) and anodization (Yu et al., 2009) to improve surface characteristic for

implant material. The objective of these surface treatments is to improve protein adsorption,

cell adhesion and differentiation and consequently, the tissue integration of titanium implants.

2.2. Commercially pure titanium

Commercially pure titanium (Ti CP) and extra low interstitial Ti-6Al-4V (ELI) are the

two most common titanium base implant biomaterials. These materials are classified as

biologically inert biomaterials. As such, they remain essentially unchanged when implanted

into human bodies. The human body is able to recognize these materials as foreign and tries

to isolate them by encasing it in fibrous tissues. However, they do not promote any adverse

reactions and are tolerated well by the human tissues. These metals do not induce allergic

reactions such as has been observed with some stainless steels, which have induced nickel

hypersensitivity in surrounding tissues.

Titanium is very light with a density of 4.5 g/cm3. The Ti CP is 98.9 - 99.6 % Ti,

being the oxygen content (and other interstitial elements such as C and N) the main element

influencing significantly its yield, tensile and fatigue strengths (Table 1). Interstitial elements

strengthen the metal through interstitial solid solution strengthening mechanism, with

nitrogen having approximately twice the hardening effect (per atom) of either carbon or

oxygen. Phase (HCP) below 882 ºC andPure Ti is an allotropic metal having hexagonal

phase (BCC) over that temperature. As its typical microstructuretransforming to a cubic is

a single alpha phase, cold work is also an applied strengthening mechanism.

13 | P a g e

It is very good biocompatibility is due the formation of an oxide film (TiO2) over its

surface. This oxide is a strong and stable layer that grows spontaneously in contact with air

and prevents the diffusion of the oxygen from the environment providing corrosion

resistance. It is a biomaterial with a high superficial energy and after implantation it provides

a favorable body reaction that leads to direct apposition of minerals on the bone-titanium

interface and titanium osseointegration.

2.3. Titanium and its structural modifications

The surface properties of Ti determine the initial protein adsorption, and subsequent

cell adhesion, cell-surface interactions and cell functions. A straightforward approach to

modify the surface chemistry of Ti is to introduce non-therapeutic or therapeutic molecules

on it (Alghamdi and Jansen, 2013). The non-therapeutic molecules are usually inorganic. One

example is the use of calcium phosphate on Ti, due to its compositional similarity to the

mineral phase of the bone (Goodman et al., 2013).

Surface modification of Ti with therapeutic molecules can enhance osseointegration

by providing biomimetic surfaces and acting like localized biochemical stimuli (Goodman et

al., 2013). These molecules are expected to alter the surface property of Ti to recreate the cell

microenvironment at the implant site (Morra, 2006, Tejero et al., 2014). For instance, ECM

components such as collagen and growth factors regulate osteoblast functions during bone

formation. They are good candidates for surface modification of Ti to induce specific

intrinsic osteogenesis directly at the bone-implant interface (de Jonge et al., 2008).

Out of the structural modification the quiet recent one is the production of porous

structures by additive manufacturing techniques as explained in detail work of Davies and

Zhen (1983) who outlined several methods of production for foamed metals. The porous Ti

structures have been manufactured for use in many applications using a powder metallurgy

route which presents a number of advantages, primarily the ability to shape complex

structures with tailored mechanical properties at low temperature as in the research work

14 | P a g e

conducted by Brenne et al. (2013) who studied the microstructure of additive manufactured

(AM) porous Ti and its impact on the mechanical properties.

2.4. Laser additive manufacturing of Titanium

Among the many additive manufactured techniques Dunand (2004) reviewed the

production methods of Ti foams by powder sintering and bubble expansion, Wadley

(2002) reviewed the development of periodic metallic porous structures and Singh et al.

(2010) looked at the additive manufactured methods to produce Ti scaffolds for biomedical

application. Thus making laser additive manufacturing (LAM) has been found to be a very

promising method in developing porous titanium for biomedical applications. This LAM

approach uses a computer aided design to direct a laser point that melts a powder bed of

titanium to directly build Ti structures with controlled porosity. LAM provides a continuous

connected pore network that is difficult to achieve using typical foaming methods such as

bubble foaming or space-holder foaming, which can form closed pores. LAM allows greater

control over the final structure of very complex interconnected strut designs to tailor pore and

strut sizes and therefore allows customization of the mechanical properties of a porous

structure.

2.5. Nanotubular structural modification of Titanium

Along with the macro porous structural modifications, the nanostructural modification

of is also an interesting area of research for biomaterial especially in the case of metals for

orthopedic implants. Nanometer-sized features control the adhesion and osteogenic

differentiation of cells (Dalby et al., 2007b; Le Guéhennec et al., 2007) but these results have

not been confirmed on titanium. It is therefore of great interest to study TiO2 nanotubular

surfaces in view of their biomedical effects. The Ti surface was modified to form self-ordered

layer of vertically oriented titanium dioxide (TiO2) nanotubes (NT) with diameters ranging

from 25 and 100 nm by anodization process (Lan et al., 2014). The results revealed that

15 | P a g e

proliferation and cytocompatibility of cells on vertically aligned TiO2 nanotube surfaces are

nanotubes diameter dependent.

It has been well acknowledged that the surface topography of Titanium nanometer

level can affect its integration with the host tissue (Gittens et al., 2013, Mendonca et al.,

2008, Shalabi et al., 2006, Wennerberg and Albrektsson, 2009). A review of surface

modification of Ti with micrometer and nanometer-scaled structure is given below. To

introduce microtopographon Ti, irregular micro features such as micro phases, micro pits and

microspores can be created using blasting, acid etching and anodization. On the other hand,

ordered micro features such as microgrooves can be created using photolithography (Nikkhah

et al., 2012). The microstructures on Ti enhance osteoblast functions in terms of adhesion,

alignment, proliferation, differentiation and/or mineralization in vitro (Cei et al., 2011, Lu

and Leng, 2003, Park et al., 2010, Park et al., 2013). In vivo, the microstructures direct the

development of proper interlocking of Ti with bone tissue, leading to improved bone-implant

contact (Cochran, 1999, Shalabi et al., 2006). Experiment driven results from in vitro and in

vivo investigations have concluded that micro topographies in the range of 1-10 μm is

optimal for orthopedic implants to maximize the physical interlocking to the host bone tissue

(Bauer et al., 2013). One limitation of the microstructures is that they are usually irregular

features, and the dimension of the features cannot be easily tuned or optimized by changing

reagents, or changing reaction or microfabrication conditions.

Titanium with nanostructures alters the chemical reactivity of Ti, and hence affects

the ionic or biomolecular interactions at the interface (Zhang et al., 2013, Zhao et al., 2010).

Since cell-surface interactions are based on integrins which also have nanostructures (8-12

nm), it can be predicted that cell-surface interactions will be affected by the nanostructures of

Ti (Cavalcanti-Adam et al., 2006, Minagar et al., 2012). Recently, different nanostructures

such as nanopits, nanopores, nanophases, NTs, nanopillars and nanodots have been created

16 | P a g e

on Ti to enhance osteoblast and MSC functions (Hong et al., 2014, Lavenus et al., 2011, Oh

et al., 2009, Sjostrom et al., 2009, Variola et al., 2008, Yu et al., 2010).

Nanotubular modification are one of the most established and characterized

nanostructures. Highly self-ordered tubular features can be formed on Ti surface with

dimensions which can be tuned by reagents and reaction conditions (Regonini et al., 2013).

Titanium nanotubes (TiNTs) can be prepared by anodization, where Ti is used as anode and

an inert metal (usually gold or platinum) is used as cathode in an electrolyte under constant

voltage. Different morphologies of NTs on Ti can be achieved by controlling the

experimental factors. These factors include type of electrolyte, concentration of electrolyte,

pH, reaction temperature, voltage applied, interelectrode spacing, duration of anodization,

and post reaction annealing (Minagar et al., 2012, Roy et al., 2011).

Numerous studies have reported NTs with diameter below 100 nm on Ti significantly

improve osteoblast and MSC functions, although there is no conclusive result on the optimal

dimension of the NTs on cell functions (Oh et al., 2009, Park et al., 2009, Yu et al., 2010).

For instance, Jin’s group reported that NTs with diameters of 70-100 nm on Ti enhanced the

differentiation of mouse osteoblasts significantly more than those with smaller diameters (20-

50 nm) in vitro (Brammer et al., 2009). The group also reported that NTs with diameter of 80

nm on Ti improved the bone bonding tensile strength compared with grit-blasted Ti in vivo in

a rabbit tibia model (Bjursten et al., 2010). For human MSCs (hMSCs), smaller diameter NTs

(~30 nm) on Ti were reported to promote adhesion but not differentiation, while larger

diameter NTs (~70-100 nm) on Ti induced osteogenic differentiation of hMSCs (Oh et al.,

2009).

On the other hand, Schumki’s group demonstrated that adhesion, proliferation and

differentiation of rat MSCs and human osteoblasts were maximally induced on NTs with

diameter of 15 nm on Ti. However, larger diameter (~100 nm) NTs impaired cell functions

on the TiNT substrate (Park et al., 2009, Park et al., 2007). The TiNT can be further modified

17 | P a g e

with non-therapeutic or therapeutic molecules to achieve a combined surface modification.

For instance, BMP-2 has been immobilized on the PDA-coated TiNT, and these results in

further enhanced osteogenic differentiation of hMSCs compared to those on TiNT in vitro.

(Lai et al., 2011).

2.6. Nanotubes and osteogenic induction potential

A nanotube with diameter of 25 nm seems to have high biocompatibility of epithelial

cells in comparison to 50 and 100 nm. Such results indicate that the surface nanostructure of

an implant is an important factor for surface cell adhesion and growth. In line with this result,

Zhao and co-workers (2013) observed 30 nm-diameter TiO2 nanotubes promotes the spread

of mesencymal stem cells (MSC) into polygonal osteoblastic shape. The TiO2 nanotubes

samples promote osteogenesis in absence of an extra osteogenic agent. A 30 nm-diameter

TiO2 nanotubes also generates big nodular alkaline phosphatase (ALP) product and induce

extracellular matrix (ECM) mineralization. However, two years ago, Zhao et al., (Zhao et al.,

2012) reported 80 nm-diameters of TiO2 nanotubes give best ability to simultaneously

promote MSC proliferation and osteogenic differentiation simultaneously.

In 2011, Choe has demonstrated that 50 nm-inner diameter of TiO2 nanotubes

provided good osseointegration such as cell proliferation, migration and differentiation (Choe

et al., 2011). Yang et al. suggested that surface treatment with nanotubular TiO2 surface

enhanced the early osteoblast response, such as cell spreading and cytokine release, which is

an important factor for subsequent cell functions and bone healing in vivo (Yang et al.,

2008a).

Previous studies by Brammer et al., demonstrate that nanotopography provided

nanoscale cue that facilitate cellular probing, cell sensing if more actin cytoskeletal filaments

formed lamellipodia and locomotive morphologies (Brammer et al., 2011b). Park’s group

also showed that adhesion, spreading, growth and differentiation of MSC are critically

dependent on the tube inner diameter (Park et al., 2007). Spacing between 15 – 30 nm

18 | P a g e

provided an effective length scale for accelerated integrin clustering/focal contact formation

and strongly enhanced cellular activities compared to smooth TiO2 surfaces. Cell adhesion

and spreading were severely impaired on nanotube layers with tube diameter larger than 50

nm resulting reduced cellular activity and experienced programmed cell death. So, Park’s

group suggested TiO2 nanotubes with 30 – 50 nm inner diameter represents critical

borderline for cell to survive (Park et al., 2007). The cell function altered if the inner diameter

of TiO2 nanotubes were less than 30 nm and more than 50 nm. The above-mentioned

findings are valid generally for the cell response to different topographical nanorough surface

and have an important impact on the design and composition of implant surfaces (Gongadze

et al., 2011).

2.7. Drug delivery using nanotubes

As the research conducted and reported by Popat et al., the surface of nanotube array

can help local delivery of antibiotics at the site of implantation, with demonstrated prevention

of bacterial adhesion while maintaining the osseointegrative properties of the nanostructured

surface. By controlling the nanotube length and diameter, drugs elution rates and amounts at

the implant site could be varied.

2.7.1. Simvastatin

Statins family including simvastatin are a category of potentially promising drugs for

treatment of osteoporosis. (Mundy et al.1999)found that statins promote new bone formation

in the calvarial bone of neonatal mice, and several studies have confirmed the discovery.

(Sugiyama et al.,2000)reported that both compactin and simvastatin increase the expression

of BMP-2 (bone morphogenetic protein-2) mRNA and protein in HOS (human osteosarcoma)

cells. Osteogenic effects of statins have also been found in other cell lines. Meanwhile,

animal tests have confirmed the osteogenic effects of statins. Recently, (Chuengsamarn et

al.2010)reported that statins promote bone formation and increase BMD (bone mineral

density) in patients with hyperlipidaemia. Other diseases, such as bone non-union or femoral

19 | P a g e

head necrosis may benefit from statins. In addition, statins decrease bone resorption by

inhibiting osteoclast differentiation and osteoblast apoptosis. Therefore statins may play an

important role in orthopedics owing to their regulatory effects on bone anabolism

2.8. Defects of titanium and its modification

Ti has been introduced for biomaterials applications because it owns some of the good

biocompatibility and high corrosion resistance. Yu et al. (2011) observed that 30 nm-diameter

TiO2 nanotubes had higher resistance of the barrier layer and lower passive current density (I

pass) compared to the smooth Ti. However, the relation within electrochemical corrosion

behavior of TiO2 nanotubes with cell-metal interaction was not reported. Indeed,

comprehensive corrosion behavior study and cell-metal analysis would able to determine the

best biomaterials implant.

The recent studies conducted reported that the increased hydrophilicity and protein

adsorption is important as it has been reported that cells are constantly in contact with

biomaterial surfaces that have previously adsorbed water and proteins from fluids rather than

with the bare surface. The cellular adhesion process begins with an attachment phase

dominated by van der Waals forces and is followed by an adhesion phase by anchoring to the

implant surface via fibronectin and vitronectin proteins to form focal adhesions at cell

membrane integrins. The spreading if fingerlike projections (filopodia) for increased

anchorage ensue. The effects of TiO2 nanotube diameter have also been investigated and it

has been reported that the optimal nanotube diameter for bone cell formation and activity is

on the order of 70 nm. In addition to in vitro studies of cellular responses to TiO2 nanotubes,

in vivo studies have also reported positive outcomes. Wang et al. investigated the effect of

anatase TiO2 nanotube diameter of implants on osseointegration in minipigs. The expression

of osteogenesis-related genes, such as alkaline phosphatase (ALP), was significantly

20 | P a g e

increased in comparison to a machined control. The highest levels of gene expression

occurred with the 70 nm nanotube implants.

Recently, surface topography such as TiO2 nanotubes have been shown to alter cell

behaviors such as adhesion, orientation, differentiation and migration significantly (Koo et

al., 2013). It is due to nanotubes topography that can provide more abundant topographical

cues similar to dimensional scale of bone collagen fibrils and elasticity resembling bones

(Wang et al., 2013). However, the dimensionality (diameter and length) of TiO2 nanotubes

on cell interaction is not well understood. In addition, there have been some inconsistencies

in the literature regarding the optimal size of TiO2 nanotubes for eliciting maximal adhesion,

proliferation and cell functionality (Moon et al., 2011; Rajyalakshmi et al., 2011; Lan et al.,

2013 and 2014). Therefore, in this research work the effect of diameter and length of TiO2

nanotubes on cell interaction were systematically studied.

Another factor attribute to the drawback of Ti as implant materials is TiO2 phases.

Among three different crystalline phases of TiO2, anatase phase is more favorable for cell

adhesion and proliferation due to lower surface contact angle (hydrophilic) and wet ability

(Koo et al., 2013). In contrast, high surface contact angle (the water contact angle is larger

than 90 °) lead to hydrophobic surface, which mimic biological surface such as lotus leaf

(Rosario et al., 2004). However, An and group reported that mixture anatase-rutile phase was

more favorable for cell interaction (An et al., 2011). Such contradicting outcomes among

research groups cause difficulty for researchers to select the best phase for implant materials.

Thus, in order to understand effect of crystal structure on cell interaction, considerable efforts

have been devoted to produce stable TiO2 nanotubes phase that suits cells interaction

requirement.

2.9. Cells for studying osteogenic potential

Besides, the selection of cells has also drawn an essential role in determining the cell-

metal interaction. Many cells cannot adapt and poorly survive in vitro or implanted in the

21 | P a g e

foreign body. This is because foreign material cannot interact properly with cells as they are

lack of ECM (Llopis-Hernández et al., 2011). Some efforts have been devoted in the

literature to correlate the surface properties to protein adsorption and cell adhesion (Wang et

al., 2012). There is still lack of understanding of the cell-metal interaction from an integrated

point of view that includes cell adhesion, cell viability and biocompatibility, adsorbed

proteins on the nanomaterials surface such as TiO2 nanotube arrays regarding their

dimensionality. The different cells been used in the literature (Ducy.et.al.,1997) also make the

analysis on the cell-metal interaction became more complicated. Therefore, detail study on

cell-metal interaction specifically on porous titanium surfaces and porous titanium with TiO2

nanotube arrays need to be done by using stem cell (bone marrow mesenchymal stem cells)

will be primary concern of this study. Bone marrow cells are well known for a good and main

available source of stem cell at the present time (Yang et al., 2004 a). It is also well ascribed

that MSC are best candidates for tissue engineering and cellular therapy of orthopedic

musculoskeletal tissues.

2.9.1. Bone marrow mesenchymal stem cells

MSCs are multipotent cells which can differentiate into mesenchymal lineages

(Pittenger. et al., 1999). It has been shown that recruitment of MSCs plays a crucial role in

bone repair (Milner et al., 2011), where local mobilization of MSCs occurs from both bone

marrow and periosteum. This local recruitment could be boosted by injection of culture-

expanded MSCs (Milner et al., 2011). MSCs have been found in a range of tissues, including

adipose tissue, bone marrow, periosteum, peripheral blood, placenta, skin, synovium, and

umbilical cord blood (De Bari et al., 2001;De Bari et al., 2006;Kassis et al., 2006;Pittenger et

al., 1999;Shih et al., 2005;Yen et al., 2005;Zuk et al., 2001). The minimal criteria to

characterize human MSCs are tri-lineage potential (adipogenic, chondrogenic and

osteogenic), adherence to plastic in culture, and surface expression of a set of defined

markers (Dominici et al., 2006). Although these minimal criteria apply to all MSCs

22 | P a g e

regardless of their different tissue origin, MSCs from various tissues appear to possess

different potential for osteogenic and chondrogenic differentiation (Im.et al., 2005).

By analysis its potential bone marrow derived mesenchymal stem cells (MSCs) have

been suggested as a suitable option for cell-based tissue engineering therapies. This is due to

their capacity for self-renewal and their ability to differentiate into numerous different tissue

types, such as bone, cartilage and fat. BMSC can be easily isolated from the marrow aspirate

based on their ability to adhere and grow on tissue culture plastics, and can reach up to 50

population doublings in culture. The quantity of stem cells initially isolated varies between

different patients and aspirate preparations, and reportedly declines with the patient age. It is

most likely that the mesenchymal stem cells from bone marrow aspirates, which drive the

normal bone remodeling and regeneration, are an excellent source of cells for bone repair.

Studies have shown that the cell culture substrate and the growth factors

supplemented to cell culture medium help maintain the differentiation potential of these cells

during expansion. The need to utilize the right cell phenotype for engineering of human

tissues is widely recognized, but the exact phenotypic characteristics are not always well

defined.

MSCs have been exploited primarily for their multipotential ability and the prospect

of differentiating them to bone and cartilage in vitro and in vivo poses them as a valuable tool

in skeletal tissue regeneration. Remodeling of bone is continuous throughout life in order to

maintain skeletal integrity and mechanical strength. Bone homeostasis is dependent on the

fine balance between bone producing cells (osteoblasts, derived from MSC) and bone

resorting cells (osteoclasts, derived from HSC) (Biel by et al., 2007). MSCs play a key role in

this process as they directly influence the rate at which osteoblasts are formed and mature

into osteocytes. However, under certain conditions, such as fractures and diseases including

osteoporosis, osteoarthritis and cancer, this balance is lost leading to poor bone healing and

reduced bone strength (Masi and Brandi, 2001). Furthermore, the associated connective

23 | P a g e

tissues including cartilage, tendon and ligament exhibit a limited regeneration capacity in

response to damage caused by trauma or disease. To address these issues, a variety of MSC

preparations have been assayed as novel cell-based therapies for the repair of damaged

skeletal tissues, including cranial bones and articular cartilage (Chang et al., 2004, Chang et

al., 2008). These MSC preparations are based on optimal numbers of MSC which are either

directly injected into the targeted site or cultured as explants in 2D and 3D cultures.

As reviewed by Boeuf. et. al., differences in chondrogenic potential could be caused

by the origin of the cells from different tissues, the isolation methods used to segregate cells,

or medium composition used to culture the cells. Likewise, osteogenic potential must be

influenced by these factors. Most studies have examined the osteogenic potential of implant

surfaces in vitro by using immature osteoblast or osteoblast cell lines (Dalby et al., 2006a;

Dalby et al., 2006b; Le Guéhennec et al., 2008a; Le Guéhennec et al., 2008b). However, the

first cells to colonise the surface after implantation, are mesenchymal stem cells (MSCs).

Peripheral MSCs are attracted into the peri-implant region by chemo-attractant molecules and

are able to migrate through the blood clot to colonise the implant surface (Caplan et al., 2006;

Caplan, 2009). MSCs are multipotent cells present in blood, bone marrow and other tissues at

low levels. Under the control of specific cues (e.g., cytokines, growth factors, or micro-

environment), MSCs have the capacity to differentiate into osteoblasts (Marinucci et al.,

2010), chondroblasts (Zannettino et al., 2008), myoblasts (Engler et al., 2006) and adipocytes

(Morganstein et al., 2010). The nature of the tissue around implants may well depend on the

differentiation of MSCs induced by their surface properties (Engler et al., 2006; Kassem,

2006; Protivínský et al., 2007; Lavenus et al., 2010). The first event after implantation is the

adsorption of blood proteins on the surface of the implant. The nature and conformation of

proteins on the implant are regulated by surface properties, in particular chemical

composition, wet ability and micro- and nanotopography (Cai et al., 2006; Protivínský et al.,

2007).

24 | P a g e

It has been shown that nanotopography does not only control protein adsorption, but

also cell morphology and adhesion (Yang et al., 2002; Zhao et al., 2007). In vitro experiments

have shown that cells can respond to their micro-environment (Curtis and Varde, 1964;

Engler et al., 2006). Other studies have demonstrated that nanotopography influenced cell

behavior (Curtis et al., 2001; Stevens and George, 2005; Dalby et al., 2007a; Dalby et al.,

2007b). Surface topography induced mechanical stress in the cytoskeleton that controls gene

expression and thus differentiation (Watson, 1991; Kilian et al., 2010; Olivares-Navarrete et

al., 2010). While the nature of cell adhesion and the degree of cytoskeletal tension are widely

accepted as affecting stem cell behavior, the precise role of nanotopography on the adhesion,

morphology and differentiation of cells has not yet been established.

2.10. Gene expression studies

RUNX2, one of the Runt-related transcription factors, has been characterized as the

principal osteogenic master gene. RUNX2 controls osteoblast differentiation and bone

formation by binding to the osteoblast specific cis-acting element (OSE2), which is located at

the promoter of osteoblast marker genes, such as collagen type I, OPN, bone sialoprotein and

OCN (Ducy et al., 1997). The osteogenic regulatory function of RUNX2 has been

demonstrated in vivo and in vitro in many studies in the last two decades (Harada and Rodan,

2003). RUNX2-deficiency in mice (RUNX2 ) results in a lethal phenotype due to the

complete lack of osteoblast activity and bone formation (Komori et al., 1997). The phenotype

in mice lacking only one allele of RUNX2 is identical to human ossification disease

cleidocranial dysplasia (CCD) and genetic analysis of CCD patients revealed that

heterozygous mutations of RUNX2 is the cause of the disease (Otto et al., 1997). Enforced

expression of RUNX2 in MSCs induce osteoblast specific gene expression, and increases

matrix mineralization in vitro.

Transplantation of the MSCs with overexpressed RUNX2 into skull defect mice

model results in an average of 85% osseous closure at four weeks, while controls with

25 | P a g e

scaffold only and with nontransduced MSC-scaffold constructs showed no defect healing

effect (Zheng et al., 2004). These data suggest RUNX2 expression is sufficient to promote

osteogenic differentiation and osteogenesis. However, transgenic mice with overexpression

of RUNX2 in osteoblasts showed osteopenia with multiple fractures which were enriched

with OPN and invaded by osteoclasts, although there was an absence of enhanced

osteoclastogenesis. Further examination of the transgenic mice revealed that mature

osteoblasts were diminished greatly, despite pre-mature osteoblasts expressing OPN

increasing in adult bone (Liu et al., 2001). These results indicate that the effect of RUNX2 on

osteogenic differentiation and bone formation is developmental stage-dependent, RUNX2

accelerates osteogenic differentiation at early stage and inhibits terminal differentiation at late

stage. Recent studies suggest RUNX2 not only guides MSCs osteogenic differentiation but

also plays regulatory roles in cell growth control. RUNX2 null cells exhibit a higher rate of

proliferation than wild type, and RUNX2 expression is regulated by the cell cycle with

maximum expression in G1 phase. Forced elevation of RUNX2 in preosteoblasts inhibits

their proliferation suggesting RUNX2 promotes cells to exit from cell cycle (Galindo et al.,

2005; Pratap et al., 2005). Further evidence was observed that RUNX2 targets at cyclin

dependent kinase (CDK) inhibitors p21 and p27; overexpression of RUNX2 resulting in

down-regulation of CDK, thus supressing progression into S-phase and promoting cell cycle

exit.

In summary, quiet few studies were conducted along these years and even the

conducted studies does not provide sufficient data regarding the osteogenic induction

potential of as laser additive manufactured commercially pure Titanium porous structures on

bone marrow mesenchymal stem cell and prove it as a biocompatible biomaterial for bone

tissue engineering or as an ideal orthopedic implant material. Even though many efforts have

been made by researchers to improve biocompatibility of titanium as an implant material by

developing TiO2 nanotubes, the effect of nanaotubular structural modification on laser

26 | P a g e

additive manufactured commercially pure porous titanium, there nanotubes dimensions,

structural topography changes, crystal structures and simvastatin drug incorporation studies

in relation to its biocompatibility and osteogenic potential in-vitro in bone marrow

mesenchymal stem cells are less reported. Therefore, in the present research those parameters

were studied.

27 | P a g e

Materials and Methods

3. Materials

3.1Chemicals

1 Alizarin red Sigma

2 Alpha minimal essential medium (α MEM) Gibco

3 Ammonium Fluoride (NH4F) Merck

4 Bovine serum albumin (BSA) Sigma

5 Cell culture flask (t25,t75) Thermo Fisher

6 Cell culture plate (12,24,48,96 wells) Thermo Fisher

7 Centrifuge tubes (1.5ml,2ml,5ml) Eppendorf

8 Cetyl pyridium chloride Sigma

9 Chloroform Merck

10 Cluster of differentiation 105(CD105) Abcam

11 Cluster of differentiation 90 (CD90) Abcam

12 Commercially pure Titanium (CpTi) Medical grade Four

13 Disodium hydrogen phosphate (Na2HPo4) Merck

14 Ethanol Merck

15 Falcon tubes (50ml,15ml) Eppendorf

16 Fluorescene di acetate (FDA) Sigma

17 Fetal bovine serum (FBS) Invitrogen

18 Glutaraldehyde Merck

19 Glycerol S.d.Fine-Chem

28 | P a g e

20 Isoamyl acetate Merck

21 Laser additive manufacture commercially pure Titanium (LAM-Cp-Ti)

22 Methanol Merck

23 Monopotassium phosphate (KH2Po4) Merck

24 Osteogenenic differentiation medium Gibco

25 Para formaldehyde Merck

26 PCR tubes Eppendorf

27 Penicillin-streptomycin Sigma

28 Phosphate Buffered Saline Invitrogen

29 Pnpp substrate Sigma

30 Potassium Chloride (KCl) Merck

31 Primers Integrated DNA Technologies

32 Propidium iodide (PI) Sigma

33 RNA’s away Invitrogen

34 RT PCR kit Eurogentec

35 Silver nitrate Sigma

36 Simvastatin Sigma

37 Sodium bicarbonate (nahco3) Merck

38 Sodium chloride (Nacl) Merck

39 Sodium hydroxide (Merck, India) Merck

40 Syber green Kappa Biosystems

41 Thiazolyl Blue Tetrazolium Blue (MTT) Sigma

42 Trichome stain kit Sigma

43 Tris hydrochloride ( tris-hcl) Sigma

44 Triton X-100 Sigma

29 | P a g e

45 Trizol Merck

46 Trypsin EDTA (Sigma) Sigma

47 Ultra pure water Invitrogen

48 β-Actin Sigma

2.1.1. Primers

No Oligo Name 5'<-----Sequence----->3' Length

1 OCN forward CAGTAAGGTGGTGAATAGACTCCG 24

OCN reverse GGTGCCATAGATGCGCTTG 19

2 COL-1 forward GGTCCCAAAGGTGCTGATGG 20

COL-1 reverse GACCAGGCTCACCACGGTCT 20

3 GAPDH forward GGCAAGTTCAACGGCACAGT 20

GAPDH reverse GCCAGTAGACTCCACGACAT 20

4 RUNX2 forward GCTTCTCCAACCCACGAATG 20

RUNX2 reverse GAACTGATAGGACGCTGACGA 21

5 OPN forward GACGGCCGAGGTGATAGCTT 20

OPN reverse CATGGCTGGTCTTCCCGTTGC 21

30 | P a g e

3.2. Methods

3.2.1. Laser Additive Manufactured Commercially Pure Titanium (LAM-

Cp-Ti)

Discs of Laser additive manufactured commercially pure Titanium (LAM-Cp-Ti) was

obtained from bar stock modified by Raja Ramanna Centre for Advanced Technology

(RRCAT) with a diameter of 3 mm. Subsequently, discs were subjected to ultra sonic

cleaning and were autoclaved at 121°C for 10 minutes.

3.3 Anodization

Nanotubes of TiO2 were grown on polished LAM-Cp-Ti substrates by

electrochemical anodization. The cleaned samples were chemically etched in 1:1 V/V HNO3

and HF. The electrolyte for anodization was based on glycerol and deionised water in a 1:1

weight ratio. 0.5 Weight % NH4F was added to the glycerol–water system kept at 25 °C and

magnetically stirred at 700 rpm for 2 h prior to anodization to ensure the complete and

homogeneous mixing. A polished and cleaned sample of titanium was used as the cathode,

while the chemically etched Ti substrate was placed as anode at 4 cm apart from cathode.

Anodization was performed at a constant voltage of 20 V with continuous magnetic stirring

for 30 min and then rinsed with deionised water. The anodized samples were then heat treated

at 450 °C for 2 h in ambient atmosphere as it is known to help crystallization of TiO2.

3.4 Surface characterization

Each Test material sample was analyzed using field emission scanning electron

microscopy (FE-SEM) (JSM-7001F) in Indian Institute of Science Education and Research

31 | P a g e

(IISER). Environmental scanning electron microscopy (ESEM) Quanta FEI, Hillsboro, USA.

The topography, Naotubular length, diameter, pore size of the scaffolds were analyzed from

ESEM micrographs using image analysis software (Image J, National Institutes of Health,

USA).

3.5 Preparation of Simvastatin solution

1mg of Simvastatin is dissolved in 1 ml absolute ethanol and transferred to a brown

bottle. 1 ml eppendorf tubes and stored in -20°C.

3.6 Loading of Simvastatin Drug and elution study

The Simvastatin loading was carried out by dipping coating and vacuum drying

process.NT- LAM-Cp-Ti discs were soaked under vacuum for 15 min in Simvastatin (200µg)

and then dried under vacuum after taking out from the Simvastatin solution. Kinetic release

measurements were performed on drug coated NT-LAM-Cp-Ti discs. Each disc was soaked

in a solution of 3 ml phosphate buffer (pH 7.2) and maintained at 37 °C. 3 ml of the aliquots

was sampled periodically up to 14days for UV Spectrophotometer analysis. 3 ml of freshly

prepared phosphate buffer was added after each sampling for further elution. The cumulative

amount of Simvastatin released was determined with ultraviolet–visible spectrophotometer

(Cary 50, Varian, and Australia) at 238 nm. Discs were weighed before and after drug

loading.

3.7 Fourier Transform Infrared spectroscopy analysis

Simvastain stock solution (1mg/ml concentration in 99.99% Ethanol),200µg of drug

aliquot and elution sample drug from drug loaded NT-LAM-Cp-Ti were subjected to Fourier

Transform Infrared (FTIR) spectroscopy analysis using Thermo Nicolet 5700 FT-IR with

32 | P a g e

Diamond ATR Accessory. The spectra were taken in the frequency range of 4000-400cm-1

and the resultant peaks obtained were analyzed.

3.8 Isolation and culture of rat BM-MSC

Mesenchymal Stem Cells was isolated from bone marrow stroma of 3 month old male

Sprague Dawley rats (140 –160 g). Animals were used with prior approval of Institute

Animal Ethics Committee. Rats were euthanized by CO2 asphyxiation and femurs were

collected in PBS containing antibiotics. The femur was cut at epiphysis level using a bone

cutter (Figure: 1) and the marrow was flushed out with minimal essential medium (αMEM)

containing antibiotic using a syringe connected with 20G needle. The flushed out marrow

was pipetted few times and was centrifuged at 600g for 10 min. The pellet was collected and

resuspended in fresh αMEM supplemented with 10% FBS and antibiotics. The cell

suspension was transferred to T25 culture flask and the culture was left undisturbed inside a

CO2 incubator set at 37C/5% CO2 for three days. The first medium change was done on

third day on every third day. The culture was maintained in αMEM supplemented with

10% FBS and antibiotics and sub cultured using Trypsin-EDTA up to two passages. The

cells at second or third passage were used for experiments.

3.9 MTT assay

The cytotoxicity was evaluated by the colorimetric MTT assay. LAM-Cp-Ti samples

were loaded with rat BM-MSC onto 96 well plates at a density of 104

cells/ml. The plate was

incubated for 24 h at 37ºC with 5% CO2. On day 2, the medium was replaced with scaffold

extract and incubated for 24 h at 37ºC with 5% CO2. On day 3 the material extract was

removed and the cells were incubated with 5 mg/ml MTT solution for 3 h and the viability of

33 | P a g e

cells were determined by measuring the Optical Density (OD) with the use of a micro plate

reader (ASYS UVM 340) at 540 nm. Phenol was used as the negative control. Percentage cell

viability was calculated using the formula:

Percentage cell toxicity = (Sample absorbance – cell free sample blank)/Mean media

control absorbance.

Figure: 1: Showing the collection of Femur from the Rat for Isolation of Rat BM-MSC

34 | P a g e

3.10. Live-dead staining of rat BM-MSC on NT-LAM-Cp-Ti

The viability of cells cultured on NT-LAM-Cp-Ti was qualitatively assessed using

live-dead staining. The scaffold along with the cells was incubated with Fluorescene di

acetate (FDA) (in FBS free media) for 5 minutes in dark. Then 100µl of propidium iodide

(PI) was added and incubated with 10 minutes. It was then washed in PBS and observed

under Nikon fluorescent microscope. FDA stains live cells green and PI stains dead cells red.

3.11 Characterization of rat BM-MSC

The cells (3rd

passage) were cultured on cover slips for 24 hrs; fixed with 4%

paraformaldehyde (w/v) in PBS (pH 7.4) for 10 min at room temperature; permeabilised with

0.1% Triton X 100 for 1 min at room temperature (permeabilisation step was avoided for the

staining of membrane markers) and blocked with 1% BSA. The slides were incubated with

primary antibodies, phalloidin-FITC, CD90 and mouse CD105 to stain the cytoskeletal

proteins such as actin and cell membrane markers CD90 and CD90 respectively at 4ºC

overnight. The nucleus was then stained with Hoechst 33258 (10µg/ml) and mounted on a

glass slide. The images were captured under Inverted fluorescence microscope (Olympus

IX71).

3.12 Multilineage differentiation of rat BM-BMSC

In order to investigate the potential of rat BM-MSC to differentiation into adipocytes,

and osteocytes, the cells were seeded at 104

cell/ml density onto a 4-well culture plate and

incubated with αMEM containing 10% FBS until the cells became confluent. The medium

was then replaced with adipogenic differentiation medium for 7 days. The medium was

changed every 2 days. On day 7 of differentiation, adipogenesis were detected by Oil Red O

positive staining of lipid droplets in the cells. The osteogenic differentiation of BM-MSC was

35 | P a g e

performed by culturing in osteogenic induction medium for 21 days. The medium was

changed every 2 days. On 21 day of differentiation cells were detected by Alizarin Red S for

calcification and Von Kossa positive staining of mineralisation in cells.

3.13 Cell adhesion assay

Rat BM-MSC attachment to the LAM-Cp-Ti, nanotubular modified and drug coated

discs was initially evaluated ESEM. After seven days of culture when the cells are attached to

the Titanium substrates cells are fixed. Nonadherent cells were removed by gentle rinsing

with phosphate-buffered saline (PBS). Adherent cells were fixed with 1% (w/v)

gluteraldehyde for 30 minutes followed by dehydration using 30%, 50%,70%,90%and 100%

ethanol for 15 minutes each with 2 changes. Later critical point drying is done after dipping

the discs in isoamyacetate for 5-10 minutes followed by gold coating.

3.14. Osteogenic study

The osteogenic property of LAM-CP-Ti was evaluated by checking the differentiation

of Rat BM-MSC to osteogenic lineage.

The rat BM-MSC monolayer at passages 1 or 2 was sub cultured to 12 well plate at a

density of 3 × 104 cells per well. The cells were allowed to form monolayer. The test

materials were placed carefully over the cells and maintained the culture for 21 days. MSC

cultured in commercially available osteogenesis differentiation medium was considered as

positive control. Negative control received αMEM. The triplicate test and control cells were

maintained at 37C in a CO2 incubator set at 95% relative humidity and 5% CO2) with media

change on every 3 days. The morphology and cell growth was monitored under inverted

phase contrast microscope (Leica DMI 6000M).

At 7, 14 and 21 days test and control cells were evaluated for the following

Alkaline Phosphatase Assay

36 | P a g e

Calcium deposition (Alizarin Red S and von Kossa staining)

Collagen staining (Masson’s Trichrome staining)

3.14.1 Alkaline Phosphatase Assay (ALP)

At 7, 14 and 21 days, cells from duplicates of test, negative control and positive

control were rinsed with PBS and lysed for ALP assay. Cells were scrapped off and collected

in lysis buffer (25 mM Tris and 0.5% (v/v) Triton X-100 (pH 7.4). The cell suspension

pipetted vigorously and stored at -80C until used for ALP estimation.

ALP activity was measured according to protocol. Standards reagents were prepared

from known concentrations of p-nitrophenylphosphate ranging from 50 to 800 mM. The

following reagents were freshly prepared and mixed sequentially within pre labeled wells of

96 well plates.

Reagent Standard Test

Cell lysate - 80 l

Working Buffer (5 mM MgCl2 and 0.5 M 2-amino-2-methyl-1-

1-propanol)

100 l 20 µl

Substrate solution (5 mM p-nitrophenylphosphate) 100 l 100 l

The plate was incubated for 1 h at 37C and the reaction was stopped by adding

100µL of 0.3 M NaOH to all wells. The absorbance was measured at 405 nm using a micro

plate reader (Biotek, USA).

3.14.2. Special Staining

Confirmation of osteogenenic property of LAM-Cp-Ti was done by Von Kossa and

Alizarin Red S staining. At 7, 14 and 21 days, test material was removed and the test,

negative control and positive control cells were fixed with 4% paraformaldehyde.

37 | P a g e

A. Von Kossa staining

Von Kossa method indirectly identifies the presence of calcium deposits or salts by

transforming calcium salts into metal salts in the presence of silver nitrate solution. The fixed

cells were exposed to 5% silver nitrate solution under ultra violet light for 30minutes. The

secretion of calcified ECM was observed as black nodules with von Kossa staining.

B. Alizarin Red S staining

The fixative was removed and cells were rinsed with PBS. 1 ml of 2% (pH 4.1)

Alizarin Red S was added to each well and incubated at room temperature for 20 min. The

stain was removed and cells were washed thrice with deionised water.

C. Collagen staining

The differentiation of MSC to osteoblastic lineage was analyzed by collagen

deposition by using Masson’s trichrome staining. The cells were fixed overnight in Bouins

fixative and rinsed with deionised water until yellow color is removed. The cells were

stained with Harry’s Iron Hematoxylin Solution for 5 min followed by Biebrich Scarlet-Acid

Fucshin for 5min. The cells were then treated with Phosphotungstic-Phosphomolybdic Acid

Solution followed by Aniline Blue Solution for 5 min each. The cells were exposed to 1%,

acetic acid for 2 min and then viewed under light microscope for collagen deposition.

3.14.3 Osteogenic gene expression study.

The gene expression pattern of differentiated MSC to osteoblastic lineage in the

presence of test samples was analyzed and compared with negative and positive control.

Total RNA was extracted from test, negative control and positive control at 7, 14 and

21 days using trizol reagent. The cell lysate in trizol was mixed thoroughly and kept at -80

C until used. RNA was isolated at 4C by phenol-chloroform and isopropanol method. The

RNA precipitate was dissolved in RNase free water and quantified spectrophotometrically

(Biophotometer, Eppendorff). The cDNA was synthesized using reverse transcriptase kit

38 | P a g e

according to the manufacturer’s instruction. The cDNA was amplified by Polymerase Chain

Reaction kit (Eurogentic RT-PCR-Kit) based on the product instructions. The specific

primers were used for the gene expression studies include Osteopontin (OPN), osteocalcin

(OCN), Runt related transcription factor2 (RUNX2) and collagen type I(COL1).

3.15. Statistical analysis

The quantitative results are represented as mean ± standard deviation and were

statistically assessed using two - way analysis of variance using graph pad prism software.

39 | P a g e

Results and Discussion

3. Results

3.1 Material Characterisation

3.1.1. Structure analysis of LAM-Cp-Ti

The topography and microstructure of laser additive manufactured Titanium porous

structures (LAM-Cp-Ti) had a uniform pattern (Figure: 2), the surface seemed to be rough

and consisted of pores. The macro pores are visible throughout the disc with varying size

ranging from 50 µm to 200 µm in diameter. Commercially pure Titanium (Cp Ti) surface

remained uniform and smooth (Figure: 3).

Figure: 2: ESEM image of the porous LAM-CpTi showing its topographic microstructure

The LAM-Cp-Ti discs exhibits a three-dimensional spatial structure. When observed

Under 50X magnification, pores are visible on the material surface and are evenly distributed

and interconnected. The trabecula between the pores is rough, presenting a micro pore

40 | P a g e

structure. A clear grading in the porosity from front to back in the test LAM-Cp-Ti has been

observed.

Figure: 3: ESEM image of the CpTi showing its topographic microstructure

3.2. Nanotubular structural modification

3.2.1 Effect of electrolyte, Voltage and time in formation of nanotubes

The Titanium oxide nanotubes formed on porous LAM-Cp-Ti are round edged

cylindrical structures. While hexagonal edged cylindrical tubes are formed on Cp-Ti. The

Field emission scanning electron microscope (FESEM) images of the nanotubular structures

formed on the porous LAM-Cp-Ti and Cp Titanium clearly shows the structural topography

difference (Figure:4). The lengths of nanotubes obtained are in the range of 100 nm to 400

nm and diameter ranges from 50 nm to 130 nm. The ESEM images clearly shows the

cylindrical Titanium oxide nanotubes formed with different lengths and diameter (Figure: 5).

Nanotubular structures in the LAM-Cp-Ti formed with 10V and 20V had a distinct porous

structures (Figure: 6)

41 | P a g e

Figure: 4: FESEM images showing the difference of nanotubular structures on the Cp Ti

(A) and porous LAM-Cp-Ti (B)

A

B

42 | P a g e

Figure: 5: ESEM images Showing the length (A) and diameter (B) of nanotubular

structures on the porous LAM-Cp-Ti

A

B

43 | P a g e

Figure: 6: FESEM images showing the nanotubular structures formed on the porous

LAM-Cp-Ti in 20V and 10V.

B

A

44 | P a g e

3.3. Simvastatin drug loading

3.3.1. Incorporation of Simvastatin into Nanotubes of LAM-Cp-Ti

The average of the weight before drug loading is 0.1182 ± 0.00121g and the average weight after

drug loading is 0.0189± 0.001212g.

3.3.2. Fourier transform infrared spectroscopy (FTIR) analysis of

Drug elution

There was no significant difference in the FTIR spectra of pure drug and the elution

samples of NT-LAM-Cp-Ti discs carrying Simvastatin. The physical mixture eluted from the

nanotubular structures showed the same spectral range like that of the pure drug. All major

peaks of Simvastatin is observed at wave numbers 3185.83 (Free O – H stretching vibrations)

and 2968.87 and 884.02 (Alkene C – H stretching vibrations), with combination of 1380.78

(C- H bending), 1274.72 (C- O- C asymmetric stretching) are retained in the eluted sample

mixtures from the nanotubes (Figure: 7-9)

Figure: 7: FTIR spectra of Simvastatin dissolved in ethanol in 1mg/ml concentration

45 | P a g e

Figure: 8: FTIR spectra of 200µg of Simvastatin ethanol mixture sample

Figure: 9: FTIR spectra of eluted mixture sample containing Simvastatin from nanotubes

on LAM-Cp-Ti.

3.3.3 The morphology of the Simvastatin loaded NT-LAM-Cp-Ti

The drug loaded NT-LAM-Cp-Ti ESEM image showed the presence of drug in the

surface covering the entire nanotubular surface (Figure: 10A). The ESEM images of the

control disc treated with ethanol alone showed nanotubular structures (Figure: 10B). The disc

loaded with ethanol clearly showed the nanotubular structures while the drug loaded disc

surface is entirely covered with drug and nanotubular structure could not be seen.

46 | P a g e

Nanotubular structure is seen in the disc after elution which is evident in the ESEM analysis

(Figure: 11).

Figure: 10: ESEM image showing the drug loaded (A )and ethanol (B)alone NT-LAM-CP-Ti disc

A

B

47 | P a g e

Figure: 11: ESEM image A and B showing the drug loaded disc after elution

A

B

48 | P a g e

3.4. In-vitro Simvastatin drug release study

3.4.1. UV-Spectroscopy analysis of drug elution

When in-vitro Simvastatin release study from drug loaded NT-LAM-Cp-Ti was

performed in PBS of 7.3 pH at 37°C. The release profiles of Simvastatin from drug-loaded

NT-LAM-Cp-Ti show a specific release pattern (Figure 12). A typical two-phase release

profile was observed, which indicates that there was a relatively rapid initial release of the

drug followed by a sustained and slow release of the drug over a prolonged period of time of

15 days (Figure:13)

In NT-LAM-Cp-Ti loaded with 200µg of Simvastatin solution, an increased release of

around 30µg was detected initially in day one followed by a steady release of the

incorporated drug was noted in the next three days, respectively. During the fourth, fifth and

sixth days the release of drug were similar to each other but greater than the previous three

days. After sixth day the release became less till eight and increased during the ninth and

moreover remained similar till fifteenth day. A total cumulative release of 40µg was detected

in total of 15 days except the burst release during the first day.

Figure: 12: The release profile of Simvastatin (SV) from drug-loaded NT-LAM-Cp-Ti

0

1

2

3

4

5

6

0 24 48 72 96 120 144 168 192 216 240 264 288 312 336 360

Am

ou

nt

of

dru

g re

leas

ed

(µ

g/m

l)

Time (h)

49 | P a g e

Figure: 13: The cumulative release profiles of Simvastatin (SV) from drug-loaded NT-

LAM-Cp-Ti

3.5. Rat Bone marrow mesenchymal Stem cells (BM-MSC)

3.5.1. Culture of rat BM-MSC

Most of the cells were still mononuclear during first day of the culture. On the second

day, some spindle-shaped cells appeared among the mononuclear cells followed by the

increase in the spindle-shaped cells on the third day. On fourth day, the spindle-shaped cells

reached about 70% confluence and the cell growth was slower in the flasks. After the cells

reached 100% confluence, they were splited and passaged. On Passage three, the cells had

uniform fibroblast-like morphology. Approximately a count of about 4 × 107–1 × 108 BM-

MSCs from one rat bone marrow was detected in passage three. During the period of cell

culture the cells seemed healthy and proliferating. The BM-MSC showed steady growth

during the period of subculture (Figure: 14)

0

5

10

15

20

25

30

35

40

45

0 24 48 72 96 120 144 168 192 216 240 264 288 312 336 360

cum

ula

tive

re

leas

e µ

g/m

l

time (h)

50 | P a g e

Figure: 14: Inverted phase contrast images (A& B) showing the cultured Rat BM-MSC

A

B

51 | P a g e

3.5.2. Characterisation of Rat Bone Marrow Mesenchymal stem cells

3.5.2.1. Direct Immunofluorescence staining

MSC showed CD90, CD105 with positive staining throughout the cell surface, but the

strongest staining was detected near the nucleus. Spindle cells from extended BM-MSC

cultures appeared elongated, elastic morphology and fibroblast-like appearance with oval

vesicular nuclei. The positive staining obtained by CD 90 (Figure: 15) and CD 105 (Figure:

16) were alike. But CD 90 was expressed by all cells while CD 105 was restricted to some

cells and in the case of CD 90 there was also a clear difference in levels of expression

between cells, with some cells much brighter than others.

3.5.2.2. Cytoskeleton staining

The fixed rat BM-MSC showed prominent cytoskeletal structures of βactin filaments.

Immunofluorescence staining showed actin cytoskeleton organization with highly dynamic

network composed of actin polymers .DAPI stain showed the predominant nucleus on cells.

Both temporally and spatially arranged actin filaments are identified with orientational

distribution of actin filaments within a cell and no disruptional formations of cytoskeletal

actin filaments were identified (Figure: 17).

52 | P a g e

Figure: 15: Fluorescence microscope images showing Immunostaining of mesenchymal


DAPI

CD90

Merged

DAPI

CD90

Merged

53 | P a g e

Figure: 16: Fluorescence microscope images showing Immunostaining of mesenchymal


DAPI

CD105

Merged

54 | P a g e

Figure: 17: Nuclei are stained blue with DAPI, and βactin filaments are labelled with β

Actin. The merged images showing the cell with nucleus is depicted above

DAPI DAPI

βactin βactin

merged merged

55 | P a g e

3.6. Cytocompatability of LAM-Cp-Ti

3.6.1. Direct contact test

3.6.1.1. Rat BM-MSC culture with porous LAM-Cp-Ti

During first day, the Rat BM-MSC’s where first attached to the plastic base of the

culture plate. After one day by BM- MSC cultured with porous LAM-Cp-Ti began to adhere

to the edges of the disc. In addition, cells of different sizes were dispersed on the bottom of

the culture plates, with cell processes exhibiting elongated spindle shapes. The number of

cells adhering to the edge increased and the cells proliferated rapidly between the next few

days, aggregating and fusing into flakes. Monolayer of cells was formed in the bottom of the

wells after seven days (Figure: 18). Proliferation rate was comparatively high. No

morphology change or apoptosis was identified. BM-MSC seemed fully growing and

adhering into the margins of the disc without any restrictions. (Figure: 19).

Figure: 18: Inverted phase contrast micrographs showing the monolayer of MSC on the

bottom of the well

56 | P a g e

Figure: 19: Inverted phase contrast micrographs showing the adherence and growth of MSC

on the marginal area of the LAM-Cp-Ti discs.

3.6.2. Cell Adhesion studies

3.6.2.1. Rat BM-MSC culture on porous LAM-Cp-Ti

ESEM micrographs have revealed that the porous LAM-Cp-Ti had numerous

micropores. Further evaluating the disc for the study of the cellular adhesion and proliferation

of mesenchymal stem cells in the macro pore regions of the LAM-Cp-Ti disc. Disc cultured

in mesenchymal stem cells for 7 days was fixed and studied using ESEM. A small number of

mesenchymal stem cells with varying morphologies were sparsely arranged on the surface of

the LAM-Cp-Ti disc samples (Figure:20).The result also showed the filopodial extension

connecting cells between macro pore structures and movement of BM-MSC interlocking

each other from the macro pore margins (Figure:21)

57 | P a g e

Figure :20: ESEM images showing the adherence and growth of MSC on the surface (A)

and macro pore (B) of the LAM-Cp-Ti discs

Figure :21: ESEM images showing the extending filopodia connecting macro pore margins

(A)and growth of MSC inside macro pore of the LAM-Cp-Ti discs(B)

A B

A B

58 | P a g e

3.6.3. Differentiation potential of rat BM-MSC

3.6.3.1. Osteogenic and Adipogenic potential of rat BM-MSC

When subjected to osteogenic and adipogenic media, the cultured rat BM-MSCs

developed calcification and lipid droplets. Von Kossa (Figure: 22). and alizarin red staining

(Figure:23) showed a good amount of calcification of cultured rat BM-MSC and oil droplets

were found concentrating on the rat BM-MSC cultured in adipogenic media. High

calcification is visible in Alizarin red staining. Small concentrated lipid droplets are seemed

scattered in the cell surface when oil red staining (Figure: 24) was done. Oil droplets are

evenly distributed throughout while the calcification seemed to be concentrated to a specified

area. A continuous mineralisation was detected by von Kossa staining.

59 | P a g e

Figure: 22: Von Kossa staining of BM-MSC showing Mineralisation

Figure: 23: Alizarin Red staining of BM-MSC showing calcification

Figure: 24: Oil red O staining of BM-MSC showing oil droplets

60 | P a g e

3.6.4. Rat BM-MSC cultured on NT-LAM-Cp-Ti

3.6.4.1 Cytoskeleton staining

The rat BM-MSC grown on the NT-LAM-Cp-TI showed prominent cytoskeletal

structures of actin filaments in βactin- DAPI staining. Immunofluorescence staining showed

actin cytoskeleton organization with highly dynamic network composed of actin polymers.

DAPI stain showed the predominant nucleus on cells. Both temporally and spatially arranged

actin filaments are identified with orientational distribution of actin filaments within a cell

and no disruptional formations of cytoskeletal actin filaments was identified. Cells are seen in

large numbers and small in size throughout the disc surface. (Figure: 25).

3.6.4.2. Live-Dead assay

High rate of cell viability is found on the NT-LAM-Cp-TI and cells seemed to be

proliferating. Some co-aggregation of cells can be spotted in specific areas over the disc and

the proliferation, adhesion and viability. An effective experiment was done using BM-MSC

on nanotubular surface. Fluorescence microscope showed the high rate of cell spreading

across the disc increasing the cell density and cells seemed to retain their shape (Figure: 26).

.

4.6.4.3. Morphology and adherence

Rat BM-MSCs cultured on the NT-LAM-Cp-TI showed that the cells are spreaded,

proliferated and attached to the nanotubular surface. The number of cells on nanotubular

surface was significantly higher in comparison to the cells adhered to Cp Ti (Figure: 27).

Importantly, the cells incubated on Titanium nanotubes (TNT) attached to the surface and

started to form filopodia and formed aggregates (Figure: 28) partially and fully coating the

61 | P a g e

nanotubular surface. The cells also presented abundant filopodia and intercellular connections

(Figure: 29)

Figure: 25: Nuclei are stained blue with DAPI,, and actin filaments are labelled with β

Actin. The merged images showing the cell with nucleus is depicted above. Cytoskeletal

staining of BM-MSC grown on NT-LAM-Cp-TI

DAP

I

βactin

merged

DAP

I

βactin

merged

62 | P a g e

Figure: 26: live dead assay of the BM-MSC grown on the surface of NT-LAM-Cp-TI

Figure: 27: ESEM images showing the difference in population of BM- MSC on porous

LAM-Cp-Ti (A) and nanotubular surface of LAM-Cp-Ti discs (B)

A B

63 | P a g e

Figure: 28: ESEM images showing the aggregation of MSC on nanotubular surface of

NT-LAM-Cp-Ti discs

Figure: 29: ESEM images showing the filopodia of BM-MSC extending into the

nanotubes formed on the NT-LAM-Cp-Ti

3.7. Osteogenic study of LAM-Cp-Ti

3.7.1. Special Staining

When cells cultured for 7, 14, 21 days with LAM-Cp-Ti are subjected to

mineralization staining Von Kossa and Alizarin Red S method indirectly identified the

presence of calcium deposits starting from the day 7 itself even though the rate of calcium

64 | P a g e

deposits were very less compared to the positive control, gradual change and increase in the

calcium deposition was found from 7 towards the 21st day. Collagen deposition was detected

in an average basis by using Masson’s Trichrome staining during the 7th, 14th and 21st day

respectively (Figure 30-38)

Figure: 30: Alizarin Red staining of BM-MSC cultured with LAM-Cp-Ti showing

calcification during 7th day. Negative control (A), Positive control (B), BM-MSC cultured

with cultured with LAM-Cp-Ti(C)

A

B

C

65 | P a g e




C

B

A

66 | P a g e


calcification during 21st day. Negative control (A), Positive control (B), BM-MSC cultured


C

B

A

67 | P a g e

Figure: 33: Trichome staining of BM-MSC cultured with LAM-Cp-Ti showing collagen

during 7th day. Negative control (A), Positive control (B), BM-MSC cultured with cultured

with LAM-Cp-Ti(C)

C

B

A

68 | P a g e


during 14th day. Negative control (A), Positive control (B), BM-MSC cultured with

cultured with LAM-Cp-Ti(C)

A

B

C

69 | P a g e


during 21st day. Negative control (A), Positive control (B), BM-MSC cultured with

cultured with LAM-Cp-Ti(C)

A

B

C

70 | P a g e

Figure: 36: Von Kossa staining of BM-MSC cultured with LAM-Cp-Ti showing



A

B

C

71 | P a g e




A

B

C

72 | P a g e


calcification during 21st day. Negative control (A), Positive control (B), BM-MSC

cultured with cultured with LAM-Cp-Ti(C)

A

B

C

73 | P a g e

3.7.2. Alkaline phosphatase assay

In the presence of induction medium, cells seeded with the unmodified LAM-Cp-Ti

underwent osteogenic differentiation. When the result where analysed all cells acquired the

mesenchymal morphology and up regulated alkaline phosphatase activity. Alkaline

phosphatase assay was done in MSC in duration of 7, 14 and 21 days in osteogenic medium

and continued to increase in intensity over 21 days. The MSC rapidly produced alkaline

phosphatise. (Figure: 39).

Figure: 39: Graph showing the ALP activity of the cell culture with LAM-Cp-Ti 7, 14

and 21 days respectively. Negative control (NC), Positive control (PC)

0

50

100

150

200

250

7 14 21

ALP

act

ivit

y in

µM

/30

00

0ce

lls

ALP of LAM-Cp-Ti

Ti

NC

PC

Days

74 | P a g e

3.7.3. Osteogenic Gene expression study

Osteogenic gene expression by LAM-Cp-Ti, and the modified nanotubular surface

and the Simvastatin loaded disc showed up and down regulation of differentiation genes on

the Rat BM-MSC. The up regulation of the major differentiation genes such as OPN, OCN,

and COL1 was observed throughout during 7th day as well as 14th day along with the down

regulation of the RUNX2 respectively. This up and down regulation showed that the

maturation protein genes including the OPN and OCN are expressed by the BM-MSC

showing differentiation into osteogenic lineage. The down regulation of RUNX2 confirmed

that the BM-MSC are losing their stemness and differentiating. (Figure: 40)

Figure: 40: Graph showing the relative gene expression on the 7th and 14th day analysis

-15

-10

-5

0

5

10

15

20

25

7th DAY 14th Day

Re

lati

ve e

xpre

ssio

n o

f G

en

es

COL

OPN

RUNX2

OCN

75 | P a g e

Rat BM-MSC cultured on nanotubular modified disc and Simvastatin eluting discs

showed variation on the intensity of gene expressed when collected in 7th and 14th day. There

was an high increase in the OPN and COL1 gene expression on the 14th day on the nanotube

modified disc when compared with the gene expression viewed in the positive control

(Induction medium) (Figure: 42). In the case of Simvastatin loaded nanotube modified disc

the gene expression was high in the case of OPN as well as COL1 (Figure:41).

Figure: 41: Graph showing the fold change of COL1 and OPN gene expressed

on the 7th day by Simvastatin loaded disc

0

5

10

15

20

25

COL OPN

fold

ch

ange

Day 7 relative gene expression

Induced SS DiscSimvastatin coated DiscInduction medium

76 | P a g e

Figure: 42: Graph showing the fold change of COL1 and OPN gene expressed

on the 14th day by nanotube modified disc

Both these results clearly show the osteogenic induction potential of LAM-Cp-Ti and

the nanotubular modification of the surface and the eluting Simvastatin drug. The intensity of

OPN expression induced by Simvastatin seemed higher compared to the nanotubes while the

OCN and COL 1 expressed by the nanotubular surface of the disc seemed quit higher with

that of Simvastatin eluting and majorly with the positive control with induction media .A

drastic change can be viewed in the induction of osteogenic differentiation gene by

Nanotubular LAM-Cp-Ti when compared with the induced samples of BM-MSC using

osteogenic induction media alone itself.

0

2

4

6

8

10

12

COL OPN

fold

ch

ange

Day 14 relative gene expression

Induced T i DiscInduction medium

77 | P a g e

3.8. Discussion

3.8.1 Material Characterisation

3.8.1.1. Structure analysis of LAM-Cp-Ti

Earlier works done on the influence of surface topography of Titanium on the

osteogenic differentiation like Buser.et.al (1991 and 1998), Wennerberg.et.al.(1996) had

proved that rough topographic Ti surfaces were clinically proven to induce more rapid

osseointegration than smooth surfaces. In this current study also the topography of LAM-

CpTi was rough compared to the CpTi and showed irregular surface topography (Figure:

2 &3).

Porosity can be defined as the percentage of void spaces in a solid. Some of the

early works by Takemoto et.al (2005 ) reported that the percentage of pores suitable for

Ti samples is between 25 and 66%. Work done by Thelen .et al., (2004) suggested that

porous Ti with 40% porosity could be an alternative for clinical use and Oliveira et.al.,

(2004) and Takemoto et.al., (2005) confirmed that the porous Titanium with 5 and 80%

porosity have shown bone formation and this increased porosity, permits the growth of

cell into the pores and subsequently followed by the mineralization. Later studies

conducted in the porous nature of Titanium confirmed that the porosity of Titanium

increases the contact area between the biomaterials and bone tissue by Bottino.et.al

(2009), this porosity results in improved implant stability over time, as well as

accelerating the process of osseointegration as per the studies done by Faria.et.al (2010)..

The LAM-Cp-Ti used in this study possess a graded porosity from 0 - 60% which clearly

defines that the porous LAM-CpTi that used in this study benefits the BM-MSC

proliferation, adhesion, etc leading to high cytocompatability and also plays an important

role in BM-MSC differentiation to osteogenic and adipogenic lineage.

78 | P a g e

3.8.2. Nanotubular structural modification

In case of nanotubular surface modification made in the LAM-Cp-Ti, early works by

Assoian et al.(1997),shown that nano-sized features control cell adhesion and osteogenic

differentiation. Theoretically, an ideal titanium implant would encourage stem cells to

differentiate into mature osteoblasts for direct bone apposition, rather than fibroblastic cells

resulting in fibrous tissue encapsulation. It has been established that integrins are the links

between cells and ECM and serve as signal transducers for regulating cell growth,

differentiation and motility as per the studies conducted by , Lafrenie and Yamade(1996),

Kumar(1998) and Wang et al., (2006). Recent works in which similar Ti surface was

modified to form self-ordered layer of vertically oriented titanium dioxide (TiO2) nanotubes

with diameters ranging from 25 and 100 nm by anodization process Lan et al.(2014). The

results revealed that proliferation and cytocompatibility of cells on vertically aligned TiO2

nanotube surfaces are nanotubes diameter dependent. A nanotube with diameter of 25 nm

seems to have high biocompatibility of epithelial cells in comparison to 50 and 100 nm. Such

results indicate that the surface nanostructure of an implant is an important factor for surface

cell adhesion and growth. In line with this result, Zhao and co-workers(2013) observed 30

nm-diameter TiO2 nanotubes promotes the spread of BM-MSC into polygonal osteoblastic

shape. The TiO2 nanotubes samples promote osteogenesis in absence of an extra osteogenic

agent. A 30 nm-diameter TiO2 nanotubes also generates big nodular alkaline phosphatase

(ALP) product and induce extracellular matrix (ECM) mineralization. However, Zhao et al.,

(2012) reported 80 nm-diameters of TiO2 nanotubes give best ability to simultaneously

promote MSC proliferation and osteogenic differentiation simultaneously. In 2011, Choe has

demonstrated that 50 nm-inner diameter of TiO2 nanotubes provided good osseointegration

such as cell proliferation, migration and differentiation (Choe et al., 2011). It has been

suggested that surface treatment with nanotubular TiO2 surface enhanced the early osteoblast

79 | P a g e

response, such as cell spreading and cytokine release, which is an important factor for

subsequent cell functions and bone healing in vivo (Yang et al., 2008a). It has also been

demonstrated that nanotopography provided nanoscale cue that facilitate cellular probing, cell

sensing if more actin cytoskeletal filaments formed lamellipodia and locomotive

morphologies (Brammer et al., 2011b). Park’s group also showed that adhesion, spreading,

growth and differentiation of MSC are critically dependent on the tube inner diameter (Park

et al., 2007). Spacing between 15 – 30 nm provided an effective length scale for accelerated

integrin clustering/focal contact formation and strongly enhanced cellular activities compared

to smooth TiO2 surfaces. Cell adhesion and spreading were severely impaired on nanotube

layers with tube diameter larger than 50 nm resulting reduced cellular activity and

experienced programmed cell death. The cell function altered if the inner diameter of TiO2

nanotubes were less than 30 nm and more than 50 nm. The above-mentioned findings are

valid generally for the cell response to different topographical nano rough surface and have

an important impact on the design and composition of implant surfaces (Gongadze et al.,

2011). Since the result obtained is moreover similar (Figure: 4&5) to the above works rat

BM-MSC had proliferated and differentiated in the nanotubular modified LAM-Cp-Ti.

.

3.8.2.1. Effect of electrolyte, Voltage and time in formation of nanotubes

According to past studies the mechanism of nanostructured titanium oxides in terms

of different anodizing conditions have a competitive reaction between the combination of

electrolyte used and the ratios in which it is optimised, which provides different levels of

incorporation of anions in the formed oxide (Ercan et al., 2011; Kalbacova et al., 2008) .This

is thought to be due to the relatively aggressive nature of the water based electrolyte and the

high dissolution rates. The main observation (Figure :6) that was found in this study is that

the topography of the nanotubes such as tube lengths (L), Diameter and type of structure

80 | P a g e

produced for a certain time and at a specific voltage showed variations in the same LAM-Cp-

Ti samples. In general, it is found that the porosity and the pore size increased with increasing

voltage. The nonporous titanium layers were detectable at voltage values of 10 V and 20 V

even though there is a variation on length and diameter formed. The surface morphology in

the LAM-Cp-Ti formed with 20V had a distinct porous structure in comparison to other

processed at lower voltage of 10 V.

By analysing the FESEM and ESEM images of the nanotubular modified LAM-Cp-

Ti discs, it is evident that nano tubes are formed on the surface of the discs during

anodisation process. The present study also shows similar data, maximum length nanotubes

have obtained is limited to100 nm to 400 nm and diameter ranges from 50 nm to 130 nm.The

ESEM images clearly shows the cylindrical Titanium oxide nanotubes formed with different

lengths and diameter. It has been found in the study that the morphology of titanium oxide

nanotubes formed upon the selected electrochemical conditions have long round edged

cylindrical nature in LAM-Cp-Ti, when compared with CpTi that shows hexagonal edged

cylindrical nanotubes

3.8.3. Simvastatin drug loading and elution studies

In this study, we demonstrated that Simvastatin can be loaded and eluted from nanotubes

successfully with a particular pattern of drug release mechanism. Simvastatin -loaded porous

LAM-CpTi surface potently increased level of gene expression of osteopontin and type I

collagen in rat BM-MSC cells.

When Simvastatin of amount 200µg used in each well carrying single nanotube modified LAM-Cp-Ti

discs along with negative control of nanotubes modified LAM-Cp-Ti discs in 200µg of ethanol was .The

entrapment was found to be about 50% but not more than that. First of all, the study clearly shows the

nanotubes can effectively entrap the Simvastatin drug molecules. Further, nanotubes have

81 | P a g e

large inner volumes that can allow for loading about 100µg of drug ensuring the increase in

the surface area. Moreover, nanotubes have open ends which can increase drug loading

efficiency. The result also shows that the ethanol was fully evaporated during the drug

incorporation process using the vacuum pump while the Simvastatin was remained in the

nanotubes. The average amount of discs showed the weight variation of 0.0001g.which

proves the maximum intake capacity of the discs. Last, but not the least, nanotubes have

separated inner and outer surfaces, which can be differentially functionalized to load desired

molecules inside, but impart chemical features to the outer surface allowing for site-specific

drug delivery. The above observations that obtained are similar to the work done by

Gulatietal.,(2012).

3.8.3.1.Fourier transform infrared spectroscopy (FTIR) Analysis

FTIR Spectroscopy was used to study the presence and concentration of Simvastatin

in stock solution, in the loading volume and in the eluted samples. Stock solution prepared by

dissolving 1 mg of Simvastatin 1ml of ethanol and elution sample of Simvastatin loaded

nanotubular modified LAM-Cp-Ti Discs in ethanol. The possibility of any interaction

between nanotubes and Simvastatin causing any denaturation of the drug. The FTIR result

shows that there is no denaturation or any chemical changes occurring in the drug when

Simvastatin was incorporated within the nanotubes. By the FTIR analysis it is evident that the

drug has been eluted outside. Titanium nanotubes are hydrophilic in nature while

Simvastatin is hydrophobic, this characteristic can make the intake of drug into the Titanium

nanotube arrays difficult. But by analysing the so far received results the presence of

Simvastatin and elution of the Simvastatin by the NT-LAM-Cp-Ti is accurately seen in this

experimental study. Earlier literatures also show that Simvastatin molecules will move from

the high concentration area to low concentration area. Therefore, we will achieve the goals to

82 | P a g e

filling the Simvastatin into the TiO2 nanotubes . The result (Figure: 7, 8 &9) that we obtained

was more over similar to the works done by Cochran et.al.,(2002) and Ayukawa et.al.,(2004).

3.8.3.2. The morphology of the Simvastatin loaded NT-LAM-Cp-Ti

The ESEM analysis (Figure:10&11) showed that the disc morphology will not change

when the drug is loaded and eluted. The nanotubular structures formed on the surface remain

at the same state without any further degradation or other damages. By analysing the data

obtained with the similar results shown in the studies conducted by Cochran et.al. (2002) and

Ayukawa et.al,(2004) it is evident that the nanotubes formed on LAM-Cp-Ti remains solid

and strong during the drug intake and eluting periods making it an ideal drug delivery

vehicle.

3.8.3.3. UV-Spectroscopy analysis of drug elution

In NT-LAM-Cp-Ti loaded with 200µg of Simvastatin solution, A release of

around 30µg was detected in 24 hours, followed by a steady release of the incorporated drug

was released in the first 3 days, respectively. During the fourth, fifth and sixth days the

release of drug were similar to each other but greater than the past three days. After sixth day

the release became less till eight and increased during the ninth and moreover remained

similar till fifteenth day (Figure: 12). A total cumulative release (Figure: 13) of 40µg was

detected in total of 15 days except the increased release found during the first hour after drug

loading was done. By analysing the elution data the burst release is very high but the drug

have a steady pattern of release during the whole 15 days.

3.8.4. In-vitro cell culture studies

3.8.4.1. Culture of rat BM-MSC

Visual assessment of cultures showed that the BM-MSC’s are bigger in size and more

heterogeneous shape-wise which proves that the cultured cells were healthy. The gradual

83 | P a g e

change of cell morphology and proliferation was observed during each passage attaining

100% confluency during the passage 3 showing the rate of proliferation of rat BM-MSC

which seemed similar studies conducted by Park.et.al.(2012).Consistent with previous

research conducted with human bone-marrow-derived cells by Colter.et.al. (2001) and

Sekiya.et.al.(2002) this study (Figure:14) also shows that the morphologies of rat MSCs

from mesenchymal tissues are heterogeneous, with large colonies consisting of small

spindle-shaped cells, and small colonies comprising large polygonal cells.

Previous work by Lavenus et al.(2010) showed that the differentiation may cause

changes in cell shape, several studies have noted that cell morphology can also alter the

differentiation of mesenchymal lineage and the round cells promote adipogenesis while cells

with high spreading prefer an osteoblast fate. These studies demonstrated that mechanical

cues embodied in cell shape, cytoskeletal tension and RhoA signalling are integral to the

commitment of stem cell fate as by Lavenus et al.( 2010). In our work, also rat BM-MSCs

spread considerably with a wide spread spindle shaped morphology on LAM-CpTi as well as

in the nanotubes modified CpTi and also showed increase in the contractility of the

cytoskeleton which can lead to the preferential osteoblastic differentiation. Similarly, in

previous works, it has been shown that the round shape induces low contractibility resulting

in adipocyte differentiation of MSCs as by Kilian et al. (2010) which was not fing in the

culture. The spindle morphology was retained by the rat BM-MSC . In our study, the LAM-

CpTi and nanostructure modified surface showed spindle shaped morphology of BM-MSC

that may promote osteogenic differentiation.

3.8.4.2. Characterisation of Rat Bone Marrow Mesenchymal stem cells

The general strategy for identifying in vitro cultivated rat BM-MSCs is to analyze the

expressions of cell-surface markers such as CD90 and CD105 which was explained in detail

in the studies conducted by Donzelli et al.(2007), Yu et al. (2007) and De Macedo Braga et

84 | P a g e

al. (2008). In order to determine the stemness of the isolated r rat BM-MSC in our study,

cultures were analyzed for panel of cell surface markers by immunofluresence staining.

Immunocytochemistry results showed that the BM-MSC were positive for stem cell

markers and showed typical in vitro MSC properties. Mesenchymal stem cells showed a

positive expression for both CD90 (Figure:15), CD105 (Figure:16). BM-MSC showed

CD105 positive staining throughout the cell surface, but the strongest staining was detected

near the nucleus. These results are in agreement with the expected phenotypic characteristics

presented by mesenchymal stem cells in the above mentioned studies conducted prior and

confirm that the plastic-adherent, self-renewing cells in the cultures we used are stem-like

cells.

The cytoskeleton plays important roles in cell morphology, adhesion, growth, and

signalling. Changes in the cytoskeleton of the cell allow the cell to migrate, divide, and

maintain its shape as described in the work of Stossel (1993) and Hayakawa.et.al (2001)

explained that the cytoskeleton responds to external mechanical stimuli. Wakatsuki.et.al

(2001) Defined that the cytoskeleton actin filaments can be bundled and cross linked by

several actin-binding proteins in a network and are anchored to stable structures, or anchor

sites, in the cell (such as the plasma membrane). In this study also the fixed rat BM-MSC

showed prominent cytoskeletal structures of βactin filaments. Immunofluorescence staining

showed (Figure: 17) actin cytoskeleton organization with highly dynamic network composed

of actin polymers .DAPI stain showed the predominant nucleus on cells. Both temporally and

spatially arranged actin filaments are identified with orientational distribution of actin

filaments within a cell and no disruptional formations of cytoskeltal actin filaments were

identified.

85 | P a g e

3.8.4.3. Cytocompatability analysis

It has previously been found that the cytoskeleton may affect the differentiation of

cells. Mallein.et.al (1991)and Spiegelman.et.al(1983) the rat BM-MSC grown on the NT-

LAM-Cp-TI showed prominent cytoskeletal structures of actin filaments in βactin- DAPI

staining. Immunofluorescence staining showed (Figure:25) actin cytoskeleton organization

with highly dynamic network composed of actin polymers. DAPI stain showed the

predominant nucleus on cells. Both temporally and spatially arranged actin filaments are

identified with orientational distribution of actin filaments within a cell and no disruptional

formations of cytoskeleton actin filaments was identified. Cells are seen in large numbers and

small in size throughout the disc surface which shows connection with the results from Oh

et al.(2009) that NTs induce larger cell numbers in the surface.

Micro- and nanotopography has been documented to increase cellular signalling,

adhesion, viability and proliferation of most cell types as studied by Martinez.et.al(2009),

Bettinger.et.al(2009), and Miller.et.al (2009). Porous three-dimensional structure were

studied intensively to understand whether it favours cytocompatability including cell

adhesion, proliferation and viability in previous literatures including Weinad.et.al(2006),

Marcacci.et.al (2007), Gan.et.al (2008), . Materials tested in the current work have

demonstrated an excellent cytocompatibility. BM-MSC can be isolated from several sources

and display multilineage differentiation ability that includes osteoblastic differentiation.

Apart from this property, they display an established immunophenotype and are in vitro

expanded based on their property of adherence to plastic surfaces pattern is explained in the

works of Dominici.et.al(2006), Barry (2004). Most studies published to date in this setting

are focussed on bone repair by combination of progenitor cells with several biomaterials,

especially calcium phosphate compounds based on their similarities with the mineral bone

86 | P a g e

phase and their resorbability. The few works that explore interactions of titanium with MSC

are mainly centred on assessing the effects on the structural architecture, especially the

surface as previously recorded by Sjostrom.et.al.(2009), Stiehler.et.al.(2008),

Zhou.et.al(2008).The results (Figure: 19&20) showed that the interaction between cells and

implants is an important focus of research into the biocompatibility of that biomaterial. The

interaction and adhesion of mesenchymal stem cells to the marginal surface of LAM-Cp-Ti

showed the positive biocompatibility nature of the test material and proving its potency in

cell adhesion and proliferation properties. The Cells must interact with the surface of the

biomaterial, including adhering, extending, migrating, differentiating and proliferating.

Adhesion to a material, including metal, can affect the proliferation and differentiation of

cells. The interaction between mesenchymal stem cells and the metallic material depends

largely on the surface properties of the material, which include the geometric structure,

porosity and chemistry. Thus the LAM-Cp-Ti has a three-dimensional structure and

interconnected pores of sufficient size, which is beneficial for bone cell adhesion and

migration, and thus, appropriate for osteogenesis.

A few protrusions (Figure: 21) grew adherently on the surface of the discs joining the

two marginal regions of the macro pores and within the macro pores. The cell stretched,

lengthened and extended pseudopodia gradually was identified revealing the adherence

nature of BM-MSC on the LAM-Cp-Ti discs. The process of adjacent cells connected with

each other across the pores was clearly visible. The BM-MSC also showed flakes like

processes extending into the adjacent surroundings. In some of the specific areas cells on the

surface and in the pores had grown into multiple layers, secreting matrix and covering the

surface completely.

Previous studies reveal that Rat bone marrow-derived MSC isolated in various

laboratories around the world share at least two characteristics; (1) BM-MSCs can grow over

87 | P a g e

a long period of time (a process known as long-term self renewal). (2) In response to

appropriate stimuli, BM-MSCs can differentiate into mesodermal lineage cells including

osteoblasts (Lorenzi et al. 2008; Zhang et al. 2008), chondrocytes (Ahmed et al. 2006; Peng

et al. 2008), muscle cells (Wakitani et al. 1995), adipocytes (Lorenzi et al. 2008; Peng et al.

2008), and tenocytes (Hoffmann and Gross 2007).In this work also the differentiation

potential of rat BM-MSC showed similar result (Figure:22,23&24) when osteogenic and

adipogenic staining was done.

Requirements for ideal biomaterials for orthopaedic implants include excellent

mechanical properties, a porous structure and the capacity to support in growth of the host

cell or tissue. Compared with other metallic materials, porous LAM-Cp-Ti is stable and has a

higher porosity, larger pore size and a low elastic modulus. By the ESEM analysis of the

adhesion property of the mesenchymal stem cell in the porous region and surface of LAM-

Cp-Ti indicated that the MSC were able to adhere, grow and proliferate in the pores of the

material and the surface and the pores of the porous LAM-Cp-Ti discs were fully covered

with rat BM-MSC. Porous LAM-Cp-Ti has a high porosity (0%–60%) and is able to induce

the development of BM-MSC and its growth inside its pores. These results also further

confirm that porous LAM-Cp-Ti promotes the adhesion, proliferation of mesenchymal stem

cells and may be able to induce stem cells for differentiation into osteoblasts

To determine the effectiveness on the surface modified nanotubes on LAM-Cp-Ti in

the proliferation, Adhesion and viability (Figure: 26) of BM-MSC cultured on them. An

effective experiment was done using BM-MSC on nanotubular surface. Experiments to

ascertain BM-MSC interaction with the disc samples were completed on days 7th day after

initial seeding of the cells. MSC nuclear, cytoplasmic and skeletal structures were stained by

cytoskeletal staining. Cellular viability was determined through the live dead assay. MSC

adhesion and morphology was observed through the employment of ESEM (Figure :27). The

88 | P a g e

Rat BM-MSC grown on the NT-LAM-Cp-TI showed prominent cytoskeletal structures of

actin filaments in β –actin- DAPI staining. Immunofluorescence staining showed actin

cytoskeleton organization with highly dynamic network composed of actin polymers .DAPI

stain showed the predominant nucleus on cells. Both temporally and spatially arranged actin

filaments are identified with Orientational distribution of actin filaments within a BM-MSC

and no disruptional formations of cytoskeleton actin filaments was identified. BM-MSC are

seen in large numbers and small in size throughout the disc surface and live dead assay

showed high rate of cell viability on the NT-LAM-Cp-TI.and seemed to be proliferating.

Some concentrations of cells can be spotted in specific areas of the disc the proliferation,

Adhesion and viability of BM-MSC cultured on them. Oh et al. And Popat. et al. Reported

that the filopodia of cell extensions were protruding into the nanotubular architecture using

different cell types. According to these research findings, it is possible to consider that the

TNT may constitute the attractant for the filopodia facilitating BM-MSC attachment. Which

is also found in this study (Figure: 29)Moreover, the ESEM data showed that the nanotubular

structure facilitates adhesion and proliferation of BM-MSC. The result more over combines

the biocompatibility of the modified NT-LAM-Cp-Ti.

3.8.4.4. Osteogenic studies

ALP is commonly used as a biochemical marker to assess osteoblast activity, using p-

nitro phenyl phosphatase (pNPP) as substrate. The hydrolysis of phosphate esters is catalyzed

by ALP under alkaline pH conditions. A coloured yellow end product, p-nitro phenol, is

optically measured at 405 nm wavelength as explained in studies conducted by Bessey,

Lowry et al. (1946), Sabokbar, Millett et al. (1994), and Akcakaya, Aroymak et al. (2007). In

contrast, the mineralization process is considered “a functional in vitro endpoint reflecting

advanced cell differentiation” as explained by Hoemann, El-Gabalawy et al. (2009). Alizarin

red staining is used to detect calcium deposition and Von Kossa staining indicates phosphate

89 | P a g e

deposition within the mineralized matrix has been provided in detailed in the results of

previous works by Henrichsen (1956), and Puchtler, Meloan et al. (1969). As expected

when the special staining was done using, Alizarin red (Figure : 30-32) , Masson’s Trichome

(Figure : 33-35) and Von Kossa (Figure:36-38).Von Kossa and Alizarin Red identified the

presence of calcium deposits starting from the day 7 itself even though the rate of calcium

deposits were far less compared to the positive control, gradual change and increase in the

calcium deposition was found from 7 towards the 21st day. Collagen deposition was detected

in an average basis by using Masson’s Trichrome staining during the 7th, 14th and 21st day

respectively.ALP activity increases (Figure: 39) over time in confluent monolayer Mac cell

cultures along with the LAM-Cp-Titanium. when compared with the negative and positive

control the alkaline phosphatise produced during the 7th, 14th and 21st day is comparatively

higher showing a positive result.MSC develop increasing ALP activity in the presence of

LAM-Cp-Titanium shows the stimulatory effect of the discs in the medium without

producing any inhibition for the ALP activity. The progression of ALP activity can be seen

from 7th to 21st day during the 14th day a slight decrease is detected with an increase in the

following 21st day. It clearly shows the events in a three-week osteogenesis assay can be

promoted or inhibited by a variety of biomaterials, hormones, cytokines, or pharmacological

agents at key developmental stages and here the LAM-Cp-Ti promoted ALP activity during

the period of osteogenesis. The progression of events in a three-week osteogenesis assay can

be promoted or inhibited by a variety of biomaterials, hormones, cytokines, or

pharmacological agents at key developmental stages. The Alp activity assay and the

osteogenic staining show that the LAM-Cp-Ti can induce osteogenic potential in BM-MSC.

3.8.4.5. Gene expression studies

Osteogenic differentiation of MSCs use transcriptional analyses of specific

osteoblastic genes including Cbfa1/Runx2, Col I, OSN, OC, OPN and ALP was specified in

90 | P a g e

previous literature like Jaiswal, Haynesworth et al. (1997) and Carpenter, Goodrich et al.

(2010).Early works done on this specific gene studies provided results that, Osteocalcin, the

bone-specific glycoprotein that binds calcium and may promote calcification of the bone

matrix has been used as a late marker for osteogenic differentiation (Ho et al. 2006; Donzelli

et al. 2007; Tseng et al. 2007). Osteopontin, synthesized by bone forming cells is also a

phosphoprotein that possesses several calcium-binding domains and is associated with cell

attachment, proliferation, and mineralization of extracellular matrix into bone (Donzelli et al.

2007). Osteonectin, one of the important non-collagen proteins is related to mineralization at

the early stage of tooth and bone formation. All together, these proteins are considered as

lineage-specific markers of osteoblastic differentiation. It has been shown by quantitative RT-

PCR analysis that osteocalcin (Eslaminejad et al. 2007; Hayashi et al. 2008) and osteopontin

(Eslaminejad et al. 2007) were produced in culture of the rat BM-MSCs in the absence of

osteogenic supplements. These data strengthens our immunohistochemical observations with

rat BM-MSCs which were positive for osteocalcin and osteopontin. However, contradictory

to our findings and the findings of supporting data, rat BM-MSCs were reported to be

osteocalcin non-expressers (Yang et al. 2007). In conclusion, it may be true to speculate that

rat BM-MSCs have diverse immunophenotypic characteristics that can explain why these

cells can easily differentiate into cells of the bone tissue. Zhang et al. (2008) examined the

level of collagen type I mRNA in rat BM-MSCs and reported an increase in the expression of

collagen type I mRNA after 12-h stretching in comparison to the control group (Zhang et al.

2008). This result agrees with observation of expression of type I collagen in rat BM-MSCs

and explains the reasoning behind the differentiation of rat BM-MSCs into tendon cells or

ligament fibroblasts (Hoffmann and Gross 2007).

91 | P a g e

In the result obtained, rat BM-MSC cultured on nanotubes modified disc and

Simvastatin eluting discs showed variation on the intensity of gene expressed when collected

in 7th and 14th day (Figure :40) . There was a high increase in the OPN and COL1 gene

expression on the 14th day (Figure: 42)on the nanotube modified disc when compared with

the gene expression viewed in the positive control (Induction medium). In the case of

Simvastatin loaded nanotube modified disc the gene expression was high in the case of OPN

as well as COL1. Regardless of the specific reason(s) for the osteogenic potential of

Simvastatin loaded and nanotububular structure modified LAM-CpTi on rat BM-MSCs, the

molecular basis for this finding is clearly evident from the results of these experiments.

Runx2 down -regulation and transcriptional activity are required for osteogenesis, as has

been compellingly demonstrated in murine gene deletion models by Komori, Yagi et al.

(1997), Nakashima, Zhou et al. (2002) and Zhou, Zhang et al. (2010). Their works showed

that Runx2 will be significantly down -regulated in BM- MSC cultures maintained in

osteogenic medium. The intimate action mechanism of statins in inducing bone formation is

not fully understood. The osteoblast-differentiating effect may be explained by a BMP2

mediated action as described by Mundy et al. (1999). Alternatively, in osteoblast-like

MC3T3-E1 cells some studies have shown that Simvastatin induces phosphorylation of

mitogen-activated-protein (MAP) kinase through the heat shock protein 27 (HSP-27) by

Wang et al., (2003)

Our findings were similar to some earlier reports on the osteogenic effects of simvatatins

(Figure: 41). Mundy et al.(1999) first reported the bone anabolic effect of Simvastatin both in

vivo and in vitro. Subsequent in vitro studies described by Li.et.al (2003), Song.et.al.(2003)

and Ruiz.et.al(2007) showed the stimulation of osteogenic differentiation and concurrent

inhibition of adipogenic differentiation of bone marrow mesenchymal cells by Simvastatin.

92 | P a g e

Furthermore, studies done by Maeda.et.al.(2004) confirmed that Simvastatin could potently

induce mRNAs encoding osteoblast differentiation markers such as, type I collagen, bone

sialoprotein, and osteopontin. Ayukawa et al. (2004) found that the administration of

Simvastatin increased the value of both bone contact ratio to the implant and bone density

and suggested that this drug might have the potential to improve the nature of

osseointegration. The intimate action mechanisms of the stimulatory effect of Simvastatin on

bone formation have not been fully defined in the work of Horiuchi.et.al. (2006) .Maeda et

al.(2001) demonstrated that Simvastatin induced synthesis of differentiation markers that are

the characteristic of late osteoblast stages. Which clearly defines the result of the COL1 and

OPN gene expression shown by Simvastatin loaded LAM-CpTi discs during the work.

93 | P a g e

Summary and conclusion

4.1. Summary

Anodization process done resulted in the formation of Titanium nanotubes on the

surfaces of LAM-Cp-Ti. The Surface characterization studies revealed the topography,

structure, and characteristic features of the nanotubes formed. The Simvastatin loading

carried out by dip coating method and vacuum drying process was successful resulted in the

incorporation of the drug into the nanotubes. FTIR analysis revealed Simvastatin on the

LAM-Cp-Ti surface and denaturing of the drug was not found. Elution studies revealed stable

release of Simvastatin continuously over a period of 15 days. Isolation and culture of rat

Bone marrow MSC is done and sub cultured effectively throughout the studies. MTT assay of

Bone marrow MSC using LAM-Cp-Ti and Simvastatin was done which revealed the

noncytotoxic nature of both the materials. High viability was shown by the cells in Live-

dead staining of BM-MSC on NT-LAM-Cp-Ti Characterization of Rat BM-MSC is done by

phalloidin-FITC, CD90 and CD105 immunofluresence staining revealed positive results.

Multilineage differentiation was shown by BM-MSC in staining. ESEM analysis provided

evidence for the Cell adhesion. Osteogenic study was evaluated by alkaline phosphatise

assay and osteogenic staining by Alizarin Red ,Vonkossa and Trichome gave much evidence

on the osteogenic induction potential of LAM-Cp-Ti followed by major osteogenic gene

expression viz., osteocalcin, osteopontin, collagen and Runx2.

Osteogenic Gene expression study shows the positive results in the induction of genes

by LAM-Cp-Ti. For osteogenesis to occur a sequence of genes needs to be activated in the

correct order to permit proliferation and differentiation. Three principal development periods

(proliferation, ECM maturation and mineralization) have been defined by the sequential

expression of the genes associated with each phase. In this progression cell cycle and growth

94 | P a g e

genes (i.e., c-fos and/or c-myc) are down regulated to end proliferation and this is followed

by the process of differentiation, with expression of genes encoding ECM proteins that

prepare the matrix for mineralization. Hence, to study growth, osteogenic gene expression by

LAM-Cp-Ti , and the modified nanotubular surface and the drug effect on the Rat BM-MSC

.Rat BM-MSC cultured on nanotopography modified disc was collected in 7 and 21 days

respectively ,the transcription factors RUNX2 , the extracellular maturation proteins ,

osteopontin (OPN) and osteocalcin (OCN) and the main ostegenic indicator COL-1 and

housekeeping gene GAPDH were examined at the transcript level over a 7 AND 21 day time

course .In the study there is an up regulation of COL1 ,OPN,OCN in the nanotubular

modified LAM-Cp-Ti, A down regulation of RUNX2 gene extensively and An up regulation

of OPN by Simvastatin drug in the nanotubes of LAM-Cp-Ti. This clearly shows the

osteogenic induction potential of LAM-Cp-Ti and the nanotubular modification of the surface

and the eluting Simvastatin drug.

4.2. Conclusion

The surface modified and Simvastatin drug eluting Laser additive manufactured

Commercially pure Titanium(CpTi) shown osteogenic induction potential on rat bone

marrow mesenchymal stem cells in vitro and can be used in bone tissue engineering

applications in the near future.

4.3. Future aspects

Drug elution studies should be studied in detail to understand the Kinetics and

mechanics of Simvastatin drug delivery from nanotubes.

Polymer –LAM-CpTi composite biomaterial modification for controlled delivery of

Drug

Specific gene expression studies including MMP9, MMP2 to understand in detail about

the cell-material interaction.

95 | P a g e

Reference

1. Ayukawa Y, Okamura A, Koyano K. Simvastatin promotes osteogenesis around titanium

implants. Clin Oral Implants Res 2004;15:346-50.

2. Boeuf S & Richter W (2010). Chondrogenesis of mesenchymal stem cells: role of tissue source

and inducing factors. Stem Cell Res Ther 1, 31.

3. Bottino MC, Coelho PG, Henriques VA, Higa OZ, Bressiani AH, Bressiani JC (2009)

Processing, characterization, and in vitro/in vivo evaluations of powder metallurgy processed

Ti-13Nb-13Zr alloys. J. biomed. mater. res. A. 88: 689-696.

4. Bottino MC, Coelho PG, Yoshimoto M, König Jr B, Henriques VAR, Bressiani AHA, et al.

(2008) Histomorphologic evaluation of Ti-13Nb-13Zr alloys processed via powder metallurgy.

A study in rabbits. Mat. sci. engin. C. 28: 223-227.

5. Branemark PI. (1983) Osseointegration and its experimental background. J. Prosth. Dent. 50:

399-410.

6. Brentel AS, Vasconcellos LM, Oliveira MV, Graça ML, Vasconcellos LG, Cairo CA,

Carvalho, YC. (2006) Histomorphometric analysis of pure titanium implants with porous

surface versus rough surface. J. appl. oral sci. 14: 213-218.

7. Bretscher A et al. (1994). J Cell Biol 126:821-825.

8. Bruder SP, Kurth AA, Shea M, Hayes WC, Jaiswal N, & Kadiyala S (1998). Bone regeneration

by implantation of purified, culture-expanded human mesenchymal stem cells. J Orthop Res 16,

155-162.

9. Buser D, Nydegger T, Hirt HP, Cochran DL, Nolte LP. Removal torque values of titanium

implants in the maxilla of miniature pigs. Int J Oral Maxillofac Implants 1998;13(5):611–9.

10. Buser D, Schenk RK, Steinemann S, Fiorellini JP, Fox CH, Stich H. Influence of surface

characteristics on bone integration of titanium implants. A histomorphometric study in miniature

pigs. J Biomed Mater Res 1991;25(7):889–902.

11. Butler DL, Gooch C, Kinneberg KRC, Boivin GP, Galloway MT, Nirmalanandhan VS, Shearn

JT, Dyment NA, Juncosa-Melvin N (2010) The use of mesenchymal stem cells in collagen-

based scaffolds for tissue-engineered repair of tendons. Nat Protoc 5: 849-863

12. C.M. Kolf, E. Cho, R.S. Tuan (2007) Mesenchymal stromal cells. Biology of adult

mesenchymal stem cells: regulation of niche, self-renewal and differentiation, Arthritis Res

Ther, 9 , p. 204

13. Chen D, Zhao M, Mundy GR (2004) Bone morphogenetic proteins. Growth Factors 22: 233-

241.

14. Cheng B, Zhao S, Luo J, Sprague E, Bonewald LF, Jiang JX (2001) Expression of functional

gap junctions and regulation by fl uid fl ow in osteocyte-like MLO-Y4 cells. J Bone Miner Res

16: 249-259.

15. Chu CR, Szczodry M, & Bruno S (2010). Animal models for cartilage regeneration and repair.

96 | P a g e

Tissue Eng Part B Rev 16, 105-115.

16. Cochran D , Schenk R, Lussi A, Higginbottom F, Buser D. Bone response to unloaded and

loaded titanium implants with a sandblasted and acid-etched surface: A histometric study in the

canine mandible. J. Biomed. Mater. Res. 1998; 40: 1-11.

17. Colter DC, Class R, DiGirolamo CM, Prockop DJ (2000) Rapid expansion of recycling stem

cells in cultures of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci USA

97:3213–3218

18. Colter DC, Sekiya I, Prockop DJ (2001) Identification of a subpopulation of rapidly self-

renewing and multipotential adult stem cells in colonies of human marrow stromal cells. Proc

Natl Acad Sci USA 98:7841–7845

19. Curtis ASG, Casey B, Gallagher JO, Pasqui D, Wood MA, Wilkinson CDW (2001) Substratum

nanotopography and the adhesion of biological cells. Are symmetry or regularity of

nanotopography important? Biophys Chem 94: 275-283

20. D. Dunand (2004)Processing of titanium foams Adv. Eng. Mater., 6, pp. 369–376

21. D.L. Cochran, D. Buser, C.M. ten Bruggenkate, D. Weingart, T.M. Taylor and J.P. Bernard

(2002),JP: Clin. Oral Implants Res. 13p. 144.

22. Dalby MJ, Gadegaard N, Herzyk P, Sutherland D, Agheli H, Wilkinson CD, Curtis AS (2007b)

Nanomechanotransduction and Interphase Nuclear Organization infl uence on genomic control.

J Cell Biochem 102: 1234-1244.

23. Dalby MJ, McCloy D, Robertson M, Wilkinson CDW, Oreffo ROC (2006a) Osteoprogenitor

response to defi ned topographies with nanoscale depths. Biomaterials 27: 1306-1315

24. De Bari C, Dell'Accio F, Tylzanowski P, & Luyten FP (2001). Multipotent mesenchymal stem

cells from adult human synovial membrane. Arthritis Rheum 44, 1928-1942.

25. De Bari C, Dell'Accio F, Vanlauwe J, Eyckmans J, Khan IM, Archer CW, Jones EA,

McGonagle D, Mitsiadis TA, Pitzalis C, & Luyten FP (2006). Mesenchymal multipotency of

adult human periosteal cells demonstrated by single-cell lineage analysis. Arthritis Rheum 54,

1209-1221.

26. Devas MB (1967). Shin splints, or stress fractures of the metacarpal bone in horses, and shin

soreness, or stress fractures of the tibia, in man. J Bone Joint Surg Br 49, 310-313.

27. Dominici M, Le BK, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A,

Prockop D, & Horwitz E (2006). Minimal criteria for defining multipotent mesenchymal

stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8,

315-317.

28. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R,

Keating A, Prockop D, Horwitz E (2006) Minimal criteria for defi ning multipotent

mesenchymal stromal cells. The International Society for Cellular Therapy position statement.

Cytotherapy 8: 315- 317.

29. Donahue H. (2000) Gap junctions and biophysical regulation of bone cell differentiation. Bone

26: 417-422. Doty SB (1981) Morphological evidence of gap junctions between bone cells.

Calcif Tissue Int 33: 509- 512.

97 | P a g e

30. Donzelli E, Salvade` A, Mimo P, Vigano` M, Morrone M, Papagna R, Carini F, Zaopo A,

Miloso M, Baldoni M, Tredici G (2007) Mesenchymal stem cells cultured on a collagen

scaffold: in vitro osteogenic differentiation. Arch Oral Biol 52:64–73

31. Dubreuil RR. (1991). BioEssays 13:219-226.

32. Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G (1997) Osf2/Cbfa1: a transcriptional

activator of osteoblast differentiation. Cell 89: 747-754

33. Ducy, P., Zhang, R., Geoffroy, V., Ridall, A.L., and Karsenty, G. (1997). Osf2/Cbfa1: a

transcriptional activator of osteoblast differentiation. Cell 89,747P754

34. Eslaminejad MB, Mirzadeh H, Mohamadi Y, Nickmahzar A (2007) Bone differentiation of

marrow-derived mesenchymal stem cells using beta-tricalcium phosphate–alginate–gelatin

hybrid scaffolds. J Tissue Eng Regen Med 1:417–424

35. F. Yang, S.F. Zhao and F. Zhang: (2011), Med. Oral Pathol Oral Radiol Endod 111p.551.

36. Faria PEP, Carvalho AL, Felipucci DNB, Wen C, Sennerby L, Salata LA. (2010) Bone

formation following implantation of titanium sponge rods into humeral osteotomies in dogs: a

histological and histometrical study. Clin. implant dent. rel. res. 12: 72-79.

37. Frosch KH, Barvencik F, Lohmann CH, Viereck V, Siggelkow H, Breme J, Dresing K, Stürmer

KM. (2002) Migration, matrix production and lamellar bone formation of human osteoblast-like

cells in porous titanium implants. Cell tis. org. 170: 214-227.

38. G. Mundy, R. Garrett, S. Harris, J. Chan, D. Chen, G. Rossini, B. Boyce, M. Zhao and G.

Gutierrez: (1999), Science 286p. 1946.

39. Gotfredsen K, Wennerberg A, Johansson C, Skovgaard LT, Hjorting-Hansen E. Anchorage of

TiO2-blasted, HA-coated, and machined implants: an experimental study with rabbits. J Biomed

Mater Res 1995;29(10):1223–31.

40. Grossner-Schreiber B, Herzog M, Hedderich J, Duck A, Hannig M, Griepentrog M. Focal

adhesion contact formation by fibroblasts cultured on surface-modified dental implants: an in

vitro study. Clin Oral Implants Res 2006;17(6):736–45.

41. Guvendiren M, Burdick JA. The control of stem cell morphology and differentiation by

hydrogel surface wrinkles. Biomaterials 2010;31:6511e8.

42. H.N.G. Wadley(2002) Cellular metals manufacturing Adv. Eng. Mater., 4 , pp. 726–733

43. Hamidouche Z, Fromigue O, Ringe J, Haupl T, Vaudin P, Pages JC, Srouji S, Livne E, Marie PJ

(2009) Priming integrin α5 promotes human mesenchymal stromal cell osteoblast differentiation

and osteogenesis. Proc Natl Acad Sci USA 106: 18587-18591

44. Hayashi O, Katsube Y, Hirose M, Ohgushi H, Ito H (2008) Comparison of osteogenic ability of

rat mesenchymal stem cells from bone marrow periosteum and adipose tissue. Calcif Tissue Int

822:38–47

45. Ho M, Yu D, Davidsion MC, Silva GA (2006) Comparison of standard surface chemistries for

culturing mesenchymal stem cells prior to neural differentiation. Biomaterials 27:4333–4339

46. Hoffmann A, Gross G (2007) Tendon and ligament engineering in the adult organism:

mesenchymal stem cells and gene-therapeutic approaches. Int Orthop 31:791–797

98 | P a g e

47. Horwitz EM, Prockop DJ, Fitzpatrick LA, Koo WW, Gordon PL, Neel M, Sussman M, Orchard

P, Marx JC, Pyeritz RE, & Brenner MK (1999). Transplantability and therapeutic effects of

bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta. Nat Med 5,

309-313.

48. Hwang R, Lee EJ, Kim MH, Li SZ, Jin YJ, Rhee Y, et al. Calcyclin, a Ca2_ ion– binding

protein, contributes to the anabolic effects of simvastatin on bone. J Biol Chem

2004;279:21239-47.

49. Im GI, Shin YW, & Lee KB (2005). Do adipose tissue-derived mesenchymal stem cells have the

same osteogenic and chondrogenic potential as bone marrow-derived cells? Osteoarthritis

Cartilage 13, 845-853.

50. Jorge R. Vega et al. (2008) Arthroscopic Fixation of Displaced Tibial Eminence Fractures: A

New Growth Plate–Sparing Method. j.arthro.2008.07.007

51. K. Gulati, S. Ramakrishnan, M. S. Aw, G. J. Atkins, D. M. Findlay, and D. Losic, (2012)

Biocompatible polymer coating of titania nanotube arrays for improved drug elution and

osteoblast adhesion. Acta Biomater. 8, 449

52. Kalbacova, M.; Macak, J. M.; S.-Stein, F.; Mierke, C. T.; Schmuki, (2008), P. TiO2 Nanotubes:

Photocatalyst for Cancer Cell Killing, Phys. Stat. Sol. 4, 194–196.

53. Kassis I, Zangi L, Rivkin R, Levdansky L, Samuel S, Marx G, & Gorodetsky R (2006).

Isolation of mesenchymal stem cells from G-CSF-mobilized human peripheral blood using

fibrin microbeads. Bone Marrow Transplant 37, 967-976

54. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu,

Y.,Bronson,R.T.,Gao,Y.H.,Inada,M.,etal.(1997).Targeted disruption of Cbfa1 results in a

complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89,

755P764.

55. Kujala S, Ryhänen J, Danilov A, Tuukkanen J. (2003) Effect of porosity on theosteointegration

and bone ingrowth of a weight-bearing nickel-titanium bone graft substitute. Biomaterials. 24:

4691-4697.

56. Laufs U, Fata VL, Liao JK. Inhibition of 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase

blocks hypoxia-mediated downregulation of endothelial nitric oxide synthase. J Biol Chem

1997;272:31725-9.

57. Le Guéhennec L, Soueidan A, Layrolle P, Amouriq Y (2007) Surface treatments of titanium

dental implants for rapid osseointegration. Dent Mater 23: 844-854

58. Li X, Cui Q, Kao C, Wang GJ, Balian G. Lovastatin inhibits adipogenic and stimulates

osteogenic differentiation by suppressing PPARgamma2 and increasing Cbfa1/Runx2

expression in bone marrow mesenchymal cell cultures. Bone 2003;33:652-9.

59. Liu YL, Schoenaers J, Groot K, Wijn JR, Schepers E. (2000) Bone healing in porous implants:

a histological and histometrical comparative study on sheep. J mat. sci mat. med. 11: 711-717.

60. Liu,W.,Toyosawa,S.,Furuichi,T.,Kanatani,N.,Yoshida,C.,Liu,Y.,Himeno,M.,Narai,S.,

Yamaguchi, A., and Komori, T. (2001). Overexpression of Cbfa1 in osteoblasts inhibits

osteoblast maturation and causes osteopenia with multiple fractures. J Cell Biol 155, 157P 166.

61. Lorenzi B, Pessina F, Lorenzoni P, Urbani S, Vernillo R, Sgaragli G, Gerli R, Mazzanti B, Bosi

99 | P a g e

A, Saccardi R, Lorenzi M (2008) Treatment of experimental injury of anal sphincters with

primary surgical repair and injection of bone marrow-derived mesenchymal stem cells. Dis

Colon Rectum 51:411–420

62. M. Sugiyama, T. Kodama, K. Konishi, K. Abe, S. Asami and S. Oikawa: (2000), Biochem.

Biophys. Res. Comm.271p.688.

63. Maeda T, Matsunuma A, Kawane T, Horiuchi N. Simvastatin promotes osteoblast

differentiation and mineralization in MC3T3-E1 cells. Biochem Biophys Res Commun 2001;

280:874-7.

64. Maeda T, Matsunuma A, Kurahashi I, Yanagawa T, Yoshida H Horiuchi N. Induction of

osteoblast differentiation indices by statins in MC3T3-E1 cells. J Cell Biochem 2004;92:458-71.

65. Marinucci L, Balloni S, Becchetti E, Bistoni G, Calvi EM, Lumare E, Ederli F, Locci P (2010)

Effects of Hydroxyapatite and Biostite on Osteogenic Induction of hMSC. Ann Biomed Eng 38:

640-648

66. Matsudaira P. (1991). Trends Biochem Sci 16:87-92.

67. Matsudaira P. (1994). Semin Cell Biol 5:165-174.

68. Milner PI, Clegg PD, & Stewart MC (2011). Stem cell-based therapies for bone repair. Vet Clin

North Am Equine Pract 27, 299-314.

69. Mustafa K, Silva Lopez B, Hultenby K, Wennerberg A, Arvidson K. Attachment and

proliferation of human oral fibroblasts to titanium surfaces blasted with TiO2 particles. A

scanning electron microscopic and histomorphometric analysis. Clin Oral Implants Res

1998;9(3):195–207

70. Nishikawa S (2000) Localization of transcription factor AP-1 family proteins in ameloblast

nuclei of the rat incisor. J Histochem Cytochem 48:1511–1520

71. Oh S, Brammer KS, Li YS, Teng D, Engler AJ, Chien S, et al. Stem cell fate dictated solely by

altered nanotube dimension. Proc Natl Acad Sci U S A 2009; 106:2130e5.

72. Oliveira PT, Nanci A. (2004) Nanotexturing of titanium-based surfaces upregulates expression

of bone sialoprotein and osteopontin by curtured osteogenic cells. Biomaterials. 25: 403-413.

73. Otto,F., Thornell, A.P., Crompton, T., Denzel, A., Gilmour, K.C., Rosewell, I.R.,

Stamp,G.W.,Beddington,R.S.,Mundlos,S.,Olsen,B.R.,et.al.(1997).Cbfa1,a candidate gene for

cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone

development.Cell 89,765P771.

74. Park CY, et al. (2010) Simultaneous genome-wide inference of physical, genetic, regulatory,

and functional pathway components. PLoS Comput Biol 6(11):e1001009

75. Park, J.T.; Patel, R.; Jeon, H.; Kim, D.J.; Shin, J.-S.; Kim, J.H.(2012) Facile fabrication of

vertically aligned TiO2 nanorods with high density and rutile/anatase phases on transparent

conducting glasses: High efficiency dye-sensitized solar cells. J. Mater. Chem. 22, 6131–6138.

76. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA,

Simonetti DW, Craig S, Marshak DR (1999) Multilineage potential of adult human

mesenchymal stem cells.Science. Apr 2; 284(5411):143-7.

100 | P a g e

77. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA,

Simonetti DW, Craig S, & Marshak DR (1999). Multilineage potential of adult human

mesenchymal stem cells. Science 284, 143- 147.

78. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage

potential of adult human mesenchymal stem cells. Science 1999; 284:143e7.

79. Pratap, J., Javed, A., Languino, L.R., van Wijnen, A.J., Stein, J.L.,Stein, G.S., and Lian

J.B.(2005).TheRunx2osteogenic transcription factor regulates matrix metalloproteinase 9 in

bone metastatic cancer cells and controls cellinvasion.MolCellBiol 25,8581P8591.

80. R. Singh, P.D. Lee, R. Dashwood, T. Lindley(2010) Titanium foams for biomedical

applications: a review Mater. Technol., 25 , pp. 127–136

81. Rao JY et al. (1990). Cancer Res 50:2215-2220.

82. Ruiz-Gaspa S, Nogues X, Enjuanes A, Monllau JC, Blanch J, Carreras R, et al. Simvastatin and

atorvastatin enhance gene expression of collagen type 1 and osteocalcin in primary human

osteoblasts and MG-63 cultures. J Cell Biochem 2007; 101:1430-8.

83. Sakou T. Bone morphogenetic proteins: from basic studies to clinical approaches. Bone

1998;22:591-603.

84. Sekiya I, Larson BL, Smith JR, Pochampally R, Cui JG, Prockop DJ (2002) Expansion of

human adult stem cells from bone marrow stroma: conditions that maximize the yields of early

progenitors and evaluate their quality. Stem Cells 20:530–541

85. Song C, Guo Z, Ma Q, Chen Z, Liu Z, Jia H, et al. Simvastatin induces osteoblastic

differentiation and inhibits adipocytic differentiation in mouse bone marrow stromal cells.

Biochem Biophys Res Commun 2003;308:458-62.

86. Sudo K, Kanno M, Miharada K, et al.(2007) Mesenchymal progenitors able to differentiate into

osteogenic, chondrogenic, and/or adipogenic cells in vitro are present in most primary

fibroblast-like cell populations.Stem Cells,25:1610–1617.

87. Takemoto M, Fujibayashi S, Neo M, Suzuki J, Kokubo T, Nakamura T. (2005) Mechanical

properties and osteoconductivity of porous bioactive titanium. Biomaterials. 26: 6014-6023.

88. Thelen S, Barthelat F, Brinson LC. (2004) Mechanics considerations for microporous titanium

as an orthopedic implant material. J. biomed. mat. res. A. 69: 601-610.

89. Tseng PY, Chen CJ, Sheu CC, Yu CW, Huang YS (2007) Spontaneous differentiation of adult

rat marrow stromal cells in a long-term culture. J Vet Med Sci 69:95–102

90. Vasconcellos LM, Oliveira MV, Graça ML, Vasconcellos LG, Cairo CAA, Carvalho YR.

(2008(a)) Design of dental implants, influence on the osteogenesis and fixation. J. mat. sci.: mat.

med. 19: 2851-2857.

91. Vasconcellos LM, Oliveira MV, Graça MLA, Vasconcellos LGO, Cairo CAA, Carvalho YR.

(2008(b)) Porous titanium scaffolds produced by powder metallurgy for biomedical

applications. Mat. res. 11: 275-280.

92. Wazen RM, Lefevre L-P, Baril E, Nanci A (2010) Initial evaluation of bone ingrowth into a

novel porous titanium coating. J. biomed. mat. res. B: applied biomat. 94: 64-71.

93. Wen CE, Yamada Y, Shimojima K, Chino Y, Asahina T, Mabuchi M. (2002) Processing and

101 | P a g e

mechanical properties of autogenous titanium implant materials. J. mat. sci. mat. med. 13: 397-

401.

94. Wennerberg A, Albrektsson T, Johansson C, Andersson B. Experimental study of turned and

grit-blasted screw-shaped implants with special emphasis on effects of blasting material and

surface topography. Biomaterials 1996;17(1):15–22

95. Y. Ayukawa, A. Okamura and K. Koyano: Clin. Oral Impl. 15(2004), p. 346.

96. Yang Y, Kusano K, Frei H, Rossi F, Brunette DM, Putnins EE. Microtopographical regulation

of adult bone marrow progenitor cells chondrogenic and osteogenic gene and protein

expressions. J Biomed Mater Res A 2010;95: 294e304.

97. Yang Y, Rossi FM, Putnins EE (2007) Ex vivo expansion of rat bone marrow mesenchymal

stromal cells on microcarrier beads in spin culture. Biomaterials 28:3110–3120

98. Yen BL, Huang HI, Chien CC, Jui HY, Ko BS, Yao M, Shun CT, Yen ML, Lee MC, & Chen

YC (2005). Isolation of multipotent cells from human term placenta. Stem Cells 23, 3-9.

99. Z. Du, J. Chen, F.Yan and Y. Xiao: Clin. (2009), Oral Implants Res. 20p.145.

100. Zhang L, Kahn CJ, Chen HQ, Tran N, Wang X (2008) Effect of uniaxial stretching on rat

bone mesenchymal stem cell: orientation and expressions of collagen types I and III and

tenascin-C. Cell Biol Int 32:344–352

101. Zhao G, Raines AL, Wieland M, Schwartz Z, Boyan BD (2007) Requirement for both

micron- and submicron scale structure for synergistic responses of osteoblasts to substrate

surface energy and topography. Biomaterials 28: 2821-2829.

102. Zhao G, Schwartz Z, Wieland M, Rupp F, Geis-Gerstorfer J, Cochran DL, et al. High surface

energy enhances cell response to titanium substrate microstructure. J Biomed Mater Res A

2005;74(1):49–58.

103. Zheng, H., Guo, Z., Ma, Q., Jia, H., and Dang, G. (2004). Cbfa1/osf2" transduced" bone"

marrow" stromal" cells" facilitate" bone" formation" in" vitro" and" in" vivo." Calcif" Tissue"Int

74," 194P203.

104. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP, &

Hedrick MH (2001). Multilineage cells from human adipose tissue: implications for cell-based

therapies. Tissue Eng 7, 211-228.

osteogenic studies of drug eluting nanotubular laser...

Documents