of chemistry vol. 261, no. june 25, by u.s.a. structure of ... · the journal 0 1986 by the...

THE JOURNAL 0 1986 by The American Society of Biological Chemists, Inc.

OF BIOLOGICAL CHEMISTRY Vol. 261, No. 18, Issue of June 25, pp. 8442-8452,1986 Printed in U.S.A.

Structure of the Murine Serum Amyloid A Gene Family GENE CONVERSION*

(Received for publication, September 30,1985)

Clifford A. Lowell$, David A. Potters, Robert S. Stearmanv, and John F. Morrow From the Howard Hughes Medical Institute and the Department of Molecular Biology and Genetics, ‘Johns Hopkins University School of Medicine, Baltimore, Maryland 21205

Serum amyloid A (SAA) is an apolipoprotein produced by the liver in response to inflammation; the levels of SAA mRNA and SAA protein increase at least 500-fold within 24 h. We have obtained clones of all three genes and a pseudogene that make up the murine SAA gene family. Two of the genes have 96% sequence homology over their entire length, including introns and flanking sequences 288 base pairs (bp) 5’ and 443 bp 3‘ to the genes: an overall length of 3215 bp. The sharp boundaries between homologous and nonhomologous sequences and the absence of interspersed repeated sequences there suggest that conversion has occurred between these two genes. The homologous regions are bounded by short inverted repeats containing alternating purine and pyrimidine residues, as described for other gene conversion units. The third SAA gene has evolved separately, although all are closely linked on chromosome 7. Comparison of the upstream regions of the SAA genes with those of the rat fibrinogen genes, whose expression is also induced by inflammation, reveals sequences common to all six genes which are very improbable on a random basis.

Inflammation caused by infection or tissue injury induces large changes in the expression of a number of genes in mammalian liver. The serum levels of a set of proteins termed the acute phase reactants increase from 2- to lOOO-fold, de- pending on the protein (Koj, 1974; Kushner, 1982). There is species-specific variation in the relative synthesis of individ- ual acute phase proteins (Laurent, 1982). Serum amyloid A (SAA’) (polypeptide M, = 11,300) is the major acute phase protein in mice. Its serum concentration increases from a normal level of 0.5-5 pg/ml to between 250 and 1000 pg/ml 24 h after injection of bacterial LPS (McAdam and Sipe, 1976; Hoffman and Benditt, 1982). SAA circulates as an apolipoprotein of HDL particles, making up as much as 20% of the protein content of HDL (Hoffman and Benditt, 1982). HDL

* This work was supported in part by Grant 5POlCA16519-01 from the National Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$Recipient of Medical Scientist Training Program Grant 2T32GM07309 from the National Institutes of Health.

3 Supported by National Research Service Award 5F32GM09765- 02.

7l Present address: Dept. of Biophysics, Johns Hopkins School of Medicine, Baltimore, MD 21205.

The abbreviations used are: SAA, serum amyloid A; LPS, lipo- polysaccharide; bp, base pairs; UTS, untranslated segment; HDL, high density lipoprotein; My, million years; dd, dideoxy; SAA,,,, experiments which cannot distinguish between the SAAl and SAAZ genes and, therefore, measure the sum of both genes.

particles containing SAA have a reduced half-life (10-30-fold) in the circulation, suggesting that SAA may play a role in stimulating HDL clearance (Benditt et al., 1980). Because of the lipoprotein association of SAA, the term apo-SAA is also used for this polypeptide. In the disease process of amyloidosis associated with chronic inflammation, an N-terminal fragment of SAA is deposited in a number of tissues (Hoffman et al., 1984).

The rapid production of acute phase proteins by the liver is regulated by increases of mRNAs encoding these proteins. SAA mRNA levels increase at least 500-fold in murine liver during the acute phase response (Morrow et al., 1981; Stear- man et al., 1982). The mRNA coding for the major acute phase protein in the rat, q-acid glycoprotein, increases at least 90-fold in the liver (Ricca et al., 1981). The levels of mRNAs coding for other acute phase proteins also increase in hepatocytes (Baumann et al., 1983).

Factors released by LPS-activated macrophages stimulate SAA production in LPS nonresponder mice, in hepatic organ culture, and in primary hepatocyte cultures (Sipe et al., 1979; Selinger et al., 1980, Baumann et al., 1984). One of these factors is interleukin 1, also known as endogenous pyrogen or lymphocyte-activating factor (Merriman et al., 1977; Sztein et al., 1981; McAdam et al., 1982). Recent studies indicate that other proteins from monocytes or epidermal cells may also stimulate hepatic acute phase protein synthesis (Bau- mann et al., 1984). Thus, the acute phase response is a model system of coordinate expression of a number of genes, in a specific tissue, in response to hormonal stimuli. The magni- tude of the response, at least 500-fold for SAA mRNA, makes this an attractive system for the study of regulatory mechanisms in gene expression.

Murine SAA is encoded by at least two genes, since Hoff- man et al. (1984) found two separate SAA isotypes, SAA, and SAA2, with different N-terminal amino acid sequences in each of three inbred mouse strains. Yamamoto and Migita (1985) recently reported the isolation of two cDNA clones which encoded these proteins. We report here the isolation and complete nucleotide sequences of the two nonallelic SAA genes encoding the two SAA isotypes. These two genes have extensive sequence homology over their entire lengths, while a third SAA gene (Stearman, 1982) has diverged completely in its introns and in the untranslated regions of the exons. These three genes, and a pseudogene, make up the entire SAA gene family. Comparison of the upstream sequences of the SAA genes with those of the fibrinogen genes, which are also induced during inflammation, reveals common sequences which may regulate the coordinate expression of these genes.

EXPERIMENTAL PROCEDURES

Zsolation of X Phage Clones, Restriction Mapping, Filter Hybridiza- tion, and Sequencing-A BALB/c mouse DNA phage library kindly

8442

Serum Amyloid A Gene Family 8443

provided by M. M. Davis and L. E. Hood (California Institute of Technology) was screened (Maniatis et al., 1982) with the SAA, cDNA clone (Morrow et al., 1981; Stearman et al., 1982) and primer-extended cDNA probe (see “cDNA Methods” below; Stearman, 1982). Restric- tion maps of phages and subclones carrying the SAA genes were generated by single and double digests with various enzymes (New England Biolabs and Bethesda Research Laboratories) and confirmed by partial digestion of end-labeled fragments (Smith and Birnstiel, 1976). Regions containing homology to the SAA, cDNA clone were identified by hybridization following transfer to nitrocellulose (South- ern, 1975). Conditions used for hybridization to cloned DNA and mouse genomic DNA were described by Pearson et al., 1981. Regions of phage DNA which hybridized to SAA cDNA or primer-extended probes were subcloned into the bacteriophage M13 cloning vectors mp8, mp9, mpl0, and mpll for sequencing by the dideoxy method (Sanger et al., 1980). Regions outside of the SAA genes were sequenced both by subcloning restriction fragments into M13 as well as subcloning random fragments generated by sonication. The mapping and sequence determination of the SAA3 gene are described elsewhere (Stearman, 1982; Stearman et ai., 1986). Sequence data were analyzed using the computer programs of Staden (1980) and Conrad and Mount (1982).

cDNA Methods-Primer-extended cDNA probes and selected cDNA probes were used in hybridization to locate restriction fragments containing SAA gene sequences not in the SAA3 cDNA clone. The 71-bp AluI/XmuI fragment from the highly conserved region of the S a cDNA clone, 32P-5’-end labeled at the XmnI site, was annealed with 5 pg of LPS-induced poly(A+) liver RNA in 185 mM KC1, 10 mM Tris, pH 7.4, 5 mM EDTA in a volume of 13 pl in a sealed capillary for 1-2 h a t 55 “C. The reaction was then adjusted to reverse transcriptase conditions (Friedman and Rosbash, 1977) and incubated with 30 units of reverse transcriptase (Life Sciences) for 1-2 h at 42 “C. The reaction was stopped by addition of EDTA, the nucleic acid collected by ethanol precipitation, and the RNA degraded by incubation in 0.2 N NaOH at 50 “C for Vi h. Analysis of the full- length extension products on urea/polyacrylamide gels revealed that the primer was extended to products of two discrete sizes: one represented extension from SAA,,, mRNA, the other from S a mRNA. These mRNAs give extension products of different sizes because they have 5’ UTS of different lengths (Fig. 3).

The selected cDNA probe was constructed by hybridizing an M13 clone containing the conserved third exon sequences from SAA, with total [32P]cDNA made from LPS-induced liver RNA in order to purify the SAA cDNA by hybridization. cDNA was made, using a method modified from Friedman and Rosbash (1977), from 5 pg of liver poly(A+) RNA isolated 16 h after LPS injection. Reactions were carried out in a 100-pl volume containing 100 pg/ml actinomycin D, 20 mM p-mercaptoethanol, 10 pg of oligo(dT), 500 units/ml human placental ribonuclease inhibitor, 100 mM Tris, pH 8.3, 133 mM KCl, 10 mM MgCl,, 1 mM each of dATP, dGTP, and dTTP, 8-10 p~ [f- 32P]dCTP (100-200 Ci/mmol), and 50 units of avian myeloblastosls virus reverse transcriptase at 42 “C for 3 h. The reactions were stopped by addition of EDTA, the RNA was hydrolyzed, and the total cDNA was hybridized with the M13 clone by the procedure of Durnam and Palmiter (1983). The M13 clone used contained the message strand of the SmaI fragment spanning the third exon of SAA,. Hybridizations were done with a 4-fold molar excess of M13 clone, in 0.6 M NaCl at 69 “C, for 3 times the reannealing f . Hybridized cDNA was separated from unhybridized cDNA by chromatography on Seph- adex G-50. About 1.5% of the total cDNA hybridized to the M13 clone, and it consisted primarily of two discrete sizes of cDNA, 610 nucleotides (the size of the SAA, and SAAz mRNA) and 570 nucleotides (SA& mRNA).

Dideoxysequencing of the 5’ ends of SAA, and SAA, mRNA was carried out as described by Smith (1980), using 20-50 p~ ddNTPs. To prime synthesis, the 49-bp AluI/NcoI fragment from the second exon of SAA,, which hybridizes only to SAA, and SAAz mRNAs, was 5’-end labeled at the NcoI site and strand separated by hybridization to an M13 clone containing the mRNA strand of the second exon of S A A Z . The 32P-labeled fragment hybridized to the M13 clone was separated from the unhybridized strand and then from the M13 clone itself by gel filtration (Durnam and Palmiter, 1983). The single- stranded fragment was annealed with 5 pg of LPS-induced poly(A+) liver RNA and extended with reverse transcriptase as previously described, except that separate reactions were done for each ddNTP. The products were analyzed in urea/polyacrylamide gels. The sequence of the primer extension product was confirmed by chemical sequencing of full-length product. In this case, the extension was

carried out in the absence of ddNTPs and then the product was sequenced as described (Maxam and Gilbert, 1980).

Induction of SAA mRNA by LPS, Preparation of RNA, and S1 Nuclease Protection Mapping-Male BALB/c mice (20-30 g) were used. Fifty pg of LPS (Sigma, L-2630) dissolved in 4% serum was injected intraperitoneally to induce acute inflammation. Livers were removed and frozen in liquid Nz. Liver RNA was purified by homog- enization of frozen tissue in guanidinium thiocyanate, followed by repeated precipitation with ethanol (Chirgwin et al., 1979). Probes for S1 mapping were 5’-end labeled with [Y-~’P]ATP and T4 kinase and strand separated by hybridization to M13 clones, as done for mRNA sequencing. The single-stranded probe (2 X lo5 cpm or 0.2 pmol) was incubated with 5 pg of poly(A+) RNA from normal or LPS- induced animals in 0.3 M NaC1, 25 mM Tris, pH 7.5, 5 mM EDTA in a volume of 20 pl in a sealed capillary tube at 50 “C for 1 h. The hybridization was slowly cooled to 35 “C (3 h) and then adjusted to S1 buffer conditions (0.25 M NaCl, 30 mM Na acetate, pH 4.6, 1 mM ZnS04, 5 mM dithiothreitol, and 100 pg/ml denatured salmon sperm DNA) and digested with 200 or 1000 units of Sl/pg of nucleic acid. The S1 digestion was carried out for 1 h at 42 “C. The protected fragments were collected by ethanol precipitation and resolved on urea/polyacrylamide gels. Materiaki-Restriction/modification enzymes, M13 cloning vec-

tors, and bacterial host strains were obtained from Bethesda Research Laboratories or New England Biolabs and used as recommended by the supplier. S1 nuclease and DNase I were supplied by Boehringer Mannheim. Cloning of gel-purified SAA restriction fragments into M13 vectors, transformation of bacterial host strain K12 JM103, and preparation of single-stranded or replicative form recombinant DNA was carried out according to Sanger et al. (1980). Radioactive nucleotides were from New England Nuclear or Amersham Corp.

RESULTS

Isolation of XSAA Clones and Organization of Coding Re- gions--X phage recombinants containing the SAA genes were isolated from a BALB/c mouse genome library (see “Experi- mental Procedures”). The restriction maps of the regions around the SAA genes are shown in Fig. 1. Exons 3 and 4 (filled boxes) encoding all but 12 amino acid residues of SAA were located by blot hybridization with the SAA, cDNA clone, followed by sequencing of hybridizing fragments. The cDNA clone contains 14 nucleotides of the second exon and all of the third and fourth exons of the SAA3 gene (Stearman et al., 1982).

The gene regions coding for the 5’ end of the mRNA were mapped using two separate radioactive probes which contain the 5‘ mRNA sequences: primer-extended probe and hybrid- selected cDNA. Primer-extended probe was constructed by hybridizing a 5l-end-labeled primer with the SAA mRNA, then extending the primer with reverse transcriptase. Hybrid- selected cDNA was made by using an M13 clone containing conserved SAA coding sequences to purify SAA cDNA from total cDNA by hybridization and subsequent gel filtration (see “Experimental Procedures”). These probes were hybridized to blots of digested phage DNA or large subcloned fragments to map exons 1 and 2 approximately, and the fragments which hybridized were sequenced. The 5’ border of exon 2 and all of exon 1 were mapped by dideoxy sequencing of the 5‘ end of SAA,,, mRNA (Smith, 1980; see “Experimental Procedures”). The nucleotide sequences of the 5’ ends of the mRNAs were confirmed by chemical sequencing of the full length primer extension products (Maxam and Gilbert, 1980). The resulting sequences were compared to the sequences of the genomic DNA to locate the precise boundaries of exons 1 and 2. The 3’ borders of the second exons of SAA, and SAAB were located by comparison of their sequences with the 14 nucleotides at the 5’ end of the cDNA clone and by comparing the predicted amino acid sequences with the N-terminal sequences of BALB/c SAA polypeptides.

The locations of the 5’ mRNA cap sites were confirmed by an S1 protection experiment using SAAz DNA 5‘-end labeled

8444 Serum Amyloid A Gene Family

SAA 1 T

2 kb FIG. 1. Structure of the murine SAA genes. The restriction maps of the SAA,, SAA2, and S& genes are

shown, aligned at their third exons. The direction of transcription (5' to 3') is from left to right. The exon sequences are shown as tilled boxes; the thinner regions represent the 5' and 3' untranslated sequences of the exons. The hatched box designates the location of the pseudogene. The vertical dashed lines indicate the boundaries of the homology between the SAA, and SAAz genes. The proposed gene converson is symbolized by the two-headed arrow. The locations of interspersed repeated sequences are indicated with diamonds: filled diamonds for B1 repeats and the open diamond for a repeat of another family. The B1 repeat near the 5'-end of the SAA, gene is not at the boundary of nucleotide homology with the SAAZ gene. It begins 73 bp 5' to the boundary and extends upstream from that point.

at the BglII site in exon 1 (see "Experimental Procedures"). DNA fragments ranging in size from 15 to 20 nucleotides were protected in samples annealed with LPS-induced RNA (Fig. 2, lanes 4 and 5 ) . The alignment of the protected fragments with the nucleotide sequence of the probe (shown in the right 4 lanes) localizes the cap sites to the positions predicted by the primer extension experiments (above). The multiple bands seen in the S1 protection experiments most likely result from heterogeneity in the absolute 5' ends of the SAA,,, mRNAs, since fragments spanning at least 5 nucleotides are seen even with a high concentration of S1 nuclease (Fig. 2, lane 5 ) . Such conditions yield fragments spanning 3 nucleotides if the RNA has a single 5' terminus (Sollner-Webb and Reeder, 1979). Similarly, the SAA,,, DNA resulting from reverse transcriptase extension of primer annealed to mRNA (see "Experimental Procedures") had 3' ends spanning 5 nucleotides. The 3' ends are homogeneous or vary by one nucleotide if the RNA has a single 5' terminus (Sollner-Webb and Reeder, 1979; Hovemann and Galler, 1982). Heterogene- ity in the 5' ends of SAA, mRNA has also been observed (Stearman et al., 1986).

Comparison of the maps of SAA, and SAA, reveals that most of the restriction sites are in identical locations within the genes but are completely unrelated in the neighboring DNA (Fig. 1). There is no similarity between the SAA, restriction map and those of the other SAA genes. The X phage recombinants containing the SAA genes do not appear to overlap, based on comparison of their maps. Hybridization studies of DNA from recombinant inbred and congenic mouse strains, using the SAA, cDNA clone as probe, reveal that these SAA genes are closely clustered on chromosome 7 (Taylor and Rowe, 1984). We conclude the SAA1, SAAZ, and

SAA3 genes are nonallelic because they were isolated from an inbred mouse strain. The mapping studies with various mouse strains confirm this conclusion.

Nucleotide Sequences of the SAA Gene Family-The complete nucleotide sequences of the SAA,, SAA2, and +SAA genes are shown in Fig. 3. The alignment of the SAA, and SAA, sequences reveals 96% homology over the entire region of the genes, including intervening sequences and flanking DNA. The homology extends from 288 bp upstream from the 5' cap site of SAA, to 443 bp downstream from the 3' end, an entire length of 3215 bp. Beyond these boundaries, the sequences of SAAl and SAA2 are completely nonhomologous. The transition between the homologous and nonhomologous sequences is very sharp (Fig. 3). Within the homologous region the majority of nucleotide differences are due to base substitutions, with few insertions or deletions. The largest insertion or deletion occurs 230 bp 3' to the genes where the sequence CAGGGAC appears once in SAAl but twice in SAA,. This may be the result of slipped pairing during replication, as suggested for other genes (Efstratiadis et al., 1980). The sequence of the SA& gene is also shown for comparison (Stearman, 1982; Stearman et al., 1986). In contrast to the uniform homology between the SAA, and SAA, genes, the SAA, gene has significant homology to them in exon 3 and in the translated portion of exon 4 (Table I). The SAA, gene has no homology to SAAl and SAAz in exon 1 (which is approximately 21 bp longer in SAA,), in the UTS of exon 4 (which is 82 bp shorter in SA&), or in the three introns.

We propose that the extensive homology of the SAA, and SAA, gene regions, each flanked by nonhomologous DNA, results from conversion between these genes (see "Discus- sion"). We note that the 5' and 3' boundaries of the homol-


123- 111- 91-

77- 68-

35-

27.

16

GC M12345G3TC

2 G

G A

T

G G

A T G T G

G G T A T . C

T

G

G

T

G

FIG. 2. Localization of the 5' cap sites of the SAA, and SAAz genes. The single-stranded SacI/BglII fragment from the SAAz gene (Fig. l), 5'-end labeled at the BglII site in exon 1, was annealed with RNA, then incubated with S1 nuclease. The protected fragments were analyzed by use of a 15% polyacrylamide-urea gel. Lanes: M, markers; I , probe alone (160 nucleotide); 2 and 3, probe annealed with 5 pg of normal liver poly(A+) RNA and incubated with 200 or 1000 units, respectively, of S1/pg of nucleic acid; 4 and 5, probe annealed with 5 pg of LPS-induced liver poly(A+) RNA and digested with 200 or 1000 units of S1, respectively, per pg of nucleic acid. In order to align the SI-protected fragments on the genomic sequence, a sequence ladder of the probe, produced by Maxam and Gilbert degradation, was run in the right four lanes. The sequence of the anti-sense strand near the cap site is shown. The SI-protected fragments migrate 1% nucleotides behind the corresponding fragments produced by chemical degradation (Sollner-Webb and Reeder, 1979). This difference was taken into account in locating the cap sites shown in Fig. 3.

ogous regions contain simple sequences consisting in part of alternating purine and pyrimidine residues, e.g. 12 bp of (AC) sequences at the 5' boundary near the SAA, gene. The sequence at the 5' homology boundary of SAA, is an imperfect inverted repetition of the sequence at the SAA, 3' homology boundary; 12 out of 14 bases match, with one gap introduced

(brackets, Fig. 3). Similarly, the sequence at the 5' homology boundary of SAA2 is an imperfect inverted repetition of a sequence near the SAA, 3' homology boundary (brackets, Fig. 3). Alternating purine and pyrimidine residues have also been found at the gene conversion boundaries near the a- and y- globin genes and the a-CH immunoglobulin genes (Shen et al., 1981; Michelson and Orkin, 1983; Flanagan et al., 1984). Flanagan and co-workers suggest that such sequences may help promote gene conversion because of their ability to untwist during transition from right-handed to left-handed helices. The ends of the region of homology between SAA, and SAA, do not contain direct repeats as the two a-globin genes do (Schon et al., 1982).

The interspersed repeated elements around the SAA genes were mapped because of their possible relationship to recombination among the genes. The repeats were mapped in blot hybridization experiments, using as probe either a cloned B1 repeat or total nick-translated mouse DNA. B1 sequences are the predominant type of interspersed repeat in the murine genome and are related in sequence to human AluI repeats (Deininger et al., 1981; Bennett et al., 1984). Six B1 repeats and one other repeat were found near the SAA genes (Fig. 1). A B1 repeat is found near the SAAl gene, beginning 73 bp 5' to the homology boundary and extending upstream from that point. There is no apparent relationship between the locations of the other interspersed repeats and the homology boundaries among the SAA,, SAA2, and $SAA genes. The only repeated element found near the SAA, gene resides within the second intron of the gene.

The SAA genes contain the known DNA sequences required for transcription and mRNA processing. All the splice junc- tions at the intronlexon boundaries contain the consensus sequences deduced from other genes (Mount, 1982). The polyadenylation signal sequence AATAAA (Proudfoot and Brownlee, 1976) is found 21 bp upstream from the polyadenylation site of SAA, and SAA2, 15 bp upstream in SAA3, and also in the pseudogene. At the 5' end of the SAA, and SAA, genes, the sequence ATAAAT is found 27 bp upstream from the cap sites, while SAA3 has the sequence TATATATA 28 bp 5' to the cap site.

The $SAA sequence is related to the 3rd and 4th exons of the SAA genes (Fig. 3). The pseudogene contains only exon 3 and exon 4 of a complete SAA gene. Sequence analysis and hybridization experiments failed to detect sequences homologous to exons 1 or 2 of the other SAA genes upstream from the pseudogene. In addition, $SAA is incapable of coding for a protein product because of a 25-bp deletion in exon 3 which causes an in-frame stop codon downstream. Finally, no RNA derived from the pseudogene is detected in S1 protection experiments (data not shown).

The Complete SAA Gene Family Consists of the SAA,, SAA,, SAA, and $SAA Genes-To determine the total number of SAA genes, two fragments from the 5' halves of the genes were used as probes in filter hybridization to mouse DNA. One fragment hybridizes with SAA, and SAA2 but not with SAA3; the other hybridizes with SAA3 alone. In a third experiment, a mixture of probes was used to determine whether there are any other SAA-like sequences in the genome. The probes were fragments from the 3rd and 4th exons of both SAA, and SAAB, which contain sequences highly conserved among the SAA genes. In each hybridization, all of the restriction fragments expected from the SAA gene maps annealed with the radioactive probes, and there were no extra hybridizing fragments (Fig. 4). As an example, there is only one hybridizing band present in each digest on the filter incubated with the SAA3 gene-specific fragment, excluding digests with


G G C C C A G C C ~ ~ C C C C T G G G ~ T G T T C C ~ ~ ~ ~ A ~ T G C C T C C ~ ~ C C ~ ~ G C C T C T ~ T T G T G T ~ G ~ T C T T ~ G C C ~ T ~ T T ~ ~ ~ T ~ T ~ T ~ ~ C A T ~ ~ C T A C ; I ; A T T ~

C A A ~ ~ C T A $ A A ~ G T C A G A A ~ T G T ~ A & & M ~ ~ G T C ~ ~ C C C ~ ~ A

T G C T / U G G A A G A A G T A G A G ~ C C C T G T G G G G C C A ~ ~ ~ ~ ~ ~ ~ C A T C T ~ T T G T ~ A ~ ~ G C A G G T ~ T A ~ T G C C ~ C C C C A A G A G C T ~ ~ T T A T ~ T ~ T ~ T ~ .. .... A ~ ~ M ~ ~ A T ~ ~ ~ A ~ T ~ ~ A A ~ ~ T G ~ ~ ~ G ~ ~ T ~ T C A T G ~ A A ~ A ~ ~ T ~ ~ ~ G T ~ ~ G A ~ A ~ ~ ~ C C C C T C T C C A S A T T ~ T G S ~ ~ G T ~ ~

C T A G T A G A A G C C T C T A C A A A A A C A C A G A C T G T C T G G T G G A T A ~ A T A C A C T A A T G A G C T C A G T ~ T ~ A G T A A T ~ T ~ ~ ~ ~ ~ ~ ~ G ~ A G T C A ~ A ~ ~ G T A T ~ ~ C ~ T ~ A ~ ~ C C ~ ~ ~ A ~ ~ ~ ~ ~ ~ ~ G C C ~ A A T C A G A G A C T G G G G G G A ~ T G A G G C A G G C A G A T ~ C T C T ~ ~ ~ ~ C A ~ ~ T ~ ~ ~ T C T ~ ~ G T G A G ~ ~ C ~ A A ~ A G C C A ~ T ~ ~ A ~ T C C T G T C A T ~ ~ .... . A G A G A ~ A ~ ~ ~ T G ~ ~ T ~ T A ~ C A G T C C T ~ C ~ C ~ C ~ ~ ~ ~ T ~ * + CA~A~CCTGAKASTGATTA ~ ~ ~ ~ ~ ~ T G ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ .. . . . .. ... .......... ............. . ... .. ...... . .......... ~ G T C G A G T G ~ ~ C T C T G C A ~ ~ G ~ ~ C T ~ T G C ~ C C T A ~ ~ C C C T A T C C ~ C T C C ~ ~ C ~ A ~ ~ C ~ ~ C ~ C C ~ C ~ ~ C C ~ ~ ~ C ~ C - - C C C ~ C ~ ~ G ~ ~ ~ C C ~ ~

~ ~ A T C ~ C A T G A ~ ~ ~ A T C A C A ~ ~ ~ ~ A ~ ~ T T T C T A T A ~ ~ T ~ ~ C C ~ ~ C ~ C C A A ~ ~ ~ ~ A T ~ ~ G ~ C T T ~ T T A T G C T A C T A T G C C C C A G A A G A C T G C T A C A G C A C A G A A A A C T C C T G T G C T C C C A ~ ~ ~ ~ T G A ~ ~ T ~ C C T ~ T G G A T ~ ~ G C T C A ~ ~ A C C ~ ~ ~ C T G T C A ~ % i ~ i ~ c A c C C ~ ~ ~ ~ ~ c ~ C c ~ A C A ~ ~ G ~ ~ i C C ~ ~ % i ~ ~ C C ~ ~ ~ ~ C ~ ~ ~ ~ ~ ~ C i ~ i ~ i ~ ~ ~ i C ~ ~ ~ ~ C C ~ ~ ~ ~ C ~ G i C ~

~ C C A A C ~ A G G A T ~ G ~ ~ C A ~ T C C T ~ ~ ~ C A ~ A A ~ C T ~ T G C ~ T A ~ T ~ ~ T C T ~ ~ ~ T G T A ~ ~ ~ ~ ~ ~ T C ~ ~ C T ~ C A G T C ~ A C A A G A A A T G A ~ ~ G T C T G G A G T T T T C C ~ ~ G T ~ T ~ C A ~ T G T C C ~ G C C C - T C A C C T ~ ~ ~ G A ~ T C A G C A T ~ T ~ C T ~ C T C C T C T C A C C T A C A C C C A T 1 1 1- ~ ~ ~ ~ A ~ M ~ ~ ~ f f G t ~ t G t A ~ ~ ~ M ~ ~ ~ ~ ~ ~ A ~ t G ~ ~ ~ f f ~ ~ ~ ~ c t ~ ~ ~ ~ ~ ~ A ~ ~ ~ ~ A ~ ~ ~ ~ ~ ~ t ~ ~ ~ ~ ~ ~ ~ ~ ~ A ~ ~ ~ A ~ A ~ ~ ~ ~ ~ ~ ~ A T G G G T ~ G ~ G G A ~ T A T G C A ~ T C ~ ~ ~ ~ ~ ~ T C C A ~ A G T ~ G ~ ~ A G ~ A T A T A T A ~ T A T C C T C ~ C A ~ ~ C T C C T ~

t t *~cCA~C~~~~i~CC~ACC~.. i~~~~iCC~~C~~C%i~~~~~iG%iG~CCiCiC~Gi~CC~CCf~~fCi~iC~C~Gi~i~~i ... .................................................................................................................... T ~ G G T C C C A G A A ~ G ~ T C ~ G ~ A C ~ * . ~ ~ G T T ~ C A G A A C T ~ ~ C C A G ~ ~ \ T T T C C T C ~ ~ ~ ~ G A T ~ C ~ ~ T C C C C G C C A ~ ~ ~ ~ T ~ ~ ~ ~ G ~ G ~ A A T G ~ C ~ A T C T C ~ A T C

. .. . . . . . . . . . . . . ..

. . . . . . . .

. . , . . . . .

. . .. . .

....... .......... ... .. .......... ................................ .............. .................................. .. .. . .. . . . . . ..

. . . . . . . ...

* ? ? .... .. . . . TCACCAGATCTGCCCAGGAGACC T G A G A ~ A G A T C C G G G C A C A ~ C T ~ f T ~ r r G C T G T G ~ C C T C T ~ A G T ~ C C T C C T ~ r r C f G C T C A C r r G T ~ ~ G T

. ... . . . .. . . .. .

E C C A G G C T G A G G A G A C A C A T ~ T G C ~ C C T A C T ~ f C A ~ G C T C C T G ~ ~ G f ~ G A C C T ~ T ~ T C C C T ~ C C C T C C A G A C C C C T C T C T A C T ~ C T G C C T G C C T T C r r A G ............ ............................................................................................... ........... . . . . . . . . . . . e ............................................................................................... ........... G C C A G G C T G A ~ G A C A ~ T ~ ~ T G C ~ ~ T A C T G A CTG~T~CACTA~ATGGTTA~AATTC

~ A G A G G T A G ~ ~ G A G C A G G C ~ T ~ T ~ T G A ~ C T ~ ~ A G C C T T G T G G C T C T ~ ~ ~ G G T C C T ~ T ~ ~ ~ ~ ~ T C T C A ~ ~ C T ~ T ~ ~ C A C A C A T ~ T A G C A G ~ A ~ ~ A ~ ~ ~ ~ A G ~ A ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ A ~ ~ ~ G ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ A ~ ~ A ~ ~ ~ ~ ~ ~ A ~ ~ A ~ ~ ~ G

~ M ~ ~ i . ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ A ~ ~ A ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ A ~ t M ~ ~ T G A G C A G G G C C T G T G T ~ T ~ G A G G C C A A ~ G ~ ~ A C C A G T C T G T ~ ~ T C T C C T C C A ~

. . . ... .. CT~;CAGAAGCATCCTCCACC~$CGAM~CATGI%A~~TTTG

... ..

~~CTGCTCCCTGCTCCTGGTCTGCCAT CCCCACCTCTAGGGGTGfCCTGAGCATTCAGGGGGGTT . . . e . . . . . . . . . . . . . . . . . . . . . . . . . . C C t i A C t ~ ~ ~ ~ f f i f f i ~ G % i C i ~ ~ ~ ~ ~ C A ~ ~

~i~~Aliffi~~c~~ffi~~t~irr~~~~~~~iAA~~ TKTGCTCCCTGCTCCTGGTCTGCCAT ................................ ...................................... . ... . .. ...... .... . . .. . .. . . .

E G A C T C A C T G C T C T G C T T G C f ~ ~ C A G G G G T T C C T ~ ~ C T T C C T G C T A A G C A ~ T ~ A T A C A G ~ ~ G G C A ~ A G G A r r A T ~ C C A ~ T ~ T T ~ G G C C A A T C T G A T C T ~ i ~ ~ ~ ~ t C t ~ % i i G C i ~ ~ C C ~ ~ ~ C ~ i ~ ~ ~ ~ t C i ~ i A T ~ i A C % i ~ A ~ ~ ~ G ~ ~ f f i C ~ ~ ~ ~ ~ ~ ~ ~ ~ C C ~ ~ i ~ ~ ~ ~ C ~ ~ ~ c T G ~ ~ t ........................................................ a . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .......... C ~ ~ ~ A G C A ~ ~ C A ~ A : A S A ~ ~ C A T ~ C ~ G ~ ~ T C ~ C C A T A ~ G T ~ G G ~ G T A G C T C T T C C T G A ~ G T ~ G T A G C ~ ~ G C T C A G T G ~ ~ C ~ ~ T G T ~ G

~i~ iC~CfGK~~t t~CAGi~ i~ iA i~~~Ai~~~~~~i~ iC~CCi~~~ iGi~~~~~iA~f f i i t~~~GTCc~CCCi~~CC~~~G~t .................................................................................................... . ................. EACTGAAAGTCGGCCTGACATTCCTCAGTGCATTTAT~G~CAT~GCTACT~T~ATCACCT~GA~TGT~fAGCTCAGA~TCCAGACA~TTCCCTGCACCTAGAGTC

UTCC

FIG. 3. Nucleotide sequences of the SAA genes. The sequences of the SAA,, SAA2, and +SAA genes, shown in the 5’ to 3’ direction, are aligned to maximize homology. Shown for comparison are the sequences of the SAA, gene exons and flanking DNA that had been previously determined (Stearman, 1982). The SAAa intron sequences were not completely determined. The 5’ end of the 4th exon of SAA, was localized by hybridization of the DNA with mRNA and resulting protection from S1 digestion. The four separate exons are enclosed in boxes. The 5’ mRNA cap sites are shown by arrows; they were determined by S1 protection (Fig. 2) and primer extensidn experiments. The boxed M indicates the AUG start codon in the second exon. The codon for the first amino acid of the secreted SAA protein, also in the second exon, is indicated as #l. The termination codon in the 4th exon is indicated by the S. The 5’ DNA homology boundary is located at nucleotide 547, and the 3’ DNA homology boundary is near nucleotide 3750. The inverted repeats near these boundaries are indicated with the brackets (above the sequence for SAA,, below for SAAz). The sequence of SAAz shown extends from the first EcoRI site 774 bp 5’ to the gene (Fig. 1) to a Sau3A site 930 bp 3’ to the gene. The SAA pseudogene sequence shown is continuous from the EcoRI site 5’ to the pseudogene to the Hind111 site 3’ to it (Fig. 1). The numbering of the nucleotides is for the SAA, sequence; each 20 nucleotides are indicated with a single dot. More than 95% of the coding regions of the SAA, and SAAz genes were sequenced on both strands. Ninety-five per cent of the SAAI DNA sequence and 84% of the SAAz DNA sequence shown were obtained on both strands. Seventy-four per cent of GSAA was sequenced on both strands.

720

839

959

1079

1199

1319

1439

1559

1679

......................... .&&?ciricuCii&ii&ti&iA

FIG. 3"continued.

PstI or EcoRI (panel A, lanes 4, 7, B ) , enzymes which cleave this SAA, gene fragment. In contrast, there are two hybridizing bands in each digest using the SAAz probe (panel B), one each from the SAAl and SAAz genes. Hybridization with the mixed probe (panel C ) produces a more complicated pattern, but the sizes of all of the fragments agree with the restriction maps of the SAA1, SAAZ, SAA3, or +SAA genes. These results indicate that there are no other members of the SAA gene family.

Homologous Sequences Upstream from the SAA and Rat Fibrinogen Genes-Inflammation causes the coordinate induction of a number of proteins synthesized by the liver,

including SAA and fibrinogen. Comparison of upstream DNA sequences from these genes may reveal common sequences which may be regulatory. The fibrinogen protein complex consists of three distinct polypeptides, a, p, and y, each of which is increased during inflammation. While the DNA sequences encoding these three polypeptides are not significantly homologous to each other, there are homologies upstream from these three genes (Fowlkes et al., 1984). Since the three fibrinogen genes diverged from each other more than 500 My ago (Doolittle, 19831, the conservation of upstream sequences suggests that they have a functional role. The comparison of these homologies with the SAA genes is


FIG. 3"continued.

TABLE I Sequence homologies in the SAA gene family

The nucleotide homologies among the SAA genes are shown to illustrate the wide variation in degree of homology. UTS indicates untranslated segment; IVS indicates intervening sequence. Note that exon 1 contains only 5' UTS sequences and that < 25% homology indicates random DNA sequence matches. The asterisks mark the number of nucleotides sequenced in the SAA3 introns; their entire sequences have not been determined (Fig. 3).

Length Homology

S A A J S A A a SAA, SAA, US. S A A a SAA, us. SAA, SAA, us. S A G

bP % Exon 1 36 51 97 <25 <25 Exon 2 95 95 96 54 54 Exon 3 139 139 94 90 81 Exon 4" 139 139 96 71 69

Coding overallb 369 369 95 73 72 5' UTS 40 61 98 <25 <25 3' UTS 210 128 91 <25 <25 IVS 1 422 178* 99 <25 <25 IVS 2 1032 191* 96 1 2 5 <25 IVS 3 412 36* 99 <25 <25

Overall homology unit 3215 96 Protein coding only.

* Including signal peptide.


shown in Fig. 5A. The fibrinogen- and SAA-coding regions are not significantly homologous. However, sequences flanking all three of the SAA genes are homologous to part of a 99- bp 5”flanking sequence shared by the rat fibrinogen genes. The probability of finding these homologies by chance is very low. For example, the best homology of the SAA, and p- fibrinogen DNAs is 25 bases matched in a 39-base sequence, with no gaps introduced (Fig. 5A; 167-206 bp upstream from the P-fibrinogen gene). The P value (Davidson et al., 1983) for this match is 1.2 x The probability is 0.4% of finding any match of 25 out of 39 bases between the 99-bp fibrinogen sequence and 250 bp of SAA, upstream DNA on a chance

A 6 C 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9

9.6- - 6.6- - 4.4- -

2.3- 2.0- 1.6-

- - -

0.6- -

FIG. 4. Determination of the number of SAA genes in the murine genome. BALB/c liver DNA (15 pg) was digested with restriction enzymes, electrophoresed in 0.8% agarose gels, denatured, and transferred to nitrocellulose. Panel A was hybridized with the SAA3 gene-specific probe, panel B was hybridized with the probe specific for the SAA, and SAA, genes, and panel C was hybridized with the mixed probe (see below). The enzymes used were as follows: lane 1, BamHI; lane 2, XbaI (note that this is a partial digest); lane 3, BglII; lane 4, PstI; lane 5, HindIII; lane 6, BglII + HindIII; lane 7, PstI + HindIII; lane 8, EcoRI + HindIII; lane 9, BamHI + HindIII. The BglII/SmaI fragment containing the second exon of SAA2 was used as a probe specific for the SAA, and SAAz genes. The BamHI fragment containing exons 1 and 2 from SAA3 was used as a probe specific for this gene (Fig. 1). The mixed probe contained the PstI fragment from the 3’ half of the SAA, gene and the XbaI fragment from the 3’ half of the SAA3 gene. Probe DNAs were labeled by nick translation and hybridized as described (Pearson et al., 1981).

basis (Goad and Kanehisa, 1982). The probability is even lower of finding a homology to this same sequence upstream from five genes whose coding sequences do not share significant nucleotide homology (Fig. 5A): approximately IO-’ in five random 440-bp sequences (Davidson et al., 1983). The SAA, gene is not counted separately from SAA, in this cal- culation because they are 96% homologous. Nevertheless, the corresponding portion of SAA, upstream DNA matches 24 of 39 bases of @-fibrinogen DNA.

The common fibrinogen sequence also contains 20-bp partial direct repeats, shown in boxes (Fig. 5A), separated from each other by 25 bp in the case of the P gene. Their similarity is maximized by introduction of one gap into each. These direct repeats have significant homologies to the SAA, and SAA3 upstream DNAs (with probabilities less than 1% for random sequences).

Comparison of the SAA genes among themselves reveals the 26-bp homology shown in Fig. 5B; 20 bases match, with no gaps introduced. The probability of finding this homology between 2 random sequences of 200 bp each is 0.1% (Goad and Kanehisa, 1982). There is no other significant homology between the 5’ flanking sequence of SAA3 and those of SAA, and SAA2. Furthermore, there is no detectable homology between SAA, and SAA, beyond the 5’ homology boundary, 288 bp upstream from the RNA cap sites.

DISCUSSION

Gene Conversion and SAA Gene Evolution-There is a region of 3215 bp of 96% DNA sequence homology between the SAA, and SAA, genes. This region includes intervening, upstream, and downstream sequences and is flanked by nonhomologous DNA sequences (Figs. 1 and 3). We propose that this extensive homology, including intervening sequences, is the result of gene conversion. Gene conversion is a nonreci- procal recombination between two genes (allelic or as in this case nonallelic), which maintains their sequence homogeneity without altering the gene number (Baltimore, 1981). Unequal crossover and gene conversion have been proposed as general

A

SPA3 ... TTCAGAAAGTCCTAACTGGCCACAATT . . 32 bp . . . . . . . . . . AAAGIUGATGTACAAWGTTATCTTCTG . 98 bp . . . . . . 5‘ nRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ........... ............. R a t 6-fib. TTch . . 37 bp . . . . . . . . . . ~~TI%GCCA~AGTGAGG~AGAGCTGTCTGATG . 167 bp . . . . . . 5‘ nRNA

SPAl ......................... MCTGTCTCCTGTGCTCCCATTGCACAATGAWGIUTGACCTGTG-GATG . 148 bp . . . . . . 5 ’ IRN4 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... R a t 6-fib. ..................... ##GAACGTCCTGTGTCCACA7PAGGCW\GWGTGAGGAAGAGCTGTCTWG . 167 bp . . . . . . 5‘ MNA

R a t r-fib. AWGTTCCCTTCTTCCACCCCTTGGCT. 14 bD . . AGTAATAGCCTGT66CTACA~~CA~CTCA66CT~TTGGTTGCAG . 336 bp . . . . . . 5‘ “4 .. . . . . . . . . . . . . . . . . . ................................. ................................. R a t E-fib. TTC$$tR&i. 16 bp . . $WC GTCCTGTGTCCACA~GGCCAGCAGTGAGGAAGAGCTGTCTGATG . 167 bp . . . . . . 5‘ nRNA

R a t a-fib. CiAGGATTGTTGGTGTll&GCCATCGGTT. 2 bp .. TGTCTTGACCTTGGGTAGAWTAATCTGTTAACATAAATGGCTTTTA . 393 bp . . . . . . 5‘ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

8

SAA. . . AAATGACTTGTCTGGAGTTTTCCCAA .. 48 bp . . ATAAAT .. 21 bp ...... 5‘ nRNA A ........................ ........................

S% . . AAATGACTTGTCTWGTATTACCPA . . 49 bp .. ATAMT .. 21 bp . . . . . . 5‘ MNA

SAA3 .. PAAGCATTTGTCTTGATTATTTCCAA . . 179 bp .. TATATATA . 21 bp ...... 5‘ MNA .................... ....................

FIG. 5. Upstream sequence homologies between SAA genes and fibrinogen genes. A, computer-aided comparison of the SAAl and SAA3 upstream sequences with the rat @-fibrinogen 5’ flanking DNA reveals statistically significant homologies. The top comparison shows the alignment of SAA3 with @-fibrinogen upstream DNA. The middle set shows SAA, aligned with the same @-fibrinogen sequence. The third set shows the alignment of the rat a- and y-fibrinogen genes with the same region of the rat P-fibrinogen upstream sequence (from Fowlkes et al., 1984) for comparison with the SAA homologies. The boxes enclosing @-fibrinogen sequences designate partial direct repeats. The distances of the homologies from the 5‘ cap sites are shown. B, computer-aided comparison of the sequences upstream from the SAAI, SAA2, and SAA3 genes reveals the homology shown. Its distance from the “TATA” sequence is shown, with the location of the 5’ cap site.

8450 Serum Amyloid A Gene J’amily

evolutionary mechanisms for maintenance of homology among members of a gene family (Baltimore, 1981). Gene conversion is thought to occur by single-strand exchange between two genes, resulting in heteroduplex formation, followed by mismatch repair of the hybrids (Petes and Fink, 1982). Other examples of apparent gene conversion in higher eucaryotes have been reported, initially in the fetal globin genes (Slightom et al., 1980) and immunoglobulin genes (Bal- timore, 1981). Other possible mechanisms of recombination to account for the structures of the SAA genes are less attractive. Recombination by a single unequal crossover would not explain the fact that SAA, and SAA, are highly homologous over a limited region, flanked on both sides by completely nonhomologous sequences. The possibility of recombination by double unequal crossover cannot be ruled out. However, the probability of double crossovers is low, particularly since there are no common DNA sequences at the homology boundaries (such as interspersed repeated elements) which could have served as target sites for homologous recombination. Sugawara and Szostak (1983) ruled out double recombination as a mechanism of gene conversion in yeast, using genetic analysis.

The structures and sequences of SAA, and SAA, indicate that these genes have evolved in concert, while SAA, has evolved separately (Fig. 1). The introns of the SAA3 gene are located in the same positions within coding regions as the SAA, and SAAZ introns; however, their lengths are quite different. Consequently, the SAA, gene is larger overall than SAA, or SAA2 (Fig. 1). At the nucleotide level, SAA, is significantly homologous to SAA, and SAA, only in the 3rd exon and in the translated region of the 4th exon (Fig. 3, Table I). The degree of divergence between SAAB and the other genes is especially reflected in the fact that the 5’ and 3’ UTS of SAA3 are not homologous in sequence to the SAA, and SAA2 UTS and are different in size. The intervening sequences of the SAA3 genes are also nonhomologous to those of SAA, and SAA2.

Yamamoto and Migita (1985) recently described cDNA clones encoding SAA, and SAA,. These are from BALB/c mice, as are the mouse genome clones described here. Their 1159-nucleotide of sequence data is identical to the exon sequences presented here, with one exception in the 3’ untranslated region. Nucleotide 3240 in Fig. 3 (a G) is not present in the sequences they present. It was found in four separate experiments in this study using dideoxy and chemical cleavage methods of sequencing. Their results confirm the exon boundaries which we determined (Fig. 3), except that they place the 3’ end of SAA4s last exon 4 nucleotides 5’ to the location we estimated by S1 nuclease-mapping studies. There may be heterogeneity in the poly(A) addition sites of the mRNAs, since they show SAA, cDNA as one nucleotide shorter than SAA2, although their sequences are the same for the preceding 12 bases.

The encoded SAA3 protein has as much homology to murine SAA, and SAAz proteins as it does to human SAA and mink SAA (Fig. 6). Consequently, the duplication which gave rise to an SAA, gene separate from the SAA, and SAAZ genes may have occurred about 85 My ago, the time of the mammalian radiation (Efstratiadis et al., 1980).

We also infer that the duplication that produced separate SAA, and SAAz genes occurred more than 50 My ago because of the divergence of their flanking nucleotide sequences beyond the homology boundaries (Fig. 3). At the time of the duplication, additional flanking sequences beyond these points were most likely duplicated along with the genes, by analogy to other gene families on a single chromosome (Ef-

NonkeyM H A R G H Y D A A Q R G P G G V Y A A ~ E A I S D A R E ~ I K L L ~ H Mink M H A R G N V D A A I d R G P G J A L V AI1 5 D A R E I R Qk

’” ’‘ J:5~nrD~ ~-JH F D A ~ K[ SM‘ Gene

G H E D T I A D O E A N R H G R S G K D P N Y Y R P P G L P D K Y G H E D T R A D Q E A N R H G R S G K D P N Y Y R P G L P A K Y G A E D S R A D F A N E Y G R S G K D P N H F R A G L P K R Y

H d n SPAl Hmrn M 6 A E D P-COllH

FIG. 6. SAA protein sequences. The amino acid sequences encoded by the SAA1, SAA,, and SAA, genes are aligned with the BALB/c SAA, and SAAz protein sequences, as well as other SAA and AA sequences. Residues conserved among nearly all species are enclosed in boxes. AA indicates amyloid A protein isolated from tissue deposits. The numbering starts at the first amino acid of the murine SAA proteins. The human and the monkey sequences and the predicted sequence of SA& have one more N-terminal amino acid. The amino acids in parentheses indicate residues not determined in BALB/c but observed in other strains. BALB/c SAA,, SAA2, and CBA/J AA sequences are from Hoffman et al. (1984); human SAA, is from Parmelee et al. (1982); human AA from Levin et al. (1972); monkey AA from Hermodson et al. (1972); mink AA from Husby and Sletten (1980). The amino acid code is from Dayhoff (1978).

SAAqjSAA2 I SA A 3

S A A 1 S A A 2 I T

85-105 MY

S A A 3

FIG. I . Evolutionary tree of the SAA gene family. SAAl- SAA, gene conversion events are represented by triangles. The A represents an ancestral SAA gene. The estimated time since the duplication of the SAA3 gene, separate from SAA, and SAAZ, is shown and also the estimated time since the last SAA, versus SAAZ gene conversion. The number of gene conversion events is not known; more than one are believed to have occurred (see “Discussion”).

stratiadis et al., 1980; Perler et al., 1980; Michelson and Orkin, 1983).

From the divergence of their intron sequences, we calculate that the last recombination between SAAl and SAA2 occurred about 5 My ago. It is unlikely that the SAA, and SAA2 genes have undergone only one rectification (5 My ago) since they were duplicated (at least 50 My ago), because they would have acquired sufficient nucleotide differences over this period of time to limit pairing (Perler et al., 1980). The summary of these calculations is shown as the evolutionary tree in Fig. 7. If rodents accumulate these nucleotide changes twice as rap-


TABLE I1 Comparison of silent and replacement site changes in the SAA genes

The numbers of nucleotide sequence differences among the SAA genes are shown. Numbers in parentheses are the percentage changes.

Coding" Noncodingb

Length Silent h2z- Length Silent

bP bp SAA, us. SAA, 309 4 (1%) 14 (5%) 2113 67 (3%) SAA, us. SAAB 309' 24 (8%) 49 (16%) 482 329 (68%)

a Excludes sequences coding for the signal peptide. SAAz US. SA% 309" 23 (7%) 55 (18%) 482 331 (69%)

Includes 5' and 3' untranslated segments and all available SAA,

Length of SAA, and SAA2 coding regions; SAA3 has one additional intron sequences.

5'-terminal codon.

idly as humans (Wu and Li, 1985), the times discussed above may be revised downward by as much as a factor of 2.

A question arises when examining the SAA evolutionary tree-how has SAA, been excluded from gene conversion with SAA, and SAA, and thus permitted to evolve separately? Weaver et al. (1981) proposed that acquisition of nonhomologous sequences reduces gene rectification, which depends on recombination. Furthermore, Michelson and Orkin (1983) observed a positive correlation between conversion unit length and the degree of homology between sequences. They proposed that as sequences drift, regions of nonhomology limit genetic exchange by blocking branch migration of heterodu- plexes, reducing the size of gene conversion units and the frequency of conversion. This model may explain how SAG, has come to evolve separately from SAA1 and SAA,. The SAA, gene may have somehow acquired sufficient differences to reduce the efficiency of its pairing with SAAl and SAA,. Then it would have been permitted to drift further by muta- tion. Such differences could include repeated elements trans- posed into flanking sequences or introns, other insertions, or deletions. The SAA, gene does have a repeated element within its second intron, while SAA, and SAA, do not (Fig. 1).

Another unusual feature of SAA gene evolution is the high rate of replacement changes in the SAA-coding regions as compared to the silent site changes (Table 11). In particular, comparison of SAAl and SAA, reveals a large number of replacement changes as compared to silent changes despite the fact that these genes have diverged for only a relatively short period of time. Comparison of SAAB with SAA, or SAA, also shows a large relative proportion of replacement changes. High rates of replacement site changes have also been observed in the hinge regions of the human a- and y-CH immunoglobulin genes (Ellison and Hood, 1982; Flanagan et at., 1984). A possible explanation for relatively high rates of replacement substitutions is that heterogeneous proteins pro- vide a selective advantage and, as a result, the genes encoding them are fixed in the population.

SAA Polypeptides-The amino acids encoded by the SAA, and SAAz genes match precisely the two N-terminal sequences of the BALB/c SAA polypeptide isotypes (38 and 26 residues, respectively; Hoffman et al., 1984). It is interesting that only the SAA, isotype is found in tissue amyloid deposits produced during chronic inflammation (Hoffman et al., 1984).

The SAA, gene is transcribed into mature mRNA (Lowell et al., 1986), and we have isolated a cDNA clone of SAA, mRNA (Stearman et al., 1982). However, protein translated from SAA3 mRNA has not been described. SAAB mRNA may be less stable or translated less efficiently than SAA, and SAA, mRNAs. Alternatively, the metabolism of the SAA, gene's polypeptide may differ from that of SAA, and SAA,; it

may not be secreted from hepatocytes efficiently, it may not associate with HDL, or it may be degraded more rapidly after binding to HDL.

The coding region homologies among the SAA genes are distributed nonrandomly. SAA polypeptides of various verte- brate species differ most in their N- and C-terminal regions, encoded by exons 2 and 4. The central region of the polypeptide, which is most highly conseryed, is encoded by exon 3 (codons 13-58; Fig. 6). It is also true in the intraspecies comparison of SAA, with SAAl and SAA2 that exon 3 has diverged much less than exons 2 and 4 (Table I). This suggests that the SAA, protein is functional and subject to genetic selection; pseudogenes, in contrast, accumulate mutations in a more random pattern. In particular, the SAA3 gene encodes a highly conserved sequence of 13 amino acids found in amyloid A protein of every species examined, from duck to human (residues 32-44; Stearman et al., 1982). Its conservation suggests that this sequence has functional importance.

SAA Gene Expression-Coordinate expression of a specific set of genes during the acute phase response suggests common mechanisms to increase their mRNA levels. SAA gene transcription has been shown to increase during the acute phase response (Stearman et al., 1982; Lowell et al., 1986). Since both SAA, and SAAz are expressed, the regulatory DNA sequences are most likely located within the regions of homology between these genes, which extend only 288 bp upstream. Within this region, homologies are found between the SAA genes and the rat fibrinogen genes (Fig. 5A). It is surprising that the homology of the murine SAA upstream sequences with the rat P-fibrinogen DNA is greater than that between the a- and P-fibrinogen sequences. The fact that these sequences are shared by five genes which have evolved separately for a very long period of time suggests that they have a functional role. The probability of finding this amount of homology in five random sequences of 440 bp each is IO-' (Davidson et al., 1983). We note that the P-fibrinogen sequence contains within itself a pair of 20-bp partial direct repeats. Both of the direct repeats have homologies with the other fibrinogen genes while each SAA gene has homology to only one of the repeats. These direct repeats also have homology to the 73- and 72-bp repeated enhancer sequences in the long terminal repeat of Moloney sarcoma virus, a murine retrovirus (Laimins et al., 1984). The greatest similarity to the Moloney virus enhancer is 12 bp matched (using one gap) with the a-fibrinogen sequence aligned near the 5' box (Fig. 5A). Its probability would be 0.4% for random sequences (Goad and Kanehisa, 1982). The data suggest that these conserved sequences may function in transcription.

In addition to the homologies with the fibrinogen genes, the SAA genes have only one other region of conserved noncoding sequence (Fig. 5B). The probability of finding this match between random sequences is very low (O.l%), suggesting that these sequences also have a functional role. The SAA, and SAA, genes have no other upstream homologies with SAA, or between themselves beyond the 5' gene conversion boundary (288 bp from the cap site). DNA transfection experiments in cultured cells will permit tests of the significance of these sequences in induction of transcription.

Acknowledgments-We wish to thank Drs. Thomas Kelly, Daniel Nathans, and Jeff Corden, and Philip Rosenfeld for critical review of this work. We also thank Cynthia Peltzman for expert technical assistance, and Gerry Hunsicker and Holly Porter for manuscript preparation.

REFERENCES Baltimore, D. (1981) Cell 24,592-594 Baumann, H., Jahreis, G. P., and Gaines, K. C. (1983) J. Cell Biol.

97,866-876

8452 Serum Amyloid A Gene Family Baumann, H., Jahreis, G. P., Sauder, D. N., and Koj, A. (1984) J.

Biol. Chem. 2 5 9 , 7331-7342 Benditt, E. P., Eriksen, N., and Hoffman, J. S. (1980) in Amyloid and

Amyloidosis (Glenner, G. G., Costa, P. P., and Falcao de Freitas, A., eds) pp. 397-405, Excerpta Medica, Amsterdam

Bennett, K. L., Hill, R. E., Pietras, D. F., Woodworth-Gutai, M., Kane-Haas, C., Houston, J. M., Heath, J. K., and Hastie, N. D. (1984) Mol. Cell. Biol. 4 , 1561-1571

Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18,5294-5299

Conrad, B., and Mount, D. W. (1982) Nucleic Acids Res. 10 , 31-38 Davidson, E. J., Jacobs, H. T., andBritten, R. J. (1983) Nature 301,

468-470 Dayhoff, M. 0. (1978) Atlas of Protein Sequence and Structure, Vol.

5, suppl. 3, pp. 273-283, National Biomedical Research Foundation, Washington, D.C.

Deininger, P. L., Jolly, D. J., Rubin, C. M., Friedmann, T., and Schmid, C. W. (1981) J. Mol. Biol. 1 5 1 , 17-33

Doolittle, R. F. (1983) Ann. N. Y. Acad. Sci. 4 0 8 , 13-26 Durnam, D. M., and Palmiter, R. D. (1983) Anal. Biochem. 131,385-

393 Efstratiadis, A., Posakony, J. W., Maniatis, T., Lawn, R. M., O'Con-

nell, C., Spritz, R. A., DeRiel, J. K., Forget, B. G., Weissman, S. M., Slightom, J. L., Blechl, A. E., Smithies, O., Baralle, F. E., Shoulders, C. C., and Proudfoot, N. J. (1980) Cell 21,653-668

Ellison, J., and Hood, L. (1982) Proc. Natl. Acad. Sci. U. S. A. 7 9 ,

Flanagan, J. G., Lefranc, M-P., and Rabbitts, T. H. (1984). Cell 36, 681-688

Fowlkes, B. M., Mullis, N. T., Comeau, C. M., and Crabtree, G. R. (1984) Proc. Natl. Acad. Sei. U. S. A. 8 1 , 2313-2316

Friedman, E. Y., and Rosbash, M. (1977) Nucleic Acids Res. 4,3455- 3471

Goad, W. B., and Kanehisa, M. (1982) Nucleic Acids Res. 10, 247- 263

Hermodson, M. A., Kuhn, R. W., Walsh, K. A., Neurath, H., Eriksen, N., and Benditt, E. P. (1972) Biochemistry 11,2934-2938

Hoffman, J. S., and Benditt, E. P. (1982) J. Biol. Chem. 257,10510- 10517

Hoffman, J. S., Ericsson, L. H., Eriksen, N., Walsh, K. A., and Benditt, E. P. (1984) J. Exp. Med. 159,641-646

Hovemann, B., and Galler, R. (1982) Nucleic Acids Res. 10 , 2261- 2274

Husby, G., and Sletten, K. (1980) in Amyloid and Amyloidosis (Glen- ner, G. G., Costa, P. P., and Falcao de Freitas, A., eds) pp. 266- 273, Excerpta Medica, Amsterdam

Koj, A. (1974) in Structure and Function of Plasma Proteins (Allison, A. C., ed) Vol. 1, pp. 73-125, Plenum Press, New York

Kushner, I. (1982) Ann. N. Y. Acad. Sci. 389,39-48 Laimins, L. A., Gruss, P., Pozzatti, R., and Khoury, G. (1984) J.

Virol. 49,183-189 Laurent, P. (1982) in Marker Proteins in Inflammation (Allen, R. C.,

Bienvenu, J., Laurent, P., and Suskind, R. M., eds) pp. 69-88, Walter de Gruyter and Co., Berlin

Levin, M., Franklin, E. C., Frangione, B., and Pras, M. (1972) J. Clin. Invest. 51,2773-2776

Lowell, C. A., Stearman, R. S., and Morrow, J. F. (1986) J. Biol. Chem. 261,8453-8461

Maniatis, T., Fritsch, E. R., and Sambrook, J. (1982) Molecular Cloning. A Laboratory Manual, pp. 320-321, Cold Spring Harbor

1984-1988

Laboratory, Cold Spring Harbor, NY Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 6 5 , 499-

560 McAdam, K. P. W. J., and Sipe, J. D. (1976) J. Exp. Med. 144,1121-

1127 McAdam, K. P. W. J., Li, J., Knowles, J., Pow, N. T., Dinarello, C.

A., Rosenwasser, L. J., Selinger, M. J., Kaplan, M. M., Goodman, R., Herbert, P. N., Bausserman, L. L., and Nadler, L. M. (1982) Ann. N. Y. Acad. Sci. 389,126-136

Merriman, C. R., Pulliam, L. A., and Kampschmidt, R. F. (1977) Proc. Soc. Exp. Biol. Med. 154,224-227

Michelson, A. M., and Orkin, S. H. (1983) J. Biol. Chern. 258,15245- 15254

Morrow, J. F., Stearman, R. S., Peltzman, C. G., and Potter, D. A. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 4718-4722

Mount, S. M. (1982) Nucleic Acids Res. 10,459-472 Parmelee, D. C., Titani, K., Ericsson, L. H., Eriksen, N., Benditt, E.

Pearson, W. R., Mukai, T., and Morrow, J. F. (1981) J. Biol. Chern.

Perler, F., Efstratiadis, A., Lomedico, P., Gilbert, W., Kolodner, R.,

Petes, T., and Fink, G. R. (1982) Nature 300,216-217 Proudfoot, N. J., and Brownlee, G. G. (1976) Nature 263 , 211-214 Ricca, G. A., Hamilton, R. W., McLean, J. W., Conn, A., Kalinyak,

J. E., and Taylor, J. M. (1981) J. Biol. Chem. 256,10362-10368 Sanger, R., Coulsen, A. R., Barrell, B. G., Smith, A. J. H., and Roe,

B. (1980) J. Mol. Biol. 143, 161-178 Schon, E. A., Wernke, S. M., and Lingrel, J. B. (1982) J. Biol. Chem.

Selinger, M. J., McAdam, K. P. W. J., Kaplan, M. M., Sipe, J. D., Vogel, S. N., and Rosenstreich, D. L. (1980) Nature 2 8 5 , 498-500

Shen, S., Slightom, J. L., and Smithies, 0. (1981) Cell 2 6 , 191-203 Sipe, J. D., Vogel, S. N., Ryan, J. C., McAdam, K. P. W. J., and

Slightom, J. L., Blechl, A. E., and Smithies, 0. (1980) Cell 2 1 , 627-

Smith, A. J. H. (1980) Methods Enzymol. 6 5 , 560-579 Smith, H. O., and Birnstiel, M. L. (1976) Nucleic Acids Res. 3, 2387-

Sollner-Webb, B., and Reeder, R. H. (1979) Cell 18 ,485499 Southern, E. M. (1975) J. Mol. Biol. 98,503-517 Staden, R. (1980) Nucleic Acids Res. 8 , 3673-3694 Stearman, R. S. (1982) Ph.D. dissertation, Johns Hopkins University Stearman, R. S., Lowell, C. A., Pearson, W. R., and Morrow, J. F.

Stearman, R. S., Lowell, C. A., Peltzman, C. G., and Morrow, J. F.

Sugawara, N., and Szostak, J. W. (1983) Proc. Natl. Acad. Sei. U. S. A.

Sztein, M. B., Vogel, S. N., Sipe, J. D., Murphy, P. A., Mizel, S. B., Oppenheim, J. J., and Rosenstreich, D. L. (1981) Cell. Immunol.

P., and Walsh, K. A. (1982) Biochemistry 2 1 , 3298-3303

256,4033-4041

and Dodgson, J. (1980) Cell 20,555-566

257,6825-6835

Rosenstreich, D. L. (1979) J. Exp. Med. 150,597-606

638

2398

(1982) Ann. N. Y. Acad. Sci. 389,106-115

(1986) Nucleic Acids Res. 1 4 , 797-809

80,5675-5679

63,164-176 Taylor, B. A., and Rowe, L. (1984) Mol. Gen. Genet. 195,491-499 Weaver, S., Comer, M. B., Jahn, C. L., Hutchinson, C. A., 111, and

Wu, C.-I., and Li, W.-H. (1985) Proc. Natl. Acad. Sci. U. S. A. 8 2 ,

Yamamoto, K., and Migita, S. (1985) Proc. Natl. Acad. Sei. U. S. A.

Edgell, M. H. (1981) Cell 24,403-411

1741-1745

82,2915-2919

of chemistry vol. 261, no. june 25, by u.s.a. structure of ... · the journal 0 1986 by the...

Documents