THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology. Inc.

Vol. 268, No. 14, Issue of May 15, pp. 10621-10626,1993 Printed in U.S.A.

A Highly Active 120-kDa Truncated Mutant of the Plasma Membrane Ca2+ Pump*

(Received for publication, January 8, 1993, and in revised form, February 10, 1993)

Agnes Enyedi, Ani1 K, Verma, Adelaida G. Filoteo, and John T. PennistonS From the Department of Biochemistry and Molecular Biology, Mayo CliniclFoundation, Rochester, Minnesota 55905

A truncated mutant (hPMCA4b(ctl20)) of the plasma membrane Ca” pump was expressed in COS-1 cells. The full-length pump (hPMCA4b) consisted of 1205 residues, and the mutant lacked 120 residues (includ- ing the 28-residue calmodulin-binding inhibitory do- main) at the COOH terminus. To characterize this con- struct, Caz+ transport was determined in a microsomal fraction. Phosphate was added to increase Ca2+ uptake, and specificity was enhanced by adding thapsigargin to inhibit the endoplasmic reticulum Ca” pump. The mutant showed a similar level of expression as hPMCA4b and a Ca2+ affinity and Ca2+ transport ac- tivity about equal to that of hPMCA4b when hPMCA4b was activated. Addition of the synthetic peptide C28R2, corresponding to the calmodulin binding re- gion of the pump, inhibited the mutant and restored the non-activated state of the enzyme. In these re- spects, the truncated mutant acted like hPMCA4b, when hPMCA4b had been proteolyzed to cleave a bond between the calmodulin binding region and the NH2- terminal portion of the molecule. This indicates that the effects of proteolysis are due to removal of the COOH terminus and not to rearrangement of the two fragments. Since the truncated mutant was fully active and its tryptic digestion resulted in the appearance of the expected 81- and 76-kDa active fragments, we concluded that the COOH-terminal portion which is missing cannot be important in synthesis or proper folding of the enzyme.

The plasma membrane Ca2+ pump is a calmodulin-modu- lated P-type ATPase which is essential for the precise control of intracellular CaZ+ concentration. The protein has been cloned from several cell types (Verma et al., 1988; Shull and Greeb, 1988; Greeb and Shull, 1989; Strehler et al., 1990) and has been shown to be a product of a multigene family with a number of alternatively spliced mRNAs (Strehler et al., 1989; Khan and Grover, 1991; Brandt et al., 1992; Adamo and Penniston, 1992; Burk and Shull, 1992). Although its prop- erties have been extensively studied (Carafoli, 1991; Pennis- ton, 19831, alterations in its activity have so far been accom- plished only by ordinary chemical and biochemical manipu- lation. The particular form of the Ca2+ pump studied here is the 1205-residue hPMCA4b; in this name, “h” denotes that it is human, “PMCA” stands for plasma membrane Ca2+ pump,

* This work was supported by National Institutes of Health Grant GM 28835. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. $To whom correspondence should be addressed Guggenbeim

1642C, Mayo Clinic, 200 First St. SW, Rochester, MN 55905. Tel.: 507-284-2295; Fax: 507-284-9759.

“4” is the gene number and “b” denotes the alternate splicing pattern. Successful expression in our laboratory of hPMCA4b in COS-1 cells (Adamo et al., 1992b) has allowed us to glimpse the possibility of the study of structure-function relationships by site-directed mutagenesis, but the system initially appeared to have some serious problems. The main problems were the low activity to background ratio obtained, and the fact that a portion of the expressed hPMCA4b enzyme remained asso- ciated with intracellular membranes. Here we introduce an assay which improves the activity ratio, and we demonstrate that in spite of its localization, the expressed hPMCA4b isozyme is a functionally competent protein.

The biological activity of the plasma membrane Ca2+ pump is regulated by calmodulin, acidic phospholipids, and CAMP- dependent phosphorylation. The regions which seem to be involved in regulation have been located (Enyedi et al., 1987; James et al., 1988; Zvaritch et al., 1990; Falchetto et al., 1991), and based on their sequences synthetic peptides have been made and used to study their interactions within the molecule (Enyedi et al., 1989b, 1991; Vorherr et al., 1990; Falchetto et al., 1991; Filoteo et al., 1992; Brodin et al., 1992). The most extensively studied region is the COOH terminally located high affinity calmodulin-binding domain which appears to be an internal inhibitor of the enzyme (Enyedi et al., 1989b). Addition of calmodulin or proteolytic removal of the calmod- ulin-binding domain activates the pump by increasing the maximum velocity and Ca2+ affinity of the enzyme.

In the present study, we have used deletion mutagenesis to analyze the function of the calmodulin-binding domain. We have deleted 120 amino acids from the COOH terminus of the hPMCA4b isoform. This deletion began at the NHz terminus of the calmodulin-binding domain and continued through the end of the molecule. Our aim was to produce a fully active, calmodulin-insensitive Ca2+ pump which might be an espe- cially useful construct for further mutations. Our success demonstrates that this COOH-terminal portion of the mole- cule is not required for proper folding. We call this mutant ct120, which stands for C-truncated 120 residues. Its full designation is, therefore, hPMCA4b(ctl20).

MATERIALS AND METHODS

CORSt~UCt~OR of the hPMCA4b(ctl20)-truncated Mutant-To facil- itate the assembly of mutated fragments, the full-length hPMCA4b was cloned into the small vector pSP72 (Promega). The truncated mutant was made by using the polymerase chain reaction and two oligonucleotide primers with the following sequences: 1) H4MA1- GGGCCATGCATTCTATCAGC and 2) H4MAZ-GGCCGG- TACCCTACTCCATCTCAGCATGG. Primer H4MAl contained an NsiI site, which occurs naturally in hPMCA4b. Primer H4MA2 contained an artificially introduced stop codon and KpnI site right after the amino acid sequence IDHAEME of sequence IDHAEMEL- RRGQIL.. . where LRRGQIL.. . is the beginning of the calmodulin- binding site of hPMCA4b. Polymerase chain reaction-produced DNA was cloned into the TA cloning vector pCRlOOO (Invitrogen). A few clones from this vector were inserted into M13mp18 for single strand

10621

10622 A Highly Active Truncated Caz+ Pump

sequencing. After locating a correct-sequence clone, its DNA was cut out of the pCRlOOO vector with restriction nucleases NsiI and KpnI. This was cloned into pSP72-hPMCA4b from which the original NsiI- KpnI fragment had been removed. Subsequently, the full cDNA insert of ct120 was removed with restriction nucleases Sal1 and KpnI and transferred to the pMM2 vector. This is the vector we previously called pMT2-m (Adamo et al,, 1992b); it is the pMT-2 vector (Kauf- man, 1990) with a modified polylinker. Three DNA preparations (pMM2 vector, pMM2-hPMCAlb, and pMM2-hPMCA4b(ct120)) were prepared according to the Qiagen maxi preparation procedure.

Transfection-COS-1 cells were transfected with the three DNA preparations as described in a previous publication (Adam0 et al., 199213). The amount of DNA (10 pg/75-cm2 flask, or 20 pg/150-cm2 flask), transfection time (3 h), and posttransfection time (48 h) used in the previous study were found to be optimal.

Isolation of Microsomes from COS-I Cells-Crude microsomal membranes were prepared by a modified version of the procedure described by Clarke et al., 1989. Cells from four 150-cm2 flasks were washed once with 20 ml of phosphate-buffered saline containing 1 mM EDTA and harvested in 10 ml of phosphate-buffered saline containing 0.1 mM phenylmethylsulfonyl fluoride and 9 pg/ml apro- tinin. Cells were collected by centrifugation (2,000 X g, 10 min) at 4 “C and resuspended in 6 ml of a hypotonic solution of 10 mM Tris- HCl, pH 7.5, 1 mM MgC12, 0.1 mM phenylmethylsulfonyl fluoride, 4 pg/ml aprotinin, 1 pg/ml leupeptin, and 2 mM dithiothreitol. The cells were swollen for 15 min on ice and then homogenized with 40 strokes in a Dounce homogenizer. The homogenate was diluted with an equal volume of 0.5 M sucrose, 0.3 M KCl, 2 mM dithiothreitol, 10 mM Tris-HC1, pH 7.5, homogenized again with 20 strokes, and centrifuged at 5,000 X g for 15 min. The supernatant was made 0.6 M in KC1 and, in order to remove calmodulin, an excess of EDTA (1.5 mM) was also added. The suspension was centrifuged at 100,000 X g for 40 min to sediment the microsomal fraction. The final pellet was resuspended in a solution containing 0.25 M sucrose, 0.15 M KC1, 10 mM Tris-HC1, pH 7.5, 2 mM dithiothreitol, and 20 g~ CaCl, at a protein concentration of 1-3 mg/ml and stored in liquid N, until needed.

Ca2+ Transport Assay-Calcium influx into microsomal vesicles was measured at 37 “C by rapid filtration through Millipore mem- brane filters (0.45-pm pore size, type HA) as described by Enyedi et al. (1989b) except that the filters were presoaked in 1 mM CaC12 to reduce the background. The transport medium contained 100 mM KCI, 25 mM TES’-triethanolamine, pH 7.2, 5 mM NaN3, 4 gg/ml oligomycin, 0.5 mM ouabain, 7 mM MgCI,, 100 p~ CaCL (labeled with 46Ca), and sufficient EGTA to obtain the desired free Ca2+. 40 mM KHzP04 and 200 nM thapsigargin were also included except where otherwise stated. Microsomes at a concentration of 6-15 gg/ ml were preincubated for 3 min at 37 “C before initiating calcium uptake by the addition of 6 mM ATP. The incubation time was 5 min unless otherwise stated. The transport activity was determined in the presence and absence of 240 nM calmodulin.

Proteolytic Digestion of Microsomes-This was carried out on ice for 2,5, and 10 min, as indicated. The proteolysis medium contained 0.5-1 mg/ml microsomal membrane protein, 0.1 mM EGTA, 40 mM TES-triethanolamine, pH 7.2, 0.4 mM dithiothreitol, and 20-40 pg/ ml trypsin or 40 pg/ml chymotrypsin. The digestion was stopped with a IO-fold excess of trypsin-chymotrypsin inhibitor. Ca2+ uptake meas- urements or SDS-gel electrophoresis followed by immunoblotting were performed immediately.

Quantitation of Ca2+ Uptake in COS Cell Membrane Preparations- The amount of Ca2+ pump expressed in COS cells was determined by “sandwich” ELISA as described by Leberer and Pette (1986) with some modifications. Antibodies raised against the human erythrocyte Ca2+-ATPase (which contains predominantly the hPMCA4 isoform) were used. For the first antibody, which binds directly to the plates, a highly specific, high affinity monoclonal antibody (5F10) (Adamo et at, 1992a) was used. For the second or top antibody, a polyclonal antibody (Verma et al., 1982) was used, and for ease of detection that antibody was conjugated to horseradish peroxidase (Nakane and Kawaoi, 1974).

The membrane preparations were washed free of dithiothreitol before incubation in a modified buffer system where the detergent concentration was 0.5% Triton X-100, 0.5% deoxycholate, and 0.05% SDS and to which 1 p~ leupeptin was added. The samples were

The abbreviations used are: TES, 2-([2-hydroxy-l,l-bis(hydroxy- methyl)ethyl]amino)ethanesulfonic acid; ELISA, enzyme-linked im- munosorbent assay.

incubated for 15 min on ice before introducing to 5F10-treated plates. For standards, purified erythrocyte CaZ+-ATPase and/or erythrocyte ghosts were used. Absorbance was read at 492 nm using an SLT-Lab Instruments EAR 400 plate reader.

et120 has significantly lower cross-reaction than hPMCA4b with the polyclonal antibody used in ELISA (data not shown). Hence, the amount of pump in mutants as compared to wild type was determined on immunoblots using monoclonal antibody 5F10. The blots were scanned digitally using MacIntosh Software Image 1.44.

Peptide-The peptide C28R2, representing the calmodulin-binding domain, was made as previously described (Enyedi et al., 1991).

RESULTS

Selective Determination of Ca2+ Transport Activities in Mi- crosomes from pMM2- and hPMCA4b-transfected COS-l Cells-To detect the total Ca2+ transport activity of hPMCA4b expressed in microsomal membranes, and to im- prove the activity to background ratio, changes in the assay conditions were made. Ca2+ uptake by microsomal vesicles derived from transfected COS-1 cells was determined. This was measured in the presence of calmodulin (unless otherwise stated), and the activity of the endoplasmic reticulum Ca2+ pump was inhibited by addition of thapsigargin. The poten- tiation of Ca2+ uptake by phosphate is shown in Fig. 1. Panel B shows that, in the absence of phosphate, maximum Ca2+ accumulation was reached after about 5 min, and the apparent Ca2+ pump activity was only about 50% higher in microsomes derived from hPMCA4b-transfected cells than in microsomes from controls sham-transfected with pMM2. As shown in panel A, the accumulation of calcium, particularly in micro- somes isolated from hPMCA4b-transfected cells, was much higher when 40 mM phosphate was present in the incubation medium. In the presence of phosphate, Ca2+ uptake by the vesicles was nearly linear for at least 15 min. Under these circumstances, the Ca2+ pump activity of the hPMCA4b- transfected microsomes was about four to six times higher than that of the control membranes. 5 mM oxalate, a precip- itating anion widely used for Ca2+ uptake in the endoplasmic

25

20 6 :

15 C

al Q

a 10

Y

3 6 a

5

.r( U

Q O

T

0 5 ID 15 Time, Minutes

FIG. 1. Effect of phosphate on Ca2+ uptake by microsomal vesicles isolated from COS-1 cells sham-transfected with the empty plasmid pMM2 (triangles) or transfected with the plas- mid containing the full-length Ca2+ pump hPMCA4b (circles). Time course of Ca2+ uptake by the vesicles in the presence (A) or absence ( B ) of 40 mM phosphate and in the presence of 0.2 p M thapsigargin and 240 nM calmodulin. Free Ca2+ concentration was 1.2 gM. All data points represent the average values of four independ- ent determinations. Error bars show the standard deviation.

A Highly Active Truncated Ca2+ Pump 10623

reticulum, also enhanced Ca2+ uptake in microsomes from hPMCA4b-transfected cells; however, it was less effective than phosphate (data not shown). Since the permeability to oxalate is much higher for the endoplasmic reticulum than for the plasma membrane (Raeymaekers et al., 1983; Enyedi et al., 1989a; DeSmedt et al., 1983), the oxalate stimulation was most probably due to Ca2+ uptake by the portion of hPMCA4b which was expressed in endoplasmic reticulum. Thus, that portion of the expressed hPMCA4b protein re- maining in the endoplasmic reticulum was also active. In subsequent Ca2+ uptake experiments, 40 mM phosphate was used because both endoplasmic reticulum and plasma mem- brane are permeable to this precipitating anion, and a larger potentiating effect on Ca2+ uptake was obtained.

As is mentioned above, all experiments were performed in the presence of thapsigargin, a potent and selective inhibitor of the endoplasmic reticulum Ca2+ pump (Thastrup et al., 1990). Fig. 2 shows that thapsigargin specifically inhibited calmodulin-insensitive calcium uptake, due to the endo- plasmic reticulum Ca" pump, with an ICbo of about 0.4-0.5 nM. Thapsigargin had no effect on the calmodulin-dependent component of Ca2+ uptake, which is mediated by the plasma membrane Ca2+ pump. This figure also shows that Ca2+ uptake measured in the presence of phosphate and thapsigargin was highly dependent on the presence of calmodulin, characteris- tic of the plasma membrane pump.

The amount of the expressed protein recovered in the microsomal fraction was determined by a sandwich ELISA procedure. This showed that about 2 pg of hPMCA4b was expressed per milligram of microsomal protein. Combining this value with the observed rate of Ca2+ uptake, we find that the estimated specific activity of the expressed protein was about 1 pmol of Ca"/(mg Ca2+ pump, min), which is compa- rable to that of the erythrocyte Ca2+ pump in inside-out red cell membrane vesicles (2-4 wmol/(mg Ca2+ pump, min). Thus, it is apparent that a functionally competent plasma membrane Ca2+ pump protein was expressed in the COS-1 cell system.

Expression and Characterization of a 120-kDa-truncated Mutant of the Plasma Membrane Caz+ Pump-Previous stud- ies on both the purified (James et al., 1989) and the mem- brane-bound (Papp et al., 1989) erythrocyte Ca2+ pump had shown that chymotrypsin or calpain digestion of the enzyme produced a fragment (apparent size 125 kDa) which was

FIG. 2. Selective inhibition of Caa+ transport activity of the endo- plasmic reticulum CaZ+ pump by thapsigargin. Ca2' uptake by microso- mal vesicles isolated from hPMCA4- transfected COS-1 cells was determined in the presence of 40 mM phosphate and in the presence (circles) or absence ( tr i - angles) of 240 nM calmodulin. The ar- rows show that the calmodulin-depend- ent Caz+ uptake was not affected by thapsigargin. Free Ca" concentration was 1.2 PM. Representative data from one of three similar experiments are shown.

fi .- 1 U

activated and had lost calmodulin dependence. Even without calmodulin, this fragment acted like the native enzyme did in the presence of calmodulin. Recent sequencing work (Zvaritch et al., 1990) has suggested that hPMCA4b is cleaved upstream of the calmodulin-binding domain to produce the activated molecule. Based on these studies, a truncated mutant, hPMCAlib(ctl20) starting at the NHz terminus of the enzyme and extending to the NH, terminus of the calmodulin-binding domain was designed and expressed in the COS cell system. This construct ended with the sequence ..DEIDHAEME at its COOH terminus, and its molecular mass was expected to be 120,228 with 1,085 residues.

The amounts and the size of the truncated mutant were judged by SDS-gel electrophoresis followed by immunoblot- ting, using 5F10 monoclonal anti-Ca2+ pump antibody. As shown in Fig. 3, lanes 1 and 5, the mutant was expressed at a level similar to the wild type and migrated with the expected molecular mass. Since 5F10 also reacted with the calcium pump native to the COS-1 cells, the amount of this latter could be estimated from lane 5; it was less than 20% of the total expressed mutant or wild type enzyme. It is worth mentioning that the COS-1 cell PMCA ran with a slightly lower mobility than hPMCA4b, while hPMCA4b migrated with the same velocity as the erythrocyte Ca2+ pump (not shown).

As a test of native topology, microsomes from transfected cells were exposed to proteolysis with trypsin. Immunoblots of the proteolyzed samples are shown in lanes 2-4 and 6-8 of Fig. 3. The antibody used (5F10) recognizes all the active fragments discussed in this report (Papp et al., 1989; Adamo et al., 1992a). The hPMCA4b enzyme had the proteolytic pattern previously observed in erythrocyte vesicles, with the 90-, 81-, and 76-kDa fragments, the latter of which accumu- lated after 10 min of digestion. Tryptic digestion of ct120 produced only two major fragments of 81 and 76 kDA, as expected. When membranes expressing ct120 were proteo- lyzed, a substantial portion of the plasma membrane Ca2+ pump native to cos-1 cells (apparent molecular mass 140 kDa) remained intact after proteolysis. Because of the low amount of this pump present, the hands representing undi- gested COS-1 pump are hard to discern in lanes 6-8 of Fig, 3. However, other experiments consistently showed the presence of this band. Its presence indicated that a large proportion of right-side-out plasma membrane vesicles were present. In

I I I .I

0 1 10 100 1000

Thapsigargin, n M

10624 A Highly Active Truncated Ca2+ Pump

such vesicles trypsin cannot cleave the protein but the anti- body reacts with the electrophoretically separated bands. The presence of right-side-out vesicles would account for the un- digested portion of the hPMCA4b and ct120 proteins evident in Fig. 3.

The capacity of ct120 to function as a calcium pump was compared to that of hPMCA4b; Fig. 4 shows the time course of calcium uptake into microsomes isolated from transfected COS-1 cells. The mutant showed the same high Ca2+ transport activity as the wild type, but in contrast to the wild type its activity was totally independent of the presence of calmodulin.

As shown in Table I, in the absence of calmodulin the Ca2+ transport activity of microsomes isolated from cells trans- fected with ct120 was more than 10 times higher than the Ca2+ transport activity of control microsomes. Thus, this mutant should be especially suitable for further mutations.

A critical parameter for the correct functioning of the plasma membrane Ca2+ pump is its affinity for calcium. Therefore, Ca2+ transport activities of microsomes isolated from the transfected cells were tested as a function of free Ca2+ concentration. As shown in Fig. 5, hPMCA4b had low Ca2+ affinity and low activity in the absence of calmodulin. Addition of calmodulin greatly enhanced the activity and shifted the Kll2 for Ca2+ from about 8 to 0.3 PM. A similar activation pattern was obtained by proteolysis of hPMCA4b with chymotrypsin (Fig. 6). I t is clear from Fig. 6 that the Ca2+ affinity and maximum activity of the truncated mutant

1 2 3 4 5 6 7 8

140 kDa 135 kDa * 120 kDa -c

90 kDa 4

81 kDa -c 76 klla

fected with cDNA encoding hPMCA4b (lanes 1-4) and ct120 FIG. 3. Immunoblots of microsomes made from cells trans-

(lunes 5-8): effect of tryptic digestion. Tryptic digestion was performed at 0 "C at the following trypsin concentrations and for the times indicated: 1 and 5, control (no trypsin); 2 and 6, 20 pg/ml trypsin, 2 min; 3 and 7, 20 pg/ml trypsin, 5 min; 4 and 8, 40 pg/ml trypsin, 10 min. 1.2 pg of membrane protein was applied on each lane of a 7.5% polyacrylamide gel. Immunoblots using monoclonal anti- body 5F10 are shown.

20.0 h e

FIG. 4. The activity of the trun- cated mutant (ct120) of the plasma membrane Ca2+ pump is not affected by calmodulin. Time course of Ca2+ uptake by microsomal vesicles isolated from COS-1 cells transfected with hPMCA4b (circles and solid lines) or ct120 (triangles and dashed lines) are shown. Ca2+ uptake was measured in the presence (filled symbols) or absence (open symbols) of 240 nM calmodulin. Free Ca2+ concentration was 1.2 pM. Ca2+ uptake by microsomal vesicles made from pMM2-transfected cells has been subtracted from all time points. Data points are average of four independent experiments. Linear least-squares lines were fitted to each set of points.

17.5 -

G fi 15.0 4 2 12.5 c,

v

$ 10.0

were like those of the chymotryptically activated wild type enzyme. Synthetic peptide C28R2 (corresponding to the cal- modulin-binding region of the rPMCA2b isoform, Enyedi et al., 1991) inhibited the mutant by decreasing the maximum activity and Ca2+ affinity and restored the inhibited state of the enzyme. Based on these data, we can conclude that the deletion of the COOH-terminal, calmodulin-binding region from the hPMCA4b Ca2+ pump by mutagenesis resulted in the expression of a fully active, calmodulin-insensitive Ca2+ transport protein.

DISCUSSION

Our previous work has demonstrated that the hPMCA4b isoform of the plasma membrane Ca2+ pump can be expressed in COS-1 cells but that a portion of the expressed protein remained associated with the endoplasmic reticulum (Adamo et al., 1992b). In that study, the activity of the pump in the transfected cells appeared to be only about 1.5-3.0-fold higher than in controls, and no estimate of the specific activity was made. The low activity to background ratio made it seem possible that only the pump protein which reached the plasma membrane was active and that the newly synthesized protein located in the endoplasmic reticulum was misfolded and in- active. We have now substantially increased the activity to background ratio, by use of thapsigargin and phosphate. Thapsigargin selectively inhibited the activity of the endoge- nous endoplasmic reticulum Ca2+ pump, thus lowering the background. Phosphate allowed us to better measure the initial activity of the pump by increasing the capacity of the vesicles. The activity under these conditions became four to six times higher than that of the PMCA native to COS cells. This activity was stimulated about 5-fold by calmodulin and was reproducible between different transfections of COS-1 cells. In addition to this improved activity, we present here three types of evidence supporting the idea that the Ca2+ pump protein is fully active and correctly folded in both plasma membrane and endoplasmic reticulum.

The first type of evidence is based on the effects of permeant anions. Incorporation of a precipitating anion into a system for assaying Ca2+ uptake has the effect of greatly increasing the total amount of Ca2+ which can be accumulated. Oxalate and phosphate can both cause this effect, but their relative effectiveness depends on the rate a t which they penetrate the membrane. In the case of endoplasmic reticulum membranes, oxalate is more effective than phosphate a t stimulating Ca2+

4 3 a 7.5 - Y

0 2 4 6 a 10 12 14

Time, Minutes

A Highly Active Truncated ea2' Pump 10625

uptake (DeSmedt et al., 1983). In plasma membranes, the opposite is true, and oxalate is nearly ineffective at stimulat- ing Ca2+ uptake (Raeymaekers et al., 1983; Enyedi et al., 1989a). Our observation that oxalate caused a substantial stimulation of the Ca2+ uptake due to hPMCA4b expressed in COS cells indicated that active (and, therefore, correctly folded) hPMCA4b was expressed in the endoplasmic reticu- lum.

The second kind of evidence was based on the specific activity of hPMCA4b. By use of the ELISA described above, we were able to measure the Ca2+ uptake activity per milligram of pump protein and to compare that with its activity in inside-out erythrocyte membrane vesicles. The specific activ- ity was estimated to be about 1 Fmol of Ca"/(mg pump, min). This was certainly an underestimate since about 35-45% of the pump protein was trapped in right-side-out plasma mem- brane vesicles (see Fig. 3), and an unknown amount of the pump was in leaky vesicles. Reported activities of the purified Ca2+ pump in mixed micelles of lipid and detergent, range from 2-6 pmol/(mg protein, min) and varied depending on the composition of the medium. The value of the Caz+ trans- port rate in erythrocyte inside-out vesicles was measured in this study (data not shown) and was 2-4 pmol/mg Ca2+ pump/ min. The ELISA assay described above showed that the Ca2+ ATPase makes up about 0.5% of the total membrane protein in erythrocyte inside-out vesicles. The good specific activity

TABLE I Comparison of Caz+ transport actioities of microsomes isolated from

pMM2-, hPMCA4b-, or ctl20-transfected COS-1 cells Ca2+ uptake by microsomal vesicles was measured for 5 min at

37 "C in the presence of 40 mM phosphate, 0.2 p~ thapsigargin, and in the presence or absence of 240 nM calmodulin. The averages (& standard deviation) from six to eight independent determinations of five different membrane preparations are shown. The free Ca2+ con- centration was 1.2 pM. COS-1 cells were transfected with three

tion), pMM2-hPMCA4b (full-length of the hPMCA4b isoform), and different DNA preparations: pMM2 vector (control, sham transfec-

pMM2-ct120 (truncated mutant of hPMCA4b).

Type of transfection Ca2+ transport

-calmodulin +calmoddin nmoll(mg membrane protein, min)

pMM2 0.13 f 0.03 0.50 & 0.06 hPMCA4b 0.40 & 0.16 ct120 1.61 f 0.14 1.79 +- 0.17

2.26 0.28

FIG. 5. CaZ+ concentration de- pendence of Ca2+ uptake by micro- ljsomal vesicles isolated from hPMCA4b transfected COS-1 cells: effect of calmodulin. Membrane vesi- cles were preincubated for 2 min at 37 "C at 20 p~ total ca2+ and no EGTA, with or without calmodulin at 5 pg of calmod- ulin/mg membrane. Calcium uptake was then started by addition of the vesicles to the transport medium. After this ad- dition, the calmodulin concentration was adjusted to 0.24 pM (circles) or remained zero (triangles). Ca2+ uptake by vesicles made from pMM2 transfected cells has been subtracted from all data points. Representative data from one of three different experiments are shown.

2.5

2.0

1.5

1.0

0.5

0.0

of the expressed hPMCA4b showed that most (or perhaps all) of it was fully active.

The third evidence for correct folding and insertion into the membrane was given by tryptic proteolysis. Trypsin treat- ment produced fragments from the COS cell-expressed hPMCA4b of the same size as previously observed in eryth- rocyte vesicles, showing that the same parts of the molecule were accessible to trypsin. Taken altogether, our data indicate that the expressed protein is functionally active and the endoplasmic reticulum localization was not due to accumula- tion of misfolded protein. Recently, a similar observation on the expression of the plant plasma membrane H+-ATPase has been reported (Villalba et al., 1992)). In that case, a fully active plasma membrane protein was retained at the endo- plasmic reticulum of yeast. Having established the validity of this system, we used it to express a calmodulin-insensitive, highly active, 120-kDa truncated mutant (ct120). Previous proteolysis work had indicated that cleavage of a bond 19 residues upstream or 2 residues downstream of the NH2 terminus of the calmodulin-binding domain activated the enzyme. We made ct120 to explore the effect of the total removal of the calmodulin-binding domain and to provide us with a more active pump to be used in future mutagenesis studies.

Immunohistochemistry experiments (not shown) revealed that both mutant (ct120) and wild type Ca2+ pumps were present within the same cellular compartments when ex- pressed in COS-1 cells. This is consistent with their similar levels of expression in the same microsomal fraction and their similar phosphate-dependent Ca2+ transport properties. The mutant exhibited more than 10 times higher calmodulin- independent Ca2+ transport activity than the pump native to these cells, and this activity was comparable to that of hPMCA4b in the presence of calmodulin. In addition, the tryptic fragmentation pattern of the mutant indicated a native topology. Therefore, deletion of the COOH-terminal portion did not affect synthesis and targeting of the newly expressed protein, nor did it result in a misfolding of the molecule. Since the truncated mutant showed the same Ca2+ transport char- acteristics as the wild type when the latter had been digested with chymotrypsin or calpain, we concluded that activation of the pump by proteolysis was due to the removal of the COOH terminus and not to rearrangement of the fragment produced.

0.1 1.0 10.0

Free Calcium, Micromolar

10626

FIG. 6. Comparison of the kinetic behavior of ct120 and hPMCA4b. Ca2+ uptake by microsomal vesicles was measured in the absence of calmodulin at different free Caz+ concentrations. Ct120 (diamonds) showed the same characteristics as hPMCA4b when the latter was proteolyzed with 40 pg/ml chymotrypsin for 10 min (circles). The inhibited state is represented by the ac- tivity of the full-length hPMCA4b in the absence of calmodulin (triangles). Addi- tion of C28R2 (stars, 6 pM; crosses, 12 p ~ ) to ct120 strongly inhibited Caz+ transport and lowered the activity nearly to that of the full-length enzyme. CaZ+ uptake by vesicles made from pMM2- transfected cells has been subtracted from all data points. Representative data from one of three similar experiments are shown.

Finally, ct120 is expected to be of great value in further mutations aimed a t investigating structure-function relation- ships in the plasma membrane ea2+ pump. Its value will derive in part from its high activity to background ratio, but an additional important factor is the ability to measure the true Ca2+ affinity of the fully activated pump. In the full- length hPMCA4b, measurements of activity versus Ca2+ con- centration in the presence of calmodulin reflect both the binding of Ca2+ to calmodulin and the activation of the transport site of the pump by ea2+. In the ct120 mutant the interaction of Ca2+ with the fully active pump can be measured without interference from calmodulin. This property will be necessary to assess the effects of mutants which alter the pump's ea2+ affinity.

Acknowledgment-We thank Dr. Randall J. Kaufman, Genetics Institute, Cambridge Massachusetts, for the expression vector pMT2.

REFERENCES Adamo, H. P., and Penniston, J. T. (1992) Biochem. J. 283,355-359 Adamo, H. P., Caride, A. J., and Penniston, J. T. (1992a) J. Bid. Chem. 2 6 7 ,

Adamo, H. P., Verma, A. K., Sanders, M. A,, Heim, R., Salisbury, J. L.. Wieben,

Brandt, P., Neve, R. L., Kammesheidt, A,, Rhoads, R. E., Vanaman, T. C.

Brodin, P., Falchetto, R., Vorherr, T., and Carafoli, E. (1992) Eur. J . Biochem.

Burk, S. E, and Shull, G. E. (1992) J. Bid. Chern. 267,19683-19690 Carafoli, E. (1991) Physiol. Reu. 71, 129-153 Clarke, D. M., Maruyama, K., Loo, T. W., Leberer, E., Inesi, G., and Mac-

DeSmedt, H., Parys, J. B., Borghgraef, R., and Wuytack, F (1983) Biochim.

Enyedi, A,, Flura, M., Sarkadi, B., Gardos, G., and Carafoli, E. (1987) J. Biol.

14244-14249

E. D., and Penniston, J. T. (1992b) Biochem. J . 285,791-797

(1992) J. Biol. Chem. 267,4376-4385

204,939-946

Lennan, D. H. (1989) J. Biol. Chem. 2 6 4 , 11246-11251

Biophys. Acta 7 2 8 , 409-418

Chem. 262,6425-6430

0.1 1.0 10.0

Free Calcium, Micromolar

Enyedi, A., Brandt, J., Minami, J., and Penniston, J. T. (1989a) Biochem. J.

Enyedi, A., Vorherr, T., James, P., McCormick, D. J., Filoteo, A. G., Carafoli,

Enyedi, A,, Filoteo, A. G., Gardos, G., and Penniston, J. T. (1991) J. Biol.

Falchetto, R., Vorherr, T., Brunner, J., and Carafoli, E. (1991) J. Biol. Chem.

Filoteo, A. G., Enyedi, A,, and Penniston, J . T. (1992) J. Biol. Chem. 2 6 7 ,

Greeb, J., and Shull, G. E. (1989) J. Biol. Chern. 264,18569-18576 James, P., Maeda, M., Fisher, R., Verma, A. K., Krebs, J., Penniston, J. T.,

James, P., Vorherr, T., Krebs, J., Morelli, A,, Castello, G., McCormick, D. J., and Carafoli, E. (1988) J. Biol. Chem. 2 6 3 , 2905-2910

Penniston, J. T., DeFlora, A,, and Carafoli, E. (1989) J. Biol. Chem. 2 6 4 , 8289-8296

2 6 1 , 23-28

E., and Penniston, J. T. (1989b) J. Bid. Chem. 2 6 4 , 12313-12321

Chem. 266,8952-8956

266,2930-2936

11800-11805

Kaufman, R. J. (1990) Methods Enzymol. 185,487-511

Leberer, E., and Pette, D. (1986) Biochem. J. 235,67-73 Khan, I., and Grover, A. K. (1991) Biochem. J. 277,345-349

Nakane, P. K., and Kawaoi, A. (1974) J. Histochem. Cytochem. 2 2 , 10&1-1091 Papp, B., Sarkadi, B., Enyedi, A,, Caride, A. J., Penniston, J. T., and Gardos,

Penniston, J. T. (1983) in Calcium and Cell Function (Cheung, W. Y., ed) Vol.

Raeymaekers, L., Wuytack, F., Eggermont, J., and deSchutter, G. (1983)

Shull, G. E., and Greeh, J. (1988) J. Biol. Chem. 263,8646-8657 Strehler, E. E., Strehler-Page, M-A., Vogel, G., and Carafoli, E. (1989) Proc.

Strehler, E. E., James, P., Fischer, R., Heim, R., Vorherr, T., Filoteo, A. G., Natl. Acad. Sci. U. S. A. 86,6908-6912

Thastrup, O., Cullen, P. J., Drobak, B. K., Hanley, M. R., and Dawson, A. P. Penniston, J. T., and Carafoli, E. (1990) J. Bid. Chem. 265 , 2835-2842

Verma, A. K., Gorski, J. P., and Penniston, J. T. (1982) Arch. Biochem. Biophys. (1990) Proc. Natl. Acad. Sci. U. S. A. 8 7 , 2466-2470

Verma, A. K., Filoteo, A. G., Stanford, D. R., Wiehen, E. D., Penniston, J. T., 215,345-354

M-A,, James, P., Vorherr, T., Krebs, J., and Carafoli, E. (1988) J . Btol. Chem. Strehler, E. E., Fischer, R., Heim, R., Vogel. G., Matthews, S., Strehler-Page,

Villalha, J. M., Palmgren, M. G., Berherian, G. E., Ferguson, C., and Serrano, 263,14152-14159

Vorherr, T., James, P., Krebs, J., Enyedi, A,, McCormick, D. J., Penniston, J. R. (1992) J . Biol. Chem. 2 6 7 , 12341-12349

Zvaritch, E., James, P., Vorherr, T., Falchetto, R., Modyanov. N., and Carafoli, T., and Carafoli, E. (1990) Biochemistry 29,355-365

E. (1990) Biochemistry 29,8070-8076

G. (1989) J. Bid. Chem. 264,4577-4582

4, pp. 99-149, Academic Press, New York

Biochem. J. 210,315-322