nrf2-dependent sulfiredoxin-1 expression protects against cigarette smoke-induced oxidative stress...

Free Radical Biology & Medicine 46 (2009) 376–386

Contents lists available at ScienceDirect

Free Radical Biology & Medicine

j ourna l homepage: www.e lsev ie r.com/ locate / f reeradb iomed

Original Contribution

Nrf2-dependent sulfiredoxin-1 expression protects against cigarette smoke-inducedoxidative stress in lungs

Anju Singh a, Guoyu Ling a, Avvaru N. Suhasini b, Ping Zhang a, Masayuki Yamamoto a,c, Ana Navas-Acien a,Gregory Cosgrove d,e, Rubin M. Tuder e, Thomas W. Kensler a,f, Walter H. Watson a, Shyam Biswal a,f,⁎a Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Johns Hopkins University, Baltimore, MD 212045, USAb National Institute on Aging, National Institutes of Health, Baltimore, MD 21224, USAc Tohoku University Graduate School of Medicine and ERATO Environmental Response Project, 2-1 Seiju-chu, Aoba-Ku, Sendai 980-8575, Japand Department of Medicine, National Jewish Health, Denver, CO 80206, USAe Department of Medicine, University of Colorado at Denver Health Sciences Center, Denver, CO 80262, USAf Department of Oncology, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University, Baltimore, MD 21205, USA

Abbreviations: Srx1, sulfiredoxin; COPD, chronic obCS, cigarette smoke; ARE, antioxidant-response elemshRNA, short hairpin RNA; siRNA, short interfering RNsynthetase catalytic subunit; GCLm, γ-glutamyl cysteinGst, glutathione S-transferase; ROS, reactive oxygenextract; TBHQ, tert-butylhydroquinone; KEAP1, Kelch-lNrf2, nuclear factor erythroid-2-related factor 2.⁎ Corresponding author. Fax: +1 410 955 0116.

E-mail address: [email protected] (S. Biswal).

0891-5849/$ – see front matter © 2008 Elsevier Inc. Aldoi:10.1016/j.freeradbiomed.2008.10.026

a b s t r a c t
a r t i c l e i n f o
Article history:
Oxidative stress results in p Received 11 August 2008Revised 6 October 2008Accepted 9 October 2008Available online 1 November 2008
Keywords:Srx1Nrf2Oxidative stressAntioxidant response elementChronic obstructive pulmonary diseaseEmphysemaFree radicals

rotein oxidation and is involved in the pathogenesis of lung diseases such aschronic obstructive pulmonary disorder (COPD). Sulfiredoxin-1 (Srx1) catalyzes the reduction of cysteinesulfinic acid to sulfenic acid in oxidized proteins and protects them from inactivation. This study examinedthe mechanism of transcriptional regulation of Srx1 and its possible protective role during oxidative stressassociated with COPD. Nrf2, a transcription factor known to influence susceptibility to pulmonary diseases,upregulates Srx1 expression during oxidative stress caused by cigarette smoke exposure in the lungs ofmice. Disruption of Nrf2 signaling by genetic knockout in mice or RNAi in cells downregulated the ex-pression of Srx1. In silico analysis of the 5′-promoter-flanking region of Srx1 identified multiple antioxidant-response elements (AREs) that are highly conserved. Reporter and chromatin-immunoprecipitation assaysdemonstrated that ARE1 at −228 is critical for the Nrf2-mediated response. Attenuation of Srx1 expressionwith RNAi potentiated the toxicity of hydrogen peroxide (H2O2), whereas overexpression of Srx1 protectedagainst H2O2-mediated cell death in vitro. Immunoblot analysis revealed dramatic decreases in Srx1expression in lungs from patients with COPD relative to nonemphysematous lungs together with a declinein Nrf2 protein. Thus, Srx1, a key Nrf2-regulated gene, contributes to protection against oxidative injury inthe lung.

© 2008 Elsevier Inc. All rights reserved.

The lung represents a unique tissue, as it is directly exposed
to high oxygen tension and oxidative insults. Many of these insultsinduce formation of reactive oxygen species such as hydrogenperoxide, oxyradicals, and organic hydroperoxides [1]. Endogenousreactive oxygen species (ROS) are constantly generated in thecourse of common metabolic process such as in the mitochon-drial respiratory chain. Because excess ROS can lead to severe celldamage and malignant transformation, cells in the lungs areequipped with a robust antioxidant enzyme defense system,which counteracts oxidative stress and maintains cellular redoxstatus [2]. The major ROS-detoxification enzymes are glutathione
structive pulmonary disorder;ent; RNAi, RNA interference;A; GCLc, γ-glutamyl cysteine

e synthetase modifier subunit;species; CSE, cigarette smokeike ECH-associated protein 1;

l rights reserved.

peroxidase, superoxide dismutase, catalase, and peroxiredoxins(Prx's). Prx's catalyze the reduction of a broad spectrum of peroxides[1,3,4].

Chronic exposure to oxidative insult due to cigarette smoke (CS)and air pollutants is the primary factor in the pathogenesis ofchronic obstructive pulmonary disease (COPD), which is definedby progressive airflow limitation that is caused by advanced obs-truction of the smaller conducting airways by mucus and/or emphy-sematous destruction of the lung [5,6]. Both cause progressivereduction in the volume of air leaving the lungs after forcedexpiration [6]. COPD has become a global epidemic and is likely tobecome the third largest cause of death worldwide by 2020 [7].Oxidant–antioxidant imbalance in lungs has been strongly impli-cated in COPD severity [8,9]. Strong epidemiological and geneticevidence supports the notion that an individual's ability to defendagainst CS-induced oxidative stress by upregulation of lungantioxidant defenses represents a critical event in the pathogenesisof COPD [10].

Nuclear factor erythroid-2-related factor 2 (Nrf2) is a centraltranscription factor that regulates the antioxidant defense system

mailto:[email protected]

http://dx.doi.org/10.1016/j.freeradbiomed.2008.10.026

http://www.sciencedirect.com/science/journal/08915849

377A. Singh et al. / Free Radical Biology & Medicine 46 (2009) 376–386

and acts as a modifier of several lung diseases that involve oxidativestress and inflammation. Nrf2 has an overarching protective rolein several lung inflammatory diseases, as Nrf2-disrupted mice havean increased sensitivity to allergen-induced asthma [11,12], bacte-rial lipopolysaccharide-induced sepsis [13], hyperoxia-inducedacute injury [14], and diesel exhaust-induced DNA damage [15].Nrf2 gene deletion in mice provided the first evidence of a directlink between the regulation of antioxidant genes and alveolardestruction in the murine model of CS-induced emphysema [16].More recently, a decline in Nrf2 has been linked to an increase inoxidative stress and pathogenesis in the lungs of patients with COPD[17–19].

In response to oxidants, including CS, a network of cytopro-tective antioxidant genes are induced in lungs in a rapid and highlycoordinated fashion through the activation of the Nrf2 pathway[2,16]. After CS exposure [20], Nrf2, a basic leucine zipper trans-cription factor, dissociates from its cytosolic repressor Kelch-likeECH-associated protein 1 (KEAP1), accumulates in the nucleus, andbinds to the antioxidant-response element (ARE) [21] in the pro-moter of its target genes, leading to their transcriptional induc-tion in lungs [22]. Nrf2 regulates genes involved in two major redoxsystems, the glutathione and thioredoxin systems. The γ-glutamylcysteine synthetase catalytic (GCLc) and regulatory (GCLm) sub-units, members of the glutathione S-transferase (Gst) family, glu-tathione reductase, glutathione peroxidase 2 (GPx2), glutathioneperoxidase 3, thioredoxin reductase, and peroxiredoxin-1 (Prx1)were all induced in the lungs of Nrf2+/+ mice in response to CS[16,23].

Srx1, also known as neoplastic progression 3, is a member of aconserved family of antioxidants present in eukaryotes and containsa C-terminal cysteine residue that is highly conserved and crucial forits antioxidant function [3,4]. It plays a key role in cellular responsesto oxidative insults by restoring the activity of overoxidized Prx's[3,4,24,25]. Gene deletion studies in yeast revealed that Srx1 geneexpression confers resistance against hydrogen peroxide toxicity[25]. A study by Rangasamy et al. [16] showed that Srx1 expressionwas selectively induced in the lungs of Nrf2+/+ mice in response toCS. Two agents known to affect Nrf2 signaling in the liver, 3H-1,2-dithiole-3-thione [26] and sodium arsenite [27], also upregulatedSrx1 expression. However, the molecular mechanism underlyingNrf2-dependent transcriptional upregulation of Srx1 expression andthe functional significance of Nrf2-dependent Srx1 induction inresponse to CS exposure or treatment with Nrf2 activators are notknown [53]. A better understanding of the role of Nrf2 in theregulation of Srx1 expression will help elucidate its possibleprotective role in lungs in response to oxidative stress caused byCS and environmental pollutants that play a role in pathogenesis ofCOPD and other lung diseases.

Materials and methods

Animals and care

Nrf2-disrupted CD-1 (ICR) mice were generated as describedpreviously [28]. Mice were genotyped for Nrf2 status by PCRamplification of genomic DNA extracted from blood as described[16]. All experimental protocols conducted in mice were performed inaccordance with the standards established by the U.S. Animal WelfareActs, set forth in the National Institutes of Health guidelines and thePolicy and Procedures Manual of the Johns Hopkins University AnimalCare and Use Committee.

Cell culture

A549 cells, human alveolar type II epithelial cells, and BEAS2Bcells were obtained from the American Type Culture Collection

(Rockville, MD, USA) and were cultured in the recommendedmedium supplemented with 10% fetal bovine serum and 1%penicillin–streptomycin.

Exposure to cigarette smoke

Eight-week-old mice were divided into four groups (n=3 pergroup): (I) control Nrf2+/+ mice; (II) experimental Nrf2+/+ mice;(III) control Nrf2−/− mice; and (IV) experimental Nrf2−/− mice. Con-trol groups I and III were kept in a filtered air environment, andtreatment groups II and IV were subjected to CS as describedpreviously [16]. Mice were exposed to acute CS for 5 h, using a TE-10smoking machine (Teague Enterprises, Davis, CA, USA) and 2R4Freference cigarettes (University of Kentucky, Tobacco ResearchInstitute, Lexington, KY, USA). Chamber atmosphere was monitoredfor total suspended particles and carbon monoxide, with concentra-tions of 90 mg/m3 and 150 ppm, respectively. Immediately after 5 hexposure, mice were sacrificed and lungs were collected. Cigarettesmoke extract (CSE; dissolved in DMSO, 40 mg/ml total particulatematter) was purchased from Murthy Pharmaceuticals (Lexington, KY,USA).

Quantitation of Srx1 mRNA expression after CS treatment

To measure the expression of Srx1, mice were exposed to CSfor 5 h. Total RNA was extracted from lung tissues and/or cellswith TRIzol reagent (Invitrogen, San Diego, CA, USA) and reversetranscribed using a high-capacity cDNA synthesis kit (AppliedBiosystems, Foster City, CA, USA) as per the manufacturer's ins-tructions. Quantitative real-time reverse transcriptase–polymerasechain reaction (RT-PCR) analyses of murine Srx1 was per-formed using Assay on Demand primers and probe sets fromApplied Biosystems. Assays were performed using the ABI 7000TaqMan system (Applied Biosystems). GAPDH was used fornormalization.

Western blot

Western blot analyses of Srx1 and Nrf2 were performed asdescribed previously [29]. Briefly, 50 μg of total protein was separatedby 15% sodium dodecyl sulfate–polyacrylamide gel electrophoresisand transferred to polyvinylidene difluoride (PVDF) transfer mem-brane by semidry blotting. The PVDF membrane was blocked in 2%nonfat milk and incubated with polyclonal goat anti-Srx1 antibody(1:200), polyclonal rabbit anti-Nrf2 antibody (1:500), or GAPDH(1:1000), followed by incubation with horseradish peroxidase-conjugated secondary antibody, and developed using an ECL chemi-luminescence detection system (Amersham Biosciences, Piscataway,NJ, USA). All the antibodies were purchased from Santa CruzBiotechnology (Santa Cruz, CA, USA).

Generation of A549 cells stably expressing Nrf2 shRNA

To inhibit the expression of Nrf2, a short hairpin RNA targetingthe 3′ end of the Nrf2 transcript was developed as describedpreviously [29,30]. The Nrf2 shRNA duplex contained the fol-lowing sense and antisense sequences: 5′-GATCCGTAAGAAGCCA-GATGTTAATTCAAGAGATTAACATCTGGCTTCTTACTTTTTTGGAAA-3′(sense) and 5 ′-AGCTTTTCCAAAAAAGTAAGAAGCCAGATGT-TAATCTCTTGAATTAACATCTGGCTTCTTACG-3′ (antisense) [29]. Theshort hairpin RNA cassette was subcloned into the pSilencer vectorand transfected into A549 cells using Lipofectamine 2000 (Invit-rogen). A short hairpin RNA targeting the luciferase gene was usedas control. Stable cell clones with reduced Nrf2 expression weregenerated. All the clones were screened by real-time RT-PCR andimmunoblotting.

378 A. Singh et al. / Free Radical Biology & Medicine 46 (2009) 376–386

Identification of AREs in the promoter of Srx1

To identify the presence and location of antioxidant-responseelements in the Srx1 promoter, the 4-kb upstream region from thetranslation start site was downloaded from the NCBI database(Human Genome resources). The 5-kb sequence was used to searchfor AREs with the help of Genamics Expression 1.1 software(Hamilton, New Zealand) using the primary core sequence of ARE(RTGABNNNGCR) as the probe [31]. The promoter sequences of theRattus norvegicus, Mus musculus, Pongo pygmaeus, Pan troglodytes,Macaca mulatta, Bos taurus, Canis familiaris, Fugu rubripes, Gaster-osteus aculeatus, and Tetraodon nigroviridis orthologues of Srx1 weredownloaded from the NCBI database and scanned for the presenceof AREs.

Plasmids and mutagenesis

The 5′ flanking region of the human Srx1 promoter region (−3664to +19) was PCR-amplified from a human bacterial artificial chromo-some [32] clone corresponding to the Srx1 gene using high-fidelityTaq polymerase (Applied Biosystems). The isolated PCR product wasligated into pCR2.1 (Invitrogen) and a KpnI–XhoI fragment from thisconstruct was cloned into the pGL3 Basic vector (Promega, Madison,WI, USA). Three deletion constructs (−1518 to +19 and −319 to +19 and−233 to +19) were generated from the full-length promoter construct.The primers used for amplification were forward primer (−3664),CGCTACGGATGAAGACAACA, and reverse primer 3 (+19), TCCGGCCG-GGCCATACCATT. The full-length 3683-bp construct consisting of allthree AREs (All-3ARE-pGL3b) was digested with KpnI and EcoRV toremove a 2164-bp fragment including ARE3 and religated. The re-sulting second ∼1.5-kb deletion construct comprising ARE2 and ARE1(ARE1 and 2-pGL3b) was further digested with BglI to remove ARE2and generate an ∼336-bp third deletion construct (ARE1-pGL3b).Finally, the third deletion construct was further cleaved with SmaI togenerate the smallest deletion construct (∼252 bp) lacking all theAREs (No-ARE-pGL3b). Oligonucleotides of all three ARE coresequences plus the flanking sequence (81 bp in length) were annealedand cloned at the KpnI–XhoI site in the pTAL luciferase reporter vector(BD Biosciences, San Jose, CA, USA) (ARE1-pTAL, ARE2-pTAL, and ARE3-pTAL). The sequences of the ARE oligos cloned in the pTAL vector areas follows: ARE1 oligo, CGGTGCGTCACCCGCGCCCCTCCCGCCCCGCGA-CCTGCAAACTCACCCTGAGTCAGCCCGCCCGGGCGTTTCCACTCCCCG;ARE2 oligo, ACCCCAGCAGCGGGGCAGCAGCGCACCGCGGGCTTTGCCG-ACTCACCCTGGCTGGGCAGGTCCGCCGCGCTCTCCCCCGCC; and ARE3oligo, GGAGGTGACCCTGAGAATGAAAACTCTGCTGGAAAATGATG-GAGCGGCAAGATAGAAAGGGCCTATGCCACTAGTGACCAT. A mutationin the ARE1 enhancer sequence cloned in the pTAL vector (Mut-ARE1-pTAL) was generated by using a site-directed mutagenesiskit from Stratagene (La Jolla, CA, USA). Primers containing themutated ARE sequence CCGCGACCTGCAAACGCCCCCTGAGTCAGC(ARE1-Mu) were used for PCR amplification of the mutated Srx1promoter. The mutation of each promoter was verified by sequencing.

Validation of Srx1 siRNA duplex

A small interfering RNA duplex targeting human Srx1 mRNA hasbeen reported by Chang et al. [33]. The sequence of siRNA targetinghuman Srx1 is 5′-GGAGGUGACUACUUCUACU-3′. The sequence of thecontrol nontargeting NS siRNA is 5′-UAGCGACUAAACACAUCAAUU-3′.A549 cells in the exponential growth phase were plated in six-wellplates at a density of 5×105 cells/well, grown for 12 h, and thentransfected with 20 pmol of siRNA duplexes by using Lipofectamine2000 and OPTI-MEM I reduced-serum medium (Invitrogen) accord-ing to the manufacturer's protocol. Concentrations of siRNAs werechosen on the basis of dose–response studies. Knockdown of thetarget gene was quantified by real-time RT-PCR at 72 h after

transfection using Assay on Demand primers and by using probesets from Applied Biosystems. Assays were performed using the ABI7000 TaqMan system (Applied Biosystems). GAPDH was used fornormalization.

DNA transfection and luciferase activity

Cells were transfected at 85% confluency using Lipofectamine 2000(Invitrogen). Briefly, cells were seeded in 24-well plates at a density of2×105 cells/ml and grown overnight. After ∼12 h, the medium wasremoved and transfection complex containing 200 ng of plasmid DNA,1 ng of pRL-TK plasmid (Promega), and transfection reagent wasadded to each well in the presence of fetal bovine serum. The cellswere incubated for another 36 h. After 48 h, the cells were lysed, andRenilla and firefly luciferase activities were measured using the dualluciferase assay kit (Promega) with a luminometer (EG and GWallac,MD, USA). Luciferase activity was normalized relative to Renillaluciferase activity, using it as an internal control.

Chromatin immunoprecipitation (CHIP) assay

CHIP assay was performed using a commercially available kit(Millipore, Billerica, MA, USA). Immunoprecipitates and total chro-matin input were reverse cross-linked, DNA was isolated, and 1 μl ofDNA was used for PCR (35 cycles) with primers specific for the Srx1promoter. The Srx1 promoter primer sequences are as follows: For-ward, AATGTTCGGAACGACTCCAG; Reverse, CAGGGTGAGTCGGCAAAG.

Measurement of ROS levels

Cells were incubatedwith 10 μM2′,7′-dichlorodihydrofluoresceindiacetate (c-H2DCFDA) (Invitrogen) for 30 min at 37°C to assess theROS-mediated oxidation to the fluorescent compound c-H2DCF. Fluo-rescence of oxidized c-H2DCF was measured at an excitationwavelength of 480 nM and an emission wavelength of 525 nMusing a FACScan flow cytometer (Becton–Dickinson, San Jose, CA,USA).

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)cell viability assay

Cells were transfected with 20 nM siRNAs two times with a 48-hinterval and, 24 h after the second transfection, cells were plated at adensity of 7500 cells/well in 180 μl of growth medium in 96-wellplates. After 12 h, the cells were treatedwith various concentrations ofH2O2 for 24 h. Cell viability was evaluated by using an MTT (Sigma, St.Louis, MO, USA) reduction conversion assay [34]. Cell survival wasexpressed as absorbance relative to that of untreated controls. Resultsare presented as means±SD.

Human tissues

Frozen lung tissue samples were obtained from the cardiopul-monary pathology tissue bank at The Johns Hopkins University(Baltimore, MD, USA) and the Interstitial Lung Disease Tissue Bank atNational Jewish Medical Health (Denver, CO, USA). The non-COPDlungs (three nonsmokers and two ex-smokers) had normal spiro-metric lung function and no evidence of emphysema. Study pro-tocols were approved by the institutional review boards for humanstudies.

Statistical analysis

Results are presented as the means±SE. Statistical comparisonswere performed by paired Student's t-tests. A value of pb0.05 wasconsidered statistically significant.


Results

Transcriptional induction of Srx1 gene expression in lungs, in response toCS exposure, is dependent on Nrf2

Nrf2+/+ and Nrf2−/− mice were exposed to CS for 5 h and thenexamined for expression of Srx1 by real-time RT-PCR. Srx1mRNA levelwas upregulated by eight-fold in response to CS in Nrf2+/+ mice. Noinduction was observed in the lungs of CS-exposed Nrf2−/− mice(Fig. 1A). Western blot analysis of lung proteins showed that Srx1proteinwas present constitutively, and its level increased significantlyon exposure to CS in Nrf2+/+ mice. By contrast, expression of Srx1protein was low in Nrf2−/− mice and did not change significantly withCS exposure (Figs. 1B and C). The data indicate that pulmonary Srx1expression is induced by CS, and the induction is abrogated in Nrf2−/−

mice, implicating a critical role for Nrf2 in induction of Srx1 geneexpression.

Nrf2 activation increases Srx1 mRNA and protein levels in lung epithelialcells

To further elucidate the role of Nrf2 in regulating transcription ofSrx1, siRNA targeting Nrf2 was used to inhibit Nrf2 activity.Conversely, KEAP1 siRNA was used to activate the expression ofNrf2-dependent genes. The siRNA duplexes were transfected into

Fig. 1. CS exposure induces expression of Srx1 in the lungs of Nrf2+/+ mice. (A) Nrf2+/+

and Nrf2−/− mice were exposed to CS for 5 h and total RNAwas isolated. The expressionlevel of Srx1 was analyzed by real-time RT-PCR. GAPDH was used for normalization.Data are presented as fold change over the air-exposed Nrf2+/+ group. (B) Srx1 proteinlevels in the lungs of Nrf2+/+ and Nrf2−/− mice. Mice were exposed to CS for 5 h and lungprotein was isolated after 24 h and used for Western blot analysis. (C) Quantification ofSrx1 protein expression in the lungs of air- and CS-exposed Nrf2+/+ and Nrf2−/− mice.(Mean±SD of the Srx1/GAPDH protein ratio in three independent samples). ⁎Significantcompared to air-exposed mice (p≤0.05).

Fig. 2.Modulation of Nrf2 activity in BEAS2B cells by the RNAi approach and oxidativestress-inducing agents. (A) siRNA targeting KEAP1 decreased KEAP1 mRNA levels andupregulated the expression of the Nrf2-dependent gene NQO1. (B) siRNA targetingNrf2 lowered Nrf2 transcript levels and inhibited the expression of the downstreamtarget gene NQO1. (C) Treatment with oxidative stress-inducing agents like CS extract(100 μg/ml), H2O2 (200 μM), and tert-butylhydroquinone (50 μM) upregulated theNQO1–ARE–luciferase activity in an Nrf2-dependent manner. ⁎Significant comparedwith vehicle (DMSO)-treated cells; †significant compared with nontargeting NS siRNA(nonspecific)-transfected BEAS2B cells (p≤0.05).

BEAS2B cells, 72 h later cells were harvested, and mRNA expressionfor Nrf2, KEAP1, and Srx1 were quantified by real-time RT-PCR. ThesiRNA targeting Nrf2 and KEAP1 led to a N85% decrease in mRNA ofthese genes (Figs. 2A and B). To further confirm the specificity of thesiRNA effect on Nrf2, we measured the transcript level of NQO1,another well-characterized target of Nrf2. The siRNA-mediateddecrease in Nrf2 led to a 65% decrease in NQO1 transcript, whereassiRNA targeting KEAP1 upregulated the expression of NQO1 by 600%(Figs. 2A and B). To further confirm that Nrf2 is essential for NQO1induction in response to oxidative stress, the NS siRNA- and Nrf2siRNA-transfected BEAS2B cells were retransfected with the NQO1–ARE reporter vector. Twenty-four hours after the second transfection,cells were treated with H2O2 (200 μM), 2,5-tert-butylhydroquinone(TBHQ) (50 μM), and CS extract (100 μg/ml) for 12 h and luciferaseactivity was measured. As shown in Fig. 2C, BEAS2B cells transfectedwith NS siRNA displayed a significant increase in the amount of AREluciferase activity in response to treatment with oxidative stress-inducing agents, whereas Nrf2 siRNA-transfected cells showedsignificantly reduced NQO1–ARE–luciferase induction. Thus, thisnontumorigenic lung cell line model was further used for determin-ing the regulation of Srx1 by Nrf2. Depletion of Nrf2 by siRNAresulted in a decline in Srx1 mRNA expression and, conversely,


inhibition of expression of KEAP1 upregulated the transcript for Srx1in BEAS2B cells (Fig. 3A). Thus, the siRNA data obtained innontumorigenic lung epithelial cells confirm the results obtainedfrom mice indicating that the increase in Srx1 mRNA level is Nrf2dependent. Next, we examined whether oxidative stress-inducingagents, which activate Nrf2, also induce Srx1 expression in BEAS2Bcells. The cells were exposed to various oxidative stressors such asH2O2 (200 μM), TBHQ (50 μM), and CS extract (100 μg/ml) for 6 to24 h. The NQO1 and Srx1 induction in response to these treatmentswas quantified by real-time RT-PCR. Srx1 expression was upregulatedin response to treatment with all three oxidative stress-inducingagents (Figs. 3B–D). To determine whether the increase in Srx1transcript correlates with an increase in Srx1 protein, cells weretreated with TBHQ and levels of Srx1 protein were measured.Treatment with TBHQ led to a parallel increase in Srx1 protein levels

Fig. 3. Nrf2 activation increases Srx1 transcript and protein levels in normal human lung epitexpression of Srx1 mRNA, whereas transfection with Nrf2 siRNA lowered the expression of SsiRNA-transfected cells. (B–D) Induction of Srx1 expression in response to treatment with muml), H2O2 (200 μM), and TBHQ (50 μM), and expression of Srx1wasmeasured by real-time RTof BEAS2B cells treated with TBHQ. Total protein was isolated and SRX1 protein levels were dthe Western blots of BEAS2B cells treated with TBHQ. ⁎Significant compared to vehicle (DM

(Figs. 3E and F). These results clearly indicate that the oxidativestress-mediated increase in Srx1 levels is dependent on activation ofNrf2 signaling.

Decreased Srx1 RNA levels in lung cancer cells expressing Nrf2 shRNA

A loss-of-functionmutation in KEAP1 results in upregulation of theNrf2 pathway in A549 lung cancer cells [29]. To attenuate theexpression of Nrf2, we designed a short hairpin RNA targeting the 3′end of the Nrf2 mRNA as described earlier [29,30]. A short hairpin RNAtargeting the luciferase gene was used as a control. Stable cell cloneswith decreased Nrf2 expression were generated. All clones werescreened by real-time RT-PCR and immunoblotting. After the initialscreening, we selected one independent clone of A549 cells expres-sing Nrf2 shRNA that demonstrated a stable 85% downregulation of

helial cells. (A) Transient transfection of BEAS2B cells with KEAP1 siRNA upregulated therx1 transcript in BEAS2B cells. ⁎Significant compared to nontargeting, nonspecific (NS)ltiple oxidative stress-inducing agents. BEAS2B cells were exposed to CS extract (100 μg/-PCR. ⁎Significant compared to vehicle (DMSO)-treated sample. (E)Western blot analysisetermined. GAPDH was used as the loading control. (F) Quantification of Srx1 protein inSO)-treated cells (p≤0.05).

Fig. 4. Increased Srx1mRNA levels in A549 lung cancer cells with constitutively activated Nrf2. (A) Generation of cell lines stably expressing Nrf2 shRNA. Real-time RT-PCR analysis ofNrf2 and NQO1 expression in A549 cells stably expressing Nrf2 shRNA and luciferase shRNA was performed. Total RNA from stable clones harboring Nrf2 shRNA or nontargetingluciferase shRNA was analyzed for expression of Nrf2 and NQO1. GAPDH was used as normalization control. ⁎Significant compared to A549 parent cells and A549 cells expressingluciferase shRNA (p≤0.05) (B) Immunoblot detection of Nrf2 in A549 cells stably transfected with shRNAs targeting Nrf2 and luciferase. (C) Comparison of Srx1 expression betweencells expressing Nrf2 shRNA and control cells expressing luciferase shRNA. (D) Western blot analysis of Srx1 expression in A549 cells stably transfected with the Nrf2 shRNA andcontrol cells expressing luciferase shRNA.


Nrf2 mRNA and a corresponding 70% decrease in NQO1 expression(Fig. 4A). Measurement of Nrf2 protein by immunoblotting showed asimilar decrease in Nrf2 protein levels (Fig. 4B). The expression of Nrf2in the control cells transfected with luciferase shRNA and theuntransfected cancer cells was comparable (Fig. 4B). Expression ofSrx1was drastically lower (N85%) in A549 cells expressing Nrf2 shRNA(Figs. 4C and D).

ARE mediates the transcriptional regulation of Srx1

To identify putative AREs in the Srx1 promoter, we examined thehuman Srx1 genomic locus in detail. Functional AREs, such as thosein the HO-1, GPx2, and NQO1 genes, are often represented by anextended ARE consensus sequence, 5′-TMAnnRTGAYnnnGCR-wwww-3′, and detailed in silico analysis of the human Srx1 genomiclocus revealed three potential ARE sequences within the ∼3.4 kb ofthe 5′ promoter region (Fig. 5) [31]. Two of these AREs are located inthe proximal approximately −340 bp region. ARE1 and ARE2 arelocated at −228 and −338 bp, respectively. In silico analysis of Srx1promoter revealed putative AREs in R. norvegicus, M. musculus, P.pygmaeus, P. troglodytes, M. mulatta, B. taurus, C. familiaris, F.rubripes, G. aculeatus, and T. nigroviridis (Table 1). The ARE1 coresequence is remarkably well conserved from humans to fish. Thelocation and orientation of the ARE enhancer sequence from thetranscription start site is similar in H. sapiens, R. norvegicus, M.musculus, P. pygmaeus, P. troglodytes, M. mulatta, B. taurus, and C.familiaris (Table 1).

A 3683-bp human Srx1 promoter region was cloned, and deletionreporter constructs containing all three putative AREs (All-3ARE-pGL3b), two AREs (ARE1 and 2-pGL3b), one ARE (ARE1-pGL3b), or noARE (No-ARE-pGL3b) were generated (Fig. 5A; Table 2). Nrf2-dependent activities of these constructs were first investigated inhuman non-small-cell lung cancer cells (A549) in which Nrf2 isconstitutively activated owing to KEAP1 mutation. All three deletion

constructs containing the ARE1 sequence exhibited over 10-foldhigher activity compared with the smallest reporter construct (−233to +19 bp) lacking all ARE sequences (Fig. 5B). All three constructscontaining the ARE1 sequence exhibited over 4-fold higher activity inA549 control cells compared with A549-Nrf2shRNA cells (Fig. 5B). Weused untransfected A549 cells as a control, because the control cellsexpressing luciferase shRNA were not compatible with the luciferasereporter assay. Of these three deletion constructs containing AREsequences, the third deletion construct (−319 to +19 bp) exhibitedthe highest reporter activity. These data strongly suggest that the−319 to +19 region of the Srx1 promoter contains an active ARE,consistent with the localization of a putative ARE (−228 bp) in thisregion. To further confirm this finding and to dissect the function-alities of individual ARE sequences to act as enhancers, we clonedindividual AREs with sufficient flanking sequences into a pTAL-Lucreporter vector containing a minimal promoter. The reporter assayusing pTAL-Luc-derived constructs showed that only ARE1 (pTAL-ARE1) demonstrates substantially higher reporter activity in controlA549 cells compared with A549-Nrf2shRNA cells (Fig. 5C). ARE2(pTAL-ARE2) and ARE3 (pTAL-ARE3) showed minimal reporteractivity. Similar to the data obtained with A549 cells, ARE1 facilitatedTBHQ inducer activity in BEAS2B cells, whereas ARE2 and ARE3showed no TBHQ inducer activity (Fig. 5D). These observationsindicate that only ARE1 is functional, and it is involved in Nrf2-dependent regulation of Srx1 promoter.

Nrf2 binds to the Srx1 promoter in vivo

We used the CHIP assay to determine whether Nrf2 binds to theendogenous Srx1 promoter constitutively. Furthermore, we deter-mined whether an increase in the oxidative stress-mediatedactivation of Nrf2 signaling leads to an increase in its recruitmentto the promoter of Srx1. In A549 control cells, constitutive re-cruitment of Nrf2 to the promoter of the Srx1 was observed (Fig. 6A).

Fig. 5. Deletion analysis of Srx1 promoter by transient transfection in A549 cells. (A) Three putative AREs were identified in the proximal promoter region of the human Srx1gene.They are located at −3.4 kb, −338 bp, and −228 bp relative to the transcription start site. Four luciferase reporter deletion constructs were made that contained all three AREs(All-3ARE-pGL3b; 3683 bp), two AREs (ARE1 and 2-pGL3b; 1.537 kb), one ARE (ARE1-pGL3b; 336 bp), or no AREs (No-ARE-pGL3b; 252 bp). (B) Reporter constructs were transfectedinto A549 cells or A549-Nrf2shRNA cells constitutively expressing the Nrf2 shRNA. A 3683-bp portion of the Srx1 promoter was cloned into the pGL3 Basic luciferase reporter vector(−3664 to +19) tomonitor the activity of this promoter. Three deletion constructs, ARE1 & 2-pGL3b (−1518 to +19), ARE1-pGL3b (−319 to +19), and No-ARE-pGL3b (−233 to +19) wereprepared by restriction digestion of the full-length 3683-bp promoter construct in the pGL3 Basic vector. All four constructs (All-3ARE-pGL3b, ARE1 and 2-pGL3b, ARE1-pGL3b, No-ARE-pGL3b) were transfected into A549 control cells and A549-Nrf2shRNA cells and luciferase activities were measured after 48 h. Luciferase activity was normalized tocotransfected pRL-TK activities and expressed in arbitrary units. The three constructs having AREs had similar reporter activities. The −233 to +19 bp deletion construct lacking an AREsequence displayed the minimum reporter activity. ⁎Significant compared to the smallest construct lacking all three AREs; †Significant compared to A549 control cells (p≤0.05). (C)ARE enhancer sequence oligonucleotides were cloned into the pTAL vector (ARE1-pTAL, ARE2-pTAL, and ARE3-pTAL) and sequence verified. An oligonucleotide containing mutationsin the ARE1 core sequence was also cloned into the pTAL vector (Mut-ARE1-pTAL). These constructs were transfected into A549 cells and A549-Nrf2shRNA cells and the luciferaseactivities were measured. ⁎Significant compared to ARE2-pTAL, ARE3-pTAL, and Mut-ARE1-pTAL. (D) The ARE1 enhancer sequence cloned into the pTAL (ARE1-pTAL) vector wastransfected into BEAS2B cells. After 36 h, cells were treated with TBHQ for 12 h and luciferase activities weremeasured. Luciferase activities were normalized bymeasuring the Renillaluciferase activity from a cotransfected reporter vector. ⁎Significant compared to vector-transfected or ARE2, ARE3-transfected cells; †significant compared to vehicle-treated BEAS2Bcells (p≤0.05).


As expected, in A549-Nrf2shRNA cells, Nrf2 was present atundetectable levels and low amplification was detected using Srx1promoter primers. As shown in Fig. 6B, Nrf2 was present in the basaltranscription complex formed with the Srx1 promoter in BEAS2Bcells. Activation of Nrf2 by TBHQ treatment enhanced the recruit-ment of Nrf2 to the Srx1 promoter as demonstrated by increasedamplification of the Srx1 promoter region (Fig. 6B). Immunoprecipi-tations with control IgG failed to select the Srx1 promoter (Fig. 6B),suggesting that the sites were not enriched in a nonspecific fashion.Collectively, the results from both A549 and BEAS2B cells conclu-sively show that Nrf2 regulates transcription of Srx1 by binding tothe ARE1 enhancer sequence in the Srx1 promoter.

Human Srx1 protects cells from oxidative stress by H2O2

To assess the importance of human Srx1 in response to oxidativestress, we used A549 cells, a lung cancer cell line with a KEAP1mutation leading to constitutive activation of Nrf2. Increased Nrf2activity in A549 leads to increased Srx1 expression, thus makingA549 cells an ideal Srx1 overexpression model system, and siRNAtargeting the Srx1 transcript downregulated Srx1 expression inA549 cells (Fig. 7A). Similarly, ecotopic expression of Srx1 cDNA inBEAS2B cells led to a substantial increase in endogenous SRX1

protein levels (Fig. 7B). We speculate that the higher levels of Srx1may enhance the recycling of the cysteine sulfinic acid forms ofPrx's with reactivation of hyperoxidized Prx's resulting in aug-mentation of the antioxidant capacity of the cell. To determinewhether attenuating Srx1 expression in A549 cells leads to anoverall increase in oxidative stress due to decreased Prx activity, wedownregulated Srx1 expression by RNAi followed by H2O2 treat-ment. Intracellular ROS levels were monitored using c-H2DCFDAand flow cytometry. The results demonstrated a 2-fold increase influorescence in vehicle-treated A549 Srx1 siRNA-transfected cellscompared to vehicle-treated nonspecific (NS) siRNA-transfectedcells (Fig. 7C). Treatment of Srx1 siRNA-transfected A549 cells withH2O2 for 30 min led to a dramatic 10-fold increase in ROS level,whereas H2O2 treatment induced only a 2-fold increase in ROSlevels in nontargeting NS siRNA-transfected A549 cells, suggestingthat peroxide detoxification is altered in Srx1 siRNA-transfectedcells (Fig. 7C). Attenuation of Srx1 expression in A549 cellspotentiated the toxicity of H2O2, whereas overexpression of Srx1cDNA in BEAS2B cells protected the cells against H2O2-mediatedcell death (Figs. 7A, B, D, and E). Thus, Srx1 protects against oxi-dative stress in lung cells, and it may contribute to the overallNrf2-mediated cytoprotection against environmental pollutantssuch as CS.

Table 1ARE mediates the transcriptional regulation of the Srx1 gene

Species Location Orientationof ARE

ARE sequence

Homo sapiens (human) −228 3′–5′ CCGCGACCTGCAAACTCACCCTGAGTCAGC−338 3′–5′ GCGGGCTTTGCCGACTCACCCTGGCTGGGC

Rattus norvegicus (rat) −252 3′–5′ CCGCGACCTGCAAACTCACCCTGAGTCAGC−613 5′–3′ GAGCCTAGATGAGCCTGCGCTGGGATCCAG

Mus musculus (mouse) +27 3′–5′ CAGTGGGCAGCTAGGTCAGAGTGAGACACG−2218 5′–3′ TAAAATGTTTGACATAGCTCAGCTTATTTC

Pongo pygmaeus (chimpanzee) −394 3′–5′ GCTAGCTTTGCCGACTCATCCTGGCTGGGC−1958 3′–5′ CTTGCTCTTGCTCTGTCACCCAGGCTGTAG

Pan troglodytes (orangutan) −824 3′–5′ CCGCGACCTGCAAACTCACCCTGAGTCAGC−931 3′–5′ GCGGGCTTTGCCGACTCATCCCGGCTGGGC

Macaca mulatta (monkey) −308 3′–5′ CCGCGACCTGCAAACTCACCCTGAGTCAGC−401 3′–5′ GCAGGATTTGCCGACTCATCCCGGCTGGGC

Bos taurus (cow) −305 3′–5′ CCACGACCTGCAGACTCACCCTGAGTCAGC−415 3′–5′ GCGAGTTTTGCCGACTCACCCTCGCTGGGC

Canis familiaris (dog) +89 3′–5′ GCCGCTTCTGCCGACTCATCCTGGCTCCGC−1415 5′–3′ CTAAGAGGGTGACTATGCATTCCCCATGCA

Fugu rubripes (Fugu fish) −3681 5′–3′ GCAGAATAATGAGACAGCAGACAGAGCGGG−4873 5′–3′ GCAATAATATGACAATGCATGTAGACATTT

Gasterosteus aculeatus(three-spined stickleback fish)

−34 5′–3′ TCCAGGAAGTGAGGAAGCGCAAACACGTCT

Tetraodon nigroviridis(green spotted puffer fish)

−3716 5′–3′ GTGGAATAATGAGACGGCAGACAGAGCGGG−4846 5′–3′ GCAATAATATGACAATGCATGTAGACATTT

Comparison of ARE sequences from H. sapiens, R. norvegicus, M. musculus, P. pygmaeus, P. troglodytes, M. mulatta, B. taurus, C. familiaris, F. rubripes, G. aculeatus, and T. nigroviridisorthologues of Srx1. Promoter sequences were downloaded from the NCBI database and scanned for the presence of an ARE. The sequence RTGAY/GNNNGCR was used as theprobe.


Srx1 expression declines in the lungs of advanced COPD patients

We have recently reported that there is a decline in Nrf2 activityand the expression of Nrf2-dependent antioxidant enzymes such asHO-1, NQO1, GCLm, and GPx2 in the lung tissues of patients withprogressive COPD, which is associated with increased oxidative stress[27]. To determine whether expression of Srx1 is affected bydiminished Nrf2 expression, we isolated total RNA from 18advanced-stage COPD lung tissues and 5 normal healthy smokerlung tissues and measured the expression of Srx1. Real-time RT-PCRrevealed a marked decrease in the expression of Srx1 in COPD tissues.The average value for relative Srx1 expression in normal healthy non-smokers /ex smokers was 1.07 (±0.32 SD). Compared with normalhealthy lungs, the relative Srx1 transcript level was significantly lowerin lung tissues from patients with COPD (average±SD=0.47±0.18,p=0.003) (Fig. 8A). Immunoblot analysis of 11 randomly selectedrepresentative COPD lungs confirmed the decrease in Srx1 mRNA andprotein expression and a decline in Nrf2 protein level in the COPD

Table 2Details of the Srx1 promoter deletion constructs

Construct name Details of the Srx1 promoter region cloned in the reporter vector

All-3ARE-pGL3b A 3683-bp Srx1 promoter region (−3664 to +19) containingall three ARE sequences, cloned into the pGL3 Basicpromoterless vector

ARE1 and 2-pGL3b A 1537-bp Srx1 promoter region (−1518 to +19) containingARE1 and ARE2, cloned into the pGL3 Basic promoterless vector

ARE1-pGL3b A 336-bp Srx1 promoter region (−319 to +19) containing onlyARE1, cloned into the pGL3 Basic promoterless vector

No-ARE-pGL3b A 252-bp Srx1 promoter region (−233 to +19) lacking all threeAREs, cloned into the pGL3 Basic promoterless vector

ARE1-pTAL ARE1 core sequence (−274 to −193) cloned into the pTALluciferase minimal promoter vector

ARE2-pTAL ARE2 core sequence (−384 to −303) cloned into the pTALluciferase minimal promoter vector

ARE3-pTAL ARE3 core sequence (-3444 to -3363) cloned in pTALluciferase minimal promoter vector

Mut-ARE1-pTAL Mutant ARE1 core sequence (−274 to −193; two single-basesubstitutions at −240 and −242) cloned into the pTAL luciferaseminimal promoter vector

lungs compared with normal lungs (Figs. 8B and C). The overallcorrelation coefficient (r) is 0.75 (p valueb0.001) (Fig. 8D).

Discussion

Cigarette smoking is the most important etiological factor for thedevelopment of COPD. There is a dose-dependent relationshipbetween the cumulative amount of smoking and the incidence ofCOPD. Nrf2, a redox-sensitive basic leucine zipper transcription factor,is a critical determinant of susceptibility to lung inflammation andoxidative stress and the development of emphysema caused bychronic exposure to CS [16]. Consistent with the central role of Nrf2 inprotection against CS-induced oxidative stress, we have previouslyobserved the enhanced formation of 4-hydroxynonenal, a marker oflipid peroxidation, and 8-Oxo-dG, a marker of oxidative DNA damage,in the lungs of Nrf2−/− mice exposed to CS relative to wild-type mice[16,30]. There is also a strong correlation between a decline in Nrf2protein levels and the severity of COPD along with an increase inoxidative stress [17–19].

The potent oxidants in CS include superoxide anion (O2U−), nitric

oxide (NOU), and reactive peroxynitrite (ONOO−), which is formed by

Fig. 6. Nrf2 binds to Srx1 promoter in vivo. (A) CHIP assay was performed with A549cells stably expressing Nrf2 shRNA and the control cells expressing luciferase shRNA.PCRs were performed to amplify the Srx1 regulatory region encompassing ARE1. (B)Increased recruitment of Nrf2 to the ARE1 consensus sequence in the Srx1 promoter inresponse to TBHQ treatment in BEAS2B cells.


the interaction of O2U− and NOU [25]. Semiquinones and benzoqui-

nones present in the cigarette tar along with superoxide radicals leadto production of reactive hydroxyl radicals (UOH) and H2O2 [35]. Someof these reactive oxygen species cause lipid peroxidation, leading to

Fig. 7. Srx1 confers protection against oxidative damage in lung epithelial cells. (A) A549cells were transfectedwith Srx1 siRNA and nontargeting NS siRNA. Cells were harvestedafter 72 h and Srx1 protein level was determined by immunoblotting. (B) BEAS2B cellswere transfected with the Srx1 cDNA expression plasmid and Srx1 protein levels weremeasured 48 h after transfection. (C) Increased ROS levels in A549 cells transfected withSrx1 siRNA and treated with H2O2. A549 cells transfected with Srx1 siRNA and NS siRNAwere treated with 500 μM H2O2 for 30 min. The cells were washed and stained withH2DCF-DA, and the mean fluorescence was measured using flow cytometry. Data arepresented as means±SD. ⁎Significant compared to NS siRNA-transfected and vehicle-treated cells; †significant compared to NS siRNA-transfected and H2O2-treated cells. (D)Attenuation of Srx1 expression in A549 cells by the RNAi approach enhanced thecytotoxicity of H2O2. Cells were exposed to H2O2 for 24 h and viable cells weredetermined byMTT assay. Data are represented as the percentage of viable cells relativeto the vehicle (culture medium)-treated control. Data are the means of six independentreplicates combined to generate the mean±SD for each concentration. ⁎pb0.01 relativeto NS siRNA. (E) Overexpression of Srx1 in BEAS2B cells protected against H2O2

cytotoxicity. ⁎pb0.05 relative to vector control.

the destruction of membrane lipids [36,37]. Lipid peroxidation, awell-established mechanism of cellular injury, is used as an indicator ofoxidative stress. Glutathione peroxidases, peroxiredoxins, and cata-lases decompose H2O2 and organic hydroperoxides produced duringoxidative insult and prevent peroxide-induced DNA damage, lipidperoxidation, and protein degradation [3,38–40]. Peroxiredoxins are afamily of enzymes that reduce H2O2 and alkyl hydroperoxides towaterand alcohol, with the use of reducing equivalents provided by a thiolsuch as thioredoxin [3,39,40]. The Prx enzymes containing twocysteine residues are intrinsically susceptible to reversible hyperox-idation to cysteine sulfinic acid. Cysteine hyperoxidation of Prx resultsin loss of peroxidase activity. Sulfiredoxin catalyzes the reduction ofsulfinic Prx enzymes to sulfenic acid, thus restoring the functionalcysteine residues and activity of Prx enzymes [3,4,24,39,40]. Srx1 isthe first protein identified that has been implicated in the removal of aglutathione moiety from proteins, a process also known as deglu-tathionylation [3,41]. The results of the present study show that Srx1expression is selectively upregulated in the lungs of Nrf2+/+ mice inresponse to CS exposure. Both basal and CS-inducible expression ofSrx1 are Nrf2 dependent in murine lungs. Consistent with the Nrf2-dependent gene expression patterns, Srx1 mRNA and protein weresignificantly higher in the lungs of Nrf2+/+ mice in response to acute CSexposure. Induction of Srx1 expression in CS-exposed Nrf2+/+ mouselungs correlated with the increase in total Prx activity in the lungs ofwild-type CS-exposed mice [16].

Exposure of lung epithelial cells (BEAS2B) to various oxidativestressors such as H2O2, TBHQ, and CSE induced the expression of Srx1,suggesting that Srx1 is an oxidative stress-responsive gene. Down-regulation of Nrf2 by RNAi in human lung epithelial cells such as A549and BEAS2B cells attenuated the expression of Srx1. Targeting thecytosolic repressor of Nrf2, KEAP1, in BEAS2B cells resulted inupregulation of Srx1 expression. A549 cells, which harbor a KEAP1mutation leading to constitutive activation of Nrf2 and its targetgenes, demonstrated increased expression of Srx1, further suggestingthat transcription of Srx1 is tightly controlled by Nrf2 status. Theseresults clearly show that basal and inducible expression of Srx1 mRNAis dependent upon cellular levels of Nrf2.

We further explored the molecular basis underlying the Nrf2-dependent Srx1 induction in lungs. A common feature of the promoterregions of genes induced by oxidative and electrophilic insult in anNrf2-dependent fashion is the presence of a cis-acting enhancersequence, the ARE [22]. Enhancers are DNA sequences that increasetranscription independent of their orientation and distance relative tothe RNA start site [42]. AREs have been identified in severalantioxidant and xenobiotic genes, including mouse Gsta1 [43], Ho-1[44], and ferritin H [45] and rat Gsta2 [46], Gsta3 [47], Nqo1 [48], GCLc[49], Gpx2 [30], and Prx1 [31,50]. We searched for AREs in the humanSrx1 and identified three putative AREs in the proximal promoterregion. The Srx1 AREs are similar to the AREs found in the HO-1 orNQO1 regulatory regions. Detailed sequence analysis revealed that the

Fig. 8. Srx1 expression declines in patients with advanced COPD. (A) Dot plot showingrelative mRNA levels of Srx1 in normal healthy individuals (n=5) and advanced COPDlungs (n=18). Srx1 expression in normal healthy individuals was significantly higherthan in patients with COPD (p=0.003). Data were analyzed using two-sample Wilcoxonrank-sum (Mann–Whitney) test. An immunoblot analysis of (B) Nrf2 and (C) Srx1protein levels in normal healthy lungs (n=5) and in advanced COPD lungs (n=11) isshown. The blots were normalized with GAPDH as loading control. P, lungs frompatients with COPD; N, normal healthy lungs. (D) Spearman correlation analysis showedsignificant correlation between Nrf2 and Srx1 protein levels. The overall correlationcoefficient (r) is 0.75 (pb0.001).


sequences of the Srx1 AREs are highly conserved across differentspecies. Identification of putative ARE sequences in the Srx1 promoterin mammals, rodents, and fish suggests that the regulation of Srx1expression is evolutionarily conserved [51].

To identify functional ARE binding sequences in the human Srx1promoter, we generated several Srx1 promoter-deletion constructs.The activity of the luciferase reporter construct (−3683 to +19)harboring all three Srx1 AREs in the pGL3 Basic vector was fourfoldhigher in A549 control cells compared to A549-Nrf2shRNA cells.

Studies with nested deletion constructs differing in their 5′ endsindicated that only the ARE sequence located between −300 and +19(ARE1) is active. The reporter construct containing the putative ARE1ligated to the pTAL luciferase vector (containing a TATA-like promoterregion) was significantly activated in response to TBHQ treatment inBEAS2B cells. The pTAL-ARE1 reporter activity was reduced substan-tially in A549-Nrf2shRNA cells. Mutation of the ARE1 core sequence inthe pGL3 reporter vector or the pTAL vector completely abolished Srx1promoter or luciferase reporter activity. Recruitment of Nrf2 to theARE1 sequence in the Srx1 promoter was further confirmed by CHIPassay with Nrf2 antibody. Collectively, these results suggest that Nrf2binds to the Srx1 ARE1 and regulates its expression. Studies focusedon understanding the functional significance of Nrf2-dependent Srx1induction in lungs revealed that attenuation of Srx1 expression byRNAi potentiated the toxicity of H2O2 whereas overexpression of Srx1protected against H2O2-mediated cell death.

Increased H2O2 levels in breath condensates from patients withCOPD have been reported [52,53] and they may result from impaireddetoxification or decomposition of H2O2. We have recently reportedthat a decline in the Nrf2-regulated antioxidant defense in COPDpatient lungs accounts for the greater oxidant–antioxidant imbalance.Lung tissues exhibiting severe emphysema demonstrated reducedmRNA and protein levels of HO-1, GCLm, NQO1, and GPx2 [17–19]. Todetermine whether suboptimal Nrf2 activity leads to a paralleldecrease in Srx1 activity as well, we measured Srx1 expression inlung tissues from patients with COPD. Interestingly, the expression ofSrx1 was downregulated at the transcriptional level as well as theprotein level in the lung tissues from patients with COPD. We spe-culate that low levels of Srx1 in COPD tissues may lead to anaccumulation of oxidized sulfinic acid forms of Prx enzymes, therebyattenuating the total Prx activity in lungs. A decline in the activity ofSrx1, which modulates Prx activity and total glutathione peroxidaseactivity, may lead to impaired H2O2 detoxification, thereby enhancingthe oxidative burden in the lungs of COPD.

In conclusion, we found that expression of Srx1, an importantoxidative stress-inducible gene, is regulated by Nrf2. Acute expo-sure to oxidative stress induces Srx1 expression through an Nrf2-dependent pathway, which has a protective role in antioxidativedefense. However, extremely low levels of Srx1 protein level in somesevere COPD lung tissues indicate that chronic exposure of cigarettesmoke can lead to a decline in Srx1 expression, which in turn confersincreased susceptibility to oxidative stress-related diseases. Failure tomaintain Srx1 transcript and protein levels in lung tissues frompatients with COPD correlates with the decreased Nrf2 activity inthese samples, suggesting an important functional relationshipbetween the decline in Nrf2 activity and Srx1 levels. Taken together,we present strong evidence that the Nrf2-dependent transcriptionalregulation of Srx1 may play an important role in counteractingoxidative stress. Preservation of basal and inducible expression ofSrx1, along with other Nrf2-regulated antioxidative enzymes, mayhelp in maintaining the pulmonary antioxidant defense and protectagainst COPD.

Acknowledgments

This workwas supported by NIH Grants R01 HL081205 (S.B.), SCCORP50 HL084945, P50 CA058184, P50 ES015903 and P30ES03819 and aYoung Clinical Innovator Award (S.B., A.N.) and a Young Clinical ScientistAward to Anju Singh from the Flight Attendant Medical ResearchInstitute. We thank JamesWatkins III for providing frozen COPD tissues.

References

[1] Peltoniemi, M. J.; Rytila, P. H.; Harju, T. H.; Soini, Y. M.; Salmenkivi, K. M.; Ruddock,L. W.; Kinnula, V. L. Modulation of glutaredoxin in the lung and sputum ofcigarette smokers and chronic obstructive pulmonary disease. Respir. Res. 7:133;2006.


[2] Kensler, T. W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environ-mental stresses via the Keap1–Nrf2–ARE pathway. Annu. Rev. Pharmacol. Toxicol.47:89–116; 2007.

[3] Findlay, V. J.; Tapiero, H.; Townsend, D. M. Sulfiredoxin: a potential therapeuticagent? Biomed. Pharmacother. 59:374–379; 2005.

[4] Rhee, S. G.; Jeong, W.; Chang, T. S.; Woo, H. A. Sulfiredoxin, the cysteine sulfinicacid reductase specific to 2-Cys peroxiredoxin: its discovery, mechanism of action,and biological significance. Kidney Int. Suppl. 72:S3–8; 2007.

[5] Barnes, P. J. Mediators of chronic obstructive pulmonary disease. Pharmacol. Rev.56:515–548; 2004.

[6] Yoshida, T.; Tuder, R. M. Pathobiology of cigarette smoke-induced chronicobstructive pulmonary disease. Physiol. Rev. 87:1047–1082; 2007.

[7] Lopez, A. D.; Shibuya, K.; Rao, C.; Mathers, C. D.; Hansell, A. L.; Held, L. S.; Schmid,V.; Buist, S. Chronic obstructive pulmonary disease: current burden and futureprojections. Eur. Respir. J. 27:397–412; 2006.

[8] Barnes, P. J. Chronic obstructive pulmonary disease. N. Engl. J. Med. 343:269–280;2000.

[9] Rahman, I.; MacNee, W. Role of oxidants/antioxidants in smoking-induced lungdiseases. Free Radic. Biol. Med. 21:669–681; 1996.

[10] Sandford, A. J.; Silverman, E. K. Chronic obstructive pulmonary disease. 1.Susceptibility factors for COPD: the genotype–environment interaction. Thorax57:736–741; 2002.

[11] Li, N.; Alam, J.; Venkatesan, M. I.; Eiguren-Fernandez, A.; Schmitz, D.; Di Stefano,E.; Slaughter, N.; Killeen, E.; Wang, X.; Huang, A.; Wang, M.; Miguel, A. H.; Cho, A.;Sioutas, C.; Nel, A. E. Nrf2 is a key transcription factor that regulates antioxidantdefense in macrophages and epithelial cells: protecting against the proinflamma-tory and oxidizing effects of diesel exhaust chemicals. J. Immunol.173:3467–3481;2004.

[12] Rangasamy, T.; Guo, J.; Mitzner, W. A.; Roman, J.; Singh, A.; Fryer, A. D.; Yamamoto,M.; Kensler, T. W.; Tuder, R. M.; Georas, S. N.; Biswal, S. Disruption of Nrf2enhances susceptibility to severe airway inflammation and asthma in mice. J. Exp.Med. 202:47–59; 2005.

[13] Thimmulappa, R. K.; Scollick, C.; Traore, K.; Yates, M.; Trush, M. A.; Liby, K. T.;Sporn, M. B.; Yamamoto, M.; Kensler, T. W.; Biswal, S. Nrf2-dependent protectionfrom LPS induced inflammatory response and mortality by CDDO-imidazolide.Biochem. Biophys. Res. Commun. 351:883–889; 2006.

[14] Cho, H. Y.; Jedlicka, A. E.; Reddy, S. P.; Kensler, T. W.; Yamamoto, M.; Zhang, L. Y.;Kleeberger, S. R. Role of NRF2 in protection against hyperoxic lung injury in mice.Am. J. Respir. Cell Mol. Biol. 26:175–182; 2002.

[15] Aoki, Y.; Sato, H.; Nishimura, N.; Takahashi, S.; Itoh, K.; Yamamoto, M. AcceleratedDNA adduct formation in the lung of the Nrf2 knockout mouse exposed to dieselexhaust. Toxicol. Appl. Pharmacol. 173:154–160; 2001.

[16] Rangasamy, T.; Cho, C. Y.; Thimmulappa, R. K.; Zhen, L.; Srisuma, S. S.; Kensler,T. W.; Yamamoto, M.; Petrache, I.; Tuder, R. M.; Biswal, S. Genetic ablation ofNrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice.J. Clin. Invest. 114:1248–1259; 2004.

[17] Goven, D.; Boutten, A.; Lecon-Malas, V.; Marchal-Somme, J.; Amara, N.; Crestani,B.; Fournier, M.; Leseche, G.; Soler, P.; Boczkowski, J.; Bonay, M. Altered Nrf2/Keap1–Bach1 equilibrium in pulmonary emphysema. Thorax 63:916–924; 2008.

[18] Malhotra, D.; Thimmulappa, R.; Navas-Acien, A.; Sandford, A.; Elliott, M.; Singh, A.;Chen, L.; Zhuang, X.; Hogg, J.; Pare, P.; Tuder, R. M.; Biswal, S. Decline in NRF2regulated antioxidants in chronic obstructive pulmonary disease lungs due to lossof its positive regulator, DJ-1. Am. J. Respir. Crit. Care Med. 178:592–604; 2008.

[19] Suzuki, M.; Betsuyaku, T.; Ito, Y.; Nagai, K.; Nasuhara, Y.; Kaga, K.; Kondo, S.;Nishimura, M. Downregulated NF-E2-related factor 2 in pulmonary macrophages ofaged smokers and COPD patients. Am. J. Respir. Cell Mol. Biol. 39 (6):673–682; 2008.

[20] Gao, A. C.; Lou, W.; Ichikawa, T.; Denmeade, S. R.; Barrett, J. C.; Isaacs, J. T.Suppression of the tumorigenicity of prostatic cancer cells by gene(s) located onhuman chromosome 19p13.1–13.2. Prostate 38:46–54; 1999.

[21] Bondareva, A. A.; Capecchi, M. R.; Iverson, S. V.; Li, Y.; Lopez, N. I.; Lucas, O.; Merrill,G. F.; Prigge, J. R.; Siders, A. M.; Wakamiya, M.; Wallin, S. L.; Schmidt, E. E. Effects ofthioredoxin reductase-1 deletion on embryogenesis and transcriptome. FreeRadic. Biol. Med. 43:911–923; 2007.

[22] Nguyen, T.; Sherratt, P. J.; Pickett, C. B. Regulatory mechanisms controlling geneexpression mediated by the antioxidant response element. Annu. Rev. Pharmacol.Toxicol. 43:233–260; 2003.

[23] Adair-Kirk, T. L.; Atkinson, J. J.; Griffin, G. L.; Watson, M. A.; Kelley, D. G.; DeMello,D.; Senior, R. M.; Betsuyaku, T. Distal airways in mice exposed to cigarette smoke:Nrf2-regulated genes are increased in Clara cells. Am. J. Respir. Cell Mol. Biol.39:400–411; 2008.

[24] Biteau, B.; Labarre, J.; Toledano, M. B. ATP-dependent reduction of cysteine-sulphinic acid by S. cerevisiae sulphiredoxin. Nature 425:980–984; 2003.

[25] Vivancos, A. P.; Castillo, E. A.; Biteau, B.; Nicot, C.; Ayte, J.; Toledano, M. B.; Hidalgo,E. A cysteine-sulfinic acid in peroxiredoxin regulates H2O2-sensing by theantioxidant Pap1 pathway. Proc. Natl. Acad. Sci. U. S. A. 102:8875–8880; 2005.

[26] Kwak, M. K.; Wakabayashi, N.; Itoh, K.; Motohashi, H.; Yamamoto, M.; Kensler,T. W. Modulation of gene expression by cancer chemopreventive dithiolethionesthrough the Keap1–Nrf2 pathway: identification of novel gene clusters for cellsurvival. J. Biol. Chem. 278:8135–8145; 2003.

[27] Liu, J.; Xie, Y.; Ducharme, D. M.; Shen, J.; Diwan, B. A.; Merrick, B. A.; Grissom, S. F.;Tucker, C. J.; Paules, R. S.; Tennant, R.; Waalkes, M. P. Global gene expressionassociated with hepatocarcinogenesis in adult male mice induced by in uteroarsenic exposure. Environ. Health Perspect. 114:404–411; 2006.

[28] Itoh, K.; Chiba, T.; Takahashi, S.; Ishii, T.; Igarashi, K.; Katoh, Y.; Oyake, T.; Hayashi,N.; Satoh, K.; Hatayama, I.; Yamamoto, M.; Nabeshima, Y. An Nrf2/small Mafheterodimer mediates the induction of phase II detoxifying enzyme genes

through antioxidant response elements. Biochem. Biophys. Res. Commun. 236:313–322; 1997.

[29] Singh, A.; Misra, V.; Thimmulappa, R. K.; Lee, H.; Ames, S.; Hoque, M. O.; Herman,J. G.; Baylin, S. B.; Sidransky, D.; Gabrielson, E.; Brock, M. V.; Biswal, S. DysfunctionalKEAP1–NRF2 interaction in non-small-cell lung cancer. PLoS Med. 3:e420; 2006.

[30] Singh, A.; Rangasamy, T.; Thimmulappa, R. K.; Lee, H.; Osburn, W. O.; Brigelius-Flohe, R.; Kensler, T. W.; Yamamoto, M.; Biswal, S. Glutathione peroxidase 2, themajor cigarette smoke-inducible isoform of GPX in lungs, is regulated by Nrf2. Am.J. Respir. Cell Mol. Biol. 35:639–650; 2006.

[31] Baker, A. F.; Landowski, T.; Dorr, R.; Tate, W. R.; Gard, J. M.; Tavenner, B. E.;Dragovich, T.; Coon, A.; Powis, G. The antitumor agent imexon activatesantioxidant gene expression: evidence for an oxidative stress response. Clin.Cancer Res. 13:3388–3394; 2007.

[32] Sjoblom, T.; Jones, S.; Wood, L. D.; Parsons, D. W.; Lin, J.; Barber, T. D.; Mandelker,D.; Leary, R. J.; Ptak, J.; Silliman, N.; Szabo, S.; Buckhaults, P.; Farrell, C.; Meeh, P.;Markowitz, S. D.;Willis, J.; Dawson, D.;Willson, J. K.; Gazdar, A. F.; Hartigan, J.;Wu,L.; Liu, C.; Parmigiani, G.; Park, B. H.; Bachman, K. E.; Papadopoulos, N.; Vogelstein,B.; Kinzler, K. W.; Velculescu, V. E. The consensus coding sequences of humanbreast and colorectal cancers. Science 314:268–274; 2006.

[33] Chang, T. S.; Jeong, W.; Woo, H. A.; Lee, S. M.; Park, S.; Rhee, S. G. Characterizationof mammalian sulfiredoxin and its reactivation of hyperoxidized peroxiredoxinthrough reduction of cysteine sulfinic acid in the active site to cysteine. J. Biol.Chem. 279:50994–51001; 2004.

[34] Alley, M. C.; Scudiero, D. A.; Monks, A.; Hursey, M. L.; Czerwinski, M. J.; Fine, D. L.;Abbott, B. J.; Mayo, J. G.; Shoemaker, R. H.; Boyd, M. R. Feasibility of drug screeningwith panels of human tumor cell lines using a microculture tetrazolium assay.Cancer Res. 48:589–601; 1988.

[35] Zang, L. Y.; Stone, K.; Pryor, W. A. Detection of free radicals in aqueous extractsof cigarette tar by electron spin resonance. Free Radic. Biol. Med. 19:161–167;1995.

[36] Rahman, I.; van Schadewijk, A. A.; Crowther, A. J.; Hiemstra, P. S.; Stolk, J.; MacNee,W.; De Boer, W. I. 4-Hydroxy-2-nonenal, a specific lipid peroxidation product, iselevated in lungs of patients with chronic obstructive pulmonary disease. Am. J.Respir. Crit. Care Med. 166:490–495; 2002.

[37] Rahman, I.; Morrison, D.; Donaldson, K.; MacNee, W. Systemic oxidative stress inasthma, COPD, and smokers. Am. J. Respir. Crit. Care Med. 154:1055–1060; 1996.

[38] Sun, Y. Free radicals, antioxidant enzymes, and carcinogenesis. Free Radic. Biol.Med. 8:583–599; 1990.

[39] Rhee, S. G.; Kang, S. W.; Jeong, W.; Chang, T. S.; Yang, K. S.; Woo, H. A. Intracellularmessenger function of hydrogen peroxide and its regulation by peroxiredoxins.Curr. Opin. Cell Biol. 17:183–189; 2005.

[40] Rhee, S. G.; Yang, K. S.; Kang, S. W.; Woo, H. A.; Chang, T. S. Controlled eliminationof intracellular H(2)O(2): regulation of peroxiredoxin, catalase, and glutathioneperoxidase via post-translational modification. Antioxid. Redox Signaling7:619–626; 2005.

[41] Findlay, V. J.; Townsend, D. M.; Morris, T. E.; Fraser, J. P.; He, L.; Tew, K. D. A novelrole for human sulfiredoxin in the reversal of glutathionylation. Cancer Res.66:6800–6806; 2006.

[42] Blackwood, E. M.; Kadonaga, J. T. Going the distance: a current view of enhanceraction. Science 281:61–63; 1998.

[43] Friling, R. S.; Bergelson, S.; Daniel, V. Two adjacent AP-1-like binding sites form theelectrophile-responsive element of the murine glutathione S-transferase Yasubunit gene. Proc. Natl. Acad. Sci. U. S. A. 89:668–672; 1992.

[44] Inamdar, N. M.; Ahn, Y. I.; Alam, J. The heme-responsive element of the mouseheme oxygenase-1 gene is an extended AP-1 binding site that resembles therecognition sequences for MAF and NF-E2 transcription factors. Biochem. Biophys.Res. Commun. 221:570–576; 1996.

[45] Tsuji, Y.; Ayaki, H.; Whitman, S. P.; Morrow, C. S.; Torti, S. V.; Torti, F. M. Coordinatetranscriptional and translational regulation of ferritin in response to oxidativestress. Mol. Cell. Biol. 20:5818–5827; 2000.

[46] Rushmore, T. H.; King, R. G.; Paulson, K. E.; Pickett, C. B. Regulation of glutathioneS-transferase Ya subunit gene expression: identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic com-pounds. Proc. Natl. Acad. Sci. U. S. A. 87:3826–3830; 1990.

[47] Jowsey, I. R.; Jiang, Q.; Itoh, K.; Yamamoto, M.; Hayes, J. D. Expression of theaflatoxin B1-8,9-epoxide-metabolizing murine glutathione S-transferase A3subunit is regulated by the Nrf2 transcription factor through an antioxidantresponse element. Mol. Pharmacol. 64:1018–1028; 2003.

[48] Favreau, L. V.; Pickett, C. B. Transcriptional regulation of the rat NAD(P)H:quinonereductase gene: identification of regulatory elements controlling basal levelexpression and inducible expression by planar aromatic compounds and phenolicantioxidants. J. Biol. Chem. 266:4556–4561; 1991.

[49] Mulcahy, R. T.; Wartman, M. A.; Bailey, H. H.; Gipp, J. J. Constitutive and beta-naphthoflavone-induced expression of the human gamma-glutamylcysteinesynthetase heavy subunit gene is regulated by a distal antioxidant responseelement/TRE sequence. J. Biol. Chem. 272:7445–7454; 1997.

[50] Kim, Y. J.; Ahn, J. Y.; Liang, P.; Ip, C.; Zhang, Y.; Park, Y. M. Human prx1 gene is atarget of Nrf2 and is up-regulated by hypoxia/reoxygenation: implication to tumorbiology. Cancer Res. 67:546–554; 2007.

[51] Nioi, P.; Hayes, J. D. Contribution of NAD(P)H:quinone oxidoreductase 1 toprotection against carcinogenesis, and regulation of its gene by the Nrf2 basic-region leucine zipper and the arylhydrocarbon receptor basic helix-loop-helixtranscription factors. Mutat. Res. 555:149–171; 2004.

[52] Kirkham, P.; Rahman, I. Oxidative stress in asthma and COPD: antioxidants as atherapeutic strategy. Pharmacol. Ther. 111:476–494; 2006.

[53] MacNee, W. Oxidants/antioxidants and COPD. Chest 117:303S–317S; 2000.

nrf2-dependent sulfiredoxin-1 expression protects against cigarette smoke-induced oxidative stress...

Documents