non programmable line follower robot
DESCRIPTION
simple non programable line follower project for all engineering students.........TRANSCRIPT
UNDER THE GUIDENCE OF:-
Mr. Samiran Biswas
SSuubbmmiitttteedd bbyy::--
UUNNIIVVEERRIITTYY RROOLLLL NNOO
AAAAAAAAssssssssiiiiiiiisssssssshhhhhhhh kkkkkkkkuuuuuuuummmmmmmmaaaaaaaarrrrrrrr SSSSSSSShhhhhhhhaaaaaaaarrrrrrrrmmmmmmmmaaaaaaaa 1111111100000000666666660000000033333333000000005555555511111111000000005555555500000000
AAAAAAAAmmmmmmmmiiiiiiiitttttttt MMMMMMMMoooooooonnnnnnnnddddddddaaaaaaaallllllll 1111111100000000666666660000000033333333000000005555555511111111000000003333333300000000
PPPPPPPPrrrrrrrraaaaaaaattttttttiiiiiiiikkkkkkkk DDDDDDDDeeeeeeeebbbbbbbbnnnnnnnnaaaaaaaatttttttthhhhhhhh 1111111100000000666666660000000033333333000000005555555511111111000000002222222299999999
RRRRRRRRoooooooohhhhhhhhiiiiiiiitttttttt kkkkkkkkuuuuuuuummmmmmmmaaaaaaaarrrrrrrr MMMMMMMMoooooooonnnnnnnnddddddddaaaaaaaallllllll 1111111100000000666666660000000033333333000000005555555511111111000000000000000099999999
ACKNOWLEDGEMENTACKNOWLEDGEMENTACKNOWLEDGEMENTACKNOWLEDGEMENT
We would like to express our heartiest gratitude to
Mr.Samiran Biswas, Mr. Chandan Kumar Ghosh, Mr.
Dipak Chakrabarty for providing us with their proper
guidelines and supervision to perform our final year
project in the 8th sem .Then I would like to thank
Subir sir, Mr. Biswajit Biswas for their continuous
inspiration during the whole project.
We would like to thank the whole ECE Dept. Of
MCET for their continuous cooperation and
clarification of doubts while carrying out project
work.
Our special thanks goes to all the faculty members
and college administration, MCET for their
assistance and encouragement.
IIIIIIIINNNNNNNNDDDDDDDDEEEEEEEEXXXXXXXX
SSll..NNoo.. CCoonntteenntt PPgg..NNoo..
11 WWhhaatt iiss RRoobboottiiccss 55
22 AAiimm && DDeessiirreedd
SSppeecciiffiiccaattiioonnss
66
33 MMeettiirreeaall RReeqq 77
44 BBlloocckk DDiiaaggrraamm 88
55 CCiirrccuuiitt DDiiaaggrraamm 99
77 WWoorrkkiinngg ooff RRoobboott 1100--1144
88 MMeessuurreemmeenntt aatt aa GGllaannccee 1155--1166
99 CCoonnttrrooll && LLooccoommoottiioonn 1177
1100 AApppplliiccaattiioonnss && LLiimmiittaaiioonn 1188
CCoonnccuullaattiioonn 1199
BBiibbllooggrraapphhyy 2200
� � � � � � � � � � � � �WHAT IS ROBOTICSWHAT IS ROBOTICSWHAT IS ROBOTICS
Robotics is the science and technology of robot, their design,
manufacture, and application.Robotics requires a working knowledge
of electronics, mechanics and software, and is usually accompanied
by a large working knowledge of many subjects.A person working in
the field is a roboticist.
Although the appearance and capabilities of robots vary vastly, all
robots share the features of a mechanical, movable structure
under some form of autonomous control. The structure of a robot
is usually mostly mechanical and can be called a kinematic chain (its
functionality being akin to the skeleton of the human body). The
chain is formed of links (its bones), actuators (its muscles) and
joints which can allow one or more degrees of freedom. Most
contemporary robots use open serial chains in which each link
connects the one before to the one after it. These robots are
called serial robots and often resemble the human arm. Some
robots, such as the Stewart platform, use closed parallel kinematic
chains. Other structures, such as those that mimic the mechanical
structure of humans, various animals and insects, are comparatively
rare. However, the development and use of such structures in
robots is an active area of research (e.g. biomechanics). Robots
used as manipulators have an end effector mounted on the last
link.
AAAAAAAAIIIIIIIIMMMMMMMM OOOOOOOOFFFFFFFF TTTTTTTTHHHHHHHHEEEEEEEE PPPPPPPPRRRRRRRROOOOOOOOJJJJJJJJEEEEEEEECCCCCCCCTTTTTTTT
TThhee aaiimm ooff tthhee pprroojjeecctt iiss ttoo mmaakkee aa rroobboott wwhhiicchh
ccaann ffoollllooww aa bbllaacckk ssttrriipp oonn aa wwhhiittee fflloooorr aanndd ccaann eexxttiinngguuiisshh
tthhee ffiirree oonn tthhee ppaatthh.. TThhee rroobboott ccaann bbee uusseedd iinn tthhee rreessccuuee
ooppeerraattiioonn.. TThhuuss tthhee rroobboott ccaann aacctt aass aa ppaatthh gguuiiddeerr iinn
nnoorrmmaall ccaassee aanndd aass aa ffiirree eexxttiinngguuiisshheerr iinn eemmeerrggeennccyy..
DDDDDDDDEEEEEEEESSSSSSSSIIIIIIIIGGGGGGGGNNNNNNNN SSSSSSSSPPPPPPPPEEEEEEEECCCCCCCCIIIIIIIIFFFFFFFFIIIIIIIICCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS
11.. FFoorr pprrooppeerr ffuunnccttiioonniinngg ooff tthhee rroobboott nneeeeddss aa vvoollttaaggee
ssuuppppllyy ooff aabboouutt 55..33VV aanndd ccuurrrreenntt aabboouutt 00..77AA..
22.. TThhee rroobboott sshhoouulldd bbee aabbllee ttoo ddiissttiinngguuiisshh bbeettwweeeenn tthhee
wwhhiittee aanndd tthhee bbllaacckk ssuurrffaaccee..
33.. IIff tthhee bbllaacckk ssuurrffaaccee ssuuddddeennllyy eennddss,, tthhee rroobboott sshhoouulldd
kkeeeepp oonn mmoovviinngg iinn tthhee ddiirreeccttiioonn iitt llaasstt mmoovveedd uunnttiill tthhee
bbllaacckk lliinnee iiss aaggaaiinn tthheerree..
44.. IItt sshhoouulldd ssttoopp aanndd eexxttiinngguuiisshh ffiirree aanndd rreessttaarrtt oonnllyy
aafftteerr mmaakkiinngg ssuurree tthhaatt tthhee ffiirree hhaass bbeeeenn
eexxttiinngguuiisshheedd..
55.. TThhiiss ccoouulldd nnoott bbee rruunn uussiinngg tthhee ddrryy cceellllss bbeeccaauussee ooff
tthhee ccuurrrreenntt rreeqquuiirreemmeenntt..
MMMMMMMMAAAAAAAATTTTTTTTEEEEEEEERRRRRRRRIIIIIIIIAAAAAAAALLLLLLLL RRRRRRRREEEEEEEEQQQQQQQQUUUUUUUUIIIIIIIIRRRRRRRREEEEEEEEDDDDDDDD
TThhee ccoommppoonneenntt lliisstt ffoorr mmaakkiinngg tthhee rroobboott iiss aass ffoolllloowwss::--
SS..NNoo MMaatteerriiaall RReeqquuiirreedd DDeessccrriippttiioonn QQuuaannttiittyy
11 LLMM335588 DDuuaall OOpp--AAmmpp 33
22 NNEE555555 TTiimmeerr 11
33 SSLL110000 NNPPNN ttrraannssiissttoorr 88
44 SSKK110000 PPNNPP ttrraannssiissttoorr 11
55 77440088 AANNDD IICC 11
66 77443322 OORR IICC 11
77 VVeeccttoorr BBooaarrdd 11
88 DDCC mmoottoorrss 33
99 LLDDRR ((LLiigghhtt ddeeppeennddeenntt
rreessiissttaannccee))
33
1100 IIRR RReecceeiivveerr ((ffoorr hheeaatt)) 11
1111 3322CC PPoowweerr NNPPNN
ttrraannssiissttoorr
22
BBBBBBBBLLLLLLLLOOOOOOOOCCCCCCCCKKKKKKKK DDDDDDDDIIIIIIIIAAAAAAAAGGGGGGGGRRRRRRRRAAAAAAAAMMMMMMMM
CCCCCCCCIIIIIIIIRRRRRRRRCCCCCCCCUUUUUUUUIIIIIIIITTTTTTTT DDDDDDDDIIIIIIIIAAAAAAAAGGGGGGGGRRRRRRRRAAAAAAAAMMMMMMMM((((((((11111111))))))))
CCCCCCCCIIIIIIIIRRRRRRRRCCCCCCCCUUUUUUUUIIIIIIIITTTTTTTT DDDDDDDDIIIIIIIIAAAAAAAAGGGGGGGGRRRRRRRRAAAAAAAAMMMMMMMM((((((((22222222))))))))
WWWWWWWWOOOOOOOORRRRRRRRKKKKKKKKIIIIIIIINNNNNNNNGGGGGGGG OOOOOOOOFFFFFFFF TTTTTTTTHHHHHHHHEEEEEEEE RRRRRRRROOOOOOOOBBBBBBBBOOOOOOOOTTTTTTTT
Obviously the line following robot will need to see the line,
therefore we require an light detector of some sort. We
also would like it if the line following robot could do this
regardless of the ambient conditions (is the room dark or
light? is it lit by sunlight or artificial light?). So the robot
will also need its own illumination source. The weapon of
choice here will be Infra Red (IR) light.
To make this easy for ourselves the light only needs to be
constant... if a white line is present then it will reflect a
lot of IR from our source. If the line is black then we see
the opposite effect.
THE CIRCUITTHE CIRCUITTHE CIRCUITTHE CIRCUIT
All we need is an IR source, an IR photo-transistor and a
couple of resistors! Here are the resources:
• IR emmiters and detector pairs:
• IR emmiters and detector pairs:
On top of these, it would be nice if the signal that we
get could be TTL (on or off, 0V, 5V). So to do this
we will also require our favourite BEAM chip, the
74AC240, heres the circuit:
Obviously the line following robot will need to see the line,
therefore we require an light detector of some sort. We
also would like it if the line following robot could do this
regardless of the ambient conditions (is the room dark or
light? is it lit by sunlight or artificial light?). So the robot
will also need its own illumination source. The weapon of
choice here will be Infra Red (IR) light.
To make this easy for ourselves the light only needs to be
constant... if a white line is present then it will reflect a
lot of IR from our source. If the line is black then we see
the opposite effect.
Circuit operation is simple.... no line to follow put the
input to the inverter high, and therefore the inverter
outputs a low, line detection turns on the transistor (or
photodiode) and thus the inverter gets a low and outputs a
high. If your robot is following a black line on a white
page, then add another invereter after or before the
first.
So what should the values for R1 and R2 be? and how do I
set up the 74AC240 chip exactly..... The value for R1
affects the source IR brightness, for maximum brightness
we set R1 to give the maximum allowable forward current
for the IR led. So what should it be?? Well, look at the
datasheet for your LED, lookup the value of the maximum
forward current. Now a simple bit of electronic theory
tells us V=IR, I will assume you are using 5V because this
is the volatge the 74AC240 should be run at (6V is OK...
4 AA batteries).
Now lets say that the max forward current is 100mA so
we have 5V = 100mA * R , therefore:
5/100*10^-3 = R = 50ohms.
Experiment with different values until you get a sensitivity
that you are happy with... too bright and the detector will
see it when it shouldn't! Also remember this will affect
the distance you can have it from the line you are
following.
So how about R2? just set R2 to about 4K.
The chip setup is simple too... ground pins 1, 10 and 19,
put 5V onto pin 20. Now choose a pin to input your signal
to, if we look at the 74AC240 datasheet on page 14, we
will see a connection diagram, any pin with an I is an
input, follow it across to find its output.
Pins 1 and 19 are the enable pins, which we have grounded
to permanently enable the inputs on both side of the chip,
this leaves you free to use any of the input pins. For
example (in case I haven't spelt it out enough already)...
input your signal at pin 4 and take the ouput from pin 16.
The output signal could be used to directly drive your
motor... just connect one side of the motor to the ouput,
and the other side to ground. If you do this for two
motors (2 sets of line detectors will require two sets of
emitters and detectors, but only one 74AC240 chip), then
you have a basic line follower already! The left detector
should be used to drive the right motor and vice versa
The behaviour of this robot as it stands will be too turn a
motor on IF a line is present, if both detectors are over
the line then it will drive straight, if the left detector
goes of the line, it will turn off the right motor causing
the robot to turn back onto the line, if the right detector
goes off the line then it will turn off the left motor and
again go back onto the line. If both detectors come off
the line (end of line) then the robot will stop altogether,
perfect!
� � � � � � � � � � � �74HC240 • 74HCT24074HC240 • 74HCT24074HC240 • 74HCT240
OCTAL BUFFER/LINE DRIVER WITH 3OCTAL BUFFER/LINE DRIVER WITH 3OCTAL BUFFER/LINE DRIVER WITH 3OCTAL BUFFER/LINE DRIVER WITH 3----
STATE OUTPUTSSTATE OUTPUTSSTATE OUTPUTSSTATE OUTPUTS
General Description
The AC/ACT240 is an octal buffer and line driver designed
to be employed as a memory address driver, clock driver
and bus oriented transmitter or receiver which provides
improved PC board density.
Features
_ ICC and IOZ reduced by 50%
_ Inverting 3-STATE outputs drive bus lines or buffer
memory address registers
_ Outputs source/sink 24 mA
_ ACT240 has TTL-compatible inputs
� � � � � � � � � � � � � � � � � � �MEASUREMENT AT A GLANCEMEASUREMENT AT A GLANCEMEASUREMENT AT A GLANCE
• Height of the base from ground = 8.7 cm
• Diameter of the wheel = 3.2 cm
• Free space = 0.1cm
• Width of wooden base = 0.5 cm
• Breadth of base = 17.6 cm
• Length of lower base = 23.7 cm
• Number of motors used = 3
• Revolving base :
Breadth =15.5 cm
Length= 30.7 cm
• Length of arm =31cm
• Length of grabbing hand = 9.6cm
• Maximum extendable length of grabbing hand =10cm
� � � � � � � � �� � � � � � � � �� � � � � � � � �� � � � � � � � �
The bot rests upon four wheels. Out of four wheels, the two
rear wheels are driven by two separate geared motors of 100
rpm each which are connected on the same axis. The D.C motors
are operated at 12 volt with normal power supply of 220- 230
volt using a Switched Mode Power Supply (SMPS). The wheels
can rotate in both clockwise and anticlockwise direction. The
rest two front wheels can rotate 360 degree on both ways to
support the bot in any direction. Left and right movement of the
bot is due to free rotation of front wheels keeping the left and
right rear wheels constant at one time respectively.
UPPER BASEUPPER BASEUPPER BASEUPPER BASE
Above the lower base of the bot, the turn table platform is of
30.7 cm length and 15.7 cm breadth. The upper revolving base
is connected with an arm which lifts and lowers down the
material and also keep the blocks in horizontal and vertical
position. The turn table is rotating in both directions through a
geared motor of 10 rpm. Horizontal movement of the arm
depends on the clockwise and anticlockwise movement of the
motor shaft of the turn table. The motor is actually fixed with
the lower base keeping the shaft at a certain height. This shaft
has got a rubber padding on its tip. turntable there is a rubber
padding.
CONTROLCONTROLCONTROLCONTROL
The mechanical structure of a robot must be controlled to perform
tasks. The control of a robot involves three distinct phases -
perception, processing and action (robotic paradigms). Sensors give
information about the environment or the robot itself (e.g. the
position of its joints or its end effector). Using strategies from
the field of control theory, this information is processed to
calculate the appropriate signals to the actuators (motors) which
move the mechanical structure. The control of a robot involves
path planning, pattern recognition, obstacle avoidance, etc. More
complex and adaptable control strategies can be referred to as
artificial intelligence.
LOCOMOTIONLOCOMOTIONLOCOMOTIONLOCOMOTION
For simplicity, most mobile robots have four wheels. However, some
researchers have tried to create more complex wheeled robots,
with only one or two wheels.
• Two-wheeled balancing: While the Segway is not commonly
thought of as a robot, it can be thought of as a component of
a robot. Several real robots do use a similar dynamic
balancing algorithm, and NASA's Robonaut has been mounted
on a Segway.
• Ballbot: Carnegie Mellon University researchers have
developed a new type of mobile robot that balances on a ball
instead of legs or wheels. "Ballbot" is a self-contained,
battery-operated, omnidirectional robot that balances
dynamically on a single urethane-coated metal sphere.
� � � � � � � � � � �APPLICATIONSAPPLICATIONSAPPLICATIONS
1. The robot can be used as a guider to guide the visitors from the
entrance to the main office .
2. It can help doctors to carry the medicines from one ward to
another .
3. The main purpose is to rescue the people by extinguishing fire in
a building .
4. When man power does not work to rescue then the robot can
done this job.
LIMITATIONS AND EXTENSIONSLIMITATIONS AND EXTENSIONSLIMITATIONS AND EXTENSIONSLIMITATIONS AND EXTENSIONS
In the present condition it can extinguish fire only in the way
and not in all the rooms. It can be extended to a real fire
extinguisher by replacing the fan by a carbon-di-oxide carrier and
by making it to extinguish fires of all the room using
microprogramming.
Also the robot could not be run through the batteries because
at some conditions the current requirement for the circuit rises to
about .8A which is very high and can not be obtained using
batteries.
CONCULCONCULCONCULCONCULATATATATIONIONIONION
We made it possible using various electrical and mechanical
components. It includes in total five geared motors of varying
rpm. We have made a differential steering set-up for the
various movements of the lower base. The other movements of
the upper base, arm and the grabbing system is provided by
mechanical coupling, pulley system and a pivoting system
respectively. Ball bearing, free rotating wheel etcetera are used
for the movement of the bot. For the electrical connection part
we had used switches, relays, connecting cables, and other
components.
In our journey we had met with several problems, especially
while working with the grabbing part. We solved most of the
problems and finally arrived up till this. Moreover all type of
electronic goods were not available in our nearby market and for
small things we had to travel a long way from Behrampore to
Kolkata. However it was fun working in such an innovative and
energetic team.
Finally we present to you, MASS, our robot. Though it looks
somewhat poverty stricken due to its rickety limb, it is capable
of performing its task in an efficient way. We had just tried to
utilize our meager resources optimally.
BIBLIOGRAPHYBIBLIOGRAPHYBIBLIOGRAPHYBIBLIOGRAPHY
These are some of the sites we visited:-
http://www.hobbyengineering.com/rmapIndex.html
http://www.ridgesoft.com/buildingbots.htm
http://www.seattlerobotics.org/guide/infrared.html
http://www.robotroom.com/RBFB.html //line following
robot
http://www.mstracey.btinternet.co.uk/interest.htm
http://www.dudi30.republika.pl/galeria/index.html
//New robot every week
http://www.robotics.com/robomenu/index.html
THANK
YOU