ngf, bdnf and nt-3 play unique roles in the in vitro development and patterning of innervation of...

DEVELOPMENTAL BRAIN

RESEARCH

ELSEVIER Developmental Brain Research 92 (1996) 49-60

Research report

NGF, BDNF and NT-3 play unique roles in the in vitro development and patterning of innervation of the mammalian inner ear

Hinrich Staecker a,c Thomas R. Van De Water a,b,c,* Philippe P. Lefebvre a,c Wei Liu a Masseih Moghadassi a, Vera Galinovic-Schwartz a, Brigitte Malgrange c Gustave Moonen c

a Department of Otolaryngology, Kennedy Center, Room 302, Albert Einstein College of Medicine, 1410 Pelham Parkway South, Bronx, NY 10461, USA b Department of Neuroscience, Kennedy Center, Room 302, Albert Einstein College of Medicine, 1410 Pelham Parkway South, Bronx, NY 10461, USA

c Department of Human Physiology and Pathophysiology, University of Liege, Place Delcour 17, Liege, Belgium B4020

Accepted 7 November 1995

Abstract

Developing cochleovestibular ganglion (CVG) neurons depend upon interaction with the otocyst, their peripheral target tissue, for both trophic support and tropic guidance. RT-PCR of Ell through El4 otocyst-CVG RNA extracts have shown that NGF as well as BDNF and NT-3 are expressed in the developing inner ear (in situ RT-PCR on tissue sections of El2 otocysts localized all three neurotrophins to the otocyst). To evaluate the functional significance of NGF, BDNF and NT-3 expression, El0.5 otocyst-CVG explants were treated with antisense oligonucleotides and compared to sense treated and control cultures. Confocal microscopic analysis revealed that treatment with BDNF antisense resulted in extensive neuronal cell death, downregulation of NGF caused an inhibition of neuritogenesis and a decrease in the neuronal population of the CVG, whereas treatment with NT-3 antisense resulted in a loss of target directed CVG neuritic ingrowth in this in vitro model. The effect of NGF or BDNF antisense treatment could be prevented by the simultaneous addition of the respective growth factor. These findings demonstrate that each of the three neurotrophins have important roles during the onset of neuritic ingrowth of the CVG neurons to the otocyst.

Keywords: Cochleovestibular ganglion; Otocyst; In vitro; Antinsense oligonucleotide; Neurotrophin; Neuronal survival; Neuritogenesis; Neurite guidance

1. Introduction

The NGF family of neurotrophins are small polypeptide growth factors that share a large degree of amino acid homology [11,20,34]. Due to a lack of antibodies specific for individual neurotrophins, detection by normal immunohistochemical methods has been difficult [1], thus necessi- tating the use of radiolabelled ligand binding and in situ hybridization to localize areas of neurotrophin gene expression [12,14].

Nerve growth factor has been shown to be required in the survival of embryonic sensory and sympathetic neurons [7,19,24,31]. The closely related BDNF [30] and NT-3 [34] have many trophic functions both in PNS and in CNS neurons including increasing neuronal survival [10,22,36], inducing neuronal differentiation [2], and possibly influ-

* Corresponding author at address a. Fax: (1) (718) 430-4258. Emaih [email protected]

0165-3806/96/$15.00 © 1996 Elsevier Science B.V. All rights reserved SSDI 0 1 6 5 - 3 8 0 6 ( 9 5 ) 0 0 1 9 8 - 0

encing Schwann cell activity [46]. However since these neurotrophins frequently have overlapping patterns of expression within a single population of neurons [14,33,38,45], it is unclear how these neurotrophins inte- grate their functions to regulate neuronal development and target tissue innervation.

The development and innervation of the developing inner ear (i.e. otocyst) by its cochleovestibular ganglion (CVG) provides an excellent model for studying the effects of neurotrophins in a single organ system since development and innervation of the inner ear can take place under regulated conditions [54]. Neuronal outgrowth from the murine CVG begins on approximately embryonic day ten (El0), with the first neurites from this ganglion complex penetrating the basal lamina of the otocyst 12 h later on El0.5 [17,44]. At this stage the entire otocyst-CVG complex can be removed from the embryo en bloc and cultured in a chemically defined medium, thus allowing manipulation of the microenvironment through either the addition of exogenous growth factor, or a reduction in

50 H. Staecker et al. / Developmental Brain Research 92 (1996) 49-60

endogenous available growth factor via either suppression of production with antisense oligonucleotides or binding of factors with their neutralizing antibodies. After these treat- ments, a detailed study of neuronal morphology in the otocyst-CVG organotypic cultures would allow determination of the respective functional roles for each of the three members of the neurotrophin family.

Until now there has only been indirect evidence that NGF is being produced by the developing inner ear [27,29,47]. So far only BDNF and NT-3 have been demonstrated to be present by in situ hybridization [38,47], in contrast to experiments that have shown that developing auditory neurons are responsive to exogenous NGF [27,28].

Using reverse transcription polymerase chain reaction (RT-PCR), and sequencing of PCR products we have identified NGF, BDNF and NT-3 expression in E11 through El4 otocyst-CVG complex samples, and with in situ RT-PCR, have localized mRNA for these three neurotrophins within the El2 otocyst-CVG complex. Further- more, we have specifically downregulated the production of NGF and most likely of BDNF and NT-3 as well as by culturing El0.5 organotypic otocyst-CVG explants for 3 days with antisense oligonucleotides. The effect of each antisense treatment on in vitro neuritic development, neuronal survival and patterns of innervation of developing otic sensory structures was observed using serial, optical sectioning with a confocal microscope, image storage and 3-D reconstructions [37].

2. Materials and methods

2.1. Cultures

CBA × C57BL6 mouse embryos were removed from staged pregnant females that were painlessly euthanised early on the l l th day of gestation. The precise developmental stage of the embryos was determined by somite count with counts ranging from 28 to 36 defining the El0.5 stage. The El0.5 otocyst with its CVG attached was microsurgically removed and placed in a defined culture medium consisting of 50 p.l of Dulbecco Modified Eagles Medium supplemented with high glucose (6 g/1 final concentration) and N1 cocktail (Bottenstein and Sato, 1979). Unmodified oligodeoxynucleotides (Albert Einstein Oligonucleotide Synthesis Facility) of the following sequences were used at a final concentration of 5 /xM: Antisense NGF (5'CATGqTCACTAGGAG; NGF-AS1) and (5'CTGCCTTGAGGCACA; NGF-AS2), sense NGF (5'CTCCTAGTGAACATG; NGF-S 1) and (5'TGTGC- CTCAAGCCAG; NGF-S 2) [52]; antisense BDNF ( 5 ' C A T C A C T C T T C T C A C ; B D N F - A S 1 ) and (5'ACACGCTCAGCTCCC; BDNF-AS 2) sense BDNF (5'GTGAGAAGAGTGATG; BDNF-S 1) and (5'GG- GAGCTGAGCGTGT; BDNF-S2)[30]; antisense NT-3

(5' CATCACCTFGTTCAC; NT-3-AS1) and (5' GCCACG- G A G A T A A G C ; NT-3-AS 2) and sense NT-3 (5'GTGAACAAGGTGATG; NT-3-S 1) and (5'GCT- TATCTCCGTGGC; NT-3-S 2) [34]. All oligodeoxynucleotides were checked for lack of cross hybridization with the complete published sequences of the other neurotrophins using the Oligo program. Cultures were incubated for 72 h at 37°C, and medium, either with or without oligodeoxynucleotides, was exchanged every 12 h to com- pensate for rapid degeneration of the oligonucleotides. To determine the rescue effect of exogenously applied neurotrophins, cultures were set up with 5 /xM of NGF-AS 1 or BDNF-AS 1 or NT-3-AS 1 and treated respectively with 50 ng/ml of hrNGF, 25 ng /ml of hrBDNF or hrNT-3, 25ng/ml. The cultures were incubated at 370 for 72 h and the medium was changed every 12 h.

2.2. Microscopy

Specimens were removed from culture medium, washed three times in Tris-buffered saline (TBS) pH 7.5 and subsequently fixed for 10 min in methacarn fixative [17]. Specimens were then washed in methanol, rehydrated and placed in a blocking buffer of TBS + 20% fetal calf serum (FCS) for 1 h. Neurons and their processes were stained with a polyclonal anti-mouse 66 kDa neurofilament antibody and visualized with FITC conjugated secondary antibody (Jaxell Labs.). The otocyst basal lamina was stained with a polyclonal anti-laminin antibody and a TRITC conjugated secondary antibody (Jaxell Labs.). Staining was carried out at 4°C for 12 h followed by five 12-h washes in TBS to remove excess antibody from the whole organotypic explants. Shorter washes resulted in high background fluorescence. Whole mount specimens were ana- lyzed with a BioRad MRC 600 confocal microscope (Al- bert Einstein Image Analysis Facility), allowing simultaneous visualization of both FITC (green) and TRITC (red) staining. The fixed otocyst-CVG complex was mounted in Vectamount antifading medium (Vector) and serially scanned at 2 /xm intervals. Images were stored on an optical disc for later analysis. Optical sectioning allowed tracing and measurement of individual cell bodies, neurites or neuronal fascicles as well as determination of ganglion volume using the BioRad confocal software. Seven-/zm slices were reconstructed and each section was measured for area and number of neurons within the area. Integration of all the measured areas of the ganglion was then used to determine the ganglion volume. Twenty random counts of neuron cell bodies per optical section area were averaged. The average neuron count per area and ganglion volume were used to determine total neuron count per ganglion. Experiments were repeated using anti-neuron specific eno- lase to verify the ability to count neurons using the an- tineurofilaments stain. Statistical analysis was carried out using the two tailed Student's t-test [6].

H. Staecker et al. / Developmental Brain Research 92 (1996) 49-60 51

2.3. In situ RT-PCR

Unless otherwise noted all glassware, plasticware and reagents used were RNAse free. El2 (43-48 somites) embryos were removed and fixed in 4% paraformaldehyde for 2 h, dehydrated and embedded in paraffin. Salivary glands were obtained from adult male mice and processed as described above. Seven-/zm sections were cut with a disposable microtome knife and placed on 3-aminoetho- xypropylsilane (Sigma) coated slides which were stored under vacuum until use. Tissue sections were deparaf- finized and pretreated for 15 min. with predigested pronase (1 /~g/ml; Sigma) and subsequently washed 5 times in 50 mM TRIS at pH 7.5. Following this step, tissue sections were treated overnight in RNAse free DNAse (20 units of enzyme per section; Boehringer Mannheim) at 37°C. After 5 washes in 50 mM TRIS at pH 7.5, reverse transcription was carried out for 1 hr at 37°C (MuLV reverse transcriptase, Boehringer Mannheim). The PCR reaction mix was made up with digoxigenin-dUTP as a fifth nucleotide at a 1:30 ratio of digoxigenin-dUTP to dT-I'P and the following primers: NGF; 5'CTCCGGTGAGTCCTGTTGAA and 5'CCAAGGACGCAGCTI~CTAT, BDNF; 5'GCC'I'TC- CTTGTTGTAACCCAT and 5 'GATGCCGCAAA- CATGTCTATG, NT-3; 5 'ATGTCCATCTTGTTT- TATGTG and 5'GATGCCAATTCATG'ITCTTCC. Se- quences were checked for lack of cross hybridization potential with the Oligo program. Hot start PCR was carried out [35,51] for a total of 25 cycles using a Coy thermal cycler designed to hold whole microscope slides (Coy Corp.). Finally the specimens were washed and accumulation of product was detected using the Genius detection kit (Boehringer Mannheim). Tissue sections were examined for digoxegonin labeled reaction product on a Zeiss Axiophot system.

2.4. RNA extraction and PCR

Mouse embryos were removed and staged by somite count (Ell, 37-39 somites; El2, 43-48 somites; El4, 60-62 somites). The otocyst CVG complex of 20 embryos was microsurgically removed and pooled for each stage studied. RNA was isolated by guanidinium thiocyanate extraction. cDNA was synthesized via reverse transcription with MuLV reverse transcriptase (Boehringer Mannheim) at 37°C for 1 h. PCR amplification conditions were as fol- lows: annealing 57°C for 1 min, extend cycle 72°C for 1 min followed by 92°C for 1 min. Twenty-five cycles were completed. All reagents used were obtained from Boehringer Mannheim. Primer sequences used for NGF, BDNF and NT-3 amplification were described above. To control for contamination with genomic DNA, amplification for all three sequences was carried out without the reverse transcription step. DNA sequencing of the PCR amplification product using the dideoxy chain termination method [43] was then carried out to determine if the

amplification product matched the predicted sequence. All protocols are described in Current Protocols in Molecular Biology [4].

3. Results

3.1. Amplification and localization of NGF, BDNF and NT-3 mRNA production.

RNA extractions from pooled El3 mouse otocyst-CVG complexes reverse transcribed then amplified with primers for either NGF, BDNF or NT-3 all yielded bands whose length corresponded to that predicted for each set of primers (Fig. 1). The identity of each product was confirmed by DNA sequencing, supporting our assumption that all three neurotrophins are produced by this stage otocyst-CVG complex. Inner ear specimens processed for RT-PCR from El l , El2 and El4 embryos were also positive for mRNA that encodes for these three neurotrophins.

To localize the sites of neurotrophin mRNA production in the developing inner ear we performed in situ RT-PCR amplification [51] on 7/xm tissue sections of E12 mouse embryo CVG-otocyst complexes which resulted in staining of the cells producing specific neurotrophin mRNAs (Fig. 2). Amplification using NGF primers revealed positive cells within the ventro-medial wall of the otocyst and also within the CVG complex (Fig. 2C). The periotic mesenchyme was also weakly positive for the presence of NGF mRNA with no staining in the tissue of the adjacent facial ganglion which does not synapse with the developing inner ear (Fig. 2C). Omission of the reverse transcription step resulted in no staining above background in these E12 otocyst specimens (Fig. 2B), showing that all genomic DNA had been removed and that only reverse transcribed cDNA had been amplified. Inner ear tissue sections were amplified with only one of the two primers used for each of the three neurotrophins studied were also negative for reaction product (Fig. 2F). Male mouse salivary gland was used as a positive control for NGF amplification. Amplifi- cation with NGF primers resulted in the expected accumulation of reaction product within the salivary acini and not in the surrounding mesenchyme (Fig. 2A). When BDNF primers were used, sections of the ventral and lateral walls of the El2 otocyst were positive for PCR amplification product (Fig. 2D). Staining of reaction product after NT-3 amplification was distributed to discrete areas of the epithelial wall of the El2 otocyst, two such areas are seen in the photomicrograph of Fig. 4E.

3.2. Effects of neurotrophin antisense treatment on neuronal survival, neuritogenesis and pattern of innervation

Since our RT-PCR (Fig. 1) and in situ RT-PCR results (Fig. 2) suggested that there is active production of all


1 2 3 4

41~NT-3

41raNG F

4 1 ~ B D N F

Fig. 1. PCR amplification of E13 otocyst-CVG cDNA with neurotrophin primers, cDNAs for all three neurotrophins were recovered after reverse transcription of pooled RNA extracted from otocyst-CVG samples. Amplification products are separated on a 1.3% agarose gel and stained with ethidium bromide. Lane 1--molecular weight markers (123, 246, 369, 492, 615, 738, 861, 948 b.p.); Lane 2 --amplification with NGF primers: the PCR product migrated in a band that corresponded to the expected product length of 403 b.p.; Lane 3--amplification with BDNF primers: the PCR product migrated in a band that corresponded to the expected product length of 234 b.p.; Lane 4--amplification with NT-3 primers: the PCR product migrated in a band that corresponded to the expected product length of 786 b.p. The identity of all of the products was confirmed by sequencing the PCR product and comparing the sequence to the appropriate published sequences for NGF, BDNF and NT-3. Note that equal volumes of PCR product were loaded on the gel for each neurotrophin studied. BDNF product, although a light band on this gel was as prominent as the NGF and NT-3 bands in other gel separation runs.

three neurotrophins in E l i through E l4 inner ears we used organotypic o tocys t -CVG explants from El0.5 embryos to evaluate the role of these growth factors during the El0.5 through E13.5 period of development. In the present study whole mount El0.5 o tocys t -CVG complexes immuno- staining for 66kD neurofilaments have indicated the first extensions of neurites from the CVG towards the otocyst confirming our previous observations in tissue sections [17]. After three days of culture in defined medium, large neuronal fascicles ( > 200 /.tm) are present that project to the areas of the developing neuroepithelium (Fig. 3A), verifying that neuronal development in our culture system parallels neuronal development in vivo [17,50]. Using se-

rial optical sectioning, image storage and 3-D reconstruc- tion with a confocal microscope we determined that in control cultures at day 1 in vitro, the CVG neuron count was 9359 + 1982 (Table 1). After 3 days in vitro, the average CVG neuron count was 12,571 + 2970 (Table 1) and the average neuronal fascicle length exceeded 200 /xm (Table 2). The average number of neuronal fascicle ingrowths into the otocyst was 7.5 + 2.8 (Table 2). To control for any unique effects of oligonucleotide treatment, two different sets of oligonucleotides were used for each neurotrophin.

3.3. N G F antisense treatment

Addition of an NGF antisense oligonucleotide (NGF- AS 1) to the culture medium at a final concentration of 5 jzM resulted in impaired neuritogenesis by CVG neurons (Fig. 3B). After 3 days of culture in 5 /.~M NGF-AS 1, the total neuron count was 8387 ___ 2011 (Table 1) representing a 33% reduction in the neuronal population of the CVG when compared to untreated control cultures. The length of individual neurites in the antisense treated explants averaged 20 + 5.6 /zm (Table 2). There was no development of major neuronal fascicles of CVG neurites as normally developed in control and NGF sense oligonucleotide (5 /xM, NGF-S 1) treated cultures. No CVG neurites crossed the otocyst basement membrane to invade areas of developing sensory epithelium in NGF-AS~ treated cultures. Otocys t -CVG explants cultured for 72 h with 5 /zM NGF-S 1 developed a full ganglion (neuron count 12,116 + 2602) with large neuronal fascicles of CVG neurites ( > 200 /xm) and an average of 5.0 + 2.6 CVG neuritic fascicle ingrowths across the otocyst basement membrane, similar to untreated o tocys t -CVG explants grown in defined medium without oligonucleotides (Tables 1 and 2). Thus the addition of sense oligonucleotide to the culture medium appeared to have no inherent neurotoxic or growth sup- pressive activity at a concentration of 5 /xM. Treatment of El0.5 o tocys t -CVG explants with a second unique set of oligonucleotides yielded a neuronal counts of 9636 _ 2692 for NGF-AS 2 (5 /xM) treated, and 13,722 + 3723 for NGF-S 2 (5 /xM) treated. There was also no penetration of CVG neurites through the basement membrane of the otocyst in the NGF-AS 2 treated o tocys t -CVG explants.

To further demonstrate the specificity of NGF-AS] treatment, the addition of exogenous NGF to these cultures, (human recombinant NGF protein, 50 n g / m l ) re- suited in a restoration of the CVG neuronal cell count (13 ,947_ 2348). Addition of exogenous NGF also re- stored the growth of CVG neuronal fascicles across the otocyst basement membrane to near (i.e. 69%) control levels and initiated the development of a few large neuronal fascicles that averaged > 2 0 0 / z m in length, as well as numerous partially arrested CVG neurites that averaged 75 /zm in length (Tables 1 and 2). This demonstrates a complete rescue from a decrease in the neuronal cell count


Fig. 2. In situ RT-PCR localization of NGF, BDNF and NT-3 mRNA in tissue sections. A: adult male mouse salivary gland tissue. B-F: El2 mouse embryo cephalic tissue. A: amplification with NGF primers resulted in high levels of staining within the acini (open arrow) similar to immunolabelling of NGF in this tissue. B: omission of the reverse transcriptase step and subsequent amplification with NGF primers resulted in no staining of the otic epithelium, demonstrating that genomic DNA was not amplified. C: NGF amplification product is seen as stained reaction product in the otic epithelium, some of the lateral wall mesenchyme and some of the CVG tissue (open arrows) but not in the facial ganglion. D: stained BDNF reaction product is limited to the walls of the otocyst (open arrows) with no significant staining of either CVG or periotic mesenchyme tissues. E: stained NT-3 reaction product can be seen localizing to two areas of the otocyst epithelial wall (arrows). F: omission of one of the two primers for NT-3 resulted in no stained reaction product. Otocyst (O), cochleovestibular ganglion (CVG), facial ganglion (FG), periotic mesenchyme of the otic capsule (M), salivary gland acini (A). Bar = 50 /.tm in A and C; 100 ~m in B, D, E and F


of the CVG but only a partial rescue from the NGF-AS1 initiated decrease in CVG neuritogenesis.

3.4. BDNF antisense treatment

Inhibition of BDNF production with antisense oligonucleotide (BDNF-AS) had a much more severe effect on

neuronal development in the otocyst-CVG explants than that observed in response to NGF-AS treatment. As shown in Fig. 3C, 72 h of culture with a 5 /zM concentration BDNF-AS 1 resulted in a 46% loss of CVG neurons when compared to the control inner ear explants (i.e. = 6828 + 1819 vs. 12,571 ___ 2970; Table 1), and there was no evidence of any neuritogenesis (Table 2). Otocyst-CVG ex-

Fig. 3. Effects of antisense oligonucleotide treatment for nerve growth factor (NGF), brain derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3) on the confocal imaging of neuronal morphology in El0.5 mouse otocyst-cochleovestibular ganglion (CVG) explants, after 3 days in vitro. A: an untreated (control) otocyst-CVG culture in defined medium shows well developed neuronal fascicles that have grown into areas of developing neurosensory epithelium. B: a Z-series projection of a otocyst-CVG complex treated with 5 /.~M NGF-AS r There is decreased neuronal density and neufitogenesis has been arrested with only rudimentary neurites present. An enlargement of a CVG neuron from this field is shown in the upper left corner inset. C: treatment of an organotypic otocyst-CVG culture with 5 p M BDNF-AS~ resulted in a significant amount of neuronal degeneration, leaving only a few densely stained neuronal cell bodies with no neurites evident. D: treatment with 5 IzM NT-3-AS 1 had only a slight effect on neuronal survival and no effect on neuritogenesis, but resulted in disorganized growth of the CVG neurites. Cultures treated with an equivalent (5 /.tM) amount of a sense oligonucleotide specific for each of the neurotrophins studied resulted in developmental patterns similar to the untreated culture depicted in 3A. Neuronal elements stained with FITC anti-NF 66 kDa neurofilament antibody are yellow-green, otic epithelium basement membrane stained with TRITC anti-laminin antibody are red. CVG, cochleovestibular ganglion. Bar = 50 /.Lm in A; 25 /~m in B, C, D; 10 # m in B inset.

H. Staecker et al. /Developmental Brain Research 92 (1996) 49-60

Table 1 Neuron counts of the CVG in El0.5 otocyst-CVG explants

55

Culture condition a Neurons/Ganglion Value of P

Control (1 day in vitro) (n = 3) Control (DMEM ± N1) (n = 10) NGF-AS 1 (n = 20) NGF-S 1 (n = 9) NGF-AS1 (n = 4) + NGF (50 ng/ml) BDNF-AS 1 (n = 20) BDNF-S 1 (n = 9) BDNF-AS 1 (n = 4) + BDNF (25 ng/ml) NT-3-AS 1 (n = 20) NT-3-S 1 (n = 9) NT-3-AS 1 (n = 4) + NT-3 (25 ng/ml)

9359 ± 1982 12,571 ± 2970 8387 ± 2011 12,116 ± 2602 13,947 ± 2348 6828 ± 1819 11,463 + 3334 13,128 ± 2731 10,192 ± 2652 11,105 ± 2968 14,921 ± 3713

< 0.001 ~, < 0.005 ce >0.1 b > 0.1 t,, < 0.002 de < 0.001 be, < 0.001 ce

> 0.05 b > 0.1 b, < 0.001 ,~e >0.05 b, >0.1 c > 0.05 b >0.1 b, >0.05 d

a Except where notes, explants developed for 3 days in vitro, oligonucleotides were used at a concentration of 5 /.LM. b Compared to control explants. c Compared to sense treated explants. d Compared to antisense treated explants.

statistically signicant difference

plants cul tured with 5 /xM B D N F sense ol igonucleot ide

(BDNF-S 1) showed a normal pattern of in vitro develop-

ment with a total C V G neuron count of 11,463 + 3,334 and an average neuronal fascicle length of > 200 /xm

(Tables 1 and 2). Trea tment with an alternate set of

o l igonucleot ides B D N F - A S 2 and BDNF-S 2 at a concentra- t ion of 5 /.LM resulted in respective neuron counts of 7495 + 2069 and 12,381 __+ 3041 which amounts to a 40%

reduct ion of the neuronal populat ion as compared to control cultures, ver i fying the consis tency of our results. Once

again in the B D N F - A S z treated o tocys t -CVG cultures there was no evidence of neuri togenesis . The addit ion of

Table 2 Nerve fascicle or neurite length and innervation density in El0.5 otocyst- CVG explants

Culture condition a Average fascicle b CVG fascicles Value of P c length (/~m) penetrating CVG fascicle

basal lamina penetrations

Control(DMEM + NI) NGF-AS l (n = 20) NGF-AS 1 (n = 4)+ NGF (50 ng/ml) BDNF-AS 1 (n = 20) 0 BDNF-AS~ (n = 4)+ > 200 BDNF (25 ng/ml) NT-3-AS 1 (n = 20) > 200 NT-3-AS 1 (n = 4)+ > 200 NT-3 (25 ng/ml) NGF,BDNF,NT-3 > 200 (-S 1) (n = 9)

> 200 d 7.5 ± 2.8 20±5.6 e 0 <0.001 f 75 ± 7.2 o, > 200 5.2 ± 3.6 > 0.05

0 <0.001 f 6.8±2.9 >0.1

17.2±4.2 <0.001 f 19.2±6.8 <0.001 f

5±2.6-9±3.2 >0.1

a Explants developed for 3 days in vitro, oligonucleotides were used at a concentration of 5 /~M. b The number of neurites composing a fascicle ranged from 10 neurites per small fascicle to over 100 neurites per large fascicle. c Compared to control explants. a Due to limitations in scanning large specimens, length of neuronal fascicles could not be measured beyond 200 /zm. e Length measurements for individual neurites only. f statistically significant difference

B D N F (human recombinant BDNF, 25 n g / m l ) to cultures

grown in the presence of 5 /.tM B D N F - A S 1 completely reversed the effect of the B D N F - A S treatment on both induced neuronal cell death and neuri togenesis . The C V G

neuron count in the B D N F rescued cultures was 13,128 _

2731 and the fascicular length averaged > 200 /xm (Ta- bles 1 and 2).

3.5. N T - 3 an t i sense t r ea tmen t

Treatment with NT-3 antisense ol igonucleot ide (NT-3-

AS1), shown in Fig. 3D and Fig. 4B, resulted in a unique

effect. Addi t ion of a 5 / z M concentra t ion of NT-3 -AS 1 for 72 h to E 10.5 o t o c y s t - C V G explants had no direct effect on average neurite length, i.e. > 200 /~m (Table 2), a

small decrease (i.e. 19%; Table 1) in neuronal survival when compared to untreated cultures. However, a str iking

feature was the presence of m a n y neuronal fascicles that failed to reach their targets (NT-3-AS1; Fig. 4B) in contrast to the large neuronal fascicles that targeted to areas of

presumptive sensory structures in the sense treated (NT-3-

$1; Fig. 4A) and control cultures (Fig. 3A). Instead of a

target directed neuri t ic outgrowth from the CVG, there was a random outgrowth of C V G neurites measur ing > 200

/~m, with a more than doubl ing of the neuronal fascicle penetrat ions of the otocyst basement membrane to an

average of 17.2 + 2.8 (Table 2). Mult iple small neuri t ic fascicles were observed forming spiral growth patterns that extended randomly along the surface of the o tocys t -CVG

explant (Fig. 4B). NT-3 sense ol igonucleot ide (NT-3-S1, 5

/zM) treated cultures (Fig. 4A) developed in a pattern similar to the untreated cultures shown in Fig. 3A although there was a smal l but s ignif icant 12% decrease in neuronal survival in the sense treated cultures when compared to untreated controls (Table 1). Results of these cultures was

verified with a second set of ol igonucleot ides NT-3-AS 2 and NT-3 -S : applied at a concentra t ion of 5 /xM which yielded neuronal counts of 1 3 , 0 8 3 _ 3102 and 13,726 +


Fig. 4. A comparison of NT-3-S versus NT-3-AS oligonucleotide treatment in the patterns of CVG neuronal outgrowth, after 3 days in vitro. In confocal images of explants immunostained with anti 66 kD antibody neurofilaments appears as white fibers. A: a NT-3-S 1 (5 /.tM) treated culture. CVG neurites join to form a well organized fascicle that grows directly towards a target area of developing sensory epithelium (arrows). B: a NT-3-AS (5 /.tM) treated culture. Neurites from the CVG appear disorganized and form numerous small fascicles with spiral branching patterns (arrows). CVG, cochleovestibular ganglion. Bar = 50 p.m.

2986 respectively. The number of neuronal fascicle penetrations in the NT-3-AS 2 treated otocyst-CVG cultures was 15.1 5- 4.2, again similar to the NT-3-AS 1 treated cultures. Addit ion of exogenous NT-3 at a concentration of 25 n g / m l to NT-3-AS 1 treated cultures did not alter the abnormal growth pattern or targeting of the CVG neurons (Tables 1 and 2).

4. Discussion

4.1. Localization o f neurotrophins in the developing ear

Direct proof for some overlapping of the expression pattern of both BDNF and NT-3 in the CVG target tissue

of the developing murine otic epithelium as well as that of the developing and postnatal rat have recently been pro- vided by in situ hybridization studies [38,46,58,60]. Ex- pression of N T - 4 / N T - 5 or NGF mRNA was not detected by in situ hybridization despite evidence that NGF may be active in the development and innervation of the otocyst [27,28,39]. Use of a more sensitive method such as RT-PCR (Fig. 1) has shown that NGF, BDNF, as well as NT-3 mRNA are produced in the developing auditory system, and application of the recently developed technique of in situ RT-PCR mRNA has demonstrated that all three of these neurotrophins can be localized to the epithelium of the E l 2 mouse otocyst (Fig. 2). NGF mRNA was present not only in the epithelium but also in the area of the developing otic capsule (periotic mesenchyme) and within


the CVG complex suggesting that NGF may play an autocrine role or may also play a role in nonneuronal development [14,57] or in Schwann cell-neuronal interactions [46,53] or possibly in paracrine control of neuronal growth. Besides the neurotrophins, other factors also appear to play an important role in the neuronal development of the auditory system. Bianchi and Cohen have demonstrated that medium conditioned by chick otocysts for 3 days contains a diffusible factor (i.e. otocyst derived factor, ODF) that does not appear to be any recognized member of the neurotrophin family and promotes significant neuritic outgrowth and neuronal survival in cultures of chick statoacoustic ganglia [8]. This finding of ODF however does not exclude the fact that members of the neurotrophin family can play active roles in otic development as numerous other studies have suggested, especially since conditioning of medium by a tissue is such a complex event and may involve multiple factors such as combinations of growth factors, extracellular matrix molecules, pH changes and alterations in ionic balance.

4.2. Trophic and tropic effects of the developing otocyst

Coculture of two otocysts with a single CVG resulted in nearly equal patterns of innervation of both otocysts [54], showing that chemoattractant fields are produced by differ- entiating otic epithelium. If, on the other hand, a CVG is isolated from it central (brainstem) and peripheral (otocyst) targets, neuronal development and survival is greatly decreased [3,61]. This trophic effect could be the result of production of NGF or related molecules by the developing otic epithelium [27].

4.3. Otocyst-CVG development in vitro

Neuritogenesis and the onset of neuritic growth towards the otocyst can already be observed by E 10.5, and by E 13.5 neurites penetrating into the areas of presumptive neurosensory epithelium are clearly present [17]. An ex- planted E 10.5 otocyst that develops in defined medium for three days covers the period from early neuritogenesis to fasciculization and consequent ingrowth of neurites into the areas of developing sensory epithelium. Addition of NGF-AS~ to the medium starting at the onset of culture of El0.5 otocyst-CVG explants resulted in an 85% downregulation of production of the targeted neurotrophin (Table 3). Thus an adequate perturbation of the targeted molecule [18] to study the process of neuronal development as previously shown where an antisense oligonucleotide tar- g~ting BDNF was successfully used to study early neuronal maturation [59].

We observed that neuronal development took place in a specific pattern in El0.5 otocyst-CVG explants grown in defined medium (untreated) as well as in cultures treated with a 5 /zM concentration of sense oligonucleotide for

Table 3 Effects of antisense NGF oligonucleotide treatment on NGF protein production

Culture condition (n = 5) NGF production ( p~g/ml/24 h) a

Control 1.5 + 0.15 NGF-AS 1 0.19 + 0.08 NGF-S l 1.3 _ 0.17

a Results based on ELISA of pooled medium from 72 h of culture.

any of the three targeted neurotrophins (Fig. 3, Tables 1 and 2).

4.4. The effect of NGF-AS on CVG-otocyst explants

Even though in utero deprivation of NGF has been shown to produce degeneration of fetal dorsal root ganglia [42] we failed to observe such drastic effects within the time frame of our cultures. Total neuronal counts for NGF-AS treated cultures were similar to neuronal counts at day 1 in vitro, less than that observed for untreated explants at day 3 but greater than those observed in BDNF-AS treated cultures. Additionally, a significant statistical difference was observed between NGF-AS and NGF-S treated cultures (Table 1). This effect of NGF-AS~ on the neuronal population of the CVG could be amelio- rated by the addition of exogenous NGF (50 ng/ml) to the antisense treated cultures (Table 1). Since neuronal proliferation within the murine CVG is not complete until El3 [41], and NGF has been shown to have a mitogenic effect on these neurons [39,40], it is possible that inhibition of NGF production may inhibit further neuronal proliferation, thus providing a rationale for the low neuronal cell counts observed in the NGF-AS treated cultures. After 72 hours in culture with 5 #M NGF-AS 1 only rudimentary CVG neurites were visualized (Fig. 3B inset) and none of these neurites crossed the basement membrane of the otic epithelium (laminin, red staining areas). Neuritogenesis by CVG neurons appeared to have been impaired, with no neuritic outgrowth having occurred beyond the El0.5 stage, strongly suggesting that NGF acts as a neuritogenesis factor in this system, as has been described in other systems [13,21,23,31]. The effect of NGF-AS t treatment on neuritogenesis could only be partially reversed through the addition of exogenous NGF (50 ng/ml) to the medium. Although neuronal fascicles similar in length and basement membrane penetration characteristics to those in untreated cultures developed in the NGF rescued cultures (Table 2), numerous individual neurites that had attained a length of 75 + 7.2 /xm were also present within the CVG neuronal population of the NGF rescued cultures. A possible explanation may be that local paracrine gradients of NGF are necessary for correct development of neurtiogenesis. Therefore, only a partial rescue of CVG neuritogenesis results when NGF is available at homogenous levels in the culture medium [46,53]. The localization of staining of


CVG neurons for NGF cDNA amplification product (Fig. 2C) supports this explanation. It is unclear whether or not NGF plays a similar role in vivo since experiments that umregulate NGF production or decrease available NGF in vivo, fail to show significant effects on auditory development [23,42].

4.5. The effect of BDNF-AS on otocyst-CVG explants

Previous studies have suggested that BDNF prevents neuronal death in developing quail dorsal root ganglia [22] and also prevents degenerative changes after axonotomy in the adult rat CNS [26], as well as in maturing motorneurons in rat pups [49] and developing motorneurons in the avian embryos [36]. BDNF has also recently been shown to be a survival factor produced by the target fields of trigeminal neurons [9,56]. Developing placodal neurons, including CVG neurons, have also been demonstrated to respond to BDNF [5,10,32,55]. Previous in situ hybridization studies localizing BDNF to the target tissue [38,46,57,60] and the responsiveness of CVG neurons to exogenous BDNF predict that downregulation of this neurotrophin would affect both CVG development and otocyst innervation. Treatment of the otocyst-CVG with BDNF-AS resulted in a greater than 40% reduction in neuronal survival and in a degeneration of all CVG neurites (Fig. 3C) when compared to control and BDNF-S treated cultures (Tables 1 and 2; result section). Morphological comparison of BDNF-AS 1 to NGF-AS 1 treated inner ear explants (Fig. 3) shows significant differences, demonstrating that exposure to each of the respective antisense oligonucleotides produce specific changes in the patterns of otocyst-CVG neuronal development. Our BDNF-AS results agree with the results of Wright et al. [60], where BDNF-AS treatment of short term cultures of embryonic chick sensory neurons prevented neuronal maturation, however, in this system antisense treatment did not affect neuronal survival because the neurons were cultured prior to acquisition of a dependency on neurotrophins for survival. The developmental stage of the CVG in our study was approximately equivalent to that of the chicks vestibular neurons that were shown to be BDNF dependent for their survival [57]. Furthermore, the deleterious effects of BDNF-AS1 treatment on neuron survival in our study could be completely prevented by the addition of 25ng/ml of exogenous BDNF to the medium (Table 1), supporting the hypothesis that BDNF is required for neuron survival in the otocyst-CVG complex in our cultures. Additionally, our finding of BDNF mediated cell death of CVG neurons is supported by the recent finding that mutant mice lacking BDNF have a severe deficit (i.e. a < 80% reduction) in the neuronal population of their vestibular ganglion [14,25]. The findings of these gene targeting studies suggest that the vestibular portion of the CVG neuronal population in our cultures may have been the most affected by a likely reduction in endogenous BDNF levels, since auditory neu-

rons of the BDNF deficient mice did not appear to be affected by an absence of BDNF [15].

4.6. The effect of NT-3-AS on otocyst-CVG explants

Otocyst-CVG explants treated for 3 days with NT-3-AS displayed only a slight decrease in neuronal survival and no effect on neuritogenesis by CVG neurons when compared to untreated or NT-3-S treated cultures (Tables 1 and 2; Results section). NT-3-AS treatment did produce random growth of numerous small neuronal fascicles and a lack of sensory epithelium targeting by some CVG neurites (Fig. 4, Table 2). Therefore, we believe that for the developmental period studied in our organotypic culture system NT-3 functions primarily as a chemoattractant molecule rather than a survival factor in contrast to previous reports that suggest NT-3 to function as a survival factor. A recent finding in transgenic mice that lack NT-3 expression shows that the development of the spiral ganglion is significantly affected with an 85% decrease in the neuronal population of this ganglion [16]. While survival was not dramatically affected in our study, the average number of ingrowths of neuronal fascicles into the basement membrane of the otocyst more than doubled in the NT-3-AS 1 treated cultures. Thus a survival effect of NT-3 may be present at a specific developmental period not covered in our study, and therefore not observed at the early stage of neuritogenesis covered by this study (i.e. E10.5-E13.5). Alternately, if neuronal fascicles fail to reach their target because of an absence of NT-3, they would be deprived of their trophic field, thus resulting in neuronal cell death.

If the effect of NT-3 in our cultures is dependent upon the establishment of gradients, then the addition of exogenous NT-3 to the culture medium would create a uniform concentration which would act against the reestablishment of a normal pattern of neuritic ingrowth to the developing otic sensory epithelium. Interestingly, the addition of exogenous NT-3 (25 ng/ml) did not rescue the CVG from the effect of NT-3-AS l treatment (Tables 1 and 2). In support of a local paracrine action for this neurotrophin in the present system (Fig. 4, Table 2), a recent study [48] has shown that locally applied NT-3 can enhance sprouting in the developing cortical spinal tract. Therefore, we propose NT-3 as one of the factors responsible for chemotaxis during primary neuritic ingrowth into the otocyst.

We have demonstrated that at an early stage of in vitro development BDNF, NGF and NT-3 are present and dif- ferentially active within the early developing inner ear as survival, neuritogenesis, and chemoattractant factors respectively. Each of these neurotrophins appear for correct innervation of developing inner ear sensory epithelium to take place. Further antisense studies as well as studies of specific trk receptors are currently underway to provide a clearer understanding of the function of these three neurotrophins at the later stages of development and in the adult inner ear.


Acknowledgements

The authors thank Drs. Alcm~,ne Chalazonitis, Dorothy Frenz and Jack Kessler for critical reading and helpful suggestions for improving this report, Dr. Kessler for a gift of growth factors, Dr. Chiu for a gift of anti NF-66kD antibody, and Rose Imperati for word processing. This work was supported by a National Institutes of Deafness and Other Communication Disorders Grant (DC0088) to T.R.V., a grant from the Deafness Research Foundation to H.S. and grants from FNRS to P.P.L. and G.M., Fondation Reine Elizabeth, Action de recherches concert~es (com- munaute fran(Aaise de Belgique) to G.M. Drs. Van De Water and Moonen are both senior authors of this work.

References

[1] Acheson, A., Barker, P., Alderson, R., Miller, F. and Murphy, R., Detection of brain derived neurotrophic factor-like activity in fibrob- lasts and Schwann cells: inhibition by antibodies to NGF, Neuron, 7 (1991) 265-275.

[2] Alderson, R.F., Alderman, A.L., Barde, Y.-A. and Lindsay, R.M., BDNF increases survival and differentiation functions of septal cholinergic neurons in culture, Neuron, 5 (1990) 297-306.

[3] Ard, M.D., Morest, D.K. and Hauger, S., Trophic interaction between the cochleovestibular ganglion of the chick embryo and its synaptic targets in culture, Neuroscience, 16 (1985) 151-170.

[4] Ausubel, F., Brent, F., Kingston, R., Moore, B., Seidman, J., Smith, J. and Struhl, K. (Eds.), Current Protocols in Molecular Biology, John Wiley and Sons, New York, 1989.

[5] Avila, M., Varela-Nieto, I., Romero, G., Mato, J., Giraldez, F., Van De Water, T.R. and Represa, J., Brain derived neurotrophic factor and neurotrophin-3 support the survival and neuritogenesis response of developing cochleovestibular ganglion neurons, Dev. Biol., 159 (1993) 266-275.

[6] Bailey, N.T., Statistical Methods in Biology, Hodder and Stoughton, London, 1985, pp. 43-51.

[7] Barde, Y.-A., Trophic factors and neuronal survival, Neuron, 2 (1989) 1525-1534.

[8] Bianchi, L.M. and Cohen, C.S., Effects of the neurotrophins and CNTF on developing statoacoustic neurons: comparison with an otocyst derived factor, Dev. Biol., 159 (1993) 353-365.

[9] Buchman, V. and Davies, A., Different neurotrophins are expressed and act in a developmental sequence to promote the survival of embryonic sensory neurons, Development, 118 (1993) 989-1001.

[10] Davies, A., Thoenen, H. and Barde, Y.-A., The response of chick sensory neurons to brain derived neurotrophic factor, J. Neurosci., 6 (1986) 1897-1904.

[11] Davies, A., The emerging generality of the neurotrophic hypothesis, Trends Neurosci., 11 (1988) 243-244.

[12] Ebendal, T. and Persson H., Detection of nerve growth factor mRNA in the developing chick embryo, Development, 102 (1988) 101-106.

[13] Edwards, R., Rutter, W. and Hanahan, D., Directed expression of NGF to pancreatic b cells in transgenic mice leads to selective hyperinnervation of the islets, Cell, 58 (1989) 161-170.

[14] Enfors, P., Wetmore, C., Olson, L. and Persson, H., Identification of cells in rat brain and peripheral tissues expressing mRNA for members of the nerve growth factor family, Neuron, 5 (1990) 511-526.

[15] Enfors, P., Lee, K-F. and Janisch, R., Mice lacking brain-derived

neurotrophic factor develop with sensory deficits, Nature, 368 (1994) 147-150.

[16] Farinas, I, Jones, K., Backus, C., Wang, X. and Reichardt, L., Severe sensory and sympathetic deficits in mice lacking neurotrophin 3, Nature, 369 (1994) 658-661.

[17] Galinovic-Schwartz, V., Peng, D., Chiu, F.C. and Van De Water, T.R., Temporal pattern of innervation in the developing mouse embryo: an immunohistochemical study of a 66 kD subunit of mammalian neurofilaments, J. Neurosci. Res., 30 (1991) 124-133.

[18] Goodchild, J., Inhibition of gene expression by oligonucleotides. In J.S. Cohen (Ed.), Oligodeoxynucleotides: Antisense Inhibition of Gene Expression, CRC Press, Boca Raton, 1989, pp. 53-71.

[19] Hagg, T. and Varon, S., Neurotropism of NGF for adult rat septal cholinergic axons in vivo, Exp. Neurol., 119 (1992) 37-45.

[20] Hallbook, F., lbanez, C.F. and Persson, H., Evolutionary studies of the nerve growth factor family reveal a novel member abundantly expressed in Xenopus ovary, Neuron, 6 (1991) 845-858.

[21] Harper, S. and Davies, A., NGF mRNA expression in developing cutaneous epithelium related to innervation density, Development, 110 (1990) 515-519.

[22] Hofer, M. and Barde, Y.-A., Brain derived neurotrophic factor prevents neuronal death in vivo, Nature, 331 (1988) 261-262.

[23] Hoyle, G., Mercer, E., Palmiter, R. and Brinster, R., Expression of NGF in sympathetic neurons leads to excessive axon outgrowth from ganglia but decreased terminal innervation within tissues, Neuron, 10 (1993) 1019-1034.

[24] Johnson, E., Rich, K. and Yip, H., The role of NGF in sensory neurons in vivo, Trends Neurosci., 9 (1986) 33-37.

[25] Jones, K., Farinas, I., Backus, C. and Reichardt, L., Targeted disruption of the BDNF gene perturbs brain and sensory neuron development but not motor neuron development, Cell, 76 (1994) 989-999.

[26] Knuesel, B., Beck, K., Winslow, J., Rosenthal, A., Burton, L.E., Widmer, H.R., Nikolics, K. and Hefti, F., Brain derived neurotrophic factor administration protects basal forebrain cholinergic but not nigral dopaminergic neurons from degenerative changes after axonotomy in the adult rat brain, J. Neurosci., 12 (1992) 4391-4402.

[27] Lefebvre, P.P., Leprince, P., Weber, T., Rigo, J.J., Delree, P. and Moonen, G., Neurotrophic effect of developing otic vesicle on cochleovestibular neurons: evidence for nerve growth factor involve- ment, Brain Res., 507 (1990) 254-260.

[28] Lefebvre, P.P., Van De Water, T.R., Represa, J., Liu, W., Bernd, P., Modlin, S., Moonen, G. and Mayer, M., Temporal patter of nerve growth factor binding in vivo and the in vitro effects of NGF on cultures of developing auditory and vestibular neurons, Acta Oto- laryngol. (Stockh.), 111 (1991) 304-311.

[29] Lefebvre, P.P., Weber, T., Rigo, J.-M., Staecker, H., Moonen, G. and Van De Water, T.R., Peripheral and central target derived trophic factors effects on auditory neurons, Hearing Res., 5 (1992) 186-192.

[30] Leibrock, J., Lottspeich, A.H., Hofer, M., Hengerer, B., Masi- akowski, P., Thoenen, H. and Barde, Y.-A., Molecular cloning and expression of brain derived neurotrophic factor, Nature, 341 (1989) 149-152.

[31] Levi-Montalcini, R. and Calissano, P., Nerve growth factor as a paradigm for other polypeptide growth factors, Trends Neurosci., 9 (1986) 473-477.

[32] Lindsay, R., Thoenen, H. and Barde, Y.-A., Placode and neural crest-derived sensory neurons are responsive at early developmental stages to brain derived neurotrophic factor, DeL,. Biol., 112 (1985) 319-328.

[33] Maisonpierre, P., Belluscio, L., Friedman, B., Alderson, R., Wie- gand, S., Furth, M., Lindsay, R. and Yancopopoulus, G., NT-3, BDNF and NGF in the developing rat nervous system: parallel as well as reciprocal patterns of expression, Neuron, 5 (1990) 501-509.

[34] Maisonpierre, P.C., Belluscio, L., Squinto, S., Ip, N.Y., Furth, M.E.,


Lindsay, R.M. and Yancopopoulus, G.D., Neurotrophin-3: a neurotrophic factor related to NGF and BDNF, Science, 247 (1990) 1446-1451.

[35] Nuovo, G., In Situ Polymerase Chain Reaction, Raven Press, New York, 1992.

[36] Oppenheim, R.W., Yin, Q.W., Prevette, D. and Yan, Q., BDNF rescues developing avian motor neurons from cell death, Nature, 360 (1992) 755-757.

[37] Pawley, J.B., Fundamental and practical limits in confocal light microscopy, Scanning, 13 (1990) 184-198.

[38] Pirvola, U., Ylikoski, J., Palgi, J., Lehtonen, E., Arumae, U. and Saarma, M., Brain derived neurotrophic factor and neurotrophin-3 mRNAs in the peripheral target fields of developing inner ear ganglia, Proc. Natl. Acad. Sci. USA, 89 (1992) 9915-9919.

[39] Represa, J. and Bernd, P., Nerve growth factor and serum differen- tially regulate development of the embryonic otic vesicle and cochleovestibular ganglion in vitro, Dev. Biol., 134 (1989) 21-29.

[40] Represa, J., Avila, M., Miner, C., Giraldez, F., Romero, G., Clemente, R., Mato, J. and Varela-Nieto, I., Glycosyl-phoshaty- dilinositol/inositol phosphoglycan: a signaling system for the low affinity nerve growth factor receptor, Proc. Natl. Acad. Sci. USA, 88 (1991) 8016-8019.

[41] Ruben, R., Development of the inner ear of the mouse: a radioauto- graphic study of terminal mitoses, Acta. Otolaryngol. (Stockh.) Suppl., 220 (1967) 1-44.

[42] Ruit, K.G., Elliot, J., Osbourne, P., Yan, Q. and Snider, W., Selective dependance of mammalian dorsal root ganglion on nerve growth factor during development, Neuron, 10 (1992) 573-587.

[43] Sanger, F., Nicklen, S. and Coulson, A.R., DNA Sequencing with chain-terminating inhibitors, Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467.

[44] Scarfone, E., Dememes, D. and Sans, A., Synapsin I and Synapto- physin expression during ontogenesis of the mouse peripheral vestibular system, J. Neurosci., 11 (1991) 1173-1781.

[45] Scarisbrick, I.A., Jones, E. and lsackson, P., Coexpression of mR- NAs for NGF, BDNF and NT-3 in the cardiovascular system of the pre- and postnatal rat, J. Neurosci., 13 (1993) 875-893.

[46] Schecterson, L. and Bothwell, M., Novel roles for neurotrophins are suggested by BDNF and NT-3 mRNA expression in developing neurons, Neuron, 9 (1992) 449-463.

[47] Schecterson, L. and Bothwell, M., Neurotrophin and neurotrophin receptor mRNA expression in the developing inner ear, Hear Res., 73 (1994) 92-100.

[48] Schnell, L., Schneider, R., Kolbeck, R., Barde, Y.-A, and Schwab, M.E., Neurotrophin-3 enhances sprouting of corticospinal tract dur-

ing development and after spinal cord lesion, Nature, 367 (1994) 170-173.

[49] Sendtner, M., Holtman, B., Kolbech, R., Thoenen, H. and Barde, Y.-A., BDNF prevents the death of motorneurons in newborn rats after nerve section, Nature, 360 (1992) 757-759.

[50] Sher, A., Embryonic and postnatal development of the inner ear of the mouse, Acta Otolaryngol. (Stockh.) Suppl., 285 (1971).

[51] Staecker, H., Cammer, M., Rubinstein, R. and Van De Water, T.R., A procedure for RT-PCR amplification of mRNAs on histological specimens, Biotechniques, 16 (1994) 76-80.

[52] Ullrich, A., Gray, A., Berman, C. and Dull, T.J., Human beta nerve growth factor gene sequence is highly homologous to that of mouse, Nature, 303 (1983) 821-824.

[53] Urschel, B. and Hulsebosch, C., Schwann cell-neuronal interactions in the rat involve nerve growth factor, J. Comp. Neurol., 296 (1990) 114-122.

[54] Van De Water, T.R., Determinants of neuron-sensory receptor cell interaction during development of the inner ear, Hear. Res., 22 (1986) 265-277.

[55] Vasquez, E., Van De Water, T.R., Del Valle, M., Vega, A., Staecker, H., Giraldez, F. and Represa, J., Pattern of trkB immunoreactivity in vivo and the in vitro effects of brain derived neurotrophic factor (BDNF) on developing cochlear and vestibular neurons, Anat. Em- bryol., 189 (1994) 157-167.

[56] Vogel, K. and Davies, A., The duration of neurotrophic factor independence in early sensory neurons is matched to the time course of target field innervation, Neuron, 7 (1991) 819-830.

[57] Wheeler, E. and Bothwell, M., Spatiotemporal patterns of expression of NGF and the low affinity NGF receptor in rat embryos suggest functional roles in tissue morphogenesis and myogenesis, J. Neu- rosci., 12 (1992) 930-945.

[58] Wheeler, E., Bothwell, M., Schecterson, L. and von Bartheld, C., Expression of BDNF and NT-3 mRNA in hair cells of the organ of Corti: quantitative analysis in developing rats, Hear. Res., 73 (1994) 46-56.

[59] Wright, E., Vogel, K. and Davies, A., Neurotrophic factors promote the maturation of developing sensory neurons before they become dependent on these factors for survival, Neuron, 9 (1992) 139-150.

[60] Ylikoski, J., Pirvola, U., Moshnyakov, M., Palgi, J., Arumae, U. and Saarma, M., Expression patterns of neurotrophin and their receptor mRNAs in the rat inner ear, Hear. Res., 56 (1993) 69-78.

[61] Zhou, X. and Van De Water, T.R., The effect of target tissues on survival and differentiation of mammalian statoacoustic ganglion neurons in organ culture, Acta Otolaryngol. (Stockh.), 104 (1987) 90-98.

ngf, bdnf and nt-3 play unique roles in the in vitro development and patterning of innervation of...

Documents