new knockdown of nfa1 gene cloned from naegleria fowleri by...
TRANSCRIPT
의학의학의학의학 박사학위박사학위박사학위박사학위 논문논문논문논문
Knockdown of nfa1 Gene Cloned from
Naegleria fowleri by Antisense RNA
아아아아 주주주주 대대대대 학학학학 교교교교 대대대대 학학학학 원원원원
의의의의 학학학학 과과과과
이이이이 상상상상 철철철철
Knockdown of nfa1 Gene Cloned from
Naegleria fowleri by Antisense RNA
by
Sang-Chul Lee
A Dissertation Submitted to The Graduate School of Ajou University
in Partial Fulfillment of the Requirements for the Degree of
DOCTOR OF PHILOSOPHY
Supervised by
Ho-Joon Shin, Ph.D.
Department of Medical Sciences
The Graduate School, Ajou University
February, 2006
이상철이상철이상철이상철의의의의 의학의학의학의학 박사학위박사학위박사학위박사학위 논문을논문을논문을논문을 인준함인준함인준함인준함.
심사심사심사심사 위원장위원장위원장위원장 이이이이 일일일일 영영영영 인인인인
심심심심 사사사사 위위위위 원원원원 신신신신 호호호호 준준준준 인인인인
심심심심 사사사사 위위위위 원원원원 박박박박 선선선선 인인인인
심심심심 사사사사 위위위위 원원원원 김김김김 경경경경 민민민민 인인인인
심심심심 사사사사 위위위위 원원원원 임임임임 경경경경 일일일일 인인인인
아아아아 주주주주 대대대대 학학학학 교교교교 대대대대 학학학학 원원원원
2005년년년년 12월월월월 22일일일일
i
-ABSTRACT-
Knockdown of nfa1 Gene Cloned from
Naegleria fowleri by Antisense RNA
PAME caused by N. fowleri is an acute, fulminant, and rapidly progressing fatal
illness that usually affects children and young adults. There have been few reports to
address proteins functioning in vitro cytotoxicity of N. fowleri. The nfa1 gene, cloned
from a cDNA library of N. fowleri by immunoscreening, should be concerned with
the formation of food-cups that is a phagocytic structure. In addition, an anti-Nfa1
antobody reduced the in vitro cytotoxicity of N. fowleri against target cells. To
elucidate the function of proteins cloned from N. fowleri, the gene-knockdown
analysis by a transfection system are not yet established. In this present study, to
describe the association of an Nfa1 protein in vitro cytotoxicity of N. fowleri to target
cells, an antisense RNA or siRNA of nfa1 gene were transfected into N. fowleri
trophozoites. By the synthetic dsRNA of nfa1 gene ORF, the expression of nfa1 gene
and the Nfa1 protein were knockdowned about 50% and 30%, respectively. However,
by antisense RNA transcribed in vitro, the expression of nfa1 gene and the Nfa1
protein were less knockdowned than those of dsRNA of nfa1 gene. Four synthetic
siRNAs were not act equally, but a sinfa1-1 was highly effective to knockdown the
nfa1 gene and Nfa1 protein with 70% and 43%, respectively. However, N. fowleri
trophozoites transfected with synthetic dsRNA or sinfa1-1 did not highly induce in
ii
vitro cytotoxicity against murine macrophages as compared with normal N. fowleri
trophozoites. Therefore, a vector-based system, in which transfected genes can be
maintain longer, was used to transfect the nfa1 gene into N. fowleri. A pAct/SAGAH
vector with a sinfa1-1 and a pAct/asnfa1AGAH vector with an asRNA of the nfa1
gene ORF were cloned, and then transfected into N. fowleri. By the pAct/SAGAH
vector, the expression of nfa1 gene and the Nfa1 protein were knockdowned as 60%
and 29%, in comparison with the pAct/asnfa1AGAH vector of 30% in the nfa1 gene
and 18% in Nfa1 protein. In particular, the in vitro cytotoxicity of N. fowleri
transfected with a pAct/SAGAH vector against macrophages was decreased to 26.6%
at 17 h and 26.8% at 24 h post co-incubation, whereas the in vitro cytotoxicity was
decreased to 7.4% at 17 h and 6.6% at 24 h by a pAct/asnfa1AGAH vector. These
results suggest that the function of RNAi should be worked in N. fowleri trophozoites.
Therefore, single stranded RNA, dsRNA, siRNA, and siRNA-vector were not only
efficiently transfected into N. fowleri using each transfection reagent, but also
decreased the function of Nfa1 protein which plays very important role in destroying
macrophages. This result may be helpful for understanding the function of Nfa1
protein as a target cell-cantact mechanism in the N. fowleri infection.
____________________________________________________________________
Key Words: N. fowleri, PAME, nfa1 gene, RNAi, cytotoxicity
iii
TABLE OF CONTENTS
ABSTRACT ------------------------------------------------------------------------------ i
TABLE OF CONTENTS --------------------------------------------------------------- iii
LIST OF FIGURES ---------------------------------------------------------------------- v
LIST OF TABLES ----------------------------------------------------------------------- vii
I. INTRODUCTION ---------------------------------------------------------------------- 1
A. Free-living amoeba Naegleria fowleri ---------------------------------------- 1
B. Life cycles and occurrence of PAME by N. fowleri ------------------------- 2
C. Pathogenic factors related to PAME by N. fowleri -------------------------- 5
D. The nfa1 gene --------------------------------------------------------------------- 6
E. Antisense RNA regulation and RNA interference --------------------------- 7
1. Antisense RNA regulation ---------------------------------------------------- 7
1-1. Antisense RNA regulated system in eukaryotes --------------------- 8
2. RNA interference -------------------------------------------------------------- 9
2-1. Mechanism of RNAi --------------------------------------------------- 11
2-2. Delivery, practical aspects and problems of RNAi -------------------- 13
F. Subjects in this study ----------------------------------------------------------- 15
II. MATERIALS AND METHODS ------------------------------------------------- 16
A. Cultivation of N. fowleri trophozoites and murine macrophages -------- 16
B. Total RNA preparation and RT-PCR ----------------------------------------- 16
C. Synthesis of antisense- and sense-directed RNA of nfa1 gene ORF,
and siRNAs of the nfa1 gene ------------------------------------------------ 17
iv
D. Southern blot hybridization --------------------------------------------------- 19
E. Transfection of asnfa1, dsnfa1 and siRNAs into N. fowleri -------------- 20
F. Northern blot hybridization and quantitation of RNA --------------------- 20
G. Cell lysate preparation and immunoblots ----------------------------------- 21
H. Vector construction of sinfa1-1 and asnfa1 -------------------------------- 22
I. Transfection of pAct/sinfa1-1AGAH and pAct/asnfa1AGAH vector
into N. fowleri trophozoites and hygromycin selection -------------------- 24
J. Indirect immunofluorescence antibody test --------------------------------- 26
K. In vitro cytotoxicity ------------------------------------------------------------ 27
III. RESULTS --------------------------------------------------------------------------- 28
A. In vitro synthesis of ssnfa1, asnfa1 and dsnfa1 ----------------------------- 28
B. Knockdown of the nfa1 mRNA and Nfa1 protein by asnfa1 or dsnfa1 -- 31
C. Knockdown of the nfa1 mRNA and Nfa1 protein by synthetic siRNAs -- 35
D. RNAi function by a vector-based system ------------------------------------ 40
E. Expression of an Nfa1 protein in N. fowleri transfected with
a RNAi vector ------------------------------------------------------------------ 45
F. In vitro cytotoxicity of N. fowleri transfected with a RNAi vector ------- 49
IV. DISCUSSION ---------------------------------------------------------------------- 51
V. CONCLUSION ---------------------------------------------------------------------- 60
REFERENCES --------------------------------------------------------------------------- 62
국문요약 ------------------------------------------------------------------------------------------ 74
v
LIST OF FIGURES
Fig. 1. Life cycles of N. fowleri and PAME ------------------------------------------ 3
Fig. 2. Model for RNAi --------------------------------------------------------------- 11
Fig. 3. Schematic representation of an nfa1 gene in N. fowleri used to produce
sense (ss) and antisense (as) RNA followed by dsRNA formation
in vitro --------------------------------------------------------------------------- 29
Fig. 4. Findings of dsnfa1 synthesis and Southern blotting ---------------------- 30
Fig. 5. Northern blotting and quantitative analysis of the nfa1 gene mRNA
from N. fowleri trophozoites transfected with an asnfa1 or dsnfa1 ----- 33
Fig. 6. Western blotting and quantitative analysis of the Nfa1 protein
from N. fowleri trophozoites transfected with an asnfa1 or dsnfa1 ----- 34
Fig. 7. GFP fluorescence in N. fowleri transfected with GFP-conjugated
with siRNA of Lamin A/C gene -------------------------------------------- 36
Fig. 8. Northern blotting and quantitative analysis of the nfa1 gene mRNA
from N. fowleri trophozoites transfected with the siRNAs
of an nfa1 gene ----------------------------------------------------------------- 38
Fig. 9. Western blotting and quantitative analysis of the Nfa1 protein from
N. fowleri trophozoites transfected with the siRNAs of an nfa1 gene -- 39
Fig. 10. Vector construction for RNAi in N. fowleri --------------------------------- 41
Fig. 11. Feasibility of transfection reagents for transfection into N. fowleri
and gene transcription by reverse transcription-PCR --------------------- 43
vi
Fig. 12. Northern blotting and quantitative analysis of the nfa1 gene mRNA
from N. fowleri trophozoites transfected with the RNAi vector --------- 44
Fig. 13. Western blotting and quantitative analysis of the Nfa1 protein
from N. fowleri trophozoites transfected with the RNAi ----------------- 46
Fig. 14. The fluorescence of the Nfa1 protein by immunocytochemistry -------- 48
vii
LIST OF TABLES
Table 1. In vitro cytotoxicity of N. fowleri against murine macrophages -------- 50
1
I. INTRODUCTION
A. Free-living amoeba Naegleria fowleri
Naegleria fowleri is the causal agent of primary amoebic meningoencephalitis
(PAME) which is fulminant and rapidly fatal disease that affects mainly children and
young adults (Carter, 1970). Naegleria spp. are amoeboflagellates found in soil and
water, but they are not as ubiquitous as Acanthamoeba, by which granulomatous
amoebic encephalitis (GAE) is occurred as a subacute or chronic disease with focal
granulomatous lesions in the brain. In a swimming pool that had been identified as
the source of an outbreak of 16 PAME cases, N. fowleri and other thermophilic
Naegleria spp. were found to proliferate in a cavity behind a damaged wall of the
pool (Kadlec et al., 1980). Although 30 species of Naegleria have been recognized
based upon sequencing data (De Jonckheere, 2004), N. fowleri is the only one that
has been isolated from cases of PAME. Other species (N. australiensis, N. italica, N.
pilippinensis) may be pathogenic in the mouse model of PAME, but have not been
identified from any human cases. Because, it grows at somewhat elevated
temperature, the amoeba has been isolated from warm-water bodies including man-
made lakes and ponds, hot spring, and thermally polluted streams and rivers. But
thermotolerance is not the sole factor determining pathogenicity of Naegleria spp.
but is non-pathogenic in the mouse model for PAME (De Jonckheere et al., 1977,
2
Stevens et al., 1980)
B. Life cycles and occurrence of PAME by N. fowleri
The Naegleria life cycle includes amoeboid and cystic stages, as well as a
flagellate stage which develops from the amoeba (Fig. 1). The trophic amoeba has
distinctive limacine (slug-like) pattern of locomotion, with one or more ectoplasmic
psuedopods. When the amoeba undergoes a morphogenetic transformation (over
30−60 min) and triggered by suspension in water, trophozoites are changed into a
transitory non-feeding and non-dividing flagellate stage. The cyst stage has a double
wall with pores. All Naegleria spp. are morphologically similar, if not identical to
one another, although some differences among species may be found, as in cyst pore
structure (Pussard and Pons, 1979). In nature and in the laboratory, the amoeba feeds
actively on bacteria. Isolations of N. fowleri from environmental soil or water
samples are accomplished by growth on nutrient agar plates coated with Escherichia
coli at 45℃ (Lares-Villa et al., 1993). Other bacteria (preferably non-mucoid strains),
such as Enterobacter aerogenes or Klebsiella pneumoniae, may also be used. PAME
is a fulminating disease, developing within several days following exposure to the
water source, and causing death within 1−2 weeks after hospitalization (Fig. 1).
3
Fig. 1. Life cycles of N. fowleri and PAME. The distinctive feature of N. fowleri
trophozoite is the presence of multiple finger-like projections, pseudopodia.
Trophozoite or flagellate form can infect human and experimental mouse via
olfactory bulb, resulting in PAME.
Olfactory nerveEpithelium
Brain
PAME
Trophozoite
Flagellate
CystTrophozoite
Pseudopodium
4
Because of the rapid onset of the infection and the delay in diagnosis, few
individuals survive. Infection results from introduction of water containing amoebae
into the nasal cavity and subsequent passage of the organisms to the central nervous
system (CNS) via the olfactory apparatus (Carter, 1968, 1970, 1972). Acute
hemorrhagic necrotizing meningoencephalitis follows invasion of the CNS. Only
amoebic trophozoites are found in the lesions of patients with PAME (Fig. 1). PAME
is characterized by the sudden onset of bifrontal or bitemporal headache, fever (from
38.2℃ to >40℃), nausea, vomiting (usually projectile), signs of meningeal irritation,
and encephalitis. There is often a rapid progression from fever and early signs of
leptomeningitis, encephalitis, or meningoencephalitis to coma and seizures. Nausea,
vomiting, photophobia, and other symptoms related to increase intracranial pressure
may also be prominent. The final diagnosis of PAME is based on the isolation and
culture of free-living amoebae from cerebrospinal fluid (CSF) or the demonstration
of amoebic trophozoites in biopsied brain tissue. Clinical diagnosis by experienced
practitioners is based on the characteristic stromal infiltrate. Antibodies may be
detected in serum; however, serologic tests usually are of no value in the diagnosis of
infections with free-living amoebae (John, 1982). Amphotercin B reportedly cured
one case of PAME (Ma et al., 1990). High morbidity and mortality may be reduced
with rapid diagnosis and earlier treatment. A drawback in the use of Amphotericin B
is its potential for impairment of kidney function. This has stimulated testing of other
less toxic forms of the drug for use in treatment. Amphotericin B methyl ester is one
of the less damaging forms of the compound, but it is less effective in treatment in
5
the mouse model of PAME (Ferrante, 1982). Other antimicrobials that have been
tested, mostly in vitro, are clotrimazole, itraconazole, fluconazole, and ketoconazole,
with varying degrees of efficacy. Differences in reported drug sensitivity are due to
the use of different N. fowleri strains in different laboratories, which show variation
to drugs. Amphotericin B, however, remains the drug of choice for PAME treatment.
C. Pathogenic factors related to PAME by N. fowleri
It is still unclear that the molecular mechanisms of invasion and pathogenesis of
PAME by N. fowleri are still unclear. The pathogenicity would be a complex process
which involves both contact-dependent and contact-independent pathways in order to
kill host cells quickly and to reduce the degree to which defense can be induced.
However, in general, adhesion is one of the crucial steps for the pathogenicity of
amoeba as non-pathogenic amoeba exhibit significant decreased binding to host cells
(Yang et al., 1997). The ability of N. fowleri to produce such a rapidly fatal infection
has encouraged to search for virulence properties of the amoeba that might serve as
virulence factors are the release of the enzymes phopholipase (Cursons et al., 1978),
or neuraminidase (Eisen and Franson, 1987), the secretion of cystein proteinase
(Aldape et al., 1994), the creation of pores in target cell membranes that may have a
lytic effect (Young and Lowrey, 1989; Herbst et al., 2002) and aggressive
phagocytotic activity (Brown, 1979). The amoeboid stage forms food cups
(amoebostomes) that are capable of pinching off bits of target cell cytoplasm (Brown,
6
1979; John et al., 1985, Kang et al., 2005). In particular, as related with contact-
dependent cell killing by N. fowleri, a few genes have been cloned and characterized
in our previous studies (Cho et al., 2003; Shin et al., 2001).
D. The nfa1 gene of N. fowleri
An antigen-related gene was cloned from cDNA expression library of N. fowleri
by immunoscreening with sera obtained from mice that were either immunized with
an amoebic lysate or infected with trophozoites. The coding sequence of the cloned
gene consisted of 357 bases that were translated into 119 amino acids. This gene was
designated as nfa1 gene (N. fowleri antigen 1). The amino acid sequence of Nfa1
protein shares 43% identity, especially 100% in conserved regions and iron-binding
residues, with the myohemerythrin protein of a marine annelid, Nereis diversicolor
(Takagi et al., 1991; Shin et al., 2001). In our previous study, the Nfa1 protein was
observed to localize specifically in pseudopodia using an anti-Nfa1 polyclonal
antibody by a transmission electron microscopy (Shin et al., 2001). More recently,
when N. fowleri trophozoites were cultured with CHO target cells, the Nfa1 protein
was observed to localize in food-cups of phagocytic organelles (Kang et al., 2005).
Anti-Nfa1 monoclonal antibodies were also produced using hybridoma (unpublished
yet). When an anti-Nfa1 monoclonal antibody was used to observe the location of the
Nfa1 protein in N. fowleri trophzoites, the Nfa1 protein was localized in pseudopodia.
Because the location of the Nfa1 protein by the anti-Nfa1 polyclonal antibody was
7
identical with that by the anti-Nfa1 monoclonal antibody, and the Nfa1 protein was
not detected in Acanthameobae by the anti-Nfa1 polyclonal antibody (Cho et al.,
2003), it was suggested that the anti-Nfa1 polyclonal antibody be a mono-specific
antibody. N. fowleri trophozoites showed the cytopathic effect on CHO target cells in
a co-culture systemd. Otherwise, CHO cells co-cultured with N. fowleri trophozoites
and an anti-Nfa1 antibody showed less destruction in a dose-dependent manner
(Jeong et al., 2004). When the nfa1 gene from N. fowleri was tranfected into non-
pathogenic N. gruberi, the in vitro cytotoxicity of N. gruberi was slightly increased
(Jeong et al., 2005).
E. Antisense RNA regulation and RNA interference
1. Antisense RNA regulation
The first natural antisense RNAs were discovered in 1981 independently in
Tomizawas and in Nordströms laboratories. These authors found that small plasmid-
encoded RNA regulators control the copy numbers of the E. coli plasmids ColE1 and
R1, respectively (Stougaard et al., 1981; Tomizawas et al., 1981). Antisense RNAs
are small, diffusible, highly structured RNAs that act via sequence complementarity
on target RNAs called sense RNAs. In eukaryotes, some processes like splicing or
editing make use also of complementary small RNAs; however, these RNAs are not
independent regulators, and therefore not regarded as bona fide antisense RNAs. In
8
the classical case, antisense RNAs are encoded in cis, i.e. they are transcribed from a
promoter located on the opposite strand of the same DNA molecule, and therefore
fully complementary to their target RNAs. However, over the past years, a number of
antisense RNAs were detected that are encoded in trans, reveal only partial
complementarity to their target RNA and have more than one target. The sense RNAs
are mostly mRNAs encoding proteins of important/essential functions. In the
majority of cases, antisense-RNA action entails posttranscriptional inhibition of
target RNA function. However, a few activating antisense RNAs have been found,
too. Some antisense RNAs (those involved in plasmid copy number control and
postsegregational killing) are unstable, others (most chromosomally encoded and a
few phage and transposon antisense RNAs) are stable.
1-1. Antisense RNA regulated system in eukaryotes
Eukaryotic antisense RNAs have been found only accidentally, and in most cases,
their regulatory roles and the mechanism of action are still elusive. They seem to act
preferentially via destabilization of the sense RNAs, but inhibition of splicing or
translation has been suggested, too. Destabilization has been attributed to targeting of
the antisense/sense-RNA duplex to dsRNase. Three cases are well studied. Antisense-
RNA-mediated mRNA destabilization occurs mostly in the cytoplasm (Hildebrandt
and Nellen, 1992). In mammalian cells, the stability of the eIF2α-mRNA is regulated
by a differentially expressed antisense transcript originating from a promoter located
9
in the first intron of the eIF2α gene. In plants, no naturally occurring antisense RNAs
have been found so far. However, artificially introduced antisense transcripts are
believed to target mRNA for degradation. Short antisense RNAs can be also
generated by RNA-dependent RNA polymerase (RdRp) from aberrant sense RNAs.
In addition to RNA interference (RNAi), such RNAs can mediate methylation of
homologous DNA sequences in the plant genome, thus silencing gene expression, a
pathway which might be used by natural RNA regulators as well (Bender 2001;
Matzke et al., 2001). Recently, a large number of small RNAs with probable
regulatory functions have been discovered in Caenorhabditis elegans (Lau et al.,
2001; Lee and Ambros, 2001). The expression of some of these microRNAs
(miRNAs) varies during larval development, and the potential orthologs of several of
these miRNA genes were identified in Drosophila and human genomes. These
findings indicate that small regulatory RNAs may be ubiquitous in eukaryotes, too.
2. RNA interference
RNA interference (RNAi) is the induction of sequence-specific gene silencing by
double-stranded RNA (dsRNA) (Fig. 2). It occurs posttranscriptionally and involves
mRNA degradation. The term RNAi was coined after the discovery that the injection
of double-stranded RNA (dsRNA) into C. elegans interferes with the expression of
specific genes highly homologous in sequence to the delivered dsRNA (Fire et al.,
1998).
10
RNAi is related to the "posttranscriptional gene silencing" (PTGS) or
"cosuppression" phenomena observed in plants (Baulcombe, 1999; Vaucheret et al.,
2000; Waterhouse et al., 1999) and "quelling" (silencing of an endogenous gene by
the introduction of a transgenic copy of the gene) observed in Neurospora (Cogoni
and Maciano, 1999, 1999). RNAi is a powerful tool that makes gene inactivation
possible in organisms that were not amenable to genetic analysis before. In nature,
RNAi may both play an important biological role in protecting the genome against
instabilities caused by transposons and repetitive sequences (Ketting et al., 1999;
Tabara et al., 1999) and be an ancient antiviral response/protection mechanism in
both animals and plants (Baulcombe, 1999, Grant, 1999; Ratcliff et al., 1999).
2-1. Mechanism of RNAi
Biochemical analysis of RNAi became possible with the development of an in
vitro Drosophila embryo lysate system for dsRNA-dependent gene silencing (Tuschl
et al., 1999). A key finding was that small (21–23 nucleotides) dsRNAs called short
interfering RNAs (siRNAs) are generated from the input dsRNA during PTGS and
RNAi (Hammond et al., 2001). These small RNAs have been detected in plants,
Drosophila and C. elegans and have been suggested to serve as guide RNAs for
target recognition. In Drosophila extracts, these siRNAs with their 3′-OH and 5′-
phosphate termini resemble breakdown products of an RNase III-like enzyme, e.g.,
11
Fig. 2. Model for RNAi. Antisense RNA strands are drawn in thin black, sense RNA
strands in thick black. Sense target RNA is shown in spotted lines, antisense target
RNA in short thin line. The dsRNA processing proteins containing an RNA binding
domain and a dsRNA-specific endonuclease domain are illustrated as grey-colored
small and big ovals. The protein domain of small oval binds in the 5′–3′ direction, the
protein domain of big oval in the 3′–5′ direction. Only the siRNA associated with the
domain of big oval is able to guide target RNA cleavage. The RNA-induced silencing
complex (RISC) is shown as large oval. A conformational change is proposed to
occur in the RISC before target RNA cleavage because the cleavage site of the target
RNA is displaced by 10–12 nt relative to the dsRNA processing site. The cleaved
target RNA is directed into the processing pathway where it will be sequentially
degraded. This figure was based on Elbashir et al (2001).
PPPP
PPPP
DicerPPPP
PPPPRISC
PPPP
AnAnAnAn
PPPP
AnAnAnAn
PrimerDependent
RdRP?
dsRNA
Activated RISC
RNA synthesis
RNA degradation
siRNA
Exogenous dsRNA
Viral dsRNA
12
Dicer, digestion (Elbashir et al., 2001). Synthetic siRNAs can also induce gene-
specific inhibition of expression in Drosophila extracts (Tuschl et al., 1999), in insect
and mammalian cell lines (Elbashir et al., 2001; Caplen et al., 2001) and in C.
elegans indicating that the dsRNA-processing step and the targeting step can be
uncoupled. In each case, the interference was superior to the inhibition mediated by
single-stranded antisense oligonucleotides (Bass, 2000). A model tries to explain why
the double-stranded trigger RNA is cleaved into small fragments. Cleavage to
segments of 21–23 nt might provide optimal specificity for a homology-based
searching mechanism. Much shorter segments would leave insufficient specificity,
while much longer segments might allow unwanted attacks on cellular genes with
partial but extended identity to the trigger.
The following model for dsRNA-directed mRNA cleavage is proposed (based on
(Bass, 2000; Berstein et al., 2001; Elbashir et al., 2001). The dsRNA is cleaved to
21–23-nt-long fragments by Dicer or a Dicer homologue. Processing starts from the
ends of the blunt-ended dsRNA or dsRNAs with short 3′ overhangs and proceeds in
21–23-nt steps. The resulting fragments (siRNAs) are bound by RNAi-specific
enzymes possibly still including Dicer and could be incorporated into a distinct
nuclease complex (RNA-induced silencing complex; RISC) that targets mRNA for
degradation. In this complex, they pair with the target mRNA and cleave the mRNA
in the center of the region recognized by the siRNA whereby the mRNA cleavage
boundaries are determined by the sequence of the dsRNA. Either the same RNase
that cleaves the dsRNA or another RNase that has to be recruited cleaves the target
13
RNA, probably by temporarily displacing the passive siRNA strand not used for
target recognition. The dsRNA-processing proteins or a subset of them remains
associated with the siRNA duplex after the processing reaction. The orientation of
the siRNA duplex relative to these proteins determines which of the two
complementary strands functions in guiding target RNA degradation. Chemically
synthesized siRNA duplexes guide cleavage of sense as well as antisense target RNA,
as they are able to associate with protein components in either possible orientation.
Adenosine triphosphate (ATP) may be required for complex formation on the dsRNA,
strand dissociation during or after dsRNA cleavage, pairing of the 21–23-nt RNAs
with the target mRNA, mRNA cleavage and recycling of the targeting complex.
Therefore, an RNA-dependent ATPase, or RNA helicase, is probably associated with
the RISC.
2-2. Delivery, practical aspects and problems of RNAi
For dsRNA delivery, several methods can be applied. Electroporation is used in
simpler organisms, whereas microinjection of dsRNA into germ line or early embryo
is the method of choice in multicellular organisms. In C. elegans, injection into the
intestine or pseudocoelom is almost as efficient as injection into the germ line. Even
feeding worms with bacteria that express dsRNA, or soaking worms in dsRNA
solutions has been applied with success (Tabara et al., 1998; Tabara et al., 1999;
Timmons and Fire, 1998). Because RNAi is homology-dependent, single base pair
14
mismatches between siRNA and target RNA dramatically reduce silencing. The
length of the dsRNA can affect the RNAi efficiency (Bosher et al., 1999). Usually,
dsRNA of at least 500 bp is applied but recently it has been found that perfectly
matching duplexes as short as 21 bp suffice (Caplen et al., 2001; Parrish et al., 2000).
When dsRNA is injected into early embryos, it is diluted upon cell division.
Therefore, early genes are more easily inactivated than late genes, which is
especially a problem for higher organisms (in mouse, a construct was effective only
until a 40–50-fold increase in cell mass) (Wianny and Zernicka-Goetz, 2000). In C.
elegans, the application of a plasmid with inducible (by heat-shock) promoter for the
production of dsRNA (sense RNA and antisense RNA expressed in the form of a
hairpin) made inheritable RNAi possible (Tavernarakis et al., 2000). With this
approach inheritable transgenes are easily generated, large numbers of mutant
organisms can be propagated delivering enough material for a broad variety of
analyses and stage-specific RNAi can be performed. Furthermore, neurons, normally
partially resistant to exogenous supply of dsRNA, became RNAi sensitive upon
plasmid-derived in vivo supply of dsRNA (Clemens, 1997). The expression of
dsRNA under the control of tissue-specific promoters instead of inducible ones is
also conceivable.
Although experiments to elucidate the underlying mechanism progress rapidly,
we are still at the beginning of our understanding of the molecular processes
responsible for RNAi and the breadth of its function in biology. In contrast, practical
applications have already allowed rapid surveys of gene functions (Fraser et al.,
15
2000) and will possibly result in new therapeutical interventions.
F. Subjects in this study
A great advance in studying the function of genes and biology of free-living
ameobae has been the use of transfection technology. In Acanthamoeba, the transient
and stable transfection system had been established (Hu and Henney, 1997; Yin and
Henney, 1997; Peng et al., 2005). Transfection of the pEGFP–C2 vector with an nfa1
gene into nonpathogenic N. gruberi has been tried in our previous study, and
transgenic N. gruberi has been maintained for nine months after the treatment of
G418 antibiotics as a selective marker (Jeong et al., 2005).
In this study, to observe the gene-knockdown of the Nfa1 protein in N. fowleri,
antisense RNA and siRNA of the nfa1 gene were constructed, cloned in a
transfection vector and transfected into trophozoites of N. fowleri. In addition, to
describe the association of Nfa1 protein with the in vitro cytotoxicity of N. fowleri to
a target cell, N. fowleri tracfected with vectors including an antisense RNA or siRNA
of the nfa1 gene was co-cultured with murine macrophages.
16
II. MATERIALS AND METHODS
A. Cultivation of N. fowleri trophozoites and murine macrophages
Trophozoites of N. fowleri (Carter NF69 strain, ATCC No. 30215) were cultured
under axenic conditions in Nelson’s medium (Willaert, 1971). Trophozoites of N.
fowleri in log phase of growth were used in all experiments. N. fowleri was tested
before use for its ability to produce PAME in experimental mouse and for its
cytopathic activity on CHO target cells (Jeong et al., 2004). Murine macrophages
(ATCC No. TIB-71) were cultured with Dulbecco’s Minimal Essential Medium
(DMEM, GibcoBRL) containing 10% fetal bovine serum (FBS, GibcoBRL)
(complete DMEM) at 37 in 5% CO℃ 2 incubator (Ralph et al., 1977).
B. Total RNA preparation and RT-PCR
Total RNA was prepared using an isolation kit RNAzol B (TEL-TEST,
Fiendswood, TX, USA) solution. After 500 µl of RNAzol B solution was mixed with
pellet of 1 × 105 N. fowleri trophozoites by pipetting, 10 µl of chloroform was added
to the mixture. It was incubated on ice for 5 min and centrifuged at 10,000 × g for 15
min at 4℃. The supernatant was transferred to a new 1.5 ml tube and reacted with
250 µl of isoamylalcohol. Incubated for 15 min at 4℃, it was centrifuged at 10,000 ×
17
g for 15 min at 4℃. The pellet was washed with 1 ml of 70% ice-cold ethanol once
and dried at room temperature (RT). The total RNA was suspended with 10 µl of
diethylpyrocarbonate (DEPC)-treated distilled water (DW) and stored at -70℃. RNA
yield and quality were evaluated spectrophotometrically and by analytical gel
electrophoresis according to Sagerström and Sive (1996). For reverse transcription-
polymerase chain reaction (RT-PCR), we used a Superscript First Strand Synthesis
System kit (Invitrogen) to generate cDNA from 5 µg of total RNA pretreated with 1
µg of DNase I (Sigma). Reverse transcription was performed according to the
manufacturer’s recommendations for first-strand synthesis using gene-specific
primers. PCR fragments were amplified from cDNA by using Taq polymerase
(Promega) and 32 cycles of 95℃ for 30 s, 55℃ for 1 min, and 72℃ for 1 min.
C. Synthesis of antisense and sense-directed RNA of nfa1 gene ORF, and siRNAs
of the nfa1 gene
To transcript antisense-directed RNA of an nfa1 gene open reading frame (ORF)
(asnfa1), the nfa1 gene was cloned into pGEM−4Z vector (Promega) containing T7
promoter behind multicloning sites (MCS) using the method of a cohesive ligation to
construct a pGEM−4Z/asnfa1 vector. The pGEM−4Z/asnfa1 vector was digested
with the restriction enzyme of Eco RI for 2 h and transcribed in vitro. Briefly,
approximately 500 ng of prepared DNA was added to the transcription mixture
containing 10 µl of 10 mM NTP mix (2.5 mM ATP, 2.5 mM CTP, 2.5 mM UTP, 2.5
18
mM GTP; Invitrogen), 2.5 µl of 10 mM DTT, 2.5 µl of 10× buffer, 40 U of RNase
inhibitor (Invitrogen) and 30 U of T7 RNA polymerase (Promega). The mixture was
incubated at 37℃ for 1 h and the reaction was stopped by phenol/chloroform
extraction. The transcripts were precipitated using 3 M sodium acetate and dissolved
in DEPC-treated water. For sense-directed RNA of an nfa1 gene ORF (ssnfa1), the
nfa1 gene was first cloned into pGEM−3Zf(+) vector (Promega) containing T7
promoter at the front of MCS using the method of a cohesive ligation to construct a
pGEM−3Zf(+)/ssnfa1 vector. The pGEM−3Zf(+)/ssnfa1 vector was digested with the
enzyme of Hind III and the sense-directed nfa1 gene was transcribed using T7
polymerase. The transcript was precipitated with 3 M sodium acetate mentioned
above. To make double stranded RNA of nfa1 gene ORF (dsnfa1), equal amounts of
ssnfa1 and asnfa1 were mixed, heated to 65 and annealed by slow cooling (65 , ℃ ℃
55 ,45 , 35 and 25 for respective 30 min) for 2 h 30 min.℃ ℃ ℃ ℃ Individual RNAs
and double stranded RNA were analyzed on 1% agarose gel. The four short double-
stranded nfa1 gene, four synthetic siRNAs; sinfa1-1, correspondence of nucleotides
340–360 of the nfa1 gene ORF (Genebank Accession No. AF230370), 5’-
r(AAGTACAAGGGAGTGCTTTAA)d(TT); sinfa1-2, correspondence of nucleotides
82–102 of the nfa1 gene ORF, 5’-r(AAGCTCTTTGCTCTCATCAAT)d(TT); sinfa1-
3, correspondence of nucleotides 252–272 of the nfa1 gene ORF, 5’-
r(AAGATGCTTTGGGTTTGAAG)d(TT); sinfa1-4, correspondence of nucleotides
196–216 of the nfa1 gene ORF, 5’-r(AAGGTGAATTTCTCTGATTCT)d(TT),
were synthesized (Qiagen) and resuspended in siRNA suspension buffer as supplied
19
by the manufacturer to final concentration of 20 µM solution. After the solution of
siRNA was heated to 90 for 1 mi℃ n and then incubated at 37 for 1 h, it was stored ℃
frozen at -20 prior to transfection.℃
D. Southern blot hybridization
To identify ssnfa1 or asnfa1 made by in vitro transcription, southern blot
hybridization was performed. Samples loaded on agarose gel were prepared by PCR.
For DNA of an nfa1 gene from pGEM–3Zf(+)/ssnfa1 vector, primers (5’-
ATGGCCACTACTATTCCATCA-3’ and 5’-TTAAAGCACTCCCTTGTACTT-3’)
were used. In our previous study, for DNA sequence unrelated with the nfa1 gene
cloned into pEGFP−C2 vector (Clontech), primers (5’-ACAACATCGAGGACGGC-
AGCGTGCAGCTCG-3’ and 5’-GTTTGGACAAACCACAACTAGAATGCAGTG-
3’) were used (Jeong et al., 2004). After electrophoresis, the gels were subjected to
short wave UV irradiation for 2 min and the DNA was denatured in alkaline solution
(10 N NaOH, 5 M NaCl) for 45 min at RT, followed by neutralization for 45 min.
DNA was transferred to Hybond N+ membrane (Amersham) by dry blotting
overnight. The membrane was cross-linked using XL-1500 UV Crosslinker
(Spectrolinker Co.). For probe preparation, RNA probe labeled with α-32P-UTP was
produced by random priming of in vitro transcribed ssnfa1 or asnfa1. The probe was
hybridized overnight at 65 in hybridization buffer. The membrane was washed and ℃
then exposed to X-ray film (Kodak) for 2 days.
20
E. Transfection of asnfa1, dsnfa1 and siRNAs into N. fowleri trophozoites
To observe the effect of asnfa1, dsnfa1, and siRNAs of the nfa1 gene, each RNA
was transfected into N. fowleri according to the procedure of an RNAi starter kit
(Qiagen). The day before transfection, 4 × 104 trophozoites were cultured in 24 well
cell culture plate (Nunc) in 0.5 ml of Nelson complete medium at 37℃. On the day
of transfection, 1 µg each RNA in Nelson medium was diluted to give a final volume
of 100 µl, and mixed by vortexing. For complex formation, 6 µl of RNAiFect reagent
(Qiagen) was added and mixed. And then the samples were incubated for 15 min at
RT to allow formation of transfection complexes. While complex formation was
taking place, Nelson medium was gently aspirated from the plate. After 300 µl of
fresh Nelson complete medium was added, the complexes were drop-wised onto the
N. fowleri trophozoites. To observe the transfection of siRNAs using RNAiFect
reagent, green fluorescent protein (GFP) fused siRNA directed against the human
lamin A/C gene, which was unrelated with the nfa1 gene, was used in parallel. The
transfection was observed under a fluorescent microscopy using standard FITC
exitation/emission filters (488 nm/507 nm).
F. Northern blot hybridization and quantitation of RNA
For northern blot hybridization, 10 µg of total RNA was heated to 65℃ for 10
21
min, and size fractionated under denaturing conditions on agarose gels containing
formaldehyde. The RNA was transferred to a Hybond N+ membrane (Amersham)
and hybridized under stringent conditions as described previously (Bracha et al.,
1995). The membrane was cross-linked using XL-1500 UV Crosslinker
(Spectrolinker). For an nfa1 gene-specific probe, the nfa1 gene was amplified with
primers of 5’-ATGGCCACTACTATTCCATCA-3’ and 5’-TTAAAGCACTCCCT-
TGTACTT-3’ and eluted. The probe randomly labeled with α-32P-dATP was prepared
from the appropriate PCR fragment. It was hybridized overnight at 65 in ℃
hybridization buffer. The membrane was washed and then exposed to imaging plate
for 2 days. After the bands on imaging plate were read by Image Reader (FLA-3000,
Fujifilm, Japan), they were quantified by a densitometer program of Image Guage
(LAS1000, Fujifilm, Japan).
G. Cell lysate preparation and immunoblots
Cultures (12 ml) of N. fowleri trophozoites were harvested and the cell pellets
were suspended with 200 µl of phosphate-buffered saline (PBS, pH 7.4; 137 mM
NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4). Pellets were solubilized by
freezing-thawing method (Im and Shin, 2003) to obtain a lysate. Protein content in
cell-free extracts was determined according to Bradford (Bradford, 1976) with
protein assay dye reagent and bovine serum albumin for standard curve calibration
(Ultrospec 3000, Pharmacia Biotech). The lysate was boiled in sodium dodecyl
22
sulfide (SDS) treatment buffer (125 mM Tris-HCl, 4% (w/v) SDS, 20% (v/v)
glycerol, 3.1% (w/v) dithiothreitol, 0.001% (w/v) bromophenol blue) for 5 min. The
lysate was resolved for 2 h at 100 V on 15% polyacrylamide gel (15 µg/lane) under
reducing conditions in a Mini-Protean II Cell (Bio-Rad) according to the method of
Laemmli (Laemmli et al., 1970). The lysate was transferred electrophoretically to
polyvinylidene difluoride (PVDF) membrane (Hybond-P; Amersham Biosciences)
with transfer buffer (25 mM Tris, 192 mM glycine, 20% (v/v) methanol; without
adjusting the pH, it should be around 8.0 − 8.2) at 250 mA for 1 h 30 min. After the
blot was incubated with 3% bovine serum albumin (BSA) in PBS, it was reacted with
a suspension of anti-Nfa1 polyclonal antibody (1:100) and then subjected to interact
with an horseradishperoxidase (HRP)-conjugated anti-mouse IgG (1:2,000)(Sigma)
and developed by enhanced chemiluminescence. Detection was done for only HRP
reaction by autoradiography. The amount was determined to quantify the Nfa1
protein expression by a densitometer (LAS1000, Fujifilm, Japan). The densities of
protein bands were divided by the corresponding densities recognized by the anti-
Nfa2 antibody to obtain a normalized protein ratio. The standard curve of proteins
was used to demonstrate that signals were in the linear range for quantitative
purposes.
H. Vector construction of sinfa1-1 and asnfa1
The vector of sinfa1-1 transfected to pathogenic N. fowleri was modified from a
23
RNAT−U6.1/Hygro (6.5 kb, Genscript) vector. The pRNAT−U6.1/Hygro vector was
designed for mammalian transfection. It carries a hygromycin resistance gene as the
selectable marker, GFP marker (coral GFP, cGFP) under cytomegalovirus (CMV)
promoter control used to track the transfection efficiency. It uses U6 promoter, which
is a kind of human polymerase III promoter to effectively transcribe short RNA. An
sinfa1-1 was cloned into the pRNAT−U6.1/Hygro vector to construct a
pRNAT−U6.1/sinfa1-1/Hygro vector by the manufacturer of Genscript company. In
our previous study, U6, CMV and simian virus (SV) 40 promoter transfected into N.
fowleri trophozoites did not transcribe siRNA, cGFP, and hygromycin resistance
gene, respectively. The fluorescence of GFP was not also observed in N. fowleri
transfected with a pRNAT−U6.1/Hygro vector (data not shown). It needs to change
other promoter functioning RNA transcription. Therefore, 5’ untranslated regions
(UTR) (kindly presented by Prof. Lee at Yonsei University) as a promoter of an actin
gene from nonpathogenic N. gruberi was used to transcribe genes mentioned above.
For cloning of 5’ UTR of an actin gene, three promoters of U6, CMV, and SV40
were excised from the vector using restriction enzymes. To clone final pAct/SAGAH
vector (Act and A, 5’ UTR of an actin gene; S, siRNA of an nfa1 gene; G, GFP; H,
hygromycin resistance gene) used to transfect into N. fowleri trophozoites, 5’ UTR of
an actin gene in pEGFP−N2 vector (Clontech) was amplified with primers containing
restriction enzymes sites as follows; for cloning of 5’ UTR of an actin gene in the
location of excised CMV, primer containing Hind III (5’-AGTCCTAAGCTTTTT-
CCTTTTTTAGAAGCC-3’) and primer containing Nhe I (5’-ACTAGGGCTA-
24
GCTTTGTTGAGTGTTTGAG-3’); for cloning of 5’ UTR of an actin gene in the
location of excised U6, primer containing Bgl II (5’-AGTCCTAGATCTTTTCCTT-
TTTTTAGAAGC-3’) and primer containing Bam HI (5’-ACTATTGGATCCT-
TTGTTGAGTGTTTGAG-3’); for cloning of 5’ UTR of an actin gene in the location
of excised SV 40, primer containing Avr II (5’-AGTCCTCCTAGGTTTCCTTTT-
TTAGAAGCC-3’) and primer containing Xma I (5’-ACTAGCCCGGGTT-
TGTTGAGTGTTTGAG-3’). Each amplified fragment was ligated into the
pRNAT−U6.1/Hygro vector excised with respective restriction enzymes to create
pAct/SAGAH vector. To also observe the effect of asnfa1 by a vector-based system,
an antisense DNA of the nfa1 gene was cloned into pAct/AGAH vector, in which an
sinfa1-1 was eliminated, to create pAct/asnfa1AGAH vector. After the PCR
fragment of antisense DNA of the nfa1 gene was amplified with the primers of 5’-
AAGTCCAAGCTTATGGCCACTACTATT-3’ containing Hind III site and 5’-
AAGTCCGGATCCTTAAAGCACTCCCTT-3’ containing Bam HI site, it was
ligated into pAct/AGAH vector to create a pAct/asnfa1AGAH vector. All cloned
vectors were sequenced with ABI Perkin Elmer 373A automated DNA sequencer
(Applied Biosystems, Foster city, CA).
I. Transfection of pAct/sinfa1-1AGAH and pAct/asnfa1AGAH vector into N.
fowleri trophozoites and hygromycin selection
The transfection of DNA vectors into pathogenic N. fowleri was performed using
25
SuperFect transfection reagent (Qiagen GmbH, Germany). As our previously data,
SuperFect reagent was successfully used in the nonpathogenic N. gruberi
transfection study (Jeong et al., 2005). The branches of the reagent radiate from a
central core and terminate at charged amino groups which can then interact with
negatively charged phosphate groups of nucleic acids (Tang et al., 1996). Briefly, the
day before transfection, 4 × 104 trophozoites were cultured in 24 well cell culture
plate (Nunc) in 0.5 ml of Nelson incomplete medium without penicillin and
streptomycin (Gibco BRL, Gaithersburg, MD) at 37 overnight. On the da℃ y of
transfection, 1 µg plasmid DNA in Nelson incomplete medium without antibiotics
was diluted to give a final volume of 60 µl, and mixed by vortexing. For complex
formation, 5 µl of SuperFect reagent was added and mixed. And then the samples
were incubated for 15 min at RT to allow formation of transfection complexes.
While complex formation was taking place, Nelson medium was gently aspirated
from the plate and N. fowleri trophozoites were washed once with 4 ml of 1 × PBS.
After 350 µl of fresh Nelson complete medium was added, the complexes were drop-
wised onto the N. fowleri trophozoites. The transfection was observed under a
fluorescent microscopy using standard FITC exitation/emission filters (488 nm/507
nm). For the selection of transfected N. fowleri trophozoites, hygromycin antibiotics
(100 µg/ml) (Gibco BRL, Gaithersburg, MD) was added to the 24 well plate 5 days
after transfection. The lethal dose of untransfected N. fowleri to hygromycin
antibiotics was determined that it was died after 1 week.
26
J. Indirect immunofluorescence antibody test
Immunocytochemistry was used to observe the knockdown of Nfa1 protein in N.
fowleri transfected with a pAct/SAGAH or pAct/asnfa1AGAH vector. N. fowleri
trophozoites were cultured on 24 well cell culture plate (Nunc A/S, Roskilde,
Denmark) overnight. After the culture medium was discarded, the trophozoites were
washed with 0.85% saline three times and were done with cold 0.85% saline at third
time. 200 µl of 10% formalin in 0.85% saline was added and the plate was incubated
at RT for 30 min. The trophozoites were washed with 0.85% saline three times,
added 200 µl of 1% NH4OH to render them permeable, and then incubated at RT for
5 min. The prefixed and permeablized trophozoites were incubated with an anti-Nfa1
polyclonal antibody (1:100 dilution containing 3% BSA) at RT overnight. After
several washes with PBS containing Tween 20 (PBST), the trophozoites were treated
with a tetramethyl rhodamine isocyanate (TRITC)-conjugated AffiniPure rabbit anti-
mouse immunoglobulin G secondary antibody (Jackson ImmunoResearch
Laboratories) (1:2,000 dilution with 3% BSA) at RT for 2 h and then washed with
PBST. Trophozoites were analyzed by fluorescence microscopy using standard FITC
excitation/emission filters (488 nm/507 nm).
K. In vitro cytotoxicity
Murine macrophages were used to observe the in vitro cytotoxicity of the amoeba.
27
This experiment, in 96 well cell culture plates, was performed using 5 × 104 murine
macrophages either alone or cocultured with (i) 5 × 104 trophozoites of N. fowleri,
(ii) 5 × 104 trophozoites of N. fowleri transfected with a pAct/AGAH vector as a
control vector, (iii) 5 × 104 trophozoites of N. fowleri transfected with a
pAct/SAGAH vector, (iv) 5 × 104 trophozoites of N. fowleri transfected with a
pAct/asnfa1AGAH vector, (v) 5 × 104 trophozoites of N. fowleri transfected with
only SuperFect reagent, (vi) 5 × 104 trophozoites of N. fowleri supplemented with
hygromycin antibiotics (100 µg/ml). The total volume per well was 200 µl of DMEM.
Murine macrophages and trophozoites were observed under an inverted microscope
at 24 h intervals. A lactate dehydrogenase (LDH) release assay was performed to
quantify in vitro cytotoxicity. For the LDH assay, 50 µl of reacted supernatant in
each well was transferred to a 96 well assay plate. After addition of 50 µl of
reconstituted assay buffer from a CytoTox96 Non-radioactive Cytotoxicity Assay kit
(Promega, Madison, WI), the plate was incubated for 30 min at RT, and then 50 µl of
stop solution was added. The reactants were read at 490 nm using an enzyme-linked
immunosorbent assay reader. The formula used to calculate the percent in vitro
cytotoxicity was as follows: (sample value − control value) × 100 /(total LDH release
− control value). Total LDH release was obtained from 50 ul of supernatant released
from 5 × 104 murine macrophages treated with lysis buffer for 1 h.
28
III. RESULTS
A. In vitro synthesis of ssnfa1, asnfa1 and dsnfa1
Prior to synthesize a dsnfa1 to knockdown an nfa1 gene and Nfa1 protein in N.
fowleri, ssnfa1 and asnfa1 were synthesized by PCR. An nfa1 gene ORF was cloned
into a pGEM−3Zf(+) and pGEM−4Z vector to create a pGEM−3Zf(+)/ssnfa1 and
pGEM−4Z/asnfa1 vector, respectively (Fig. 3). The transcription was driven by the
T7 promoter. After restriction enzymes digestion of Hind III for ssnfa1 and Eco RI
for asnfa1, the restricted fragment was transcribed in vitro using T7 RNA polymerase.
For dsnfa1, ssnfa1 and asnfa1 were equally mixed and annealed by slow-cooling
method (Malhotra et al., 2002). Individual RNAs and double stranded RNAs were
analyzed on 1% agarose gel (Fig. 4A). As the fragments were compared with each
other, the size of ssnfa1 and asnfa1 was a little higher than PCR product of the nfa1
gene ORF of 360 bp. According to Malhotra et al. (2002), the size of dsRNA and
dsDNA was almost double to ssRNA. The reason why size variation was occurred in
ssnfa1, asnfa1, and dsnfa1 seemed to be the structural differences of genes. Although
the size of synthetic dsnfa1 was not exactly double to single-stranded RNA, because
the size of PCR fragment of the nfa1 gene was similar with it of dsRNA, dsnfa1 was
successfully synthesized in the present study (Fig. 4A). Moreover, that ssnfa1 and
asnfa1 were well synthesized was confirmed by southern blotting of DNA-RNA
29
Fig. 3. Schematic representation of an nfa1 gene in N. fowleri used to produce
sense (ss) and antisense (as) RNA followed by dsRNA formation in vitro. To
prepare dsRNA, the nfa1 gene cloned into a pGEM–3Zf(+) and pGEM–4Z vector
was in vitro transcribed by T7 polymerase, and then ssRNA and asRNA were mixed,
incubated at 65℃, and cooled slowly to obtain their corresponding dsRNA.
SP6 promoternfa1 (360 bp)T7 promoter
EcoRI HindIII
Transcription start
pGEM-3Zf(+)/ssnfa1
T7 promoternfa1 (360 bp)SP6 promoterTranscription start
pGEM-4Z/asnfa1
30
Fig. 4. Findings of dsnfa1 synthesis and Southern blotting. (A) Agarose gel
electrophoresis of the nfa1 gene. To prepare dsnfa1, in vitro transcribed ssnfa1 and
asnfa1 were mixed with equal amounts, incubated at 65 and coole℃ d slowly. (B).
Schematic representation of the nfa1 gene of N. fowleri used to produce ssnfa1,
asnfa1 and dsnfa1 by in vitro transcription. M, 1kb+ DNA ladder; lane 1, PCR
product of nfa1 gene in pGEM–3Zf(+)/ssnfa1; lane 2, PCR product of nfa1 gene in
pGEM–4Z/asnfa1; lane 3, nfa1 ssnfa1; lane 4, asnfa1; lane 5, dsnfa1.
A
1.0
0.5
0.3
kb
B 1
asnfa1 probe
2 3 1 2 3
ssnfa1 probe
M 1 2 3 4 5
31
hybridization (Fig. 4B). DNA of nfa1 gene amplified from pGEM–3Zf(+)/nfa1
vector was detected with α-32P-UTP labeled ssnfa1 or asnfa1. But, a GFP gene in
pEGFP–C2 vector and a control of DW was not detected.
B. Knockdown of the nfa1 mRNA and Nfa1 protein by asnfa1 or dsnfa1
RNAi means post-transcriptional gene silencing and has been induced in most
organisms by microinjection. In this present study, a lipid formulation was used for
the transfection. Because there have not been reports showing the effect of
transfection reagents for RNAi in free-living amoebae, TransMessenger or RNAiFect
reagent was used for the transfection of single-stranded and dsRNA. As a northern
blot analysis, it was observed that an nfa1 mRNA was successfully knockdowned in
N. fowleri trophozoites transfected with dsnfa1 using RNAiFect reagent (Fig. 5A,
5B). Using TransMessenger reagent, no changes were observed in the level of the
nfa1 gene mRNA. In the principle, TransMessenger reagent is recommended in the
transfection of single-stranded RNA. Hybridizations of northern blotting with a
probe specific for the nfa1 gene revealed that in the transfection of asnfa1 using
TransMessenger reagent, no changes were observed in the level of the nfa1 gene
mRNA and also, in ssnfa1 and only RNAiFect reagent, the level of the nfa1 gene
mRNA was almost identical with it of untransfected N. fowleri. Therefore, it was
suggested that dsnfa1 should be very effective in knockdowning the nfa1 gene
mRNA. An nfa2 gene which used to normalize and show that RNAi was specific for
32
the nfa1 gene was not changed in the mRNA patterns (Fig. 5A). Therefore, it was
suggested that, although long dsRNA but not siRNA had the problem of non-
specificity, dsnfa1 could be specifically acted in N. fowleri. In Fig. 5B, it was shown
that there were not any problems in nfa1 gene-specific probe due to the stringent
experimental conditions. To more understand the level of knockdowned nfa1 gene
mRNA, a quantitative analysis was performed (Fig. 5C). The transfection of dsnfa1
using RNAiFect reagent had the highest effect about 60% on knockdowning the
mRNA gene. There were not the differences of dsnfa1 transfected using
TransMessenger reagent with asnfa1 transfected using RNAiFect reagent. When
asnfa1 was transfected using TransMessenger reagent, no change was also observed
in the nfa1 gene mRNA (data not shown).
As a western blot analysis, the Nfa1 protein was not decreased highly as the nfa1
gene mRNA (Fig. 6). It was observed that the Nfa1 protein was higher knockdowned
in N. fowleri trophozoites transfected with dsnfa1 than asRNA using RNAiFect or
dsnfa1 using TransMessenger reagent (Fig. 6A). Similar amounts of the Nfa1 protein
were detected in the controls and the patterns of the Nfa2 protein of 21 kDa were not
changed (Fig. 6A). Quantitative estimation of the level of the Nfa1 protein showed
higher decreasing effect about 30% in the N. fowleri transfected with dsnfa1 using
RNAiFect reagent (Fig. 6B). On contrast, there were few changes in the dsnfa1 using
TransMessenger or asnfa1 using RNAiFect reagent. These results indicate that
dsnfa1 using RNAiFect reagent is the most efficient for knockdowning the nfa1 and
Nfa1 protein
33
Fig. 5. Northern blotting and quantitative analysis of the nfa1 gene mRNA from
N. fowleri trophozoites transfected with an asnfa1 or dsnfa1. (A) Northern
blotting of the nfa1 or nfa2 gene mRNA with a gene-specific probe. 25 µg of the
mRNA samples were loaded. (B) Northern blotting of the nfa1 gene mRNA used as a
loading control. C. Quantitative analysis of fig. 5A. F, RNAiFect reagent; T,
TransMessenger reagent.
Probe
nfa1
nfa2
asnfa
1 (F)
ssnfa
1 (F)
dsnfa
1 (T)
dsnfa
1 (F)
F NoneA
B5 μμμμ
g10
μμμμg
15 μμμμ
g20
μμμμg25
μμμμg30
μμμμg35
μμμμg40
μμμμg
C
Probe
nfa1
99.895.4 98.7
50.4
100 100
Qua
ntity
of a
n N
fa1
prot
ein
(%)
20
40
60
80
100
ssnf
a1 (F
)as
nfa1
(F)
dsnf
a1 (T
)ds
nfa1
(F) F
Non
e
34
Fig. 6. Western blotting and quantitative analysis of the Nfa1 protein from N.
fowleri trophozoites transfected with an asnfa1 or dsnfa1. (A) Western blotting of
the Nfa1 or Nfa2 protein detected with a respective polyclonal antibody. 10 µg of the
N. fowleri lysate was loaded. (B) Quantitative analysis of fig. 5A. F, RNAiFect
reagent; T, TransMessenger reagent.
Probe
nfa1
nfa2
asnfa
1 (F)
ssnfa
1 (F)
dsnfa
1 (T)
dsnfa
1 (F)
F None
99.1 100 97.6
70.1
100 99.8
Qua
ntity
of a
n N
fa1
prot
ein
(%)
20
40
60
80
100
ssnf
a1 (F
)as
nfa1
(F)
dsnf
a1 (T
)ds
nfa1
(F) F
Non
e
A B
35
C. Knockdown of an nfa1 gene mRNA and Nfa1 protein by synthetic siRNAs
The transfection of siRNA into N. fowleri trophozoites was performed with
RNAiFect reagent. It is not easy to find the most functional siRNA of any genes.
Although a lot of siRNAs are chosen, they don’t act to knockdown equally. In other
words, in the present study, four siRNAs were randomly chosen as considerations of
siRNA choices. Because siRNA has very little nucleotide and it is difficult to observe
whether the transfection is done or not, we identified the transfection with the
fluorescence of GFP-conjugated siRNA of Lamin A/C gene from human, irrespective
of the nfa1 gene (Fig. 7). GFP fluorescence was observed 24 h after the transfection
into N. fowleri trophozoites with the GFP-conjugated siRNA of Lamin A/C as
compared with untransfected N. fowleri. GFP fluorescence was observed in the
cytoplasm of transfected N. fowleri. This result showed that siRNA could be
transfected using RNAiFect reagent. The fact of the decrease of the nfa1 gene and
Nfa1 protein by a dsnfa1 transfection using RNAiFect reagent supported that the
RNAi mechanism associated with siRNA not only exist in N. fowleri trophozoites but
also siRNA act to knockdown the nfa1 gene. Thus, we transfected each siRNA
(sinfa1-1, sinfa1-2, sinfa1-3 and sinfa1-4) using a RNAiFect reagent into N. fowleri
trophozoites. All siRNAs were composed of each 21 nucleotides. The expression of
the nfa1 gene mRNA in the siRNA transfectants was assessed by northern blot
analysis with a specific probe for the nfa1 gene ORF (Fig. 8).
36
Fig. 7. GFP fluorescence in N. fowleri transfected with GFP-conjugated with
siRNA of Lamin A/C gene. (A) and (C) under a light microscopy, and (B) and (D)
under a fluorescence microscopy were observed 24 h after the transfection. (D)
shows N. fowleri transfected with GFP-conjugated with siRNA of Lamin A/C
compared with untransfected N. fowleri of fig. 7D. × 400.
B
D
A
C
37
Although they didn’t show an identical effect, all siRNAs had an effect on
knockdowning nfa1 gene mRNA. In particular, the sinfa1-1 showed the highest
knockdown of the nfa1 gene mRNA by northern blotting (Fig. 8A). According to the
quantitative analysis, even the sinfa1-2 or sinfa1-4 showed the effect from 55 ~ 57%
and the sinfa1-1 did the effect about 70% (Fig. 8B). No change of the nfa2 gene
mRNA, which is not homologous with the nfa1 gene, was occurred by the
transfection of siRNAs of the nfa1 gene (Fig. 8A). Western blots with anti-Nfa1
polyclonal antibody showed the highest decreasing effect of the Nfa1 protein levels
by the sinfa1-1, in agreement with the northern blot data (Fig. 9). The Nfa1 protein
transfected with each siRNA was not knockdowned as the nfa1 gene mRNA (Fig.
9A). According to the quantitative analysis of fig. 9A, the knockdowned Nfa1 protein
was higher about 20% than the nfa1 protein (Fig. 9B). Even though it was done so,
the sinfa1-1 showed the highest decreasing effect with about 43%. In the sinfa1-4,
the nfa1 gene mRNA was knockdowned with about 45% but the Nfa1 protein with
7%, which was very different from the effect of other three siRNAs. The level of the
Nfa2 protein was not affected by the transfection of siRNAs of the nfa1 gene (Fig.
9A). These results supported the functional analysis in vitro. However, when we
observed the in vitro cytotoxicity of N. fowleri trophozoites knockdowned by the
dsnfa1 or sinfa1-1 against murine macrophages, we didn’t observe the significant
inhibition of the cytotoxicity of N. fowleri by the morphological analysis of murine
macrophages and LDH release assay (data not shown).
38
Fig. 8. Northern blotting and quantitative analysis of the nfa1 gene mRNA from
N. fowleri trophozoites transfected with the siRNAs of an nfa1 gene. (A)
Northern blotting of the nfa1 or nfa2 gene mRNA with a gene-specific probe. 25 µg
of the mRNA samples were loaded. (B) Quantitative analysis of fig. 5A. N. fowleri
trophzoites were transfected using RNAiFect reagent.
sinfa
1-1
sinfa
1-2
sinfa
1-3
sinfa
1-4
RNAiFec
t
None
Probe
nfa1
nfa2
30.8
53.244.6
55.4
100 100
Qua
ntity
of a
n N
fa1
prot
ein
(%)
20
40
60
80
100
sinfa
1-1
sinfa
1-2
sinfa
1-3
sinfa
1-4
RN
AiF
ect
Non
e
A B
39
Fig. 9. Western blotting and quantitative analysis of the Nfa1 protein from N.
fowleri trophozoites transfected with the siRNAs of an nfa1 gene. (A) Western
blotting of the Nfa1 or Nfa2 protein detected with a respective polyclonal antibody.
10 µg of the N. fowleri lysate was loaded. (B) Quantitative analysis of fig. 5A. N.
fowleri trophzoites were transfected using RNAiFect reagent.
sinfa
1-1
sinfa
1-2
sinfa
1-3
sinfa
1-4
F None
Probe
nfa1
nfa2 57.5
70.666.5
93.6100 99.3
Qua
ntity
of a
n N
fa1
prot
ein
(%)
20
40
60
80
100
sinf
a1-1
sinf
a1-2
sinfa
1-3
sinfa
1-4
RN
AiF
ect
Non
e
A B
40
This result supported the use of a long-lasting system such as a vector. Therefore, we
used the vector-based system with sinfa1-1 showing the highest decreasing effect of
the nfa1 gene mRNA and Nfa1 protein.
D. RNAi function by a vector-based system
DNA-vector based technology has a lot of advantages comparing to chemically
synthesized siRNA. It is more effective than synthetic siRNA for inhibition of gene
expression and very stable and easy to handle (Yu et al., 2002). It also allows
researcher to obtain a stable cell line, and observe long-term effects of RNAi. The
vector with selectable markers and active promoters is required to transfect. A
pRNAT−U6.1/Hygro vector was transfected into N. fowleri trophozoites using
SuperFect reagent, but the GFP fluorescence (data not shown) as well as GFP
transcript by reverse transcription-PCR were not observed. Also, when the nfa1 gene
mRNA level was examined by northern blotting, it was not knockdowned in N.
fowleri trophzoites transfected with the pRNAT−U6.1/Hygro vector (data not shown).
It meant that U6 promoter in the vector did not act to transcribe a sinfa1-1. Therefore,
all viral promoters and U6 promoter in the pRNAT−U6.1/Hygro vector were
replaced with 5’ UTR of actin gene from nonpathogenic N. gruberi, and a sinfa1-1
showed the highest decreasing effect or asnfa1 was cloned to create a pAct/SAGAH
or pAct/ asnfa1AGAH vector (Fig. 10). The size of the pAct/SAGAH and pAct/
asnfa1AGAH vector was 7040 and 7400 bp, respectively. Act means 5’ UTR of actin
41
Fig. 10. Vector construction for RNAi in N. fowleri. The pAct/SAGAH and
pAct/asnfa1AGAH vector were derived from the pRNAT–U6.1/Hygro vector. All
promoters in the pRNAT–U6.1/Hygro vector were replaced with 5’ UTR of actin
gene. S, sinfa1-1; A, 5’ UTR of actin gene; G, GFP; H, hygromycin resistance gene.
pRNAT–U6.1/Hygro6549 bp
GFP
Hygr gene
pUCOri
Ampr
gene
U6P
CMV P
SV40P
Multicloning sites
Bam
HI
Asp
718
IK
pnI
Hin
dIII
pAct/SAGAH7040 bp
GFP
Hygr gene
pUCOri
Ampr
gene
sinfa1-1Bam
HI
(17
6 bp
)
Hin
dIII
(2
48 b
p)
Nhe I (706 bp)
5’ UTR of actin Avr II(2460 bp)
Xma I (2923 bp)
5’ UTR of actin
Bgl II (6331 bp)
ssDNA loop asDNAIn vivo
ssRNAloop
asRNA
SV40P
pAct/asnfa1AGAH7400 bp
GFP
Hygr gene
pUCOri
Ampr
gene
asnfa1Bam
HI
(176
bp)
Hin
dIII
(5
43 b
p)
Nhe I (1066 bp)
5’ UTR of actin Avr II(3820 bp)
Xma I (3283 bp)
5’ UTR of actin
Bgl II (6691 bp)
SV40P
42
gene. It has not been used in pathogenic N. fowleri yet. When 5’ UTR cloned into the
pAct/SAGAH vector was applied to this RNAi study, it efficiently transcribed the
GFP and hygromycin resistance gene, which were observed by reverse transcription-
PCR (Fig. 11). On the other hand, GFP gene was not transcribed in N. fowleri
transfected with a pAct/SAGAH vector using a lipid formulated-Lipofectamine 2000
(Invitrogen) compared (Fig. 11A). In other pAct/AGAH, pAct/SAGAH, and pAct/
asnfa1AGAH vector, the hygromycin resistance gene was transcribed by reverse
transcription-PCR (Fig. 11B). However, no fragments were amplified in controls of
untransfected and mock-transfected N. fowleri. These result showed the possibility of
5’ UTR of actin gene as a promoter, and that SuperFect reagent could be used to
transfect a mammalian vector into N. fowleri trophozoites.
The knockdown of an nfa1 gene and Nfa1 protein was observed by northern and
western blotting. When the pAct/SAGAH vector with sinfa1-1 was transfected into N.
fowleri, the nfa1 gene mRNA was significantly knockdowned as compared with
pAct/AGAH vector without sinfa1-1 by northern blot analysis (Fig. 12A).
Surprisingly, in the transfectants of the pAct/asnfa1AGAH vector with asnfa1, the
nfa1 gene mRNA was a little knockdowned. In the study of asnfa1 which was not
cloned into a vector, when asnfa1 was transfected into N. fowleri trophozoites, no
changes were occurred in the level of the nfa1 gene mRNA and Nfa1 protein. It was
suggested that the vector-based system cloned with asnfa1 should be more stable to
knockdown the nfa1 gene mRNA than asnfa1 alone. This suggestion was supported
by quantitative analysis (Fig. 12B). About 30% of the nfa1 gene mRNA was
43
Fig. 11. Feasibility of transfection reagents for transfection into N. fowleri and
gene transcription by reverse transcription-PCR. (A) Reverse transcription-PCR
data of GFP gene from N. fowleri transfected with each vector using Lipofectamine
2000 or SuperFect reagent. pDNA was used as a positive control of plasmid DNA
from E. coli. (B) Reverse transcription-PCR data of hygromycin resistance gene from
N. fowleri transfected with a vector with 5’ UTR of actin gene using SuperFect
reagent. pDNA was used as a positive control of plasmid DNA from E. coli.
M1.65
1.00.85
1024 bp
kb None
pAct/AGAH
pAct/SAGAH
pAct/asn
fa1AGAH
SuperFect
pDNA
Hygromycinresistance gene
M None
pRNAT-U6.1
/Hyg
ro
SuperFec
t
pDNApRNAT-U
6.1/si
nfa1-1/H
ygro
pAct/SAGAH
Lipofecta
mine2000
pRNAT-U6.1
/Hyg
ro
pRNAT-U6.1
/sinfa1-1
/Hyg
ro
pAct/SAGAH
Lipofectamine 2000 SuperFect
0.65
0.40.5
kb
500 bp
A
B
44
Fig. 12. Northern blotting and quantitative analysis of the nfa1 gene mRNA
from N. fowleri trophozoites transfected with the RNAi vector. (A) Northern
blotting of the nfa1 or nfa2 gene mRNA with a gene-specific probe. 25 µg of the
mRNA samples were loaded. (B) Quantitative analysis of fig. 5A. N. fowleri
trophzoites were transfected using SuperFect reagent.
None
pAct/AGAH
pAct/SAGAH
pAct/as
nfa1AGAH
SuperFect
Probe
nfa1
nfa2
95.799.9
40.8
70.7
100
Qua
ntity
of a
n N
fa1
prot
ein
(%)
20
40
60
80
100
None
pAct
/AG
AH
Supe
rFec
t
pAct
/SAG
AHpA
ct/a
snfa
1AG
AH
A B
45
knockdowned in N. fowleri transfected with the pAct/asnfa1AGAH vector. In the
transfection of the pAct/SAGAH vector, the nfa1 gene mRNA was higher
knockdowned with about 60% than in the pAct/asnfa1AGAH vector. By western blot
analysis, identical patterns of the Nfa1 protein were shown (Fig. 13). The Nfa1
protein from N. fowleri transfected with a pAct/SAGAH vector was knockdowned
with about 28% compared with N. fowleri transfected with a pAct/asnfa1AGAH
vector with about 17% (Fig. 13B). However, the level of the Nfa1 protein was more
increased about 29% in the pAct/SAGAH vector and 12% in the pAct/asnfa1AGAH
vector than that of the nfa1 gene mRNA. This increased result was similar with the
effect of dsnfa1 and asnfa1 without cloning into a vector. There were no changes in
the level of the Nfa1 protein from the controls of a pAct/AGAH vector and
SuperFect alone and Nfa2 protein used to normalize or prove Nfa1 protein-specific
(Fig. 13A). The results supported that the RNAi vectors should be transfected into N.
fowleri trophzoites using SuperFect reagent and used to knockdown the specific
genes.
E. Expression of an Nfa1 protein in N. fowleri transfected with a RNAi vector
Immunocytochemistry was used to observe the knockdown of a Nfa1 protein in
N. fowleri transfected with a pAct/SAGAH or pAct/asnfa1AGAH vector.
46
Fig. 13. Western blotting and quantitative analysis of the Nfa1 protein from N.
fowleri trophozoites transfected with the RNAi vector. (A) Western blotting of the
Nfa1 or Nfa2 protein detected with a respective polyclonal antibody. 10 µg of the N.
fowleri lysate was loaded. (B) Quantitative analysis of fig. 5A. N. fowleri trophzoites
were transfected using SuperFect reagent.
None
pAct/AGAH
pAct/SAGAH
pAct/asn
fa1AGAH
SuperFect
Probe
nfa1
nfa2
99.9 99.9
71.7
82.5
100
Qua
ntity
of a
n N
fa1
prot
ein
(%)
20
40
60
80
100
None
pAct/
AGAH
Supe
rFec
t
pAct/
SAGAH
pAct/
asnf
a1AGAH
A B
47
Prior to IFA test, the GFP expression of N. fowleri transfected with a RNAi vector
mentioned above was observed under immunofluorescence microscope (data not
shown). It was observed very weakly in N. fowleri transfected with the vector. When
the transfection efficiency was analyzed with fluorescence activated cell sorting
(FACS), 0.10 ~ 0.24% N. fowleri showing weak or strong GFP fluorescence was
observed (data not shown). Although the transfection efficiency was very low,
fluorescent N. fowleri trophozoites were sorted using FACS followed by
immunocytochemistry. After N. fowleri trophozoites were fixed by 10% formalin
and permeabilized, they were treated with the anti-Nfa1 antibody, followed by
rhodamine-conjugated anti-IgG antibody. The fluorescence of red colored-rhodamine
of the Nfa1 protein was observed under a fluorescence microscopy (Fig. 14). N.
fowleri trophozoites transfected with the pAct/SAGAH vector showed the weakest
fluorescence among other samples. The fluorescence of N. fowleri transfected with
the pAct/asnfa1AGAH vector was a little stronger than that transfected with
pAct/SAGAH vector. Other samples as controls showed the strongest fluorescence.
These results were similar patterns with northern or western blotting by RNAi
vectors.
48
Fig. 14. The fluorescence of the Nfa1 protein by immunocytochemistry. N.
fowleri trophozoites were treated with the anti-Nfa1 polyclonal antibody, followed
by rhodamine-conjugated anti-IgG. (A) Untransfected N. fowleri. (B) N. fowleri
transfected with a pAct/AGAH vector. (C) N. fowleri transfected with a
pAct/SAGAH vector. (D) N. fowleri transfected with a pAct/asnfa1AGAH vector.
(E) mock-transfected N. fowleri. × 400.
A B C
D E
None pAct/AGAH pAct/SAGAH
pAct/asnfa1AGAH SuperFect
49
F. In vitro cytotoxicity of N. fowleri transfected with a RNAi vector
To test whether an nfa1 gene-knockdowned N. fowleri trophzoites could destroy
murine macrophages, the in vitro cytotoxicity was performed by LDH release assay,
where a red color represents the extent of in vitro cytotoxicity. LDH is released from
destroyed mammalian cells. All transfected or untransfected N. fowleri trophozoites
were maintained with the Nelson medium containing hygromycin (100 µg /ml). As
experimental time increased, murine macrophages were severely damaged by
untransfected N. fowleri, but murine macrophages cocultured with N. fowleri
transfected with a pAct/SAGAH or pAct/asnfa1AGAH vector were less damaged for
17 h and 24 h than murine macrophages cocultured with N. fowleri transfected with a
control, pAct/AGAH vector (Table 1). The calculated cytotoxicity of untransfected N.
fowleri was highest, with a mean of 67% for 17 h and 89% for 24 h. The cytotoxicity
of N. fowleri transfected with the pAct/SAGAH vector was about 40% for 17 h and
52% for 24 h, lower than that of untransfected N. fowleri (t test; P < 0.01). The
inhibition of the cytotoxicity of N. fowleri transfected with the pAct/AGAH vector
was not occurred. The in vitro cytotoxicity of N. fowleri with added hygromycin
antibiotics showed no differences from that of normal N. gruberi. Therefore, an
increase in the cytotoxicity of N. fowleri transfected with the pAct/SAGAH vector
was not the result of hygromycin antibiotics selection. These results show that N.
fowleri trophozoites knockdowned with the nfa1 gene be inhibited in the cytotoxicity
against murine macrophages.
50
Table 1. In vitro cytotoxicity of N. fowleri against murine macrophages.
66.9 ± 0.5
59.1 ± 2.6
40.9 ± 0.2
66.2 ± 0.1
66.5 ± 2.2
67.3 ± 5.0
17 h 24 hMacrophagea
89.1 ± 4.2Macrophage + N. fowlerib ----------------------------------------------------------
52.9 ± 0.8Macrophage + N. fowleri transfected with a pAct/SAGAH vector ----------
79.1 ± 1.1Macrophage + N. fowleri transfected with a pAct/asnfa1AGAH vector ----
86.4 ± 0.2Macrophage + N. fowleri transfected with only SuperFect reagent ----------
85.1 ± 2.6Macrophage + N. fowleri transfected with a pAct/AGAH vector ------------
85.7 ± 3.1Macrophage + N. fowleri + Hygromycin antibioticsc --------------------------
Cytotoxicity (%)
66.9 ± 0.5
59.1 ± 2.6
40.9 ± 0.2
66.2 ± 0.1
66.5 ± 2.2
67.3 ± 5.0
17 h 24 hMacrophagea
89.1 ± 4.2Macrophage + N. fowlerib ----------------------------------------------------------
52.9 ± 0.8Macrophage + N. fowleri transfected with a pAct/SAGAH vector ----------
79.1 ± 1.1Macrophage + N. fowleri transfected with a pAct/asnfa1AGAH vector ----
86.4 ± 0.2Macrophage + N. fowleri transfected with only SuperFect reagent ----------
85.1 ± 2.6Macrophage + N. fowleri transfected with a pAct/AGAH vector ------------
85.7 ± 3.1Macrophage + N. fowleri + Hygromycin antibioticsc --------------------------
Cytotoxicity (%)
a 5 × 104 cells.b 5 × 104 trophozoites.c 100 μg/ml of hygromycin antibiotics.
Group
51
IV. DISCUSSION
PAME caused by N. fowleri is an acute, fulminant, and rapidly progressing fatal
illness that usually affects children and young adults. The olfactory neuroepithelium
is the route of invasion in PAME due to N. fowleri. Invasions of the olfactory mucosa
and the olfactory bulbs, with hemorrhagic necrosis of both cerebral gray and white
matters and an acute inflammatory infiltrate, are the histopathologic characteristics
(Maritra et al., 1976). Naegleria has an intranuclear mitosis, called promitosis,
following the classical pattern of chromosome separation, but the chromosomes are
too small to be counted by conventional histological techniques (Fulton, 1970).
However, it has been possible to enumerate the chromosomes with the use of pulsed
field gel electrophoresis. The number of chromosomes and their size differ between
species and even between strains of the same species. Two stains of N. gruberi sensu
lato have 23 chromosomes, but the size of some chromosomes differs (Clark et al.,
1990). The ploidy of the Naegleria genome is still not known. The sum of the
chromosome sizes (approximately 19 Mb) does not equal the expected genome size
(approximately 104 Mb), which indicates that Naegleria might be polyploidy (Clark
et al., 1990). Isoenzyme studies of Naegleria spp. usually imply diploidy (Cariou and
Pernin, 1987). These organisms have been long recognized as attractive models for a
variety of studies in basic cellular and molecular biology. They have a relatively
large size, rapid growth in axenic culture, active motility and phagocytosis, and they
52
exhibit unicellular differentiation. Despite the attractiveness of Naegleria, it has been
underutilized as a model system. So far there has been no evidence for sexual
reproduction. Therefore, classical mapping and genetic analysis is limited. The
earliest stage post-inoculation of N. fowleri was 24 h (Jarolim et al., 2000). As the
recent study (Rojas-Hernández et al., 2004), the events occurring during the first 8 h
post-inoculation are as follows: N. fowleri trophozoites make contact with the surface
of the mucous layer of the olfactory epithelium; some of them move across the
mucous layer and reach the apical pole of the epithelial cells, apparently without
disruption and/or depletion of the mucosa. Several trophozoites are eliminated by
being embedded in the mucous layer that sometimes forms a lump containing
inflammatory cells. The binding of N. fowleri trophozoites to the mucous layer can
be mediated by specific cell surface lectins that recognize carbohydrates in mucin
glycoproteins, as has been described during intestinal colonization by Entamoeba
histolytica (Chadee et al., 1987, 1988). The binding of N. fowleri trophozoites to
mucins may facilitate the adhesion and invasion of the parasite. After 96 h, N. fowleri
trophozoites in the olfactory bulb were abundant, suggesting that they have
proliferated. Furthermore, abundant inflammatory cells and severe tissue damage
were found. This damage could be provoked by both N. fowleri and neutrophils.
Trophozoites may invade and enhance tissue damage by releasing cystein proteases
and other enzymes which degrade components of the extracellular space and have a
cytopathic effect on mammalian cells (Aldape et al., 1994). In Acanthameoba of
same free-living amoeba, the mechanism by which Acanthamoeba produces
53
granulomatous amoebic encephalitis and amoebic keratitis (AK) has not been fully
elucidated. However, it is generally accepted that the two major predisposing factors
in the pathogenesis of AK are minor corneal trauma caused by contact lens wear or
other noxious agents and exposure to contaminated solutions including lens care
products and tap water (Kilvington et al., 2004; Larkin et al., 1990). The adhesion of
parasites to the host cells is clearly a critical first step in the pathogenesis of infection
(Moore et al., 1991; Panjwani et al., 1997; van Klink et al., 1992). Subsequent to
adhesion, the parasites produce a potent cytopathic effect leading to target cell death
(Cao et al., 1998; De Jonckeere, 1980; Larkin et al., 1991; van Klink et al., 1992).
That the Acanthamoeba may adhere to host cells via a carbohydrate-binding protein
has been suggested by studies demonstrating that: (i) the adhesion of Acanthamoeba
to corneal epithelial cells in culture as well as to the surface of the corneal buttons
can be inhibited by free methyl-α-mannopyranoside (α-Man) but not by a number of
other sugars (Cao et al., 1998; Morton et al., 1991; Panjwani et al., 1997; Yang et al.,
1997), (ii) Acanthamoebae bind to a neoglycoprotein, mannosylated-bovine serum
albumin but not to galactose-bovine serum albumin (Cao et al., 1998), (iii) mannose-
related saccharides that inhibit amoeba binding to corneal epithelial cells are also
potent inhibitors of the amoeba-induced cytopathic effect (Cao et al., 1998). In
addition, preliminary studies have shown that Acanthamoebae express a putative
mannose-binding protein (MBP) of 136 kDa (Yang et al., 1997). These findings
suggest that the adhesion of Acanthamoeba to the corneal surface is mediated by
interactions between a mannose-specific lectin on the surface of the amoeba and
54
mannose residues of glycoproteins of corneal epithelium, and that the mannose-
mediated cross-talk between amoeba and corneal epithelial cells is a key component
of the Acanthamoeba-induced cytopathic effect. On the mechanism of pathogenicity
of N. fowleri, the adherence of the amoeba to host cells is most important, and the
specific pseudopodial projection, so called as amoebastome, is formed (Derr-Harf
and De Joncheere, 1984). In addition, it was reported that killing of host cells is
mediated by a pore-forming peptide known as amoebapore (Herbst et al., 2002) and
proteolysis of the host’s extracellular matrix is mediated by cysteine proteinases
(Aldape et al., 1994). We previously reported that the Nfa1 protein expressed from
nfa1 gene was located in pseudopodia and around vacuoles (Shin et al., 2001). When
CHO target cells were cocultured with N. fowleri trophozoites, the Nfa1 protein was
specifically localized at amoebastomes of phagocytic evidence (Kang et al., 2005). It
powerfully supported that the Nfa1 protein might be related with the cytotoxicity of
N. fowleri. Moreover, the treatment of anti-Nfa1 antibody decreased the cytotoxicity
of N. fowleri against CHO cells (Jeong et al., 2004). Recently, to elucidate an Nfa1
protein with cytotoxicity of transgenic N. gruberi to CHO cells, transfection study
was performed (Jeong et al., 2005). N. gruberi trophozoites were transfected with a
pEGFP–C2/nfa1UTR vector, and the trophozoites induced in vitro cytotoxicity to
CHO cells. And also, the treatment of anti-Nfa1 antibody to transgenic N. gruberi
decreased the cytotoxicity to CHO cells.
In Naegleria, because of the presence of multiple copies of the genome, it is
difficult to study gene function in N. fowleri by classical genetical methods or to
55
isolate mutants. Mammalian gene function has been determined traditionally by
methods such as disruption of murine genes, the introduction of transgenes, the
molecular characterization of human hereditary diseases, and targeting of genes by
antisense or ribozyme techniques. In addition, microinjection of specific antibodies
into cultured cells or binding of antibodies to cell surface-exposed receptors may
provide information on the function of the targeted protein. A new alternative to
these reverse genetic approaches has now become available with the discovery of
small interfering RNAs, which are able to trigger RNA interference in mammalian
somatic cells (Caplen et al., 2001; Elbashir et al., 2001). RNAi is a sequence-specific
posttranscriptional gene silencing mechanism, which is triggered by dsRNA and
causes degradation of mRNAs homologous in sequence to the dsRNA (Fire et al.,
1988; Montgomery et al., 1998). Our strategy involves the use of antisense RNA or
dsRNAi, which have been used effectively in other protozoa, E. histolytica (Kaur and
Lohia, 2004), Leishmania donovani (Zhang and Matlashewski, 2000), Trypanosoma
brucei (Tschudi et al., 2003), Plasmodium falciparum (Malhotra et al., 2002), and
other organisms.
In the present study, to observe the association of an Nfa1 protein with
cytotoxicity of N. fowleri infection, we have applied antisense RNA or dsRNA
interference strategy to the nfa1 gene, which is post-transcriptional gene silencing
mechanism, to knockdown an nfa1 gene and the Nfa1 protein. When antisense RNA
or dsRNA of the nfa1 gene was transfected into N. fowleri trophozoites, the nfa1
gene and the Nfa1 protein were efficiently knockdowned. However, dsRNA
56
transfection was more effective than antisense RNA transfection. In other words, the
effect of dsRNA using RNAiFect transfection reagent was higher about 45% in an
nfa1 gene and 29% in an Nfa1 protein than antisense RNA. It was presumed that
exogenously transfected antisense RNA should be unstable. The fact that dsRNA
induced to knockdown the nfa1 gene supported that RNAi mechanism should be in N.
fowleri trophozoites. Initially, dsRNA have to be excised by enzyme, e.g.,
RNAaseIII-like endonuclease to form siRNAs to specifically knockdown a gene. It
was supported that endonuclease identically functioning with RNAaseIII-like
endonuclease should be in N. fowleri trophozoites. There was no change in the level
of an nfa2 mRNA and Nfa2 protein used to normalize and show specific function.
The nfa2 gene was cloned by immunoscreening with immune and infected sera
identically used for the nfa1 gene in our previous study (Jeong et al., 2004). It was
homologous to calcineurin B gene related with signal transduction. The reason why
the nfa2 gene was used to normalize and show specific function was that any house-
keeping gene like glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in
mammalian cells has not yet been cloned in pathogenic N. fowleri trophozoites. The
quantity of the nfa2 mRNA and Nfa2 protein has no changes, although dsRNA
treatment has the possibility of nonspecific function, which supported that dsRNA
and antisense RNA of the nfa1 gene was specifically functioned in N. fowleri
trophozoites. Using siRNAs, although dsRNA of nfa1 gene ORF was processed to
siRNAs, all siRNAs did not function identically. However, a randomly chosen
sinfa1-1 of nfa1 gene was more effective with about 13.8 ~ 24.6% than sinfa1-2,
57
sinfa1-3, and sinfa1-4. The sinfa1-1 was corresponded to nucleotides 340–360 closed
by ending codon of the nfa1 gene. There were no changes in the level of the nfa2
gene and Nfa2 protein in this siRNA transfection study. In vitro cytotoxicity
experiment was performed with the nfa1 gene knockdowned-N. fowleri trophozoites
against murine macrophages. When N. fowleri transfected with dsRNA or sinfa1-1 of
the nfa1 gene was applied for the in vitro cytotoxicity, we could not observe the
obscure inhibition of cytotoxicity of the amoeba. Thus, we applied a vector-based
system of plasmid to transfect into N. fowleri trophozoites. The vector-based system
supplies more stable system and marker select transfected N. fowleri. A pRNAT–
U6.1/Hygro vector was used, and it carries GFP and hygromycin selectable marker
transcriptable by viral promoters. In particular, U6.1 is a promoter from human and
can efficiently transcript short RNAs. When a pRNAT–U6.1/Hygro vector was
transfected into N. fowleri, we could observe neither GFP fluorescence (data not
shown) nor any fragment transcripted by a viral promoter using reverse transcription-
PCR. Therefore, viral promoters and U6.1 promoter were replaced with 5’ UTR of an
actin gene in nonpathogenic N. gruberi by cohesive ligation to make a pAct/SAGAH
vector. When the vector was transfected into N. fowleri trophzoites, the nfa1 gene
and Nfa1 protein efficiently were knockdowned. Moreover, the GFP gene and
hygromycin resistance gene transcript were observed by reverse transcription-PCR.
Also, we observed the weak GFP fluorescence in the transfected N. fowleri. Even
though it was done so, it was supported that 5’ UTR of an actin gene could be used as
a promoter to transcript siRNA of sinfa1-1 in a pAct/SAGAH vector. In addition, a
58
pAct/asnfa1AGAH vector transcriptable to antisense RNA of the nfa1 gene was
cloned to compare with a pAct/SAGAH vector. There was no GFP fluorescence in
transfected N. fowleri until five days of transfection with a pAct/SAGAH or
pAct/asnfa1AGAH vector. We did not observe any amplified fragment by reverse
transcription-PCR using even 1 µg of cDNA. The result was different from general
transfection data in mammalian cells or other protozoa. In our transfection system,
GFP fluorescence, and GFP and hygromycin resistance gene transcript were detected
since six days of the transfection. In particular, the nfa1 gene mRNA and Nfa1
protein were efficiently knockdowned in N. fowleri transfected with a pAct/SAGAH
vector. In the case of a pAct/asnfa1AGAH vector, the knockdown effect was less
than a pAct/SAGAH vector. The nfa1 gene mRNA and Nfa1 protein in N. fowleri
transfected with the pAct/SAGAH vector were knockdowned with about 60% and
30%, respectively. On the other hand, by the pAct/asnfa1AGAH vector, the nfa1
gene mRNA and Nfa1 protein were knockdowned with about 30% and 18%,
respectively. There were no changes in the nfa2 gene and Nfa2 protein. Following
the observation of the nfa1 gene and Nfa1 protein knockdown, the transfected N.
fowleri trophozoites were selected with hygromycin antibiotics. After N. fowleri
trophzoites were selected with hygromycin antibiotics two times, they were used to
experiment in vitro cytotoxicity against macrophages, which have similar
characteristics with murine microglial cells of target cells by the infection of N.
fowleri. In our previous study, in vitro cytotoxicity of other free-living amoeba, A.
culbertsoni, was performed with primary cultured rat microglial cells (Shin et al.,
59
2001). Recently, in vitro cytotoxicity of N. fowleri was performed with primary
cultured rat microglial cells (unpublished). Because it was difficult in obtain
sufficient numbers of primary cultured rat microglial cells, and CHO target cells
often used for in vitro cytotoxicity did not have characteristics similar to microglial
cells, immortalized murine macrophages were used in this study. Almost all (89% at
24 h) macrophages cocultured with N. fowleri at a ratio of 1 to 1 were destroyed,
whereas N. fowleri transfected with a pAct/SAGAH and pAct/asnfa1AGAH vector
destroyed 52.9% and 79.1% of macrophages at 24 h, respectively. However, the
cytotoxicity of N. fowleri transfected with a pAct/AGAH vector as a control vector,
was about 66.5% at 17 h and 85.7% at 24 h, which was little difference with the
cytotoxicity of normal N. fowleri. Moreover, the in vitro cytotoxicity of N. fowleri
with added hygromycin antibiotics showed no difference from that of normal N.
fowleri. Therefore, the decrease in the cytotoxicity of N. fowleri transfected with a
pAct/AGAH or pAct/asnfa1AGAH vector was not the result of G418 selection. The
lower cytotoxic effect of transgenic N. fowleri transfected with a pAct/AGAH or
pAct/asnfa1AGAH vector suggests that Nfa1 protein contributes to in vitro
cytotoxicity against macrophages.
60
V. CONCLUSION
In the present study, to observe whether the nfa1 gene could be related with in
vitro cytotoxicity, an nfa1 gene and Nfa1 protein were knockdowned in pathogenic N.
fowleri using RNAi strategy. By synthetic dsRNA of the nfa1 gene ORF, the
expression of nfa1 gene and the Nfa1 protein were knockdowned about 50% and
30%, respectively. However, the exoression of nfa1 gene and the Nfa1 protein by in
vitro transcribed asRNA were not highly knockdowned as dsRNA of nfa1 gene. Four
synthetic siRNAs were not act equally, but sinfa1-1 was the highest effective for
knockdown of the expression of nfa1 gene and Nfa1 protein with 70% and 43%,
respectively. However, N. fowleri trophozoites transfected with synthetic dsRNA or
sinfa1-1 did not highly induce in vitro cytotoxicity against murine macrophages as
compared with normal N. fowleri trophozoites. Therefore, a vector-based system, in
which transfected genes can be maintain longer, was used to transfect the nfa1 gene
into N. fowleri. A pAct/SAGAH vector with sinfa1-1 and a pAct/asnfa1AGAH
vector with asRNA of the nfa1 gene ORF to transcribe efficiently selective marker
genes were cloned and transfected into N. fowleri. The expression of nfa1 gene and
Nfa1 protein were efficiently knockdowned about 60% and 29%, respectively by a
pAct/SAGAH vector, as compared with a pAct/asnfa1AGAH vector of 30% in the
nfa1 gene and 18% in Nfa1 protein. In particular, the in vitro cytotoxicity of N.
fowleri transfected with a pAct/SAGAH vector against macrophages were decreased
61
with 26.6% at 17 h and 26.8% at 24 h in comparision with normal N. fowleri and N.
fowleri transfected with a pAct/AGAH control vector. Also, the in vitro cytotoxicity
by a pAct/asnfa1AGAH vector was decreased with 7.4% at 17 h and 6.6% at 24 h.
These results suggest that the mechanism of RNAi should be worked in N. fowleri
trophozoites. Therefore, single stranded RNA, dsRNA, siRNA and siRNA-vector
were not only efficiently transfected into N. fowleri using each transfection reagent
but also the Nfa1 protein play very important role in destroying macrophages.
62
REFERENCES
1. Aldape K, H Huizinga, J Bouvier, J McKerrow: Naegleria fowleri:
Characterization of a secreted histolytic cysteine protease. Exp Parasitol 78:230–
241, 1994
2. Bass BL: Double-Stranded RNA as a Template for Gene Silencing. Cell 101:235–
238, 2000
3. Baulcombe DC: Viruses and gene silencing in plants. Arch Virol Suppl 15:189–
201, 1999
4. Bender J: RNA Silencing and DNA Methylation in Plants. Cell 106:129–132,
2001
5. Bernstein E, AA Caudy, SM Hammond, GJ Hannon: Role for a bidentate
ribonuclease in the initiation step of RNA interference. Nature 409:363–366,
2001
6. Bosher JM, P Dufourcq, S Sookhareea, M Labouesse: RNA interference can target
pre-mRNA: Consequences for gene expression in a Caenorhabditis elegans
operon. Genetics 159:1245–1256, 1999
7. Bradford MM: A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem
7:248−254, 1976
8. Brown T: Observation by immunofluorescence microscopy on the
63
cytopathogenicity of Naegelria fowleri in mouse embryo-cell cultures. J Med
Microbiol 12:363−371, 1979
9. Cao Z, DM Jefferson, N Panjwani: Role of Carbohydrate-mediated adherence in
cytopathogenic mechanisms of Acanthamoeba. J Biol Chem 273:15838−15845,
1998
10. Caplen NJ, S Parrish, F Imani, A Fire, RA Morgan: Specific inhibition of gene
expression by small double-stranded RNAs in invertebrate and vertebrate
systems. Proc Natl Acad Sci USA 98:9742–9747, 2001
11. Cariou ML, P Pernin: First evidence for diploidy and genetic recombination in
free-living amoebae of the genus Naegleria on the basis of electrophoretic
variation. Genetics 115:265−270, 1987
12. Carter RF: Description of Naegleria sp. Isolated from two cases of primary
amoebic meningoencephalitis, and the experimental pathological changes
induced by it. J Pathol 100:217−244, 1970
13. Carter RF: Primary amoebic meningoencephalitis: clinical, pathological and
epidemiological features of six fatal cases. J Pathol Bacteriol 96:1−25, 1968
14. Carter RF: Primary amoebic meningo-encephalitis. An appraisal of present
knowledge. Trans R Soc Trop Med Hyg 66:193−213, 1972
15. Chadee K, WA Petri, DJ Innes, JI Ravdin: Rat and human colonic mucins bind to
and inhibit adherence lectin of Entamoeba histolytica. J Clin Invest
80:1245−1254, 1987
64
16. Chadee K, ML Johnson, E Orozco, WA Petri, JI Ravdin: Binding and
internalization of rat colonic mucins by the galactose/N-acetyl-D-galactosamine
adherence lectin of Entamoeba histolytica. J Infect Dis 158:398−406, 1988
17. Cho MS, SY Jung, S Park, KH Kim, HI Kim, SH Sohn, HJ Kim, KI Im, HJ Shin:
Immunological characterizations of a cloned 13.1-kilodalton protein from
pathogenic Naegleria fowleri. Clin Diagn Lab Immunol 10:954–959, 2003
18. Clark CG: Genome structure and evolution of Naegleria and its relatives. J
Protozool 37:25–65, 1990
19. Clark CG, EY Lei, C Fulton, GAM Cross: Electrophoretic karyotype and linkage
groups for the amoeboflagellate Naegleria gruberi. J Protozool 37:400–408,
1990
20. Clemens MJ: PKR–A protein kinase regulated by double-stranded RNA. Int J
Biochem Cell Biol 29:945–949, 1997
21. Clemens CJ, Worby CA, Simonson-Leff N, Muda M, Maehama T, Hemmings
BA, Dixon JE: Use of double-stranded RNA interference in Drosophila cell lines
to dissect signal transduction pathways. Proc Natl Acad Sci USA 97:6499–6503,
2000
22. Cogoni C, G Macino: Gene silencing in Neurospora crassa requires a protein
homologous to RNA-dependent RNA polymerase. Nature 399:166–169, 1999
23. Cogoni C, G Macino: Posttranscriptional gene silencing in Neurospora by a
RecQ DNA helicase. Science 286:2342–2344, 1999
24. Cursons RTM, TJ Brown, EA Keyes: Virulence of pathogenic free-living amebae.
65
J Parasitol 64:744–745, 1978
25. De Jonckheere JF: Growth characteristics, cytopathic effect in cell culture, and
virulence in mice of 36 type strains belonging to 19 different Acanthamoeba spp.
Appl Environ Microbiol 39:681–685, 1980
26. De Jonckheere J, H van de Voorde: Comparative study of six strains of Naegleria
with special reference to nonpathogenic variants of Naegleria fowleri. J
Protozool 24:304–309, 1977
27. Derr-Harf C, JF De Joncheere: Isolation of pathogenic Naegleria australiensis
(Amoebida, Vahlkampfiidae) from the Rhine. Protistologica 302:489–494, 1984
28. Eisen D, RC Franson: Acid-active neuraminidases in growth media from cultures
of pathogenic Naegleria fowleri and in sonicates of rabbit alveolar macrophages.
Biochim Biophys Acta 924:369–372, 1987
29. Elbashir SM, J Harborth, W Lendeckel, A Yalcin, K Weber, T Tuschl: Duplexes
of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Nature 411:494–498, 2001
30. Elbashir SM, W Lendeckel, T Tuschl: RNA interference is mediated by 21- and
22-nucleotide RNAs. Genes Dev 15:188–200, 2001
31. Ferrante A: Comparative sensitivity of Naegleria fowleri to amphotericin B and
amphotericin B methyl ester. R Soc Trop Medi Hyg 76:476–478, 1982
32. Fire A, S Xu, MK Montgomery, SA Kostas, SE Driver, CC Mello: Potent and
specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
Nature 391:806–811, 1988
66
33. Fjose A, Ellingsen S, Wargelius A, Seo HC: RNA interference. Mechanism and
applications. Annu Rev Biotechnol 7:31–57, 2001
34. Fraser AG, Kamath RS, Zipperlen P, M Martinez-Campos, M Sohrmann, J
Ahringer: Functional genomic analysis of C. elegans chromosome I by
systematic RNA interference. Nature 408:325–330, 2000
35. Fulton C: Amebo-flgellates as research partners: the laboratory biology of
Naegleria and Tetramitus. In: Meth Cell physiol (Ed. D. M. Prescott). Academic
Press 4:341–476, 1970
36. Grant SR: Dissecting the Mechanisms of Posttranscriptional Gene Silencing. Cell
96:303–306, 1999
37. Hammond SM, E Bernstein, D Beach, GJ Hannon: An RNA-directed nuclease
mediates post-transcriptional gene silencing in Drosophila cells. Nature
404:293–296, 2000
38. Herbst R, C Ott, T Jacobs, T Marti, F Marciano-Cabral, M Leippe: Pore-forming
Polypeptides of the Pathogenic Protozoon Naegleria fowleri. J Biol Chem
277:22353–22360, 2002
39. Hildebrandt M, W Nellen: Differential antisense transcription from the
Dictyostelium EB4 gene locus: Implications on antisense-mediated regulation of
mRNA stability. Cell 69:197–204, 1992
40. Hu Q, HR Henny Jr: An Acanthamoeba polyubiquitin gene and application of its
promoter to the establishment of a transient transfection system. Biochim Biophys
Acta 20:126–136, 1997
67
41. Im KI, HJ Shin: Acanthamoeba sohi, n. sp., a pathogenic Korean isolate YM-4
from a freshwater fish. Korean J Parasitol 41:181–188, 2003
42. Jarolim KL, JK McCosh, MJ Howard, DT John: A light microscopy study of the
migration of Naegleria fowleri from the nasal submucosa to the central nervous
system during the early stage of primary amebic meningoencephalitis in mice. J
Parasitol 86:50–55, 2000
43. Jeong SR, SC Lee, KJ Song, S Park, K Kim, MH Kwon, KI Im, HJ Shin:
Expression of the nfa1 gene cloned from pathogenic Naegleria fowleri in
nonpathogenic N. gruberi enhances cytotoxicity against CHO target cells in vitro.
Infect Immun 73:4098-4105, 2005
44. Jeong SR, SY Kang, SC Lee, KJ Song, KI Im, HJ Shin: Decreasing effect of an
anti-Nfa1 polyclonal antibody on the in vitro cytotoxicity of pathogenic
Naegleria fowleri. Korean J Parasitol 42:35–40, 2004
45. John DT: Primary amebic meningoencephalitis and the biology of Naegleria
fowleri. Annu Rev Microbiol 36:101−23, 1982
46. John DT, TB Cole Jr, RA Bruner: Amebostomes of Naegleria fowleri. J
Protozool 32:12–19, 1985
47. Kadlec V, J Skvarova, L Cerva, D Nebazniva: Virulent Naegleria fowleri in
indoor swimming pool. Folia Parasit (Praha) 27:11−17, 1980
48. Kang SY, KJ Song, SR Jeong, JH Kim, S Park, K Kim, MH Kwon, HJ Shin:
Role of the Nfa1 protein in pathogenic Naegleria fowleri cocultured with CHO
target cells. Clin Diagn Lab Immunol 12:873−876, 2005
68
49. Kaur G, A Lohia: Inhibition of gene expression with double strand RNA
interference in Entamoeba histolytica. Biochem Biophys Res Comm
320:1118−1122, 2004.
50. Ketting RF, TH Haverkamp, HG van Luenen, RH Plasterk: mut-7 of C. elegans,
required for transposon silencing and RNA interference, is a homolog of werner
syndrome helicase and RNaseD. Cell 99:133–141, 1999
51. Kilvington S, T Gray, J Dart, N Morlet, JR Beeching, DG Frazer, M Matheson:
Acanthamoeba Keratitis: The Role of Domestic Tap Water Contamination in the
United Kingdom. Invest Ophthalmol Vis Sci 45:165–169, 2004
52. Lares-Villa F, JF De Jonckheere, DE Moura H, A Recchi-Iruretagoyena, E
Ferreira-Guerrero, G Fernadez-Quintanilla, C Ruiz-Matus, GS Visvesvara: Five
cases of primary amebic meningoencephalitis in Mexicali, Mexico: study of the
isolates. J Clin Microbiol 31:685−688, 1993
53. Larkin DF, M Berry, DL Easty: In vitro corneal pathogenicity of Acanthamoeba.
Eye 5:560−568, 1991
54. Larkin DF, S Kilvington, DL Easty: Contamination of contact lens storage cases
by Acanthamoeba and bacteria. British J Ophthalmol 74:133–135, 1990
55. Lau NC, PL Lee, EG Weinstein, DP Bartel: An abundant class of tiny RNAs with
probable regulatory roles in Caenorhabditis elegans. Science 294:858–862, 2001
56. Lee RC, V Ambros: An extensive class of small RNAs in Caenorhabditis
elegans. Scienc 294:862–864, 2001
57. Ma P, GS Visvesvara, AJ Martinez, FH Theodore, PM Daggett, TK Sawyer:
69
Naegleria and Acanthamoeba infections: Review. Rev Infect Dis 12:490–513,
1990.
58. Malhotra P, Dasaradhi PVN, Kumar A, Mohmmed A, Agrawal N, Bhatnagar RK,
Chauhan VS: Double-stranded RNA-mediated gene silencing of cysteine
proteases (falcipain-1 and -2) of Plasmodium falciparum. Mol Microbiol
45:1245–1254, 2002
59. Maritra SC, PBN Krishna, SC Agarwala, SR Das: Ultrastructure studies on
experimental primary amoebic meningo-encephalitis (PAME) of mouse due to
Naegleria aerobia and Hartmanella culbertsoni. Int J Parasitol 6:489–493, 1976
60. Matzke MA, AJ Matzke, GJ Pruss, VB Vance: RNA-based silencing strategies in
plants. Curr Opin Genet Dev 11:221–227, 2001
61. Montgomery MK, S Xu, A Fire: RNA as a target of double-stranded RNA-
mediated genetic interference in Caenorhabditis elegans. Proc Natl Acad Sci
USA 95:15502–15507, 1998
62. Moore MB, JE Ubelaker, JH Martin, R Silvany, JM Dougherty, DR Meyer, JP
McCulley: In vitro penetration of human corneal epithelium by Acanthamoeba
castellanii: a scanning and transmission electron microscopy study. Cornea
10:291–298, 1991
63. Morton LD, GL McLaughlin, HE Whiteley: Effects of temperature, amebic strain,
and carbohydrates on Acanthamoeba adherence to corneal epithelium in vitro.
Infect Immun 59:3819–3822, 1991
64. Ngo H, C Tschudi, K Gull, E Ullu: Double-stranded RNA induces mRNA
70
degradation in Trypanosoma brucei Proc Natl Acad Sci USA 95:14687–14692,
1998
65. Panjwani N, Z Zhao, J Baum, LD Hazlett, Z Yang: Acanthamoebae bind to rabbit
corneal epithelium in vitro. Invest Ophthalmol Vis Sci 38:1858–1864, 1997
66. Parrish S, J Fleenor, S Xu, C Mello, A Fire: Functional anatomy of a dsRNA
trigger differential requirement for the two trigger strands in RNA interference.
Mol Cell 6:1077–1087, 2000
67. Peng Z, R Omaruddin, E Bateman: Stable transfection of Acanthamoeba
castellanii. Biochim Biophys Acta 22:93–100, 2005.
68. Pussard M, R Pons: Étude des genres Leptomyxa et Gephyramoeba (Protozoa,
Sarcodina). II−Leptomyxa flagellate Goodey. Protistologica 12:307−319, 1979
69. Ralph P, I Nakoinz: Antibody-dependent killing of erythrocyte and tumor targets
by macrophage-related cell lines: enhancement by PPD and LPS. J Immunol
119:950−954, 1977
70. Ratcliff FG, SA MacFarlane, DC Baulcombe: Gene Silencing without DNA:
RNA-Mediated Cross-Protection between Viruses. Plant Cell 11:1207–1216,
1999
71. Rojas-Hernández S, A Jarillo-Luna, M Rodríguez-Monroy, L Moreno-Fierros,
R Campos-Rodríguez: Immunohistochemical characterization of the initial stages
of Naegleria fowleri meningoencephalitis in mice. Parasitol Res 94:31−36, 2004
72. Sagerström CG, HL Sive: A laboratory guide to RNA: Isolation, analysis, and
synthesis (Krieg PA, ed), Wiley-Liss, Inc, New York 83−103, 1996.
71
73. Shin HJ, MS Cho, SY Jung, HI Kim, S Park, HJ Kim, KI Im: Molecular cloning
and characterization of a gene encoding a 13.1 kDa antigenic protein of
Naegleria fowleri. J Eukaryot Microbiol 48:713−717, 2001
74. Shin HJ, MS Cho, SY Jung, HI Kim, S Park, JH Seo, JC Yoo, KI Im: Cytopathic
changes in rat microglial cells induced by pathogenic Acanthamoeba culbertsoni:
morphology and cytokine release. Clin Diag Lab Immunol 8:837–840, 2001
75. Stevens AR, JF De Jonckheere, E Willaert: Naegleria lovaniensis new species:
Isolation and identification of six thermophilic strains of a new species found in
association with Naegleria fowleri. Int J Parasitol 10:51−64, 1980
76. Stougaard P, S Molin, K Nordström: RNAs involved in copy-number control and
incompatibility of plasmid R1. Proc Natl Acad Sci USA 78:6008–6012, 1981
77. Tabara H, A Grishok, CC Mello: RNAi in C. elegans: Soaking in the genome
sequence. Science 282:430–431, 1998
78. Tabara H, M Sarkissian, WG Kelly, J Fleenor, A Grishok, L Timmons, A Fire,
CC Mello: The rde-1 Gene, RNA interference, and transposon silencing in
Caenorhabditis elegans. Cell 99:123–132, 1999
79. Takagi T, Cox JA: Primary structure of myohemerythrin from the annelid Nereis
diversicolor. FEBS Lett 285:25−27, 1991
80. Tang MX, CT Redemann, FC Szoka: In vitro gene delivery by degraded
polyamidoamine dendrimers. Bioconjugate Chem 7:703, 1996.
81. Tavernarakis N, SL Wang, M Dorovkov, A Ryazanov, M Driscoll: Heritable and
inducible genetic interference by double-stranded RNA encoded by transgenes.
72
Nat Genet 24:180–183, 2000
82. Timmons L, A Fire: Specific interference by ingested dsRNA. Nature 395:854,
1998
83. Tomizawa J, T Itoh, G Selzer, T Som: Inhibition of ColE1 RNA primer formation
by a plasmid-specified small RNA. Proc Natl Acad Sci USA 78:1421–1425, 1981
84. Tschudi C, A Djikeng, H Shi, E Ullu: In vivo analysis of the RNA interference
mechanism in Trypanosoma brucei. Methods 30:304–312, 2003
85. Tuschl T, PD Zamore, R Lehmann, DP Bartel, PA Sharp: Targeted mRNA
degradation by double-stranded RNA in vitro. Genes Dev 13:3191–3197, 1999
86. van Klink F, H Alizadeh, GL Stewart, MS Pidherney, RE Silvany, Y He, JP
McCulley, JY Niederkorn: Characterization and pathogenic potential of a soil
isolate and an ocular isolate of Acanthamoeba castellanii in relation to
Acanthamoeba keratitis. Curr Eye Res 11:1207–1220, 1992
87. Vaucheret H, C Beclin, T Elmayan, F Feuerbach, C Godon, JB Morel, P
Mourrain, JC Palauqui, S Vernhettes: Transgene-induced gene silencing in plants.
Plant J 16:651–659, 1998
88. Waterhouse PM, NA Smith, MB Wang: Virus resistance and gene silencing:
killing the messenger Trends Plant Sci 4:452–457, 1999
89. Willaert E: Isolement et culture in vitro des amibes de genre Naegleria. Ann Soc
Belg Med Trop 51:701−708, 1971
73
90. Yang Z, Z Cao, N Panjwani: Pathogenesis of Acanthamoeba keratitis:
carbohydrate-mediated host-parasite interactions. Infect Immun 65:439−445,
1997
91. Yin J, HR Henney Jr: Stable transfection of Acanthamoeba. Can J Microbiol
43:239-244, 1997
92. Young JDE, DM Lowrey: Biochemical and functional characterization of a
membrane-associated pore-forming protein from the pathogenic ameboflagellate
Naegleria fowleri. J Biol Chem 264:1077−1083, 1989
93. Yu JY, SL DeRuiter SL, DL Turner DL: RNA interference by expression of
short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad
Sci USA 99:6047–6052, 2002
94. Zhang WW, G Matlashewski: Analysis of antisense and double stranded RNA
downregulation of A2 protein expression in Leishmania donovani. Mol Biochem
Parasitol 107:315–319, 2000
74
–국문요약–
Antisense RNA를를를를 이용한이용한이용한이용한 병원성병원성병원성병원성자유아메바로부터자유아메바로부터자유아메바로부터자유아메바로부터 클로닝된클로닝된클로닝된클로닝된
nfa1 유전자의유전자의유전자의유전자의 발현억제발현억제발현억제발현억제 시스템시스템시스템시스템
아주대학교 대학원의학과
이 상 철
(지도교수: 신 호 준)
파울러자유아메바 (Naegleria fowleri)에 의한 원발성 아메바성 수막뇌염 (primary
amoebic meningoencephalitis)은 소아나 실험동물에서 급성으로 발병하며 치명적
이다. 파울러자유아메바의 병인기전 및 독성과 연관된 단백질에 관한 보고는
거의 미약하다. 또한, 단백질의 기능을 파악하기 위한 transfection 시스템도 아직
완전히 확립되지 못하였다. 본 연구에서 사용된 병원성 nfa1 유전자는 병원성
파울러자유아메바로부터 immunoscreening 통해 클로닝되었으며, 357 개의 DNA로
구성되어 있다. Nfa1 단백질은 아메바의 위족 특히, food-cup 형성에 관여하는
것으로 알려져 있다. 또한 anti-Nfa1 항체는 파울러아메바의 세포독성을 감소
시키는 효과를 갖고 있다. 따라서 본 연구자는 nfa1 유전자에 대한 antisense
RNA와 siRNA를 이용하여, transfection system의 확립과 더불어 표적세포에 대한
아메바의 세포독성에 있어서 Nfa1 단백질의 연관성을 확인하고자 하였다. 시험관
내에서 합성된 dsRNA에 의해서 nfa1 유전자의발현과 Nfa1 단백질의 생산은 각각
약 50% 및 30%가 억제되었다. 하지만, 시험관 내에서 합성된 antisense RNA에
의해서는 dsRNA에 의한 효과만큼 크지는 않았다. 합성된 네개의 siRNAs들 중
sinfa1-1이 최대의 효과가 있었으며, nfa1 유전자에는 70% 그리고 Nfa1 단백질에
75
는 43%의 억제를 보여주었다. 하지만, 합성된 dsRNA 혹은 sinfa1-1을 transfection
한 파울러자유아메바는 대식세포에 대한 세포독성을 유발하지 않았다. 따라서,
transfection 된 유전자가 더욱 더 세포내에서 오랫동안 유지 될 수 있는 벡터를
이용하여 파울러자유아메바에 transfection하고 세포독성을 관찰하고자 하였다.
sinfa1-1이 클로닝된 pAct/SAGAH와 antisense nfa1 유전자 mRNA가 클로닝된
pAct/asnfa1AGAH 벡터가 이용되었다. pAct/SAGAH 벡터에 의해서 nfa1 유전자의
발현과 Nfa1 단백질 생산이 각각 60% 및 29%가 억제되었고, pAct/asnfa1AGAH
벡터에 의해서 유전자와 단백질이 30% 및 18%가 각각 억제되었다. 특히,
pAct/SAGAH 벡터가 transfection 된 파울러자유아메바는 표적세포인 대식세포와
17 시간 혼합배양에 있어서 대조군들보다 약 26.6% 그리고 24 시간에 있어서 약
26.8%의 세포독성 억제를 보여주었다. pAct/asnfa1AGAH 벡터가 transfection 된
파울러자유아메바에 의해서는 17 시간 혼합배양 하였을때 약 7.4% 그리고 24
시간에 있어서는 약 26.8% 정도의 세포독성이 감소되었다. 본 연구의 결과,
파울러자유아메바의 nfa1 유전자의 antisense RNA를 만들어 벡타를 이용하여
transfection 시킴으로써 nfa1 유전자의 발현을 억제시키는 system을 확립할 수
있었다. 그 결과, 파울러자유아메바의 Nfa1 단백질은 표적세포를 파괴하는데
중요한 역할을 한다는 것을 알 수 있었으며, 이 연구는 파울러자유아메바에 의한
감염기전을 밝히는데 중요한 자료가 될 것이다.
____________________________________________________________________
핵심어: 원발성아메바성수막뇌12130염, N. fowleri, nfa1 gene, RNAi, 세포독성