nbt supplementary vr3 · carboxyfluorescein succinimidyl ester (cfse). primary culture was...

1

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES

Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a,

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

immature dendritic cells harvested from bone marrow; scale bar = 200nm. b, Size

distribution of the diameters of exosomes as measured by NTA peaking at 95nm diameter.

Nature Biotechnology: doi:10.1038/nbt.1807

2

Supplementary Figure 2. Schematic representation of Lamp2b cloning and exosome

pulldown assay. a, Cloning of targeting peptide into Lamp2b between linkers after the

signal peptide. b, The FLAG epitope is expressed on the N-terminus of Lamp2b. As

Lamp2b’s topology in exosomes is unknown, the N-terminus can either be extra-exosomal

(top) or intra-exosomal (bottom) or a mix of both. If some FLAG epitope was located on the

surface of exosomes, the exosomes will be pulled down by anti-FLAG beads but not if it

was internal.

a b


3

Supplementary Figure 3. Retention of Cy5 labeled siRNA after electroporation with

exosomes. Exosomes were electroporated with siRNA and spun down at 120,000g for 1

hour to pellet the exosomes and encapsulated siRNA. The exosomes were then lysed in

pure water and siRNA fluorescence assayed with excitation 560nm and emission 610nm on

a fluorescent plate reader. a and b, Percentage of labeled siRNA retained after a, 3µg of

siRNA was electroporated with 3µg protein equivalent of RVG-exosomes in 200µl of buffer

at the settings shown on the x-axis. ‘Unelectroporated’ refers to RVG-exosomes mixed with

siRNA without electroporation and spun down in a fashion similar to the other samples; b,

3µg of siRNA was electroporated with 3µg protein equivalent of RVG-exosomes at 400V

125µF in the volume of buffer shown on the x-axis. All experiments were performed in

duplicate.


4

Supplementary Figure 4. In vitro delivery of siRNA with targeted exosomes. a, Size

distribution of electroporated RVG-exosomes as measured by NTA peaking at 84nm

diameter; b, Electron micrograph of phosphotungstanic acid-stained RVG-exosomes; scale

bar = 200nm. c-d, qPCR of cyclophilin B (PPIB) normalised against 18S in Neuro2A cells

and C2C12 cells 2 days after application of medium (Control), siRNA delivered with

lipofectamine 2000 (siRNA+LP), unmodified exosomes (Exosomes), MSP-exosomes (MSP

exos) or RVG-exosomes (RVG exos). * and ** indicates p < 0.05 and p < 0.01 vs untreated

control respectively. All experiments were performed in triplicate and each repeat was

carried out with a new batch of exosomes to internalize batch-to-batch variation. For

graphs, data are means and s.d.


5

Supplementary Figure 5. Toxicity and immunogenicity of exosomes in vitro. a, b, MTT assay performed 2 days after Neuro2A or C2C12 cells were incubated with unmodified (Exosome), MSP- or RVG- exosomes without electroporation or transfection, the same exosomes electroporated with siRNA (elect) or ‘transfected’ with pEGFP-C1 (GFP). The experiments were conducted in triplicates and error bars indicate standard deviation. c, CD3+ T cell proliferation assay measured in mixed splenocyte culture with carboxyfluorescein succinimidyl ester (CFSE). Primary culture was established from spleens of mouse littermates from which exosomes were derived (syngeneic) and from Balb/C mice (allogeneic). 3µg of unmodified and RVG-exosomes with or without 3µg of GAPDH siRNA was used, with Concanavalin A (ConA) (5µg/ml) was used as a positive control for T cell stimulation. The cells were analysed by FACS assay and representative histograms are shown. x-axis is a log representation of CFSE fluorescence within the cells, y-axis is cell counts. Population shift towards lower fluorescence is indicative of cell proliferation.


6

Supplementary Figure 6. In vivo delivery of siRNA with targeted exosomes. Relative

GAPDH knockdown using qPCR in the striatum, midbrain, cortex, muscle, spleen, liver,

kidney and heart 3 days after intravenous injection of GAPDH siRNA encapsulated in a,

unmodified exosomes or b, MSP-exosomes (see Figure 3 for details). c, GAPDH qPCR of

RNA extracted from the striatum, cortex and midbrain of untreated mice (control) or mice

injected with empty RVG-exosomes intravenously on Day 1 and Day 8 then with RVG-

exosome-encapsulated GAPDH siRNA (150 µg) on Day 22 before sacrificing the mice on

Day 25. 3 mice were injected in each sample group and all error bars reflect standard

deviation (n=3).


7

Supplementary Figure 7. Distribution of Cy3-GAPDH siRNA in the brain. C57BL/6

mice were intravenously injected with 150µg of Cy3-labeled-GAPDH siRNA (red)

encapsulated in 150µg of RVG-exosomes. The brain was harvested after 12 hours and

washed in ice cold PBS before being snap-frozen in dry-ice-chilled isopentane. Transverse

cortical sections were prepared and stained with primary antibodies against NeuN

(neurons), GFAP (astrocytes), Iba1 (microglia), OSP (oligodendrocytes) and NG2


8

(oligodendrocyte precursors), a secondary antibody (green) and DAPI (blue).


9

Supplementary Figure 8. 5’Rapid Amplification of cDNA ends performed on BACE-1

cleavage product. RNA was harvested from cortical sections of the brain of mice injected

with BACE-1 siRNAs encapsulated RVG-exosomes. A RNA linker was ligated to the

unprotected phosphorylated 5’ end of RNA and the product was reverse transcribed using a

specific primer against BACE-1. Using a specific primer for the 5’ linker and the specific

BACE-1 primer, the cDNA was amplified and cloned into TA-cloned into a vector and

sequenced.


10

Supplementary Figure 9. Full-length Western blots


11

Supplementary Table 1. Serum cytokine concentrations (pg/ml) in mice after BACE-1 siRNA treatment. Control siRNA-RVG

exosomes

siRNA-RVG

peptide

siRNA-TR RVG

exosomes

IL-6 0 0 102.9 (± 6) *** 8.1 (± 11.5) 24.8 (± 11.5) *

IFN-α 0.3 (± 1.6) 10.1 (± 11.9) 0 12.73 (± 15) 0

IP-10 445 (± 21.2) 539 (± 281) 510 (± 113) 480 (± 56.9) 415 (± 42)

TNF-α 31.4 (± 16.1) 30.55 (± 16.9) 25.8 (± 8.2) 32.5 (± 12.9) 25 (± 7.8)

Serum cytokine concentrations were measured by ELISA with 50µl of serum. Mice were

injected intravenously with RVG exosomes, 150µg each of two BACE-1 siRNAs

encapsulated in 150µg of RVG-exosomes, complexed with in vivo transfection reagent or

RVG-9R peptide. * and *** indicates p < 0.05 and p < 0.001 vs untreated control. 5 mice

were injected in each sample group and all error bars reflect standard deviation (n=5).


12

Supplementary Table 2. List of primers used.

Primer Sequence

Lamp2b PCR

Lamp5F 5’-atccgctagcggtcgccaccatgtgcctctctccggtt-3’ Lamp5R 5’-gtcactcgagcataaaggcaagtaccctttgaa-3’ Lamp3F 5’-gtcactcgaggtcacatccggaggtgcagaatgggagatgaatttca-3’ Lamp3R 5’-atccggatccttagtgttacagagtctgatatcc-3’

Targeting peptides

RVG F 5’-tcgatacaccatttggatgcccgagaatccgagaccagggacaccttgtgacattttta ccaatagcagagggaagagagcatccaacgggt-3’

RVG R 5’-ccggacccgttggatgctctcttccctctgctattggtaaaaatgtcacaaggtgtccctggtct cggattctcgggcatccaaatggtgta-3’

MSP F 5’-tcgagccagcagcctgaacatcgcct-3’ MSP R 5’-ccggaggcgatgttcaggctgctggc-3’ FLAG F 5’-tcgagattacaaggatgacgatgacaagt-3’ FLAG R 5’-ccggacttgtcatcgtcatccttgtaatc-3’

Quantitative PCR

mGAPDH F mGAPDH R

HK-SY-mo-600 against murine GAPDH (PrimerDesign)

mPPIB F mPPIB R

Mm_PPIB_1_SG_Quantitect Primer Assay (Sigma)

eGFP F 5’-tcttcaagtccgccatgcc-3’ eGFP R 5’-tgtcgccctcgaacttcac-3’

18S F 5’-gtaacccgttgaaccccatt-3’ 18S R 5’-ccatccaatcggtagtagcg-3’


nbt supplementary vr3 · carboxyfluorescein succinimidyl ester (cfse). primary culture was...

Documents