J Cell Physiol. 2020;1–11. wileyonlinelibrary.com/journal/jcp © 2020 Wiley Periodicals, Inc. | 1

Received: 17 July 2019 | Accepted: 9 January 2020

DOI: 10.1002/jcp.29506

OR I G I NA L R E S EA RCH AR T I C L E

miR‐4510 acts as a tumor suppressor in gastrointestinalstromal tumor by targeting APOC2

Yuan Chen1 | Chengkun Qin2 | Xianping Cui2 | Wenmao Geng2 | Guozhe Xian2 |Zhiyi Wang2

1Department of Pediatrics, Shandong

Provincial Hospital Affiliated to Shandong

University, Jinan, China

2Department of Hepatobiliary Surgery,

Shandong Provincial Hospital Affiliated to

Shandong University, Jinan, China

Correspondence

Zhiyi Wang, Department of Hepatobiliary

Surgery, Shandong provincial Hospital

Affiliated to Shandong University, 324 Jingwu

Road, Jinan, 250021 Shandong, P.R. China.

Email: wzy665@163.com

Funding information

Natural Science Foundation of Shandong

Province, Grant/Award Number:

ZR2013HQ026; Key Research and

Development Plan of Shandong Province,

Grant/Award Numbers: 2013G0021810,

2017GSF218035

Abstract

Dysregulation of microRNAs (miRNAs) expression has been demonstrated in

gastrointestinal stromal tumor (GIST). In this study, we aimed to determine the

differential miRNAs expression in GISTs and explore the functional mechanism of

differential miRNAs in GIST cells. We measured differential miRNAs in six pairs of

GIST tissues and matched adjacent tissues through a high‐throughput sequencing,which was confirmed in 64 pairs of GIST tissues and adjacent tissues by real‐time

polymerase chain reaction. We found that miR‐4510 expression was significantly

downregulated in GIST tissues compared to matched control tissues. Luciferase

reporter assay identified apolipoprotein C‐II (APOC2) as a direct target of

miR‐4510. Overexpression of miR‐4510 inhibited the mRNA and protein expression

of APOC2. In addition, overexpression of miR‐4510 suppressed GIST cell

proliferation, migration, and invasion. Overexpression of miR‐4510 also inhibited

the phosphorylation of AKT and ERK1/2, reduced the expression of matrix

metallopeptidase 2 (MMP2) and MMP9. APOC2 knockdown mimicked the effect

of miR‐4510 overexpression. Further investigation confirmed that APOC2 was

notably upregulated in GIST tissues compared to adjacent control tissues. These

results suggested that miR‐4510 downregulation could promote GIST progression,

including growth, invasion, and metastasis, through increasing APOC2 expression.

K E YWORD S

APOC2, gastrointestinal stromal tumor, microRNA, miR‐4510, proliferation

1 | INTRODUCTION

Gastrointestinal stromal tumor (GIST) is commonly characterized

as mesenchymal tumors of gastrointestinal tract (Nannini et al.,

2015). The activating mutations in c‐KIT and platelet‐derivedgrowth factor receptor‐α (PDGFRA) are found in over 80% of

GISTs, which triggers GIST growth (Barnett, Corless, & Heinrich,

2013). Approximately 10% of GISTs without mutations in c‐KITand PDGFRA are called “wild type (wt)” GISTs (Barnett et al.,

2013). Pediatric GISTs and 10–15% of adult GISTs present as wt

GISTs (Weldon et al., 2017). So far, surgical resection is the main

treatment for patients with GIST. However, more than 50%

patients subsequently develop local recurrence and distant

metastasis, leading to fatal prognosis (Joensuu, Hohenberger, &

Corless, 2013). The adjuvant imatinib that targets the tyrosine

kinase c‐KIT has improved the prognosis of GIST patients

with mutations in c‐KIT and PDGFRA after surgery, but

is powerless for wt GISTs (Chen et al., 2017). Therefore, it is

necessary to explore the novel molecular mechanism of GIST

progression.

MicroRNAs (miRNAs) are small noncoding RNAs that

contain 18–25 nucleotides, and regulate gene expression by

binding to the 3′‐untranslated region (3′‐UTR) of targeted

messenger RNAs (mRNAs; Akcakaya et al., 2014). miRNAs have

been widely implicated in tumor progression, including prolifera-

tion, invasion, and metastasis. Recently, miRNAs have been

demonstrated to be critical for the development and progression

of GIST (Akcakaya et al., 2014; Long, Wu, Cai, Wang, & Zhou,

2018; Yun et al., 2018). For example, miR‐221 and miR‐222 are

significantly downregulated in KIT‐positive GIST, and overexpres-

sion of these two miRNAs inhibits proliferation of GIST‐T1 cells by

targeting KIT (Ihle et al., 2015). miR‐374b promotes GIST cell

proliferation by inhibiting phosphatase and tensin homolog (Long

et al., 2018). miR‐182 expression is remarkably elevated in GISTs

compared with adjacent normal tissues, and overexpression of

miR‐182 increased GIST‐T1 cell proliferation and migration by

inhibiting the expression of cylindromatosis (Ling, Yu, & Cao,

2018). These results indicate that dysregulation of microRNAs in

GISTs plays a key role in GIST cells growth, migration, and

invasion.

In this study, we evidenced that miR‐4510 expression was

reduced in GISTs compared with adjacent normal tissues. Over-

expression of miR‐4510 inhibited GIST‐882 cell proliferation,

migration, and invasion by targeting apolipoprotein C‐II (APOC2).

Further investigation showed that APOC2 expression was higher in

GISTs than that in adjacent normal tissues. These results suggested

that downregulation of miR‐4510 might promote the progression of

GISTs by increasing APOC2 expression.

2 | MATERIALS AND METHODS

2.1 | Antibodies and reagents

Anti‐Akt was purchased from Anbo Biotechnology Company

(San Francisco, CA); Anti‐phospho‐Akt (Ser473), anti‐phospho‐ERK1/2, anti‐ERK1/2, anti‐APOC2, anti‐matrix metallopeptidase 2

(MMP2), anti‐MMP9, and anti‐β‐actin were purchased from

Abcam (Cambridge, MA); Cell Counting Kit‐8 was purchased from

Dojindo Laboratories (Tokyo, Japan). miR‐4510 and miR‐4510inhibitor were synthesized by Biosune Biotechnology (Shanghai,

China).

2.2 | Study population

Patients with GIST were recruited from Shandong Provincial Hospital

Affiliated to Shandong University. Sixty four patients received

surgery, of which none received receptor tyrosine kinase inhibitor

therapy before the surgery. All procedures performed in studies

involving human participants were in accordance with the ethical

standards of the Ethics Committee of Shandong provincial Hospital

affiliated to Shandong University and with the 1964 Helsinki

declaration and its later amendments or comparable ethical

standards. Informed consent was obtained from all individual

participants included in the study.

2.3 | Small RNA preparation and analysis

Total RNAs were extracted using TRIzol reagent (Invitrogen), and were

sequentially ligated with RNA 5′ and 3′ adapters. The complementary

DNA (cDNA) constructs were created by reverse transcription followed

by polymerase chain reaction (PCR) amplification. Gel purification was

performed to obtain the amplified cDNA constructs. The small RNA

library was prepared using TruSeq Small RNA Sample Prep Kits

(Illumina, San Diego). The purified cDNA library was prepared for

cluster generation on Illumina's Cluster Station.

Raw reads were subjected to an in‐house program, ACGT101‐miR

(LC Sciences, Houston, TX), to remove adapter dimers, low quality

reads, common RNA families (rRNA, tRNA, snRNA, snoRNA), and

repeats. Subsequently, unique sequences containing 18–26 bases were

mapped to specific species precursors in miRBase 22.0 using a BLAST

search to identify known miRNAs and novel 3p‐ and 5p‐derivedmiRNAs. The mapped sequences were identified as known miRNAs. The

remaining sequences were mapped to other selected species precursors

in miRBase 22.0 by BLAST search. The unmapped sequences were

analyzed by a BLAST search against the specific genomes, and the

sequences containing hairpin RNA structures were predicated from the

flank 80‐nt sequences using RNAfold software (http://rna.tbi.univie.ac.

at/cgi‐bin/RNAfold.cgi).

2.4 | Cell culture

The human GIST‐882 and GIST‐T1 cells were purchased from American

Type Culture Collection (Manassas, VA). Cells were cultured in Roswell

Park Memorial Institute‐1640 medium (HyClone) containing 10% fetal

bovine serum (HyClone) at 37°C in 5% CO2.

2.5 | Gene transfection

GIST‐882 and GIST‐T1 cells were grown in a 96‐well plate at a density of

5.0 × 103 cells/well. After growing overnight, the cells were transfected

with lentivirus carrying short hairpin RNAs (shRNAs) against APOC2

(GeneChem, Shanghai, China). For determining the effect of miR‐4510,GIST‐882 cells were transfected with negative control (NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐4510 mimics (5′‐UGAGGGAGUAGGAUGUAUGGUU‐3′), or anti‐miR‐4510 (5′‐AACCAUACAUCCUACUCCCUCA‐3′) using Lipofectamine 3000 (Invitrogen).

2.6 | Cell viability assay

GIST‐882 and GIST‐T1 cells were grown in 96‐well plates at a

density of 5.0 × 103 cells/well. After gene transfection, the cells

were incubated for indicated time. Sequentially, the cells were

incubated with 10 μl WST‐8 dye for 2 hr at 37°C. The absorbance

was measured at 450 nm using SpectraMax M2.

2 | CHEN ET AL.

2.7 | Flow cytometric analysis

GIST‐882 and GIST‐T1 cells were transfected with NC, miR‐4510,or anti‐miR‐4510 for indicated time. The cells were harvested

using trypsin without ethylenediaminetetraacetic acid and phenol

red, followed by incubation in binding buffer containing Annexin‐V‐fluorescein isothiocyanate (2.5 mg/ml) and propidium iodide

(5mg/ml) for 10min in the dark at room temperature. Sequentially,

cell apoptosis was determined by flow cytometric analysis

(Beckman Coulter, Chicago).

F IGURE 1 Differential microRNA (miRNA) expression in gastrointestinal stromal tumor (GIST) tissues. (a) miRNA expression heatmap of

GIST tissues and matched control tissues. (b) Volcano plot of differentially expressed miRNAs in GIST tissues compared to matched controltissues. (c) Gene Ontology enrichment analyses of the differential miRNAs. (d) The Kyoto Encyclopedia of Genes and Genomes pathwayanalyses of the differential miRNAs

CHEN ET AL. | 3

2.8 | Western blot analysis

Western blot analysis was performed as previously described

(Wang et al., 2017). Equal amounts of protein were subjected

to sodium dodecyl sulfate‐polyacrylamide gel electrophoresis

gels and were transferred onto polyvinylidene fluoride mem-

branes. The membranes were blocked with 5% nonfat milk, and

were then incubated with the indicated primary and secondary

antibodies. The protein signals were determined using the

enhanced chemiluminescence kit and quantified using Scion

Image.

2.9 | Luciferase reporter assay

The sequence between the position 80–270 of APOC2 3′‐UTRwere amplified using forward (5′‐GCATCCAGGACCCAGAAGTT‐3′) and reverse (5′‐AAAGCACAGATGGTTAGAGGGA‐3′) primers,

and was then digested and ligated to pMIR‐REPORT (Promega).

HEK293 cells were cotransfected with 300 ng reporter vector,

20 nM wide type miR‐4510 (miR‐4510 WT), or mutant

miR‐4510 (miR‐4510 MT) using Lipofectamine 3000 (Roche), and

5 ng pRL‐SV40 plasmid (Promega) as a normalizing control.

After 24 hr of incubation, luciferase activities were determined

using the Dual‐Luciferase Assay (Promega) according to the

manufacturer's instructions.

2.10 | Quantitative real‐time polymerase chainreaction

Total RNAs were extracted using TRIzol reagent (Invitrogen).

The expression of differential microRNAs was analyzed using

TaqMan miRNA assays (Applied Biosystems, CA) according to

the manufacturer's instructions. U6 snRNA was used as an

internal control. The mRNA expression of APOC2 was determined

using forward (5′‐TGTGGAGCGGAAGTGGGTC‐3′) and reverse

(5′‐CGGCAGAAAGAGGGTGAGA‐3′) primers.

2.11 | Wound‐healing assay

GIST‐882 and GIST‐T1 cells overexpressing miR‐4510 or anti‐miR‐4510 were seeded in six‐well plates at a density of 2 × 105 cells/well.

F IGURE 2 miR‐4510 was downregulated in GIST tissues. (a) A heatmap of eight differential miRNAs between GIST tissues andmatched control tissues. (b–i) Real‐time polymerase chain reaction (PCR) was performed to determine the expression of miR‐134‐5p,miR‐382‐5p, miR‐323b‐3p, miR‐409‐3p, miR‐1185‐1‐3p, miR‐4510, miR‐3187‐3p, and miR‐29b‐1‐5p in 64 pairs of GIST tissues. GIST,gastrointestinal stromal tumor; miRNA, microRNA

4 | CHEN ET AL.

After reaching approximately 90% confluence, a linear wound was

produced in cell monolayer by a sterile pipette tip. Images were

captured in three defined fields at 0 and 24 hr, respectively. The

closure area of wounds was determined using ImageJ (National

Institutes of Health, Bethesda, MD).

2.12 | Transwell assay

GIST‐882 and GIST‐T1 cells overexpressing miR‐4510 or anti‐miR‐4510 were seeded in upper chamber of 24‐well plates containing

serum‐free medium. The upper chambers were coated with Matrigel

Matrix (1× phosphate buffered saline dilution: 1:5; BD Biosciences).

After 48 hr of incubation, the cells invaded to the lower surface of

the membranes were fixed and strained using crystal violet.

2.13 | Statistical analysis

Statistical analysis was performed using GraphPad Prism 6.0. All data

are presented as the mean ± SD of at least three independent

experiments. Student's t test was used to assess the differences

between two groups. One‐way analysis of variance was used to

assess the differences among multiple groups. p < .05 was considered

to be statistically significant.

3 | RESULTS

3.1 | Differential miRNAs between gastrointestinalstromal tumor tissues and matched control tissues

We first analyzed miRNA expression in six pairs of human GIST tissues

(GIST tissue vs. matched control tissue from the same patients). After

excluding undetectable miRNAs in some tissues, we found 117

differential miRNAs in these six pairs of GIST tissues. Figure 1a shows

a heatmap that represented miRNA profiling. The detail data are shown

in Supporting information. Among these miRNAs, five miRNAs were

significantly upregulated (p < .05) and 15 miRNAs were significantly

downregulated (p < .05) (Figure 1b). Subsequently, Gene Ontology (GO)

enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG)

pathway analyses were performed to assess the functions of these

differential miRNAs. Figure 1c,d reveals the probable biological

functions of targeted genes of these differential miRNAs.

3.2 | miR‐4510 was downregulated in GIST tissues

Among these differential miRNAs, miR‐134‐5p, miR‐382‐5p,miR‐323b‐3p, miR‐409‐3p, miR‐1185‐1‐3p, miR‐4510, and

miR‐3187‐3p were significantly downregulated in each pair of GIST

tissues, whereas miR‐29b‐1‐5p was significantly upregulated

(Figure 2a). We next verified the expression of these eight miRNAs

in 64 pairs of GIST tissues by real‐time PCR. The results showed

that miR‐4510, miR‐323b‐3p, and miR‐409‐3p were significantly

downregulated, and miR‐29b‐1‐5p was significantly upregulated in

GIST tissues (GIST‐T) compared to matched control tissues (GIST‐N;

Figure 2b–e). However, no significant difference was observed

in the expression of miR‐134‐5p, miR‐382‐5p, miR‐1185‐1‐3p,and miR‐3187‐3p between GIST‐T and GIST‐N (Figure 2f–i). The

associations between miR‐4510 expression and the clinicopatholo-

gical parameters are shown in Table 1. There was no significant

association between miR‐4510 expression and age (p = .608),

gender (p = .8987), and mutation status (p = .2283). However,

miR‐4510 expression was significantly associated with tumor

location (p = .048), tumor size (p = .02), mitoses (p = 0.03338), and

risk classification (p < .0001).

3.3 | miR‐4510 overexpression inhibited GIST cellproliferation, migration, and invasion

To determine the function of miR‐4510 in GIST progression,

we tested the effect of miR‐4510 on GIST cell proliferation,

migration, and invasion. The results showed that miR‐4510

TABLE 1 The clinicopathological parameters and expression of

miR‐4510 in gastrointestinal stromal tumor samples

Characteristics Number (%)Median expressionof miR‐4510 p‐value

Age (years)

≤55 30 (46.9) 0.79518 ± 0.39196 .608

>55 34 (53.1) 0.74976 ± 0.51164

Gender

Famale 31 (48.4) 0.77092 ± 0.49808 .8987

Male 33 (46.9) 0.75599 ± 0.43544

Location

Stomach 41 (64.1) 0.75144 ± 0.46545 .048

Small intestine 17 (26.5) 0.92892 ± 0.45066

Other 6 (9.4) 0.45245 ± 0.18037

Tumor size (cm)

≤5 22 (34.4) 0.90936 ± 0.47665 .02

≤10 35 (54.7) 0.75251 ± 0.43877

>10 7 (10.9) 0.35745 ± 0.30834

Mitoses per 50 HPFs

≤5 37 0.84103 ± 0.46408 .03338

>5 27 0.62029 ± 0.45761

Mutation status

Wild type 13 (20.3) 0.70923 ± 0.35799 .2283

c‐kit andmutation

48 (75) 0.78101 ± 0.48134

PDGFRA

mutation

3 (4.7) 0.87436 ± 0.54934

Risk classification

Low 10 (15.6) 1.00728 ± 0.39005 <.0001

Intermediate 15 (23.4) 1.08887 ± 0.37747

High 39 (61) 0.57539 ± 0.41635

Abbreviations: HPF, high‐power field; miR‐4510, microRNA‐4510;PDGFRA, platelet‐derived growth factor receptor‐α

CHEN ET AL. | 5

overexpression suppressed GIST cell proliferation while anti‐miR‐4510 accelerated GIST cell growth compared to negative

control (NC) (Figure 3a). Flow cytometry analysis confirmed that

miR‐4510 overexpression increased GIST cell apoptosis while

anti‐miR‐4510 reduced GIST cell apoptosis compared to NC

group (Figure 3b). Further investigation revealed that miR‐4510overexpression inhibited GIST cell migration and invasion

(Figure 3c,d). These results suggested that downregulation of

miR‐4510 in GIST tissues might contribute to GIST cell

proliferation, migration, and invasion.

F IGURE 3 miR‐4510 inhibited GIST cell proliferation, migration, and invasion. (a) GIST‐882 and GIST‐T1 cells were transfected withnegative control (NC), miR‐4510, or anti‐miR‐4510 for indicated time. Cell Counting Kit‐8 (CCK8) assay was used to determine cell viability.

(b) After GIST‐882 and GIST‐T1 cells were transfected with negative control (NC), miR‐4510, or anti‐miR‐4510 for 72 hr, flow cytometricanalysis was performed to determine cell apoptosis. (c and d) After GIST‐882 and GIST‐T1 cells were transfected with negative control (NC),miR‐4510, or anti‐miR‐4510 for 72 hr, cell migration and invasion were determined by wound‐healing assay and transwell assay.GIST, gastrointestinal stromal tumor

6 | CHEN ET AL.

3.4 | APOC2 was a direct target of miR‐4510

We further identified the targeted genes of miR‐4510. The targeted

genes were predicted by Targetscan (http://www.targetscan.org/). As

shown in Figure 4a, at the position 80–270 of APOC2 3′‐UTR, therewere six binding sites of miR‐4510. The sequences containing these

sites were ligated to pMIR‐REPORT to construct pMIR‐APOC2‐Lucplasmid. HEK293 cells were cotransfected with pMIR‐APOC2‐lucand wild type miR‐4510 (miR‐4510 WT) or mutant type miR‐4510(miR‐4510 MT). The results showed that miR‐4510 WT remarkably

reduced luciferase activities while miR‐4510 MT had no effect

(Figure 4b). Overexpression of miR‐4510 not only suppressed mRNA

and protein expression of APOC2 (Figure 4c,d), but also reduced the

secretion of APOC2 to media (Figure 4e). These results indicated

that APOC2 was a direct target of miR‐4510.

3.5 | APOC2 knockdown inhibited GIST cellproliferation, migration, and invasion

APOC2 knockdown was performed to determine the role of APOC2

in GIST progression. Figure 5a showed that, after transfection with

lentivirus carrying shRNAs against APOC2, APOC2 expression was

significantly reduced in GIST cells. APOC2 knockdown inhibited

GIST cell proliferation (Figure 5b), and restrained GIST cell migration

and invasion (Figure 5c–e), which was similar to the effect of

miR‐4510 overexpression. These results suggested that miR‐4510

might control the proliferation, migration, and invasion of GIST cells

by inhibiting APOC2 expression.

3.6 | miR‐4510 overexpression inhibited thephosphorylation of ERK1/2 and AKT, the expressionof MMP2 and MMP9

To determine the functional mechanism of miR‐4510 and APOC2 in

GIST cells, we tested the effects of miR‐4501 overexpression and

APOC2 knockdown on the phosphorylation of ERK1/2 and AKT as

well as the expression of MMP2 and MMP9 in GIST cells. The results

showed that miR‐4510 overexpression notably reduced the phos-

phorylation of ERK1/2 and AKT, and inhibited the expression of

MMP2 and MMP9, which was consistent with the effect of APOC2

knockdown (Figure 6). These results suggested that miR‐4510 might

regulate the phosphorylation of ERK1/2 and AKT as well as the

expression of MMP2 and MMP9 by directly inhibiting APOC2

expression.

3.7 | APOC2 expression was elevated in GISTtissues

We finally assayed the expression of APOC2 in GIST tissues and the

adjacent normal tissues. The western blot analysis showed that

APOC2 expression was higher in GIST tissues than that in the

F IGURE 4 Apolipoprotein C‐II (APOC2) was a direct target of miR‐4510. (a) The putative binding sites of miR‐4510 in the 3′‐untranslatedregion region of APOC2. (b) HEK293 cells were transfected with wild type miR‐4510 (miR‐4510 WT) or mutant type miR‐4510 (miR‐4510 MT)and pMIR‐APOC2‐luc. The dual‐luciferase assay was used to determine the luciferase activities. (c) GIST‐882 cells were transfected with

miR‐4510 or anti‐miR‐4510 for 72 hr. Real‐time PCR was performed to determine the messenger RNA expression of APOC2. (d and e)Western blot analysis was performed to determine the protein expression of APOC2. PCR, polymerase chain reaction

CHEN ET AL. | 7

adjacent normal tissues (Figure 7a), which was confirmed by real‐time PCR (Figure 7b). The associations between APOC2 expression

and the clinicopathological parameters are shown in Table 2. Despite

no significant association between APOC2 expression and age

(p = .9006), gender (p = .2412), and tumor location (p = .5508), APOC2

expression was significantly associated with tumor size (p = .0066),

mitoses (p = .0031), mutation status (p = .0313), and risk classification

(p = .0481). These results suggested that APOC2 upregulation might

contribute to GIST progression.

4 | DISCUSSION

miRNAs are a class of noncoding RNAs that have been implicated in

multiple tumor processes by suppressing the expression of targeted

genes. Recently, several investigations have been performed to

explore miRNA profiling in GIST tissues. For example, downregula-

tion of miR‐221 and miR‐222 promoted KIT‐positive GIST progres-

sion by increasing KIT expression (Ihle et al., 2015), and miR‐494expression is negatively correlated to KIT expression in GIST (Kim

et al., 2011; Yun et al., 2018). Moreover, upregulation of miR‐196a in

GIST tissues is significantly associated with risk classification and

metastasis (Niinuma et al., 2012). In the present study, we evidenced

that miR‐4510 was downregulated in GIST tissues compared to

matched control tissues. To our knowledge, only one report about

miR‐4510 function has been found. This finding identifies miR‐4510as a suppressor in liver cancer by targeting glypican‐3 (Cartier et al.,

2017). Conformably, our results suggested that miR‐4510 served as a

suppressor in GIST cells. Overexpression of miR‐4510 significantly

inhibited GIST cell proliferation, migration, and invasion. Our results

indicated that miR‐4510 downregulation could propel GIST process.

Further investigation identified APOC2 as a direct target of

miR‐4510. APOC2 is a small protein that is synthesized by the liver

and intestine (Jong, Hofker, & Havekes, 1999). APOC2 acts as an

important component of low‐density lipoproteins, very low‐densitylipoproteins, and high‐density lipoproteins, where it assists to

hydrolyze triglycerides associated with lipoproteins by activating

lipoprotein lipase (LaRosa, Levy, Herbert, Lux, & Fredrickson, 1970).

APOC2 has been demonstrated to be closely associated with survival

of patients with pancreatic cancer (Xue et al., 2012). Elevated APOC2

promotes pancreatic cancer cell growth, migration, and invasion.

Although the role of APOC2 in GIST has never been reported,

considering that APOC2 was a direct target of miR‐4510, it was likely

that APOC2 upregulation accelerated GIST progression. As expected,

F IGURE 5 APOC2 knockdown suppressed GIST cell proliferation, migration, and invasion. (a) GIST‐882 and GIST‐T1 cells were transfectedwith lentivirus carrying short hairpin RNAs (shRNAs) against APOC2 (APOC2 shRNA). Western blot analysis was performed to determine

the protein expression of APOC2. (b) After GIST‐882 and GIST‐T1 cells were transfected with APOC2 shRNA, CCK8 assay was performedto determine the cell viability. (c and d) After GIST‐882 and GIST‐T1 cells were transfected with APOC2 shRNA for 72 hr, cells migrationand invasion were determined by wound‐healing assay and transwell assay. APOC2, apolipoprotein C‐II; CCK8, cell counting kit‐8;GIST, gastrointestinal stromal tumor

8 | CHEN ET AL.

our results showed that APOC2 knockdown inhibited GIST cell

proliferation, migration, and invasion. In addition, APOC2 expression

was significantly higher in GIST tissues than that in adjacent tissues.

These results suggested that elevated APOC2 could promote GIST

progression.

KIT signaling pathway has been demonstrated to be an

effective target of GIST (Ran et al., 2015). KIT can bind some

cytoplasmic proteins to form complex, and then phosphorylates

other proteins, which activates AKT and ERK pathway (Bauer,

Duensing, Demetri, & Fletcher, 2007). The phosphorylation

of AKT and ERK play key roles in GIST cell proliferation and

survival (Bauer et al., 2007; Ihle et al., 2015). Our results showed

that both miR‐4510 overexpression and APOC2 knockdown

inhibited the phosphorylation of AKT and ERK, which explained

the inhibitory effects of miR‐4510 overexpression and APOC2

knockdown on GIST cell proliferation. Moreover, miR‐4510

F IGURE 6 miR‐4510 overexpression

and APOC2 knockdown inhibited thephosphorylation of AKT and ERK1/2, theexpression of matrix metallopeptidase

2 (MMP2) and MMP9. GIST‐882 andGIST‐T1 cells were transfected with NC,miR‐4510, ctrl shRNA, or APOC2 shRNA

for 72 hr. Western blot analysis wasperformed to determine the proteinexpression of phosphorylated AKT,phosphorylated ERK1/2, MMP2, and

MMP9. APOC2, apolipoprotein C‐II;shRNA, short hairpin RNA

F IGURE 7 APOC2 expression waselevated in GIST tissues. The western blot

(a) and real‐time PCR (b) were used todetermine the expression of APOC2expression in GIST tissues and the adjacentnormal tissues. APOC2, apolipoprotein

C‐II; GIST, gastrointestinal stromaltumor; PCR, polymerase chain reaction

CHEN ET AL. | 9

overexpression and APOC2 knockdown also suppressed MMP2

and MMP9 expression. MMP2 and MMP9 have been involved in

metastasis of multiple malignancies (Gao et al., 2015; Lu et al.,

2015; Ma et al., 2016; Ye et al., 2017). Therefore, it was reasonable

that miR‐4510 overexpression and APOC2 knockdown reduced

the migratory and invasive capabilities of GIST cells.

5 | CONCLUSION

Taken together, we provided evidence that miR‐4510 expression

was significantly reduced while APOC2 expression was signifi-

cantly elevated in GIST tissues compared to adjacent control

tissues. Further investigation confirmed that APOC2 was a

direct target of miR‐4510. Overexpression of miR‐4510 inhibited

GIST cell proliferation, migration, and invasion, and blocked the

phosphorylation of AKT and ERK1/2 as well as the expression

of MMP2 and MMP9, which was similar to APOC2 knockdown.

These results suggested that miR‐4510 downregulation could

promote GIST progression, including growth, invasion, and

metastasis, through increasing APOC2 expression.

ACKNOWLEDGMENTS

This study was funded by Natural Science Foundation of Shandong

Province (grant no. ZR2013HQ026) and Key Research and Devel-

opment Plan of Shandong Province (grant nos. 2013G0021810;

2017GSF218035).

CONFLICT OF INTERESTS

The authors declare that there are no conflict of interests.

AUTHOR CONTRIBUTIONS

Y. C. and X. C. carried out the experiments. C. Q. and Z. W.

participated in the experiment design. W. G. and G. X. analyzed the

data and wrote the manuscript. All authors read and approved

the final manuscript.

DATA AVAILABILITY STATEMENT

All data used and/or analyzed during the current study are available

from the corresponding author on reasonable request.

ORCID

Zhiyi Wang http://orcid.org/0000-0002-3254-9132

REFERENCES

Akcakaya, P., Caramuta, S., Ahlen, J., Ghaderi, M., Berglund, E.,

Ostman, A., … Lui, W. O. (2014). microRNA expression signatures

of gastrointestinal stromal tumours: Associations with imatinib

resistance and patient outcome. British Journal of Cancer, 111(11),

2091–2102. https://doi.org/10.1038/bjc.2014.548

Barnett, C. M., Corless, C. L., & Heinrich, M. C. (2013). Gastrointestinal

stromal tumors: Molecular markers and genetic subtypes. Hematology/

Oncology Clinics of North America, 27(5), 871–888. https://doi.org/10.

1016/j.hoc.2013.07.003

Bauer, S., Duensing, A., Demetri, G. D., & Fletcher, J. A. (2007). KIT oncogenic

signaling mechanisms in imatinib‐resistant gastrointestinal stromal

tumor: PI3‐kinase/AKT is a crucial survival pathway. Oncogene, 26(54),

7560–7568. https://doi.org/10.1038/sj.onc.1210558

Cartier, F., Indersie, E., Lesjean, S., Charpentier, J., Hooks, K. B., Ghousein,

A., … Grosset, C. F. (2017). New tumor suppressor microRNAs target

glypican‐3 in human liver cancer. Oncotarget, 8(25), 41211–41226.

https://doi.org/10.18632/oncotarget.17162

Chen, W., Kuang, Y., Qiu, H. B., Cao, Z., Tu, Y., Sheng, Q., … Ou, W. B.

(2017). Dual targeting of insulin receptor and KIT in imatinib‐resistantgastrointestinal stromal tumors. Cancer Research, 77(18), 5107–5117.

https://doi.org/10.1158/0008‐5472.CAN‐17‐0917Gao, Y., Guan, Z., Chen, J., Xie, H., Yang, Z., Fan, J., … Li, L. (2015). CXCL5/

CXCR2 axis promotes bladder cancer cell migration and invasion

by activating PI3K/AKT‐induced upregulation of MMP2/MMP9.

International Journal of Oncology, 47(2), 690–700. https://doi.org/10.

3892/ijo.2015.3041

Ihle, M. A., Trautmann, M., Kuenstlinger, H., Huss, S., Heydt, C., Fassunke,

J., …Merkelbach‐Bruse, S. (2015). miRNA‐221 and miRNA‐222 induce

TABLE 2 The clinicopathological parameters and expression ofAPOC2 in GIST samples

Characteristics Number (%)

Median expression

of APOC2 p‐value

Age (years)

≤55 30 (46.9) 1.80286 ± 0.76471 .9006

>55 34 (53.1) 1.76616 ± 1.43092

Gender

Famale 31 (48.4) 1.9596 ± 1.35347 . 2412

Male 33 (46.9) 1.6178 ± 0.93081

Location

Stomach 41 (64.1) 1.89554 ± 1.35335 .5508

Small intestine 17 (26.5) 1.5278 ± 0.62096

Other 6 (9.4) 1.7409 ± 0.83431

Tumor size (cm)

≤5 22 (34.4) 1.21251 ± 0.61498 .0066

>5 to ≤10 35 (54.7) 1.98731 ±± 1.13034

>10 7 (10.9) 2.55771 ± 1.84135

Mitoses per 50 HPFs

≤5 37 1.42596 ± 0.76332 .0031

>5 27 2.27314 ± 1.41924

Mutation status

Wild type 13 (20.3) 2.45613 ± 1.66917 .0313

c‐kit mutation 48 (75) 1.6574 ± 0.94246

PDGFRA

mutation

3 (4.7) 0.88351 ± 0.38296

Risk classification

Low 10 (15.6) 0.85553 ± 0.26006 .0481

Intermediate 15 (23.4) 1.68313 ± 1.04404

High 39 (61) 2.05982 ± 1.2241

Abbreviations: APOC2, apolipoprotein C‐II; GIST, gastrointestinal stromal

tumor; HPF, high‐power field; PDGFRA, platelet‐derived growth factor

receptor‐α

10 | CHEN ET AL.

apoptosis via the KIT/AKT signalling pathway in gastrointestinal

stromal tumours. Molecular Oncology, 9(7), 1421–1433. https://doi.

org/10.1016/j.molonc.2015.03.013

Joensuu, H., Hohenberger, P., & Corless, C. L. (2013). Gastrointestinal

stromal tumour. Lancet, 382(9896), 973–983. https://doi.org/10.

1016/S0140‐6736(13)60106‐3Jong, M. C., Hofker, M. H., & Havekes, L. M. (1999). Role of ApoCs

in lipoprotein metabolism: Functional differences between ApoC1,

ApoC2, and ApoC3. Arteriosclerosis, Thrombosis, and Vascular Biology,

19(3), 472–484.

Kim, W. K., Park, M., Kim, Y. K., Tae, Y. K., Yang, H. K., Lee, J. M., & Kim, H.

(2011). MicroRNA‐494 downregulates KIT and inhibits gastrointestinal

stromal tumor cell proliferation. Clinical Cancer Research, 17(24),

7584–7594. https://doi.org/10.1158/1078‐0432.CCR‐11‐0166LaRosa, J. C., Levy, R. I., Herbert, P., Lux, S. E., & Fredrickson, D. S. (1970).

A specific apoprotein activator for lipoprotein lipase. Biochemical and

Biophysical Research Communications, 41(1), 57–62. https://doi.org/10.

1016/0006‐291x(70)90468‐7Ling, T., Yu, F., & Cao, H. (2018). miR‐182 controls cell growth in

gastrointestinal stromal tumors by negatively regulating CYLD

expression. Oncology Reports, 40(6), 3705–3713. https://doi.org/10.

3892/or.2018.6765

Long, Z. W., Wu, J. H., Cai, H., Wang, Y. N., & Zhou, Y. (2018). MiR‐374bpromotes proliferation and inhibits apoptosis of human GIST

cells by inhibiting PTEN through activation of the PI3K/Akt

pathway. Molecules and Cells, 41(6), 532–544. https://doi.org/10.

14348/molcells.2018.2211

Lu, S., Zhu, Q., Zhang, Y., Song, W., Wilson, M. J., & Liu, P. (2015).

Dual‐functions of miR‐373 and miR‐520c by differently regulating

the activities of MMP2 and MMP9. Journal of Cellular Physiology,

230(8), 1862–1870. https://doi.org/10.1002/jcp.24914

Ma, J., Fu, G., Wu, J., Han, S., Zhang, L., Yang, M., … Wang, Y. (2016).

4‐cholesten‐3‐one suppresses lung adenocarcinoma metastasis by

regulating translocation of HMGB1, HIF1alpha and Caveolin‐1. CellDeath & Disease, 7(9), 1–10. https://doi.org/10.1038/cddis.2016.281

Nannini, M., Ravegnini, G., Angelini, S., Astolfi, A., Biasco, G., & Pantaleo,

M. A. (2015). miRNA profiling in gastrointestinal stromal tumors:

Implication as diagnostic and prognostic markers. Epigenomics, 7(6),

1033–1049. https://doi.org/10.2217/epi.15.52

Niinuma, T., Suzuki, H., Nojima, M., Nosho, K., Yamamoto, H., Takamaru,

H., … Shinomura, Y. (2012). Upregulation of miR‐196a and HOTAIR

drive malignant character in gastrointestinal stromal tumors. Cancer

Research, 72(5), 1126–1136. https://doi.org/10.1158/0008‐5472.CAN‐11‐1803

Ran, L., Sirota, I., Cao, Z., Murphy, D., Chen, Y., Shukla, S., … Chi, P. (2015).

Combined inhibition of MAP kinase and KIT signaling synergistically

destabilizes ETV1 and suppresses GIST tumor growth. Cancer

Discovery, 5(3), 304–315. https://doi.org/10.1158/2159‐8290.CD‐14‐0985

Wang, Z., Chen, Y., Lin, Y., Wang, X., Cui, X., Zhang, Z., … Qin, C. (2017).

Novel crosstalk between KLF4 and ZEB1 regulates gemcitabine

resistance in pancreatic ductal adenocarcinoma. International

Journal of Oncology, 51(4), 1239–1248. https://doi.org/10.3892/

ijo.2017.4099

Weldon, C. B., Madenci, A. L., Boikos, S. A., Janeway, K. A., George, S., von

Mehren, M., … La Quaglia, M. P. (2017). Surgical management of

wild‐type gastrointestinal stromal tumors: A report from the National

Institutes of Health Pediatric and Wildtype GIST Clinic. Journal of

Clinical Oncology, 35(5), 523–528. https://doi.org/10.1200/JCO.2016.

68.6733

Xue, A., Chang, J. W., Chung, L., Samra, J., Hugh, T., Gill, A., … Smith, R.

C. (2012). Serum apolipoprotein C‐II is prognostic for survival

after pancreatic resection for adenocarcinoma. British Journal

of Cancer, 107(11), 1883–1891. https://doi.org/10.1038/bjc.

2012.458

Ye, T. H., Yang, F. F., Zhu, Y. X., Li, Y. L., Lei, Q., Song, X. J., … Wei, Y. Q.

(2017). Inhibition of Stat3 signaling pathway by nifuroxazide

improves antitumor immunity and impairs colorectal carcinoma

metastasis. Cell Death & Disease, 8(1), 1–13. https://doi.org/10.

1038/cddis.2016.452

Yun, S., Kim, W. K., Kwon, Y., Jang, M., Bauer, S., & Kim, H. (2018). Survivin

is a novel transcription regulator of KIT and is downregulated by

miRNA‐494 in gastrointestinal stromal tumors. International Journal

of Cancer, 142(10), 2080–2093. https://doi.org/10.1002/ijc.31235

SUPPORTING INFORMATION

Additional supporting information may be found online in the

Supporting Information section.

How to cite this article: Chen Y, Qin C, Cui X, Geng W,

Xian G, Wang Z. miR‐4510 acts as a tumor suppressor in

gastrointestinal stromal tumor by targeting APOC2. J Cell

Physiol. 2020;1–11. https://doi.org/10.1002/jcp.29506

CHEN ET AL. | 11