microsoft word - frameworks science 6th grade 05 … science/2006-2007/6th... · web viewfinger...

Science Curriculum Framework

6th Grade

2006-2007

Science Curriculum Framework 2006-2007 1

Table of Contents 1

Mission Statement and Belief Statement 2

Acknowledgement 3

Introduction 4

Student Participation in TEKS-Based Inquiry and the BISD Science Fair 5

Scope & Sequence 6

Curriculum Frameworks First Six Weeks 7-9

Second Six Weeks 10-12

Third Six Weeks 13-14

Fourth Six Weeks 15-16

Fifth Six Weeks 17-18

Sixth Six Weeks 19-20

Appendix

Texas Essential Knowledge and Skills Subchapter A. ElementarySubchapter B. Middle SchoolSubchapter C. High School

Texas Assessment of Knowledge and Skills Objectives Fifth Grade, Eighth Grade, Tenth Grade, and Eleventh Grade

Science TEKS Toolkit Excerpts Materials and Safety Equipment List Checklist for Science Field Investigations Science Facility Safety Checklist Laboratory Safety Survey Assessment Methods and Web-Based Resources

Recommended/Exemplar Labs

National Science Education Standards

Science Curriculum Framework 2006-2007

Table of Contents

1

The mission of the Brownsville Independent School District, an international community respected for its rich cultural heritage is to produce responsible, well-rounded graduates

Who -have the ability to pursue a post-secondary education and/or career -possess a capability for independent learning and thinking with a competitive edge in a multi-cultural, multi-lingual world

By - identifying and maximizing physical, financial, and human resources and -Unifying community and school commitment to excellence in education and equal educational opportunity.

Excellence is our common goal. Parental responsibility is an integral factor in student success. Belief in self is fundamental to success. Everyone deserves respect as a human being. Perseverance and hard work are essential for success. Change creates opportunities for growth. Truthfulness is important for effective communication. Public schools are an extension of the community. Sensitivity is essential for understanding the needs of others. Great achievements follow high expectations. Cooperation is necessary to get things done. Active listening is essential for effective communication. Successful students are active participants in the learning process.


Brownsville Independent School District

Mission Statement

Brownsville Independent School District

Belief Statement

2

The Brownsville Independent School District gratefully acknowledges the contributions given by the Science teachers who participated in the development of this secondary Science curriculum framework. Science teachers from the following campuses assisted in the development of the framework:

Besteiro Middle School Cummings Middle School Faulk Middle School Garcia Middle School Lucio Middle School Oliveira Middle School Perkins Middle School Stell Middle School Stillman Middle School Vela Middle School Secondary Science Curriculum Specialists


Acknowledgement

3

Texas Legislation requires that all Texas school districts develop, implement, and evaluate a comprehensive educational program aimed at student mastery of the Texas Essential Knowledge and Skills as defined in Chapter 112.

The purpose of this Secondary Science Curriculum Framework is to match learning experiences to the Texas Essential Knowledge and Skills and provide a sequence of objectives and lab activities that are also aligned, including the 40% lab requirement for all High School Science courses. Brownsville ISD also requires the 40% lab minimum curriculum requirement for all Middle School Science courses.

In addition, this document includes sample activities and required “RECOMMENDED/EXEMPLAR” labs to be taught in each course. These labs are not intended to be the only labs taught in each course, but are provided to ensure consistency in high-quality instruction throughout the district. They should further serve to avoid overemphasis in one area while neglecting another, and thus, focus on student needs.

Pre-AP accommodations are indicated throughout the document, either as additional TEKS added to the course to meet the needs of the Pre-AP course sequence, or emphasized TEKS that need to be taught with added depth to the Pre-AP student in order to prepare them for the AP or Dual Enrollment course. Adaptations for other special populations will be made as needed, but the basic curriculum is the same for all students.

The textbook provided by the state is a resource for teaching the course, not the curriculum. Although the textbook “covers” all TEKS for the course, it does not necessarily provide instructional support for teaching the TEKS to the level of depth necessary to fulfill the TEKS intention. Therefore, it is highly recommended that teachers use a variety of additional resources from multiple sources in order to meet the TEKS requirements. Some of these resources may include, but are not limited to the required Recommended/Exemplar Labs, FOSS kits (which should be taught in their entirety as a unit), TEXTEAMS activities, Calculator Based Labs, Snapshot Activities and Vistas provided through the Charles A. Dana Center Science Toolkit.


Introduction

4

This curriculum framework is primarily a working document that prescribes what is to be taught in a given subject or area of study. It gives both structure and direction to the educational program. As a formal document, it is an official statement of the curriculum and a teacher’s guide to instruction.

Research, inquiry and invention are essential skills successful students must develop as they grow academically. Students must be able to discuss and evaluate social, technological and scientific issues evident today and trends influencing the future. A challenge for educators is to exploit the natural curiosity all students possess. Allowing time, opportunity and support during school hours for student-based inquiry permits learners to expose their misconceptions and pursue the “why” questions they have. Students should plan investigations and conduct research that can help them test their ideas, interpret differing points of view and justify consequent discoveries. Students are much more likely to internalize and remember concepts learned if they are actively involved with them, rather than passively observing them take place.

TEKS-based investigations enable students to effectively learn and use content-area concepts and skills. Through these types of direct investigations students are able to “maximize their ability to make sense of the world and to learn more about it.” (Science for All Americans) Therefore, it is a BISD requirement that all students participate in a research-based inquiry project at the sixth, seventh, and eighth grades. Participation at other grades or courses is highly recommended since successful research projects take two to four years. When students are engaged in research-based inquiry, they are involved in using a rich variety of primary and secondary source materials and the Science Process Skills as required by law in the Science TEKS.

A successful classroom science investigation may be developed into a research-based inquiry project and entered in the Science Fair. Students who choose to enter the fair will be able to create investigations from among fifteen different categories. The Science Fair will be held annually in the fall, allowing teachers and students to prepare for one science competition per year following the rules of the Intel International Science and Engineering Fair, www.sciserv.org/isef . All students will have the opportunity to complete an original investigation . Individual campuses,


Student Participation in TEKS-Based Inquiry and the BISD Science Fair

5

http://www.sciserv.org/isef

teachers and students will be able to choose which projects to enter in the Science and Engineering Fair.


Six Weeks TAKS TEKS Ch. Concepts Recommended Labs/Websites

1st

Obj.1: Nature of Science* 6.1-6.4 Intro. To

ScienceSafety; measurements (length, mass, volume & density); proper use of scientific tools & equipment; scientific & process skills

FOSS Variables Kit: ???? Science Lesson Plans: www.col-ed.org/cur/science.html Pickle Lab: Gummy Bear Lab: See Appendix

Obj.5: Earth 6.14 B; 6.5B 16

Identify relationships between groundwater & surface water in a watershed; explain & illustrate the interactions between the matter & energy in the water cycle & in the decay of biomass such as in a compost bin

Water from Trees: Sci. Explorer pg. 403 Soil Testing: Sci. Explorer pp. 416-417 Groundwater Contamination: Trouble in Fruitvale: SEPUP

Labs2nd

Obj.3: Structures & Properties of Matter

6.7A,B;6.8A,B

1-2

Demonstrate new substances can be made when two or more substances are chemically combined & compare the properties of the new substances to the original substances; classify substances by their physical & chemical properties; define matter & energy; explain & illustrate the interaction between matter & energy in the water cycle & in the decay of biomass such as in a compost bin

Ice Cream Lab: http://teachers.kidzonline.org/skwalsh/Lithosphere/ice%20cream%20lab.htm

S’mores Lab: See Appendix Oobleck Lab:

http://education.jlab.org/beamsactivity/6thgrade/oobleck/oobleck.pdf Vernier MS Science with Calculators: Experiments 13-15

3rd

Obj.5: Space 6.13A,B 6.5B 16

Identify characteristics of objects in our solar system including the sun, planets, meteorites, comets, asteroids, & moons; describe types of equipment & transportation needed for space travel

Speeding Around the Sun: Sci. Explorer pp. 560-561 Be a Rocket Scientist Lab: Sci. Explorer: pg. 568 Solar Systems Adventure Lab Solar Heating: Sci. Explorer Lab Manual pg. 45

4th

Obj.4: Force & Motion

6.6B; 6.9A 3, 9

Demonstrate that changes in motion can be measured & graphically represented; identify energy transformations occurring during the production of energy for human use such as electrical energy to heat energy or heat energy to electrical energy

Ballon Racer Lab (Rocket Car): See Appendix Forces & Motion:

http://school.discovery.com/lessonplans/programs/forcesandmotion

Take a Walk Lab: See Appendix Keeping Comfortable: Sci. Explorer pg. 312

5th

Obj.2: Living Systems & Environment

6.10B,C 4, 5

Determine that all organisms are composed of cells that carry on functions to sustain life; identify how structure compliments function at different levels of organization including organs, organ systems, organisms & populations

Microscope Lab: Sci. Explorer Lab Manual pp. 17-22 Egg-speriment with a Cell: Sci. Explorer pg. 157 A Magnified View of Life: Sci. Explorer pp. 148-149 Jell-O Cell Plant Cell Investigation (Onion and Celery cells)

6th

Obj.2: Living Systems & Environment

6.11A-C 4, 5

Identify some changes in traits that can occur over several generations through natural occurrence & selective breeding; identify cells as structures containing genetic material; interpret the role off genes in inheritance

DNA Chain Letter: See Appendix http://www.successlink.org/gti/gti_lesson.asp?lid=2716

Cell Membranes and Permeability Lab: Sci. Explorer Lab Manual pg. 23

Skittles Lab: See Appendix Finger Printing Lab:

http://school.discovery.com/lessonplans/programs/whodidit

6th Grade Scope and Sequence 2006-2007Science Curriculum Framework 2006-2007 7

http://school.discovery.com/lessonplans/programs/whodidit

http://www.successlink.org/gti/gti_lesson.asp?lid=2716

http://www.accessexcellence.org/AE/ATG/data/released/0251-NickHoffman/



http://education.jlab.org/beamsactivity/6thgrade/oobleck/oobleck.pdf

http://teachers.kidzonline.org/skwalsh/Lithosphere/ice%20cream%20lab.htm


http://www.col-ed.org/cur/science.html

6th Grade Scope and Sequence 2006-2007

Time Frame: 1st Six Weeks (page 1 of 3)

Concept and Process TEKS (reinforced TEKS in parentheses)

6.14 B; 6.8 B;6.1 – 6.4

Required Recommended Lab (Pickle Dissection Lab)

andSuggested Instructional Activities Integrating Concepts & Processes

Suggested Resources(Use of additional & various resources from

multiple sources is necessary to meet the TEKS)

(6.14) Science concepts. The student knows the structures and functions of Earth systems. The student is expected to:

(B) identify relationships between groundwater and surface water in a watershed

(6.8) The student knows that complex interactions occur between matter and energy. The student is expected to:

(B) explain and illustrate the interactions between matter and energy in the water cycle and in the decay of biomass such as in a compost bin; and

Activity: The student will identify relationships between groundwater and surface water in a watershed such as:

Create a model of a watershed and identify limitations.

Use a model of a watershed in order to analyze and interpret information and construct reasonable explanations.

Activity: The student will demonstrate an understanding of the interactions between matter and energy in the water cycle and in the decay of biomass:

Implement and collect data on a composting system.

Practice using a scientific method while using safe laboratory procedures.

Make wise choices in recycling materials

Prentice Hall Science Explorer: Chapter 12

Middle School Science & Engineering Fair Guidelines and Information booklet

Snapshot Activities 6.5b, 6.14 b http://www.utdanacenter.org/sciencetoolkit/instruction/snapshots/6.php

Water Cycle Game

Science Explore Safety Manual

www.geology.com


Unit Concepts: TAKS Objective: Notes:Earth Science: Obj.1: Nature of Science Researched based inquiry project

required for sixth grade.

8

http://www.geology.com/

http://www.utdanacenter.org/sciencetoolkit/instruction/snapshots/6.php



Time Frame: 1st Six Weeks (page 2 of 3)

Concept and Process TEKS

(reinforced TEKS in parentheses)6.14 B; 6.8 B;

6.1 – 6.4

Required Recommended Lab:Pickle Dissection Lab


Suggested Resources(Use of additional & various resources from multiple sources is necessary to

meet the TEKS)

Science Processes:

6.1 – 6.4

(40% Course Requirement minimum)

Ongoing / Integrated with concepts throughout unit.

Recommended Lab: Pickle Dissection LabScience Project: (optional at 6th grade)

Choose a limited subject, ask a question; identify or originate/define a problem to study.

Review published materials related to problem or question.

Evaluate possible solutions and make hypothesis.

http://www.ngdc.noaa.gov/ mgg/mggd.html

http://www.usgs.gov/ education/learnweb/ice.html

http:// www.exploratorium.edu/cooking/pickles/index.html (pickle lab)

http://www.science-class.net/ (covers all objectives)

http://sln.fi.edu/tfi/hotlists/ hotlists.html

http://education.jlab.org/ vocabhangman/index.html (covers science vocabulary)

http://sciencespot.net/Media/ mmaniabearlab.pdf (gummy bear lab)

ISEF Science Fair: http://www.sciserv.org/isef/

teachers/index.asp

STUDENT PRODUCTS may include (but are not limited to):~ Journals/Notebooks/Reports ~ Projects ~Labs ~Presentations.


http://www.sciserv.org/isef/teachers/index.asp

http://www.sciserv.org/isef/teachers/index.asp

http://sciencespot.net/Media/mmaniabearlab.pdf

http://sciencespot.net/Media/mmaniabearlab.pdf

http://education.jlab.org/vocabhangman/index.html

http://education.jlab.org/vocabhangman/index.html

http://sln.fi.edu/tfi/hotlists/hotlists.html


http://www.science-class.net/

http://www.exploratorium.edu/cooking/pickles/index.html



http://www.usgs.gov/education/learnweb/ice.html

http://www.usgs.gov/education/learnweb/ice.html

http://www.ngdc.noaa.gov/mgg/mggd.html

http://www.ngdc.noaa.gov/mgg/mggd.html

Alignment and Correlations Charts

Time Frame: 1st Six Weeks (page 3of 3)

TEKS/TAKS Correlations*

6th Gr. TEKS

5th Grade TAKS Correlation

Prior Knowledge

TEKS

Subsequent Knowledge

TEKS

Eighth TAKS Correlation

6.14 b Objective 4 Objective 56.13 a, b Objective 4 5.5 a, b 7.13 a b Objective 56.5 a Objective 2 5.5 a, b 7.5 a Objective 26.8 b 7.8 , b Objective2Processes:6.1 a, b6.2 a, b, c, d, e6.3 a, b, c, d, e6.4 a, b

Objective 1 5.1 a, b5.2 a, b, c, d, e5.3 a, b, c, d, e5.4 a, b

7.1 a, b 7.2 a, b, c, d, e7.3 a, b7.3 c, d, e7.4 a, b

Objective 1

*Refer to Appendix for complete TEKS and TAKS objectives.

Pre-AP Course Curricular Requirements**Required Pre-AP Course TEKS Additions

8.13 b, c

Resources: 8th Grade TextbookSnapshot Activities: http://www.tenet.edu/teks/snapshots/index.html?8th

**Also see Appendix for Pre-AP/AP Alignment Chart


Time Frame: 2nd Six Weeks (page 1 of 3)

Unit Concepts: TAKS Objectives: Notes:Structures and Properties of

MatterObj.3: Structures and Properties of Matter

Researched based inquiry project required for sixth grade.


(reinforced TEKS in parentheses)6.7 A,B; 6.8 A,B

Required Recommended Lab:Ice-Cream Lab



meet the TEKS)

(6.7) Science concepts. The student knows that substances have physical and chemical properties. The student is expected to:

(A)demonstrate that new substances can be made when two or more substances are chemically combined and compare the properties of the new substances to the original substances; and

(B)classify substances by their physical and chemical properties.

Activity: The student will demonstrate that new substances are chemically combined and compare the properties of the new substances to the original substances:

Plan and implement investigations about chemical changes while using safe laboratory practices and making wise choices in the use of resources.

Predict outcomes of chemical combinations.

Analyze, interpret and communicate valid conclusions about the outcomes of chemical combinations.

Prentice Hall Science Explorer Grade 6:

Chapters 1, 2

Snapshot Activities 6.7 a, b, 6.8 a, 6.6b http://www.utdanacenter.org/sciencetoolkit/instruction/snapshots/6.php

Vista, “Systems: Something New! Is It Different?” http://www.utdanacenter.org/sciencetoolkit/downloads/vistas/6systems.pdf


http://www.utdanacenter.org/sciencetoolkit/downloads/vistas/6systems.pdf








(reinforced TEKS in parentheses)6.7 A,B; 6.8 A,B

Required Recommended Lab:Ice-Cream Lab

and Suggested Instructional Activities Integrating Concepts & Processes


meet the TEKS)

(6.8) The student knows that complex interactions occur between matter and energy. The student is expected to:

(A)define matter and energy.

(B)Explain and illustrate the interactions between matter and energy in the water cycle and in the decay of biomass such as in a compost bin

Activity: The student will classify substances by their physical and chemical properties: Research and communicate

information on families of elements.

Collect data by observing and measuring using scientific tools while using safe laboratory practices and making wise choices in the use of resources.

Chart physical and chemical properties according to similarities.

Activity: The student will demonstrate an understanding that complex interactions occur between matter and energy: Construct reasonable explanations from direct and indirect evidence

http://teachers.kidzonline.org/ skwalsh/Lithosphere/ice%20cream%20lab.htm

http://education.jlab.org/ beamsactivity/6thgrade/oobleck/overview.html


http://education.jlab.org/beamsactivity/6thgrade/oobleck/overview.html









6th Gr. TEKS


Prior Knowledge

TEKS


TEKS


6.7 a Objective 3 5.7 b Objective 36.7 b Objective 3 5.7 a Objective 36.8 a Objective 3 5.7 a Objective 36.8 b Objective 3Proceses:6.1 a, b6.2 a, b, c, d, e6.3 a, b, c, d, e6.4 a, b


7.1 a, b 7.2 a, b, c, d, e7.3 a, b7.3 c, d, e7.4 a, b

Objective 1



Time Frame: 3rd Six Weeks (page 1 of 2)Unit Concepts: TAKS Objectives: Notes:

Space Obj.5: Space Researched based inquiry project required for sixth grade.


(reinforced TEKS in parentheses) 6.13 A,B; 6.5 B

6.1 – 6.4

Required Recommended Lab: Be a Rocket Scientist Lab



meet the TEKS)

(6.13) Science concepts. The student knows components of our solar system. The student is expected to:

(A) identify characteristics of objects in our solar system including the Sun, planets, meteorites, comets, asteroids, and moons; and

(B) describe types of equipment and transportation needed for space travel.

(6.5) The student knows that systems may combine with other systems to form a larger system

(B) Describe how the properties of a system are different from the properties of its parts

Activity: The student will demonstrate an understanding of the components of our solar system:

Create a model of our solar system and identify the limitations of the model.

Evaluate the impact of space research on society.

Research astronauts and astronomers that have made important contributions to our understanding of the solar system.

Describe the relationship between human body systems in space.

Illustrate analogies between the human body system and the solar system

FOSS: “Planetary Science”

Snapshot Activities 6.13 A,B; 6.5 A http://www.utdanacenter.org/sciencetoolkit/instruction/snapshots/6.php

http://www.nasa.gov/home/ index.html?skipIntro=1

http://www.nasa.gov/ externalflash/sts-121_front/index.html

http://www.eduplace.com/rdg/ gen_act/advent/solar.html

http://stardate.org/nightsky/ moon/

http://imagine.gsfc.nasa.gov/ docs/teachers/teachers_corner.html

http://www.windows.ucar.edu/


http://www.windows.ucar.edu/

http://imagine.gsfc.nasa.gov/docs/teachers/teachers_corner.html



http://stardate.org/nightsky/moon/

http://stardate.org/nightsky/moon/

http://www.eduplace.com/rdg/gen_act/advent/solar.html

http://www.eduplace.com/rdg/gen_act/advent/solar.html

http://www.nasa.gov/externalflash/sts-121_front/index.html



http://www.nasa.gov/home/index.html?skipIntro=1

http://www.nasa.gov/home/index.html?skipIntro=1





Time Frame: 3rd Six Weeks (page 2 of 2)


6th Gr. TEKS


Prior Knowledge

TEKS


TEKS


6.13 a Objective 4 5.12 c Objective 56.13 b Objective 4 5.12 d Objective 56.5 b Objective 2 5.5 b 7.5 b Objective 2

Proceses:6.1 a, b6.2 a, b, c, d, e6.3 a, b, c, d, e6.4 a, b


7.1 a, b 7.2 a, b, c, d, e7.3 a, b7.3 c, d, e7.4 a, b

Objective 1



Time Frame: 4th Six Weeks (page 1 of 2)

Unit Concepts: TAKS Objective: Notes:Force and Motion Obj.4: Force and Motion Researched based inquiry

project required for sixth grade.


6.6 B; 6.9 A; 6.1 – 6.4

Required Recommended Labs: Rocket Racer Lab

Keeping Comfortableand

Suggested Instructional Activities Integrating Concepts & Processes


meet the TEKS)

(6.9) The student knows that obtaining, transforming, and distributing energy affects the environment. The student is expected to:

(A) identify energy transformations occurring during the production of energy for human use such as electrical energy to heat energy or heat energy to electrical energy;

(6.6) Science concepts. The student knows that there is a relationship between force and motion. The student is expected to:

(B) demonstrate that changes in motion can be measured and graphically represented

Activity: The student will illustrate the effects of obtaining, transforming, and distributing energy on the environment: Evaluate promotional campaigns of

hybrid cars or solar powered devices.

http:// www.middleschoolscience.com/balloonracers.htm (Rocket Racer)

Keeping Comfortable/Science Explorer pg. 312

http:// www.middleschoolscience.com/walk.html

http://school.discovery.com/ lessonplans/programs/forcesandmotion/

http://psrc.aapt.org/


http://www.eduplace.com/ activity/

http://www.d91.k12.id.us/ hawth/web%20site/lesson%20plans/web%20pages/wind%20page/wind%20energy.html


http://www.d91.k12.id.us/hawth/web%20site/lesson%20plans/web%20pages/wind%20page/wind%20energy.html



http://www.eduplace.com/activity/

http://www.eduplace.com/activity/



http://psrc.aapt.org/

http://school.discovery.com/lessonplans/programs/forcesandmotion/



http://www.middleschoolscience.com/walk.html



http://www.middleschoolscience.com/balloonracers.htm






6th Gr. TEKS


Prior Knowledge

TEKS


TEKS


6.6 b Objective 3 5.12 d 7.6 b Objective 46.9 a Objective 4 5.8 a 7.8 b Objectives 4Processes:6.1 a, b6.2 a, b, c, d, e6.3 a, b, c, d, e6.4 a, b


7.1 a, b 7.2 a, b, c, d, e7.3 a, b7.3 c, d, e7.4 a, b

Objective 1




Unit Concepts:Life Science Environmental Science:BacteriaPlantsAnimalsEcosystems

TAKS Objective:Obj.2: Living Systems & Environment

Notes: Researched based inquiry project required for sixth grade.


6.10 B,C; 6.1 – 6.4

Required Recommended Lab, Egg-speriment With a Cell Lab



meet the TEKS)

(6.10) Science concepts. The student knows the relationship between structure and function in living systems. The student is expected to:

(B) determine that all organisms are composed of cells that carry on functions to sustain life; and

(C) identify how structure complements function at different levels of organization including organs, organ systems, organisms, and populations.

Activity: The student will demonstrate an understanding of the cell theory:

Use micro-slide viewers or microscopes to view plant and animal cells to create a chart that compares and contrasts the organelles.

Analyze and interpret data collected from observing egg yolk in high salt content to construct reasonable explanations and communicate valid conclusions.


http:// www.biologylessons.sdsu.edu/index.html


http://www.biologylessons.sdsu.edu/index.html








6th Gr. TEKS


Prior Knowledge

TEKS


TEKS


6.10 b, c 7.9 a Objective 2Proceses:6.1 a, b6.2 a, b, c, d, e6.3 a, b, c, d, e6.4 a, b


7.1 a, b7.2 a, b, c, d, e7.3 a, b, c, d, e7.4 a, b

Objective 1




Unit Concepts:Life Science:CellsCell Processes

TAKS Objective:Obj.2: Living Systems & Environment

Notes: Researched based inquiry project required for sixth grade.


6.11 A-C; 6.1 – 6.4

Required Recommended Lab, Organism Dissection



meet the TEKS)

(6.11) Science concepts. The student knows that traits of species can change through generations and that the instructions for traits are contained in the genetic material of the organisms. The student is expected to:

(A) identify some changes in traits that can occur over several generations through natural occurrence and selective breeding;

(B) identify cells as structures containing genetic material; and

(C) interpret the role of genes in inheritance.

Activity: The student will predict that the genetic material of organisms will change the traits of species through generations: Create a model of a cell identifying

where genetic material is found.Activity: Suggested Recommended Lab: Modeling Mendel’s Pea Experiment

This activity allows students to discover for themselves what Mendel uncovered in his famous pea experiments.

http://school.discovery.com/ lessonplans/programs/whodidit/

http://www.successlink.org/ gti/gti_lesson.asp?lid=2716

http:// www.nationalgeographic.org/

Adapted from an Access Excellence Activities Exchange Lab www.accessexcellence.com


http://www.accessexcellence.com/

http://www.nationalgeographic.org/

http://www.nationalgeographic.org/



http://school.discovery.com/lessonplans/programs/whodidit/






6th Gr. TEKS


Prior Knowledge

TEKS


TEKS


6.11 a, b, c Objective 2 5.9 a, b, c 7.10 a, b, c Objective 2Proceses:6.1 a, b6.2 a, b, c, d, e6.3 a, b, c, d, e6.4 a, b


7.1 a, b 7.2 a, b, c, d, e7.3 a, b7.3 c, d, e7.4 a, b

Objective 1



APPENDIX

Texas Essential Knowledge and Skills Fifth Grade Science (Texas Essential Knowledge and Skills for Science

Subchapter A Elementary)http://www.tea.state.tx.us/rules/tac/chapter112/ch112a.html

Texas Essential Knowledge and Skills for Science Subchapter B Middle Schoolhttp://www.tea.state.tx.us/rules/tac/chapter112/ch112b.html

Texas Essential Knowledge and Skills for Science Subchapter C High Schoolhttp://www.tea.state.tx.us/rules/tac/chapter112/ch112c.html

Texas Assessment of Knowledge and Skills Objectives Fifth Grade http://www.tea.state.tx.us/student.assessment/resources/guides/study/

Gr5Rdg_Mth_Sci.pdf Eighth Grade

http://www.tea.state.tx.us/student.assessment/resources/guides/study/Gr8Sci.pdf Tenth Grade

http://www.tea.state.tx.us/student.assessment/resources/guides/study/Gr10Mth_Sci.pdf

Eleventh Gradehttp://www.tea.state.tx.us/student.assessment/resources/guides/study/Gr11Mth_Sci.pdf

Science TEKS Toolkit Excerpts http://www.utdanacenter.org/sciencetoolkit Materials and Safety Equipment List Checklist for Science Field Investigations Science Facility Safety Checklist Laboratory Safety Survey Assessment Methods Web-Based Resources

National Science Education Standards http://www.nsta.org/standards


http://www.nsta.org/standards

http://www.utdanacenter.org/sciencetoolkit



http://www.tea.state.tx.us/student.assessment/resources/guides/study/Gr8Sci.pdf

http://www.tea.state.tx.us/student.assessment/resources/guides/study/Gr5Rdg_Mth_Sci.pdf

http://www.tea.state.tx.us/student.assessment/resources/guides/study/Gr5Rdg_Mth_Sci.pdf

http://www.tea.state.tx.us/rules/tac/chapter112/ch112c.html

http://www.tea.state.tx.us/rules/tac/chapter112/ch112b.html

http://www.tea.state.tx.us/rules/tac/chapter112/ch112a.html

Sixth Grade Recommended Labs

Six Weeks

TEKS Recommended Lab Source

1st 6.1-6.4 / 6.8 b

Pickle Dissection Lab/ A World in a Bottle

Lab


Science Explorer pg 272

2nd 6.7 a,b; 6.8 a,b Ice-Cream Lab


3rd 6.13

a,b; 6.5 b

Be A Rocket Scientists Lab Science Explorer pg 568

4th 6.6 b; 6.9 a

Balloon Racer Lab / Keeping Comfortable

http://www.middleschoolscience.com/balloonracers.htmScience Explorer pg 312

5th 6.10 b, c

Egg-speriment With a Cell Lab Science Explorer pg 157

6th 6.11 a,b,c Organism Dissection Science Explorer pg 226 or 240








Gummy Bear Lab Name ____________________________ Hypothesis: What do you think will happen to a gummy bear when you put it in water over night?

Part A: Choose one gummy bear from the container on your table. Use the equipment available to measure your gummy bear and record the data in the chart for Day 1.

Measurements: ← The length of your gummy bear should be measured from the top of its head to the bottom of its feet to the nearest tenth of a centimeter. ← Measure the width at the widest point across the back of the bear to the nearest tenth of a centimeter. ← Measure the thickness from the front to the back at the thickest point to the nearest tenth of a centimeter. ← Calculate the volume by multiplying the length, width, and thickness. Round to the nearest hundredth. ← Measure the mass using a triple-beam balance or other scale to the nearest tenth of a gram. ← Calculate the density by dividing the mass by the volume. Round answer to the nearest hundredth.

Part B: Put the bear in a cup labeled with your name and class period. Add 50 ml of water to the cup and allow it to sit overnight. On Day 2, remove the gummy bear from the cup of water and use a towel to dry it off to prevent it from dripping all over the place. Repeat the measurements from Part A and record your data in the correct portion of the chart. Determine the amount of change for each measurement and record in the chart.

Experiment Data:

Questions: 1 Was your hypothesis correct? Why or why not? 2 Which change is greater - volume or mass? Explain. 3 Was there a change in density? Why? 4 How do your results compare to those of your classmates?

T. Trimpe 2002 http://sciencespot.net/


http://sciencespot.net/

Teacher Notes: This lab worksheet was created based on a gummy bear lab I found on the internet; however, the website with the original lab is no longer available. I use the lab during my Metric Mania unit when we are studying volume and mass. I did find another gummy bear lab that explores diffusion with gummy bears and describes the lab in terms of polymers. Go to http://www.psrc.usm.edu/macrog/proposal/dreyfus/outcome/gelatin/bearlab.html to view this lab and get ideas for extension lessons.

Materials - Each student will need: 1 gummy bear (may want extra for the students to eat after they have completed the lab)1 small cup of water (4 oz.)Measuring tools - metric ruler and scaleCalculator (optional)1 worksheet

NOTE: I have had good luck with Brachs brand of gummy bears, but be sure to test your gummy bears before trying the lab with your students. Some gummy bears do not absorb water well as others. If you find some that don’t work for the lab, save them for treats after the lab!

Extra time? Challenge your students to create an experiment with gummy bears. My students have asked if they will “grow” larger if left for another day. Others wondered if the temperature of the water had an effect on the rate of absorption. Some students wanted to experiment with colored water and other liquids to see what would happen to the gummy bears. Buy some extra and experiment!

T. Trimpe 2002 http://sciencespot.net/

http://sciencespot.net/

http://www.psrc.usm.edu/macrog/proposal/dreyfus/outcome/gelatin/bearlab.html

http://www.psrc.usm.edu/macrog/proposal/dreyfus/outcome/gelatin/bearlab.html

Physical and Chemical Changes Lab / S’Mores

Problem:

Hypothesis:

Materials:1. Bunsen Burner2. Skewers3. Graham Crackers4. Hershey Bars5. Marshmallows6. Goggles7. Paper Plates / Napkins

Procedure:

Results:

Conclusion:

Bunsen Burner Safety Procedure1. Prepare all materials.

2. Put on goggles

3. Tie hair back, roll up sleeves.

4. Check gas valves. Close if open.

5. Connect hose securely to the main valve.

6. Close Bunsen Burner window.

7. Open Bunsen Burner gas supply valve, turn knob three times.

8. Open main gas valve.

9. Wait three seconds.

10. Light the burner.

11. Open window to focus the flame.

12. Use the Bunsen Burner.

13. Close gas supply valve on the burner, shut off the main gas valve.

14. Disconnect the hose.

15. Remove goggles.

16. Clean the lab area and return all equipment to its designated location.

Propane Tank Burner Procedure1. Prepare all materials.

2. Put on goggles

3. Tie hair back, roll up sleeves.

4. Open gas supply valve ¼ turn.

5. Light the burner.

6. Use the burner.

7. Close the gas supply valve on the burner.

8. Remove goggles.

9. Clean the lab area and return all equipment to its designated location.

Balloon Powered Race Cars

Objectives: to create a balloon powered race car for maximum speed and distance to incorporate Newton's Laws of Motion to learn how to use the formula Speed= Distance / Time

Materials: 9 inch balloon is standard pen barrel or straw various materials to construct the racers Grading Rubric (PDF)

Rules: The car must be powered by no more than 2 balloons. You can build the car out of anything. It must have at least three wheels. Wheels are defined as anything that is round and

goes around. The wheels can not be wheels from a toy car. They must be made out of something

that was not originally meant to be used as wheels. The car may not leave the ground. The car must be capable of traveling at least 5 meters.

Procedure:1. You will bring in materials from home and assemble your car in class. 2. On race day we will set up a track in our classroom. 3. You will race in pairs against other classmates. 4. Cars that follow all of the rules will be eligible for awards. 5. Winning cars will be displayed in the lobby as well as on our web page! 6. These awards will be given in three categories. Best Looking Car Fastest Car (in first 5 meters) Farthest Distance Traveled

Good Luck!

This activity was inspired by Mr. Bings Physical Science Class. This is his page: http://www.ahsd25.k12.il.us/School%20Info/South/Southfiles/Bingaman/motion/balloon/racers.htm

Helpful Links:http://pbskids.org/zoom/freeloads/ballooncar.html http://www.kyrene.k12.az.us/schools/Pueblo/Tech/balloon_car.htm http://www.alaska.faa.gov/flt_std/aved/teachers/Rcar.html http://library.thinkquest.org/50109/projects/bcars.html http://www.eecs.umich.edu/mathscience/funexperiments/agesubject/lessons/other/rocket_car.html

http://www.eecs.umich.edu/mathscience/funexperiments/agesubject/lessons/other/rocket_car.html

http://www.eecs.umich.edu/mathscience/funexperiments/agesubject/lessons/other/rocket_car.html

http://library.thinkquest.org/50109/projects/bcars.html

http://www.alaska.faa.gov/flt_std/aved/teachers/Rcar.html

http://www.kyrene.k12.az.us/schools/Pueblo/Tech/balloon_car.htm

http://pbskids.org/zoom/freeloads/ballooncar.html

http://www.ahsd25.k12.il.us/School%20Info/South/Southfiles/Bingaman/motion/balloon/racers.htm

http://www.middleschoolscience.com/racergrade.pdf

Take a Walk!by E.S. Belasic Teacher Notes

Objectives: to calculate the speed of our normal walk in meters/second to graph our acceleration to practice using the metric system. to do statistical data analysis.

Procedure:1. Measure out 15 meters. 2. At the 0, 5, 10, & 15 m, mark with masking tape. 3. One student will be at the 0m start mark, one at 5m, one at 10m, and finally one at

15m. 4. The student at the start line will hold their arm up in the air, the other 3 will be at their

places with stopwatches waiting for the signal. 5. As soon as the student is ready, he/she will lower their arm and start walking. The

other 3 will start their stopwatches at the same exact time. 6. Time will be recorded at the 5, 10, and 15m mark. 7. Rotate through until each one has had a turn.

Data: Table 1: Walking Data (half page)

Student Time for 5 m(seconds)

Time for 10 m(seconds)

Time for 15 m(seconds)

speed=total distance/ time

(meters/second)

1

2

3

4

Figure 1: Line Graph of Time vs. Distance for your group (whole page, 4 lines w/ key)

Figure 2: Stem and Leaf of Average Speed m/s for Whole Class (half page)

http://www.middleschoolscience.com/tawt.html

Table 2: Summary Data Table of Average Speed m/s for whole class (half page)

n max min range sum avg median

Whole Class

Analysis/Results: 1. Look at your graph. Was your line a straight line? Explain why or

why not. 2. What was your Average Speed ? 3. How long would it take you to travel 20 m? 4. How about 100m? 5. Look at your class data for average speed. What was the average

speed? 6. How do you compare to the class average? Explain.

Conclusion:

2-3 sentences on what you learned

DNA Chain Letter

Contributing Teacher: Scott McQuerry

Materials Needed: A chain letter for the students (Figure 1) and a team/class roster (Figure 2). This

roster will contain all students, listed vertically, one row after another, with arrows pointing towards each subsequent row of names. Each individual on the roster will contain two arrows pointing towards two different students.

Paper and writing implement. Objectives:

1. Identify and analyze different mutations within a strand of DNA. 2. Describe the path of inheritance for a mutation. 3. Analyze the repair mechanisms a cell undertakes to correct a mutation.

Time Allowance: At least 6 weeks

Description: This activity engages the students in an authentic model for DNA replication, inheritance, mutation, and repair -- cells

Comments: Time allowance is at least 6 weeks to incorporate a class of 100 students. A shorter time is possible if the instructor has a smaller class or if the roster is modified in any way. The actual time for each individual student to participate within the activity is minimal, ranging from 1-5 minutes.

Classroom ComponentSteps to Implement this Lesson:

This activity must be initiated several weeks prior to the beginning of a unit on DNA. The construction of the chain letter and a team roster is all that is required. Samples for both the letter and the roster are provided. It is possible to amplify the students' curiosities throughout this activity by adding an element of mystery at its beginning. By not informing them of the purpose of the chain letter, many students will be eager to participate.Assessment:

A Student completes their copies and delivers the original letter to the instructor within a 24 hour period.

B Student completes their copies and delivers the original letter to the instructor within a 24-48 hour period.

C Student completes their copies and delivers the original letter to the instructor within a 48-72 hour period.

D Student completes their copies and delivers the original letter to the instructor after a 72 hour period.

F Student does not complete this activity, delivering no copies at all.

Activities and Procedures:

In the first few days of school, I begin a chain letter with the students on my team. The letter's message instructs the reader to make two handwritten copies and to pass them along to two different individuals listed on a team roster that I provide. Each of the two new letters is to be signed by the new author before their delivery. The original letter is then passed back to the instructor. This final step is crucial, as it provides evidence for the progression of the message and participation of the students throughout the roster.

The instructions within the letter's message, informs the students that they are to replicate the copy they receive, character by character. Even if a word is misspelled within the text, the student is to copy the error within their reproductions. This procedure allows for the chain letter to be used as a model for DNA replication and the inheritance of mutations. When a student misspells a word, the subsequent students will perpetuate the error by copying it into their reproductions. Since each individual delivers two copies of the letter to different students, the error will spread exponentially throughout the rows of students.

The error within the message of the text is analogous to a mutation within the DNA code. After each student participates with this activity, and the documents are spread out for them to observe, the students can map the path of errors that have been created and the mutation's inheritance throughout successive "generations" of letters. Three different types of DNA mutations can be observed in this activity. Some mistakes are simple misspelled words (substitution mutations), or involve the addition of previously unwritten words (insertion mutations), or perhaps entail the removal of a word (deletion mutations.) Although the students may initially desire to "see who made the most mistakes," it remains an authentic tool for students to become engaged with an analogous model for DNA inheritance.

At times, students overlook the instructions and correct the errors in the text. This, too, can be used as an educational model. This time, it models the actions of DNA repair. Just as mutations are being created, the cell's repair enzymes are constantly working to fix any mutations that are discovered. Inadvertently, the students who have made these corrections have become a part of the chain letter model. This activity has elicited the same amount of interest among the student body for the past two years of its use.

Accommodations:

Size - Reduce the number of copies each individual is responsible for.Time - Increase the amount of time for students to copy and deliver their letter.Level of Support - Assign peer buddies to help students in their work.Input - Demonstrate the purpose behind the activity.Difficulty - Have students be the first in the roster to copy the letter; thus avoiding the spelling/grammatical errors that will exist after distribution through the roster.Output - Have another individual write for the student, while he/she dictates the letter.Participation - Students can send copy blindly to future students by having the instructor deliver the copies to other students.Alternate Goals - Accept letters without the ATGC's.

Substitute Curriculum - Instead of distributing the letters, some students may be learning alternate skills in the computer lab.

Figure 1: Sample format for chain letter

(Insert Date)

Dear ________,

If you are reading this letter, you have been successfully incorporated into our DNA project. Remember, it is very important to copy down everything on this letter exactly as you see it. You will handwrite two identical copies of this letter and send it to your designated contact individuals located on the student roster in class. Make certain to sign your name to each of these copies before you send them. If you do not have any such individuals, you are to handwrite two copies of this letter and deliver it, in person, to your teacher.

Make certain this letter gets delivered to your teacher.

ATCGGCTAAAGGCTTCAAGCGGGGGCTATATATAGCGCCCCGCGCTATCTATCGATCAGATAGCTACGCTACGAGCTACGACTAGCATCGACGATACTAGCTACTTCAAGCGGGGGCTATATATAGCGTTCAAGCGGGGGCTATATATAGCGCTAC

Sincerely,

DNA Inheritance Lab

Activity: From One Generation to Another

OBJECTIVES: Simulate the transmission of genetic information from grandparents to parents to

children. Collect and interpret data on the diversity of patterns possible from such transmission. Relate the physical attributes of humans to the genetic information received from

previous generations.

MATERIALS: 24 Skittles ® (6 red, 6 green, 6 yellow, 6 orange) 6 Styrofoam cups 1 felt-tip marker (black) 4 crayons (in colors to match Skittles®

DIRECTIONS:

1. Label the 6 Styrofoam cups with the black felt-tip marker as follows: Grandfather 1, Grandmother 1, Grandfather 2, Grandmother 2, Mother, and Father. Place the cups on the table in an arrangement like that shown on page 3.

2. Place 6 red Skittles® in the Grandfather 1 cup and 6 green Skittles® in the Grandmother 1 cup. Place 6 yellow Skittles® in the Grandfather 2 cup and 6 orange Skittles® in the Grandmother 2 cup. (The Skittles® stand for the genes of each of the grandparents, those “somethings” which determine the characteristics that the grandparents will pass on to their children).

3. Without looking, select three Skittles® (genes) from the Grandfather 1 cup and three from the Grandmother 1 cup. These genes represent the daughter of the first grandparents, the daughter who will grow up to become a mother herself. Place them in the cup marked Mother. The mother now has six genes, just as did each of her parents.

4. Without looking, select three Skittles® (genes) from the Grandfather 2 cup and three from the Grandmother 2 cup. Place them in the cup marked Father. The father now has six genes, just as did each of his parents. Color the diagram to show the genes for the Mother and the Father.

5. Assume that the Mother and Father have four children (Sarah, Brian, Cathy, and Hugh) as shown in the diagram. To find Sarah’s genes, draw (without looking) three genes each from the Mother and Father cups. Color the blanks in the space for Sarah to match the colors for the genes you chose.

6. Return all genes to the cups. (Return red and green genes to the cup labeled Mother and yellow and orange genes to the cup labeled Father). Now select Brian’s genes. Close your eyes when you select the genes. Color the diagram to show the genes for Brian.

7. Repeat step #6 for each of the remaining tow children, Cathy and Hugh. Color in the blanks for these two children on the diagram.

8. Summarize your data in the following table. In each box, write the number of genes each child received from each grandparent. (The total should always be six).

Grandfather 1 (red)

Grandmother 1 (green)

Grandfather 2 (yellow)

Grandmother 2 (orange)Total 6 6 6 6

QUESTIONS:

1. Were any of the four children exactly alike? If your answer was yes, what do you think would have happened if you had been working with many hundreds of genes, instead of only six?

2. Why was it necessary to take three genes from the Mother cup and three from the Father cup to make the total of six genes in each child?

3. Why was it necessary to return the genes to the cups of the Mother and the Father each time?

4. Suppose the Skittles® actually were genes that controlled some very obvious characteristic. Which of the children you created would look mot alike? Why? Which of the children you created would most resemble a parent or grandparent? Why?

GOING FURTHER:Repeat the process described in steps 5, 6, and 7 of the directions 20 times. Record the colors of the Skittles® selected each time on a tally list.

Sarah Brian Cathy Hugh

DNA Inheritance Lab

Grandfather 1 Grandmother 1 Grandfather 2 Grandmother 2

MotherFather

Sarah Brian Cathy Hugh

National Science Education Content Standards

For Grades 5-8 Content Standard

A: Science As Inquiry Abilities to do scientific inquiry Understandings about scientific inquiry

B: Physical Science Properties and changes of properties in matter Motions and forces Transfer of energy

C: Life Science Structure and function in living systems Reproduction and heredity Regulation and Behavior Populations and ecosystems Diversity and adaptations of organisms

D: Earth and Space Science

Structure of the earth system Earth’s history Earth in the solar system

E: Science and Technology

Abilities of technological design Understandings about science and technology

F: Science in Personal and Social Perspectives

Personal health Populations, resources, and environments Natural hazards Risks and benefits Science and technology in society

G: History and Nature of Science

Science as a human endeavor Nature of science History of science

microsoft word - frameworks science 6th grade 05 … science/2006-2007/6th... · web viewfinger...

Documents