Ye Wang, Xiaowen Zhao, Xiaoming Wu, Yunhai Dai, Peng Chen, and Lixin Xie

microRNA-182 Mediates Sirt1-InducedDiabetic Corneal Nerve RegenerationDiabetes 2016;65:2020–2031 | DOI: 10.2337/db15-1283

Sensory neurons are particularly susceptible to neuro-nal damage in diabetes, and silent mating type informa-tion regulation 2 homolog 1 (Sirt1) has been recentlyidentified as a key gene in neuroprotection and woundhealing. We found that the expression of Sirt1 was down-regulated in trigeminal sensory neurons of diabetic mice.A microRNA microarray analysis identified microRNA-182(miR-182) as a Sirt1 downstream effector, and the expres-sion level of miR-182 was increased by Sirt1 overexpres-sion in trigeminal neurons; Sirt1 bound to the promoter ofmiR-182 and regulated its transcription. We also revealedthat miR-182 enhanced neurite outgrowth in isolated tri-geminal sensory neurons and overcame the detrimentaleffects of hyperglycemia by stimulating corneal nerve re-generation by decreasing the expression of one of its tar-get genes, NOX4. Furthermore, the effects of miR-182 oncorneal nerve regeneration are associated with a func-tional recovery of corneal sensation in hyperglycemic con-ditions. These data demonstrate that miR-182 is a keyregulator in diabetic corneal nerve regeneration throughtargeting NOX4, suggesting that miR-182 might be a po-tential target for the treatment of diabetic sensory nerveregeneration and diabetic keratopathy.

Patients with diabetes exhibit various types of diabetickeratopathy, resulting in irreversible visual impairment(1,2). The cornea receives a dense sensory innervationfrom the trigeminal ganglion (TG) (3), and corneal nervefibers are sensitive to low-intensity mechanical, chemical,and thermal stimulation (4). The corneal nerve supportscorneal epithelial nerve function (5) and plays an impor-tant role in corneal epithelial wound healing through theinteractions with TG sensory neurons (6). Decreased corneal

sensitivity and neuronal abnormalities in patients withdiabetes were thought to be the main cause of diabetickeratopathy (7).

Silent mating type information regulation 2 homolog 1(Sirt1) is an emerging focus in neuroprotection in boththe central nervous system (8,9) and peripheral nervoussystem (10–12). In our previous study, overexpression ofSirt1 promoted epithelial wound healing in diabetic cor-neas (13,14). However, the underlying mechanism bywhich Sirt1 induces diabetic corneal nerve regenerationremains elusive.

microRNAs (miRNAs) are small, noncoding RNA mole-cules found in multicellular eukaryotes and play essen-tial regulatory roles in translational repression (15). Severalwound healing–related miRNAs, such as miR-146a, wereidentified in the corneas of people with diabetes (14,16,17).Abnormal miR-146a upregulation may be an importantmechanism of delayed wound healing in the diabeticcornea (17,18).

Sirt1 is a direct target of miR-204-5p in regulating theepithelial cell cycle in the corneas of persons with diabetes,suggesting that Sirt1 is involved in the miRNA–mRNAregulatory network (14), whereas the downstream miRNAtargets of Sirt1 in corneal nerve regeneration in diabetesremain unclear.

miR-182 is a sensory organ–specific miRNA (19) andwas implicated in diabetic retinopathy, which is damageto the retina (the transparent, light-sensitive structure atthe back of the eye) as a result of diabetes. miR-182 wasalso found to be associated with oxidative stress (20,21)and has developed with selective axonopathy in sensoryneurons (22). Here we used the adenoviral system to acti-vate Sirt1 in TG tissue through subconjunctival injection.

State Key Laboratory Cultivation Base, Shandong Provincial Key Laboratory ofOphthalmology, Shandong Eye Institute, Shandong Academy of Medical Sci-ences, Qingdao, China

Corresponding authors: Ye Wang, wye112002@126.com, and Lixin Xie, lixin_xie@hotmail.com.

Received 11 September 2015 and accepted 6 April 2016.

This article contains Supplementary Data online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1.

Y.W. is currently affiliated with the Central Laboratory of the Second AffiliatedHospital, Medical College of Qingdao University, Qingdao, China.

© 2016 by the American Diabetes Association. Readers may use this article aslong as the work is properly cited, the use is educational and not for profit, andthe work is not altered.

2020 Diabetes Volume 65, July 2016

COMPLIC

ATIO

NS

Using miRNA screening, we revealed that the expression ofmiR-182 was upregulated by Sirt1 as a direct downstreamtarget. Using in silico prediction and a luciferase reporter assay,we found NADPH oxidase 4 (NOX4), which belongs to theNOX family—a major source of reactive oxygen species (ROS)in peripheral sensory neurons (23)—may be one miR-182target gene in corneal nerve regeneration in diabetes.

RESEARCH DESIGN AND METHODS

Experimental Animals and Tract-Tracing TechniquesThe animal experiments were approved by the InstitutionalAnimal Care and Use Committee, Shandong Eye Institute(Qingdao, Shandong, China). The procedures using andthe handling of the animals during this study conformedto the guidelines of the Association for Research and Visionand Ophthalmology statement for the use of animals inophthalmic and vision research. In this study we usedBKS.Cg-m+/+Leprdb/J (db/db) mice as the model of type2 diabetes. db/db and nondiabetic control db/+ mice wereobtained from The Jackson Laboratory (Bar Harbor, ME).Glucose concentrations in blood from the tail vein weredetermined using a commercial glucometer (Bayer DiabetesCare, Elkhart, IN). A blood glucose concentration.15 mmol/Lwas considered to be indicative of diabetes. Experimentson mice were performed more than 24 weeks after theonset of diabetes based on a previous report (24). Theblood glucose and body weight values of db/db and non-diabetic control db/+ mice are shown in Table 1.

The in vivo corneal injury model was established aspreviously described (25). The entire corneal epithelium,including the limbal region (marked using a 3-mm tre-phine), was scraped with an AlgerBrush II corneal rustring remover (Alger Equipment Co., Lago Vista, TX),and the right eye was wounded in each animal. Fluoro-Gold (2% in saline; Fluorochrome, Denver, CO) was usedas a retrograde tracer to identify neurons in the TG bydetecting the expression of miR-182 after subconjunctivalinjection with miR-182 agomir (RiboBio, Guangzhou,China). The mice were injected with an agomir negative-treated control (NTC), miR-182 agomir, adenovirus(Ad)–expressing Sirt1 (Hanbio, Shanghai, China), or Ad-expressing Sirt1 small interfering RNA (siRNA). Ad-expressing green fluorescent protein (GFP) served as acontrol. Agomir NTC (2.5 nmol/L) or miR-182 agomir

with 2 mL Fluoro-Gold was injected into the subconjunc-tival site of the right eye on the same day as the cornealepithelium was injured. This experiment was performedat least twice. All of the mice were assessed by using 3 mL0.25% fluorescein sodium and were photographed at 0,24, 48, and 72 h under a dissecting microscope (Canon,Tokyo, Japan) and a tungsten light source with a cobaltblue filter (Welch Allyn, Inc., Skaneateles Falls, NY). Thephotographs were analyzed to quantify the area of theepithelial wound using Adobe Photoshop software (AdobeSystems, Mountain View, CA).

Primary TG Neuronal Cell Culture and TreatmentOphthalmic branches of the trigeminal nerves were col-lected from db/db mice and nondiabetic db/+ mice, andprimary TG neuronal cells were cultured as described pre-viously (17). Culturing neurons from diabetic animalswere treated with 5 mmol/L D-glucose (considered normalglucose [NG]) and 25 mmol/L D-glucose (considered highglucose [HG]). The osmotic pressure of the NG mediumwas adjusted to the same level of the HG medium byadding 20 mmol/L L-glucose. In addition, TG cells weretreated with 1 mmol/L SRT1720 (Selleck Chemicals,Houston, TX) or 10 mmol/L resveratrol (RSV) (Sigma-Aldrich, St. Louis, MO) in HG medium. Cells cultured inNG medium were treated with these chemicals for useas a control.

RNA Isolation, Quantitative RT-PCR, and miRNAExpression Profiling and ValidationTo detect Sirt1 mRNA expression, total RNA was isolatedfrom murine TG using the RNeasy Mini Kit (Qiagen,Hilden, Germany) and transcribed using the SuperScriptReverse Transcriptase (Invitrogen, Carlsbad, CA). Primersequences are listed in Supplementary Table 1. Data werenormalized using the murine ribosomal protein L5 house-keeping gene and analyzed by the 22DCt values of thenormalized data.

To analyze miRNA expression profiling, 24 TG sampleswere harvested from 12 wild-type C57BL/6 mice aged6–8 weeks after 3 days of subconjunctival injection withAd-expressing Sirt1 or GFP (serving as a control). Thesesamples were pooled into six groups and subjected to themiRNA microarray assay (Ad-Sirt1 infection groups 1–3and Ad-GFP infection groups 1–3, each of which comprisedfour TGs from two mice). The array was analyzed—including labeling, hybridization, scanning, normalization,and data analysis—by CloudSeq Biotech Inc., Shanghai,China, using a miRCURY LNA microRNA Array Kit ver-sion 16.0 (Exiqon, Vedbaek, Denmark). The specific pri-mers for detecting miR-182 expression were designed andsynthesized by RiboBio (Guangzhou, China) using theSYBR Green Quantitative PCR Protocol. U6 was used asan endogenous control to normalize the expression levelof miR-182. All reactions were performed in triplicate.The TG infected with Ad-GFP was used as a calibrator,and the data were presented as the fold change relative tothe calibrator.

Table 1—Average weight and blood glucose concentrationat time of death

Group Mice (n)Age

(weeks) Weight (g)Blood glucose

(mmol/L)

Control 27 20–24 26.54 6 0.86 6.81 6 1.18

Diabetes 51 20–24 58.39 6 2.45* 25.92 6 2.88#

BKS-db/db mice had significantly higher blood glucose concen-trations than control mice, and the weight of BKS-db/db micewas also significantly higher than that of the control animals.*P, 0.05. #P, 0.01, unpaired t test relative to the correspondingcontrol group.

diabetes.diabetesjournals.org Wang and Associates 2021

Real-Time PCR–Based Array AnalysisTotal RNA was isolated and cDNA was synthesized asdescribed previously (13). The real-time PCR array anddata analyses were performed using a RT2 Profiler PCRArray (Mouse Oxidative Stress and Antioxidant DefensePCR Array, PAMM-065A; SABiosciences, Frederick, MD).

Luciferase AssayA 2,000-bp DNA fragment containing the putative pro-moter region of mouse miR-182 was amplified by PCRusing mice genomic DNA as a template. This was clonedinto the pGL3 Luciferase Reporter Vector (Promega, Madison,WI). The primers used for the PCR were as follows:

mmu-miR-182-p-F: GAATTGGTACCCCTTGGTGGAGGCTTTGCTGAGACC

mmu-miR-182-p-R: GGAATACGCGTCAGCAGCCAGACCAGTAAGCCTATG

miR-182-Luc reporter plasmid (200 ng) containing thefirefly luciferase gene and pRL-TK (50 ng) (Promega) werecotransfected with Sirt1 or the control vector (800 ng) intohuman HEK 293T cells. Luciferase activities were measuredwith the Dual-Luciferase Reporter Assay System (Promega)and Centro LB 960 detection system (Berthold, Germany).

Mouse NOX4 39 untranslated region (UTR) containingthe putative target site for miR-182 was amplified fromgenomic DNA by PCR amplification and inserted into thepmiR-REPORT (RiboBio). The mutant reporter plasmid atthe miR-182 complementarity site (TGCCAAA to ACGGTTT)was generated by the QuikChange II Site-DirectedMutagenesis Kit (Stratagene California, La Jolla, CA). SH-SY5Y neuroblastoma cells were transiently transfected withwild-type or mutant reporter plasmid and miRNA agomir/mimic using Lipofectamine 2000 (Invitrogen).

Corneal Nerve StainingCorneas from db/db and control db/+ mice were fixed in4% paraformaldehyde and stained with an Anti-b IIITubulin antibody (ab7751; Abcam, Cambridge, MA). Rep-resentative images were taken with a Nikon Eclipse Ni-Ufluorescence microscope (Nikon, Tokyo, Japan). Four pie-shaped quadrants of corneal specimens were examined:superior (10.30–1.30 o’clock), inferior (4.30–7.30 o’clock),nasal (right eye) and temporal (left eye) (1.30–4.30 o’clock),and temporal (right eye) and nasal (left eye) (7.30–10.30 o’clock). The corneal nerves entering each quadrantwere counted using ImageJ software (National Insti-tutes of Health, Bethesda, MD).

ImmunofluorescenceCornea and TG samples were frozen in Tissue-Tek optimumcutting temperature compound (Sakura Finetechnical Co.,Tokyo, Japan). Frozen sections were fixed in 4% para-formaldehyde. The samples were stained with primaryantibodies (Supplementary Table 2) and subsequently incu-bated with fluorescein-conjugated secondary antibodies. Allstained samples were observed under a microscope as de-scribed previously (14).

Western BlotSamples were homogenized in 100 mL radioimmunoprecipi-tation assay buffer supplemented with a proteinase inhibitorcocktail. The homogenates, which contained 10–20 mg pro-tein, were then separated in 15% SDS–polyacrylamide geland transferred to polyvinyl difluoride membranes. Theblots were probed with primary antibodies as describedpreviously (14).

SmartFlares Detection of miR-182 in TrigeminalSensory NeuronsThe presence of miR-182 in trigeminal sensory neuronswas tested using SmartFlares (Merck Millipore, Billerica,MA). SmartFlares (1.5 mL) was injected below the conjunc-tiva in the right eye after 24 h of miR-182 agomir or agomirNTC treatment. After another 24 h, the TG samples werecollected to detect miR-182 expression. We also doublestained Neurofilament 200 (NF200; Sigma-Aldrich, Shang-hai, China) and miR-182 with SmartFlare RNA detectionprobes according to the immunocytochemistry protocol formurine primary neuronal cells.

Statistical AnalysesThe results are presented as the means 6 SEMs. Thestatistical analyses were performed using an unpairedt test or one-way ANOVA by comparing the groups usingthe Student-Newman-Keuls test. The least significant dif-ference procedure was performed with GraphPad Prismsoftware 5.0 (GraphPad Software, Inc., San Diego, CA). AP value ,0.05 was considered statistically significant.

RESULTS

Downregulation of Sirt1 in Trigeminal Sensory NeuronsFrom Diabetic MiceWe first examined the blood glucose concentrations andbody weights of db/db and nondiabetic control db/+ mice(Table 1). As expected, db/db mice had significantly higherconcentrations of blood glucose and higher body weightsthan the control mice (n = 20 per group). The expressionof Sirt1 was significantly downregulated at both the mRNAand protein levels in the diabetic TG neurons compared withthe control neurons (n = 10 per group) (Fig. 1A-i and B-i).

The mRNA and protein expression levels of Sirt1 werealso reduced in TG cells with HG treatment comparedwith the group receiving NG treatment (n = 10 per group)(Fig. 1A-ii and B-ii). Coimmunostaining results showedthat Sirt1 was partially colabeled with NF200-expressingneuronal cell bodies of TG sensory neurons (Fig. 1C).There were significantly fewer Sirt1-positive cells in thediabetic mice, which confirmed the downregulation ofSirt1 in db/db mice.

miR-182 Is Regulated by Sirt1 in HG ConditionsIn view of the downregulation of Sirt1 in TG sensoryneurons of db/db mice, we hypothesized that Sirt1 mightbe essential for sensory neuron protection. Thereforewe used the adenoviral system to overexpress Sirt1 inTG tissue through subconjunctival injection, and Sirt1-overexpressing TG tissues were collected to analyze the

2022 Sirt1/miR-182 in Corneal Nerve Regeneration Diabetes Volume 65, July 2016

miRNA expression profile. Differentially expressed miRNAsmatching these stringent criteria are listed in Supple-mentary Table 3. As shown in Fig. 2A and SupplementaryTable 3, several miRNAs (e.g., miR-1a-3p, miR-5129-5p, miR-470-5p, miR-182) were deregulated in Sirt1-activated TG tissues (n = 3 per group). Among thesedifferentially expressed genes, miR-182 was significantlyupregulated (2.27-fold; P = 0.00018) in the TG tissueinfected with Ad-Sirt1 compared with that infectedwith Ad-GFP.

Further, we studied the role of miR-182 in TG sensoryneurons because 1) miR-182 had the minimum P value; 2)miR-182 is a sensory organ–specific miRNA (19); and 3)miR-182 has been implicated in diabetic retinopathy (26),which occurs in parallel with nerve fiber alterations of thesubbasal nerve plexus of diabetic corneas (27).

As we expected, the mRNA expression of miR-182 wasdecreased in the diabetic TG samples compared with thatin control mice (n = 10 per group) (Fig. 2B). We also found

miR-182 was downregulated in the primary HG-treatedTG cells compared with NG-treated TG cells (n = 4 pergroup) (Fig. 2C). We treated the primary cultured TGcells with two different Sirt1 activators, SRT1720 andRSV, which resulted in efficient upregulation of Sirt1and miR-182 expression (n = 4 per group) (Supplemen-tary Fig. 1 and Fig. 2D). In addition, the expression ofmiR-182 was increased in TG cells infected with an Ad-expressing Sirt1 and decreased in TG cells infected withan Ad-expressing Sirt siRNA (n = 4 per group) (Fig. 2F).We revealed that the relative luciferase activity of themiR-182 promoter was enhanced by cotransfection withSirt1 in a dose-dependent manner (n = 4 per group) (Fig.2G). We also performed chromatin immunoprecipitationassay to evaluate Sirt1 binding activity on the miR-182promoter in chromatin prepared from the TG samples.Computational methods were used to predict the bind-ing regions. The results in Fig. 2H demonstrate thatSirt1 binds to this predicted promoter region. Taken

Figure 1—The downregulation of Sirt1 in the TG of diabetic db/db mice. A: The expression of Sirt1 mRNA was significantly downregulatedin the TG samples from diabetic db/dbmice compared with the TG samples from nondiabetic control db/+mice (i). The TG sample from thenondiabetic control db/+ mice served as the control. Data are mean 6 SEM (n = 10 per group). HG conditions induced the downregulationof Sirt1 mRNA in the primary cultured TG cells, as indicated. TG cells were harvested 72 h after NG (5 mmol/L D-glucose plus 20 mmol/LL-glucose) or HG (25 mm D-glucose) treatment. The TG cells treated with NG served as the control. Data are mean6 SEM (n = 6 per group)(ii ). B: The expression of the Sirt1 protein was significantly downregulated in the TG of diabetic db/db mice compared with the TG ofnondiabetic control db/+ mice (i ). The TG sample from the nondiabetic control db/+ mice served as the control. Data are mean 6 SEM (n =6 per group). HG conditions induced downregulation of the Sirt1 protein in cultured TG cells, as indicated (ii ). Data are mean 6 SEM (n = 6per group). C: The expression and localization of Sirt1 with NF200 on the TG sections from the db/dbmice and the nondiabetic control db/+mice. *P < 0.05, TG samples of the diabetic group vs. those of the control group . Scale bar = 50 mm.

diabetes.diabetesjournals.org Wang and Associates 2023

together, these results indicate that miR-182 is upregu-lated by Sirt1 in TG sensory neurons.

miR-182 Promotes Diabetic Trigeminal SensoryNeuron Growth In VitroPrimary cultured TG sensory neurons were transfectedwith miR-182 agomir (200 mmol/L) to achieve robust and

predictable miR-182 overexpression in TG neurons de-rived from both control and db/db mice (Fig. 3A). After3 days of transfection with miR-182 agomir, diabetic TGneurons exhibited more and longer neuritis than thosetransfected with miRNA agomir NTC in sensory neuronsfrom db/db and control mice (Fig. 3B). Statistical analy-sis showed that the total neurite length increased by

Figure 2—miR-182 is regulated by Sirt1 in HG conditions. A: Volcano plot filtering of expression of genes detected in TG tissue frommiRNA array data. Group G is the Ad-GFP infection group (control); group S is the Ad-Sirt1 infection group (n = 3 per group). B: QuantitativePCR analysis of miR-182 in the RNA of the TG from the diabetic db/db mice and the control db/+ mice. Samples were normalized to U6RNA samples and analyzed in parallel. Data are mean6 SEM (n = 10 per group). C: Quantitative PCR analysis of miR-182 in the RNA of theprimary cultured TG cells treated with NG (5 mmol/L D-glucose plus 20 mmol/L mannitol) or HG (25 mm D-glucose). Data are mean 6 SEM(n = 4 per group). D: SRT1720 and RSV treatment induced the upregulation of miR-182 in primary cultured TG cells. The TG cells with notreatment served as the control. Data are mean 6 SEM (n = 4 per group). E: SRT1720 and RSV treatment induced the upregulation of miR-182 in primary cultured TG cells from diabetic mice. The diabetic TG cells with no treatment served as the control. Data are mean 6 SEM(n = 4 per group). F: Overexpression or downregulation of Sirt1 by recombinant Ad induced the upregulation or downregulation of miR-182in primary cultured TG cells. The TG cells with Ad-GFP treatment served as the control. Data are mean 6 SEM (n = 4 per group). G: Sirt1activates the miR-182 promoter by luciferase reporter assay. Data are represented as mean 6 SEM (n = 4 per group). H: Chromatinimmunoprecipitation assay to evaluate Sirt1 binding activity on the miR-182 promoter in chromatin prepared from the TG samples (n = 3per group). *Significant differences (P < 0.05) between the diabetic group and the control group or the TG samples treated with HG or NG.Ctrol, control; IP, immunoprecipitation; OE, overexpression.

2024 Sirt1/miR-182 in Corneal Nerve Regeneration Diabetes Volume 65, July 2016

2.98 6 0.029–fold in miR-182 agomir–transfected TGsensory neurons (n = 4 per group) (Fig. 3C). These datademonstrate that miR-182 promotes the growth of neuritesfrom diabetic trigeminal sensory neurons in vitro.

miR-182 Promotes the Attenuation of CornealEpithelial Wound Healing and Innervation of theSubbasal Layer of Corneal Nerves in Diabeticdb/db MiceAfter 3 days of subconjunctival injections, miR-182 wasexpressed at 5.12 6 0.20–fold higher levels in TG sensoryneurons versus neurons in the NTC-treated mice (n = 10per group) (Fig. 4A). Representative images of TG cola-beled with miR-182 and Fluoro-Gold in diabetic db/dbmice are presented in Fig. 4B; these show that moreFluoro-Gold-labeled cell bodies were observed in the me-dial region of the ipsilateral TG compared with that inNTC-treated mice. Moreover, miR-182 was observed to becostained with NF200-positive cells (Fig. 4C). We also gotthe same results in control db/+ mice (data not shown).These results suggest that miR-182 is overexpressed in alarge proportion of trigeminal sensory neurons.

Quantitative PCR analysis showed that miR-182 wasexpressed at a 71.24 6 0.14–fold higher level in the cor-neas of the db/db mice with a subconjunctival injection ofmiR-182 agomir versus the NTC-treated mice (n = 10 pergroup) (Fig. 5A). Punctate fluorescence staining showed asignificant difference with regard to the corneal epithelialhealing rate within 48 h of the corneal epithelium scrapebetween control and miR-182 agomir–injected db/db mice(Fig. 5B-i). The size of the corneal epithelium defect in themiR-182 agomir–injected diabetic mice (9.73 6 0.43%;n = 10) was remarkably improved compared with thatof the diabetic mice (54.78 6 0.49%; n = 10) and theNTC-treated diabetic mice (52.726 0.45%; n = 10), whichreached a level comparable to that of the control mice

(18.59 6 0.36%; n = 10) (Fig. 5B-ii). Representative im-ages of innervation of the subbasal layer are presented inFig. 5C-i. At day 28 after abrasion, the diabetic mice thatreceived miR-182 agomir treatment displayed a significantincrease in corneal nerve density in both the central andperipheral zones compared with the agomir NTC-treateddiabetic mice (n = 6 per group) (Fig. 5C-ii and iii). Cornealnerve regeneration is associated with equal functional re-covery. At day 28 after corneal epithelial debridement, thecorneal sensation in the diabetic mice receiving the miR-182agomir injection increased significantly compared with thatin the NTC-treated mice and returned almost to the level ofthe control db/+ mice (n = 10 per group) (Fig. 5C-iv).

NOX4 Is Directly Targeted by miR-182To study the molecular mechanism of miR-182 in diabeticTG sensory neurons and diabetic keratopathy, we used insilico prediction and a luciferase reporter assay to search forpotential miR-182 target genes. Using in silico prediction,we followed three different miRNA target predictionalgorithms: PicTar, miRanda, and TargetScan. Three geneswere implicated in oxidative stress, including membraneprotein, palmitoylated 1 (MPP1); protein phosphatase 1,regulatory (inhibitor) subunit 13B (PPP1R13B); and NOX4.To investigate whether miR-182 targets these 3 genes, weperformed a luciferase reporter assay in SH-SY5Y neuroblas-toma cells. In view of the upregulation of NOX4 in TGneurons from diabetic mice, we found the possibility of adirect link only between miR-182 and NOX4. A significantdecrease of the relative luciferase activity was observedwhen pmiR-RB-REPORT-NOX4–39 UTR was cotransfectedwith an miR-182 agomir (n = 4 per group) (Fig. 6A). Notably,the mutation of the perfectly miR-182 complementary sitein the 39 UTR of NOX4 (TGCCAAA → ACGGTTT) abolishedthe suppressive effect of miR-182 through the disruption ofthe interaction between miR-182 and NOX4.

Figure 3—miR-182 promotes diabetic trigeminal sensory neuron growth in vitro. A: Primary cultured TG sensory neurons were transfectedwith miR-182 agomir (200 mmol/L) to achieve robust and predictable miR-182 overexpression in TG neurons derived from both control anddb/db mice (n = 4 per group). B: miR-182 agomir promotes diabetic TG neurite growth in vitro. The TG neurons treated with NG (5 mmol/LD-glucose plus 20 mmol/L L-glucose) served as the control. The data represent the results of four different experiments. Scale bar = 100 mm.C:miR-182 effects on the neurite growth of neurons from the db/db and the control db/+ mice. *P < 0.05 (n = 4 per group). ns, not significant.

diabetes.diabetesjournals.org Wang and Associates 2025

The NOX4 protein level was decreased in TG cells bymiR-182 agomir treatment, but it increased with miR-182antagomir treatment (n = 4 per group) (Fig. 6B-i and ii).However, miR-182 generated no effect on the expressionof NOX2, another NAPDH isoform, with same treatment(Fig. 6B-i and iii). We then detected the effect of miR-182on the regulation of the NOX4 or NOX2 protein in TGcells under HG conditions in vitro. In contrast to thedownregulation of Sirt1 and miR-182 expression, NOX4protein levels were increased upon HG treatment (Fig.6C). In addition, the NOX4 expression levels were signif-icantly downregulated after 48 h of miR-182 agomir treat-ment, whereas NOX2 expression remained at comparablelevels (n = 3 per group) (Fig. 6C). Next, diabetic adultsensory neurons from db/db or db/+ mice were treatedwith miR-182 agomir and cultured in the HG medium.Representative results showed that NOX4 was colocalizedwith NF200 and that the expression of NOX4 was signif-icantly downregulated in the diabetic TG cells after miR-182agomir treatment (Fig. 6D).

Oxidant-Antioxidant Imbalance in Diabetic TG Neuronsand Upregulation of NOX4 in TG Neurons FromDiabetic MiceMouse Oxidative Stress and Antioxidant Defense RT2 PCRarrays were performed to investigate the oxidant-antioxidantimbalance that was involved in the diabetic TG neurons. Ofthe 84 genes assayed in the scatter plot (Fig. 7A), 24 tran-scripts were downregulated (Supplementary Table 4) and 5

transcripts were upregulated (Supplementary Table 5).Among these genes, NOX4 was expressed at a 10.11-foldhigher level in diabetic TG neurons compared with the con-trol neurons. The expression levels of NOX4 mRNA (n = 10per group) and protein (n = 3 per group) were significantlyupregulated in the diabetic TG neurons compared with thecontrols (Fig. 7B and C). Representative results show theNOX4-positive cells were significantly increased in the neu-ronal cells of diabetic mice, with stronger fluorescence uponstaining, and NOX4 was colocalized with NF200-positive TGneurons (Fig. 7D), suggesting that NOX4 expression wasmarkedly upregulated in diabetic TG neurons.

NOX4 Is a Functional Target of miR-182 in DiabeticCorneal Nerve RegenerationAn Ad-NOX4, Ad-expressing siRNA-NOX4, or Ad-GFPviral preparation was injected below the conjunctiva onthe same day the corneal epithelium was injured aftermiR-182 agomir or NTC treatment for 24 h. After injury(48 h), the NOX4 knockdown in corneal epithelia withmiR-182 agomir efficiently promoted the wound healingprocess (Fig. 8A), and the wound area in diabetic micethat were administered Ad-expressing siRNA-NOX4 plusmiR-182 was most significantly decreased relative toother groups (Fig. 8B). Conversely, NOX4 overexpressionremarkably antagonized the promotion effect of miR-182agomir on corneal wound healing. At day 28 after abra-sion, nerve staining analysis revealed that knockdown ofNOX4 in corneal epithelia with miR-182 agomir promoted

Figure 4—The expression of miR-182 in TGs of diabetic db/db mice after subconjunctival injection. A: After 3 days of subconjunctivalinjection, miR-182 was expressed at 5.12 6 0.20–fold higher levels in TG sensory neurons versus the NTC-treated mice (n = 10 pergroup). *P < 0.05. B: Representative images of miR-182 and Fluoro-Gold colabeling in TGs of diabetic db/db mice. Scale bar = 100 mm.C: Representative images of miR-182 and NF200 colabeling in TGs of diabetic db/db mice. Scale bar = 50 mm.

2026 Sirt1/miR-182 in Corneal Nerve Regeneration Diabetes Volume 65, July 2016

corneal nerve regeneration in diabetic mice (Fig. 8C). Thediabetic mice that received Ad-expressing siRNA-NOX4 plusmiR-182 agomir treatment displayed a significant increasein corneal nerve density compared with the NTC-treateddiabetic mice (n = 6 per group) (Fig. 8D). Importantly, themiR-182–enhanced corneal nerve growth was obviously hin-dered in diabetic mice treated with Ad-NOX4 with miR-182(Fig. 8D). After subconjunctival injection, NOX4 was local-ized in the corneal epithelium (Fig. 8E). Compared with thecorneal epithelia of the group infected with Ad-expressingsiRNA-NOX4, the corneal epithelia of the Ad-NOX4-infectedgroup receiving miR-182 agomir treatment were character-ized by high NOX4 mRNA expression (Fig. 8F). In addition,several factors that have been used as markers for cornealwound healing—phospho-AKT, epidermal growth factorreceptor, and Ki67 (28)—were also detected by immuno-fluorescence. The expression levels of phospho-AKT,epidermal growth factor receptor, and Ki67 were signifi-cantly increased in diabetic mice with Ad-expressing

siRNA-NOX4 infection and miR-182 treatment (Fig.8E), further demonstrating that downregulation ofNOX4 by either miR-182 targeting or NOX4 siRNAresults in an increase in corneal nerve growth.

DISCUSSION

In this article we report on miR-182 as a Sirt1 downstreameffector to protect against peripheral nerve damage in TGneurons and keratopathy in an experimental mouse modelof diabetes. We used the adenoviral system to overexpressSirt1 in TG tissues and identified miR-182 as an upregulatedmiRNA. Moreover, the promoter activity of miR-182 isenhanced by Sirt1. These results indicate that miR-182maybe a downstream effector of Sirt1.

Several miRNAs could be used in a potential therapeu-tic approach for peripheral nerve regeneration, includingmiR-21 and miR-29b. miR-21 was able to promote axongrowth in adult dorsal root ganglion neurons by targetingthe Sprouty2 protein (29). miR-29b was reported to exhibit

Figure 5—miR-182 promotes the attenuation of corneal epithelial wound healing and innervation of the subbasal layer of corneal nerves indiabetic db/dbmice. A: High miR-182 expression was present after a subconjunctival injection of miR-182 agomir in the corneas of diabeticdb/db mice (2.5 nmol per eye both for miR-182 agomir and agomir NTC; n = 10 per group). The untreated group was used as the controlgroup. Significant differences were identified (*P < 0.05). B: The miR-182 agomir promotes the attenuation of corneal epithelial woundhealing in diabetic db/dbmice. i: The fluorescein-stained corneas 48 h after injury. ii: The remaining wound area 48 h after injury. *P < 0.05.C: miR-182 promotes the attenuation of corneal nerve innervation. i: Representative images of the central zone of the subbasal nervesof the cornea from the control db/+ mice, the agomir NTC-treated db/db mice, and the agomir-treated db/db mice (top row; scale bar = 100 mm)and representative images of the peripheral zone of the subbasal nerves of the cornea from the control db/+ mice, the agomir NTC-treated db/dbmice, and the miR-182 agomir-treated BKS-db/dbmice (bottom row; scale bar = 50 mm). The percentages of the areas occupied by the subbasalnerves in the central zone (ii ) and the peripheral zone (iii ) are shown. The untreated db/+ mice served as the control. Data aremean 6 SEM (n = 6 per group). iv: Corneal nerve regeneration is associated with equal functional recovery. Data are mean 6 SEM(n = 10 per group). *P < 0.05.

diabetes.diabetesjournals.org Wang and Associates 2027

neuronal protective effects in sciatic nerve regeneration(30). In this study miR-182 promoted corneal sensory nervegrowth in a chronic diabetic neuropathy mice model. Thecolocalization of miR-182 and Fluoro-Gold by immunofluo-rescence indicates the retrograde transport of miR-182 ago-mir from the cornea to the TG. The responses to miR-182

overexpression mainly occurred in TG sensory neurons; thisis supported by the colocalization of miR-182 and NF200 inTG neurons. Furthermore, miR-182 agomir treatment sig-nificantly increased the corneal nerve density in diabetes.These results demonstrate that miR-182 significantly in-creased corneal nerve regeneration in diabetic mice.

Figure 6—NOX4 is directly targeted by miR-182. A: The miR-182 binding site in the 39 UTR of NOX4 was assessed using a luciferasereporter assay. Luciferase activity was detected by a luminometer after 48 h of cotransfection. Data are represented as mean6 SEM (n = 4per group). *P< 0.05. Mut, mutant; NC, negative control; WT, wild type. B: NOX4 protein levels are downregulated by miR-182. i: Data fromthe gels. ii and iii: Normalization to GAPDH. The NOX4 protein level (ii ) was decreased in primary cultured TG cells by miR-182 agomirtreatment, but it was increased with miR-182 antagomir treatment (n = 4 per group). However, miR-182 generated no effect on theexpression of NOX2 (iii ), another NAPDH isoform, with same treatment. *P < 0.05. C: The effect of miR-182 on the regulation of theNOX4 or NOX2 protein in primary cultured TG cells under HG conditions in vitro (i ). In contrast to the downregulation of Sirt1 and miR-182expression, NOX4 protein levels were increased upon HG treatment (ii). In addition, NOX4 expression levels were significantly downregulatedafter 48 h of miR-182 agomir treatment, whereas NOX2 expression remained at uncomparable levels (iii ) (n = 3 per group). *P < 0.05.D: Representative results showed that NOX4 was colocalized with NF200 and that the expression of NOX4 was significantly down-regulated in diabetic TG cells after miR-182 agomir treatment. The data represent the results from three different experiments. Scale bar = 50 mm.

2028 Sirt1/miR-182 in Corneal Nerve Regeneration Diabetes Volume 65, July 2016

Accumulating evidence implies that Sirt1 has a criticalneuroprotective effect on nerve injury (31,32). Consistentwith this, Ogawa et al. (33) reported on the expression ofSirt1 in the TG of developing mice. Although severalmiRNAs are reported to be regulated by Sirt1, such asmiR-134 in the brain (34) and miR-138 in mammalianaxon regeneration (35), the spectrum of Sirt1-regulatedmiRNAs in diabetic TG sensory neurons remains to beexplored in detail. Previous studies proposed that miR-182 was implicated in multiple functional processes, suchas oncogenesis and light/dark transition in the retina(36), T helper cell clonal expansion (37), and lipid homeo-stasis. miR-182 was recently reported to be tightly asso-ciated with metastasis of primary sarcomas (18) andROS-induced premature senescence (38).

Most investigators believe the theory that abnormaloxidative stress mediates changes in diabetic neuropathy

and ROS accumulation–induced impaired antioxidantcapabilities in response to hyperglycemia; this hasbeen considered as one of the critical pathologicalmechanisms in diabetic neuropathy (39,40). Consistentwith this notion, inhibition of ROS signaling preventshyperglycemia-induced complications, including dia-betic keratopathy (28,41). As targets for diabetic com-plications (42), NOX4 expression and NOX4-derivedROS production could be significantly induced by di-abetes and HG (43,44). These findings suggest thatROS-related NOX4 is likely to be involved in diabeticneuropathy.

miR-182 actually has many targets, and several ofthese have been reported previously, such as cortactin andRac1 in amygdala-dependent memory formation (45).That we investigated only one target gene of miR-182in this study may seem like an oversimplification. We

Figure 7—Oxidant-antioxidant imbalance in diabetic TG neurons and upregulation of NOX4 in TG neurons from diabetic mice. A: MouseOxidative Stress and Antioxidant Defense RT2 PCR array assay. B: The expression of NOX4 mRNA (n = 10 per group) was significantlyupregulated in diabetic TG neurons compared with the controls. *P < 0.05. C: The expression of NOX4 protein (n = 3 per group)was significantly upregulated in diabetic TG neurons compared with the controls (left, data from the gels; right, normalization to GAPDH).*P < 0.05. D: Representative results of coimmunostaining with NOX4 and NF200 antibodies. The NOX4-positive cells were significantlyincreased in the neuronal cells of diabetic mice, with stronger staining fluorescence, and NOX4 was colocalized with NF200-positive TGneurons, suggesting that NOX4 expression was markedly upregulated in diabetic TG neurons. Scale bar = 50 mm.

diabetes.diabetesjournals.org Wang and Associates 2029

focused on investigating NOX4 as a miR-182 target genebecause 1) NOX4 is a major source of ROS in peripheralsensory neurons; 2) NOX4 expression was significantlydifferent between diabetic TG tissues and control tissuesbased on the PCR array test; and 3) NOX4 was presentin the miRNA predictions using three methods. As weexpected, NOX4 is directly targeted by miR-182, and itacts as a key downstream target to mediate functionselicited by the Sirt1-miR-182 axis in corneal nerve regen-eration in diabetes; this strongly demonstrates that NOX4is involved in diabetic keratopathy. To understand furtherhow miR-182 targets NOX4, we performed rescue exper-iments in a corneal injury model with overexpression orknockdown of NOX4 expression. The promotion effectof miR-182 on corneal wound healing and nerve regener-ation was counteracted by NOX4 overexpression, whereas

downregulating the expression of NOX4 enhanced the func-tional effect of miR-182.

Acknowledgments. The authors thank Xiaolong Cai, Hanbio Biotechnol-ogy Co., Ltd. (Shanghai, China); Meifang Dai, CloudSeq Biotech Inc. (Shanghai,China); Lei Zhang, Hubei University of Technology (Wuhan, China); and Ji Xu,RiboBio Co., Ltd. (Guangzhou, China), for help with preparing the manuscript. Theauthors acknowledge the editorial assistance of Scribendi Inc., Chatham, Canada.Funding. This study was supported by the State Key Basic Research (973)Project of China (2012CB722409), the National Natural Science Foundation ofChina (30901637, 81370990, 81300742), and the Shandong Province NaturalScience Foundation (BS2012YY030, BS2013YY013).Duality of Interest. No potential conflicts of interest relevant to this articlewere reported.Author Contributions. Y.W. interpreted the data and wrote the manu-script. Y.W., X.Z., and X.W. collected and analyzed the data. Y.W. and L.X.

Figure 8—NOX4 is a functional target of miR-182 in diabetic corneal nerve regeneration in diabetes. A: The corneal surface wound wasmonitored using fluorescein dye. B: The remaining wound area 48 h after injury (n = 6 per group). *P < 0.05. C: Representative images ofinnervation of the subbasal corneal nerves. Scale bar = 100 mm. D: The results of the percentage of the area occupied by the subbasalnerves in the central zone. Data are mean 6 SEM (n = 6 per group). *P < 0.05. E: Representative results of immunostaining with NOX4,phospho-AKT (p-AKT), epidermal growth factor receptor (EGFR), and Ki67 in corneas (n = 6 per group). The expression of p-AKT, EGFR,and Ki67 were significantly increased in diabetic mice infected with Ad-expressing NOX4 siRNA and miR-182 treatment. Scale bars =50 mm. F: The expression of NOX4 in corneas. Compared with the corneal epithelia of the group infected by Ad-expressing NOX4 siRNA,the corneal epithelia of the group infected by Ad-NOX4 and treated with miR-182 agomir were characterized by high NOX4 mRNAexpression. Data are mean 6 SEM (n = 10 per group). ns, not significant; OE, overexpression.

2030 Sirt1/miR-182 in Corneal Nerve Regeneration Diabetes Volume 65, July 2016

obtained funding for the study. X.Z. and Y.D. contributed the animal model. P.C.performed the cell culture and treatment. All authors read and approved the finalmanuscript. Y.W. is the guarantor of this work and, as such, had full access to allthe data in the study and takes responsibility for the integrity of the data and theaccuracy of the data analysis.

References1. Schultz RO, Peters MA, Sobocinski K, Nassif K, Schultz KJ. Diabetic ker-atopathy as a manifestation of peripheral neuropathy. Am J Ophthalmol 1983;96:368–3712. Jeri�c M, Vuica A, Bori�c M, et al. Diabetes mellitus affects activity of calcium/calmodulin-dependent protein kinase II alpha in rat trigeminal ganglia. J ChemNeuroanat 2015;64–65:12–193. Beckers HJ, Klooster J, Vrensen GF, Lamers WP. Ultrastructural identifi-cation of trigeminal nerve endings in the rat cornea and iris. Invest OphthalmolVis Sci 1992;33:1979–19864. Acosta MC, Tan ME, Belmonte C, Gallar J. Sensations evoked by selectivemechanical, chemical, and thermal stimulation of the conjunctiva and cornea.Invest Ophthalmol Vis Sci 2001;42:2063–20675. de Leeuw AM, Chan KY. Corneal nerve regeneration. Correlation betweenmorphology and restoration of sensitivity. Invest Ophthalmol Vis Sci 1989;30:1980–19906. Nones CF, Reis RC, Jesus CH, Veronez DA, Cunha JM, Chichorro JG.Orofacial sensory changes after streptozotocin-induced diabetes in rats. BrainRes 2013;1501:56–677. Bikbova G, Oshitari T, Tawada A, Yamamoto S. Corneal changes in diabetesmellitus. Curr Diabetes Rev 2012;8:294–3028. Jiang M, Wang J, Fu J, et al. Neuroprotective role of Sirt1 in mammalianmodels of Huntington’s disease through activation of multiple Sirt1 targets. NatMed 2011;18:153–1589. Jeong H, Cohen DE, Cui L, et al. Sirt1 mediates neuroprotection frommutant huntingtin by activation of the TORC1 and CREB transcriptional pathway.Nat Med 2011;18:159–16510. Araki T, Sasaki Y, Milbrandt J. Increased nuclear NAD biosynthesis andSIRT1 activation prevent axonal degeneration. Science 2004;305:1010–101311. Rigol M, Dunjko V, Olshanii M. Thermalization and its mechanism for ge-neric isolated quantum systems. Nature 2008;452:854–85812. Ramadori G, Fujikawa T, Anderson J, et al. SIRT1 deacetylase in SF1neurons protects against metabolic imbalance. Cell Metab 2011;14:301–31213. Wang Y, Zhao X, Shi D, et al. Overexpression of SIRT1 promotes highglucose-attenuated corneal epithelial wound healing via p53 regulation of theIGFBP3/IGF-1R/AKT pathway. Invest Ophthalmol Vis Sci 2013;54:3806–381414. Gao J, Wang Y, Zhao X, Chen P, Xie L. MicroRNA-204-5p-mediated reg-ulation of SIRT1 contributes to the delay of epithelial cell cycle traversal in di-abetic corneas. Invest Ophthalmol Vis Sci 2015;56:1493–150415. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function.Cell 2004;116:281–29716. Peng H, Hamanaka RB, Katsnelson J, et al. MicroRNA-31 targets FIH-1 topositively regulate corneal epithelial glycogen metabolism. FASEB J 2012;26:3140–314717. Winkler MA, Dib C, Ljubimov AV, Saghizadeh M. Targeting miR-146a totreat delayed wound healing in human diabetic organ-cultured corneas. PLoSOne 2014;9:e11469218. Funari VA, Winkler M, Brown J, Dimitrijevich SD, Ljubimov AV, SaghizadehM. Differentially expressed wound healing-related microRNAs in the human di-abetic cornea. PLoS One 2013;8:e8442519. Xu S, Witmer PD, Lumayag S, Kovacs B, Valle D. MicroRNA (miRNA)transcriptome of mouse retina and identification of a sensory organ-specificmiRNA cluster. J Biol Chem 2007;282:25053–2506620. Gheysarzadeh A, Yazdanparast R. STAT5 reactivation by catechin modulatesH2O 2-induced apoptosis through miR-182/FOXO1 pathway in SK-N-MC cells.Cell Biochem Biophys 2015;71:649–656

21. Li G, Luna C, Qiu J, Epstein DL, Gonzalez P. Alterations in microRNA expressionin stress-induced cellular senescence. Mech Ageing Dev 2009;130:731–74122. Zherebitskaya E, Akude E, Smith DR, Fernyhough P. Development of se-lective axonopathy in adult sensory neurons isolated from diabetic rats: role ofglucose-induced oxidative stress. Diabetes 2009;58:1356–136423. Chapleau MW. The continuing saga of neuronal oxidative stress in hyper-tension: Nox, Nox who’s there, and where? Hypertension 2007;50:600–60224. Sullivan KA, Lentz SI, Roberts JL Jr, Feldman EL. Criteria for creating andassessing mouse models of diabetic neuropathy. Curr Drug Targets 2008;9:3–1325. Yang L, Di G, Qi X, et al. Substance P promotes diabetic corneal epithelialwound healing through molecular mechanisms mediated via the neurokinin-1receptor. Diabetes 2014;63:4262–427426. Wu JH, Gao Y, Ren AJ, et al. Altered microRNA expression profiles in retinaswith diabetic retinopathy. Ophthalmic Res 2012;47:195–20127. Nitoda E, Kallinikos P, Pallikaris A, et al. Correlation of diabetic retinopathy andcorneal neuropathy using confocal microscopy. Curr Eye Res 2012;37:898–90628. Xu KP, Li Y, Ljubimov AV, Yu FS. High glucose suppresses epidermal growthfactor receptor/phosphatidylinositol 3-kinase/Akt signaling pathway and attenu-ates corneal epithelial wound healing. Diabetes 2009;58:1077–108529. Strickland IT, Richards L, Holmes FE, Wynick D, Uney JB, Wong LF.Axotomy-induced miR-21 promotes axon growth in adult dorsal root ganglionneurons. PLoS One 2011;6:e2342330. Kole AJ, Swahari V, Hammond SM, Deshmukh M. miR-29b is activatedduring neuronal maturation and targets BH3-only genes to restrict apoptosis.Genes Dev 2011;25:125–13031. Donmez G, Outeiro TF. SIRT1 and SIRT2: emerging targets in neuro-degeneration. EMBO Mol Med 2013;5:344–35232. Zochodne DW, Ramji N, Toth C. Neuronal targeting in diabetes mellitus: astory of sensory neurons and motor neurons. Neuroscientist 2008;14:311–31833. Ogawa T, Wakai C, Saito T, et al. Distribution of the longevity gene product,SIRT1, in developing mouse organs. Congenit Anom (Kyoto) 2011;51:70–7934. Gao J, Wang WY, Mao YW, et al. A novel pathway regulates memory andplasticity via SIRT1 and miR-134. Nature 2010;466:1105–110935. Liu CM, Wang RY, Saijilafu, Jiao ZX, Zhang BY, Zhou FQ. MicroRNA-138 andSIRT1 form a mutual negative feedback loop to regulate mammalian axon re-generation. Genes Dev 2013;27:1473–148336. Krol J, Busskamp V, Markiewicz I, et al. Characterizing light-regulatedretinal microRNAs reveals rapid turnover as a common property of neuronalmicroRNAs. Cell 2010;141:618–63137. Stittrich AB, Haftmann C, Sgouroudis E, et al. The microRNA miR-182 isinduced by IL-2 and promotes clonal expansion of activated helper T lympho-cytes. Nat Immunol 2010;11:1057–106238. Chen Z, Shentu TP, Wen L, Johnson DA, Shyy JY. Regulation of SIRT1 byoxidative stress-responsive miRNAs and a systematic approach to identify its rolein the endothelium. Antioxid Redox Signal 2013;19:1522–153839. Forbes JM, Cooper ME. Mechanisms of diabetic complications. Physiol Rev2013;93:137–18840. Song B, Scheuner D, Ron D, Pennathur S, Kaufman RJ. Chop deletion re-duces oxidative stress, improves beta cell function, and promotes cell survival inmultiple mouse models of diabetes. J Clin Invest 2008;118:3378–338941. Kim J, Kim CS, Kim H, Jeong IH, Sohn E, Kim JS. Protection against ad-vanced glycation end products and oxidative stress during the development ofdiabetic keratopathy by KIOM-79. J Pharm Pharmacol 2011;63:524–53042. Gorin Y, Block K. Nox as a target for diabetic complications. Clin Sci (Lond)2013;125:361–38243. Eid AA, Ford BM, Block K, et al. AMP-activated protein kinase (AMPK)negatively regulates Nox4-dependent activation of p53 and epithelial cell apo-ptosis in diabetes. J Biol Chem 2010;285:37503–3751244. Block K, Gorin Y, Abboud HE. Subcellular localization of Nox4 and regulationin diabetes. Proc Natl Acad Sci U S A 2009;106:14385–1439045. Griggs EM, Young EJ, Rumbaugh G, Miller CA. MicroRNA-182 regulatesamygdala-dependent memory formation. J Neurosci 2013;33:1734–1740

diabetes.diabetesjournals.org Wang and Associates 2031