Fax +41 61 306 12 34E-Mail karger@karger.chwww.karger.com

Clinical Translational Research

Oncology 2012;83:273–282 DOI: 10.1159/000342083

Methylated DNA and Total DNA in Serum Detected by One-Step Methylation-Specific PCR Is Predictive of Poor Prognosis for Breast Cancer Patients

Noriko Fujita a Takahiro Nakayama a Noriaki Yamamoto b Seung Jin Kim a

Kenzo Shimazu a Atsushi Shimomura a Naomi Maruyama a Koji Morimoto a

Yasuhiro Tamaki a Shinzaburo Noguchi a

a Department of Breast and Endocrine Surgery, Osaka University Graduate School of Medicine, Osaka , and

b Central Research Laboratories, Sysmex Corporation, Kobe , Japan

18) showed a much worse OS rate at 100 months (65 vs. 94%; p ! 0.001) than the others (n = 318). Conclusions: Met-DNA in serum detected with the OS-MSP assay constitutes a sig-nificant and independent prognostic factor, and its combi-nation with total DNA in serum seems to be even more ef-fective for prediction of prognosis for breast cancer patients.

Copyright © 2012 S. Karger AG, Basel

Introduction

For an accurate decision on the indication of adjuvant therapy for breast cancer patients, it is very important to obtain precise information on the risk of recurrence. Con-ventional prognostic factors are clinically useful, but their accuracy remains unsatisfactory. These factors include nodal status, tumor size, histological grade, estrogen re-ceptor (ER), progesterone receptor (PR), and HER2 as well as the results of recently developed multigene assays such as Oncotype DX [1] and MammaPrint [2] . Thus, the de-velopment of new and more precise diagnostic methods for prognosis prediction has been eagerly awaited.

Promoter hypermethylation of the various genes has re-portedly been detected in breast cancer tissues, and inter-

Key Words

Breast cancer � Methylation � DNA � Serum � Prognosis

Abstract

Purpose: We recently developed the one-step methylation-specific PCR (OS-MSP) assay which can detect methylated DNA (met-DNA) in serum with high sensitivity. To examine its prognostic value, we applied this new assay to the detec-tion of met-DNA in serum of breast cancer patients. Meth-

ods: Serum samples taken before surgery from 336 primary invasive breast cancer patients were subjected to the OS-MSP assay for the promoter regions of GSTP1 , RASSF1A , and RAR � 2 . The assay outcome was considered positive when methylation was detected in at least one of these three genes. Total DNA content in serum was also determined. Re-

sults: Of the 336 stage I/II patients, 33 (10%) were positive for met-DNA in serum and showed a significantly worse overall survival (OS) rate at 100 months (78 vs. 95%; p = 0.002) than those with negative findings (n = 303). Patients with high to-tal DNA in serum (n = 112) also showed a significantly worse OS rate at 100 months (86 vs. 97%; p = 0.001) than those with low total DNA in serum (n = 224). Moreover, patients both positive for met-DNA and with high total DNA in serum (n =

Received: May 24, 2012 Accepted after revision: July 13, 2012 Published online: September 5, 2012

Shinzaburo Noguchi, MD Department of Breast and Endocrine Surgery Osaka University Graduate School of Medicine 2-2-E10 Yamadaoka, Suita-shi, Osaka 565-0871 (Japan) Tel. +81 6 6879 3772, E-Mail noguchi   @   onsurg.med.osaka-u.ac.jp

© 2012 S. Karger AG, Basel 0030–2414/12/0835–0273$38.00/0

Accessible online at: www.karger.com/ocl

Fujita et al.   Oncology 2012;83:273–282274

estingly, the methylated genes have also been found in se-rum DNA of 10–30% of primary breast cancer patients and of 50–80% of metastatic breast cancer patients [3, 4] . Only a few studies have assessed the prognostic value of methylated DNA (met-DNA) in serum of breast cancer pa-tients [5–9] . Muller et al. [5] reported that breast cancer patients with methylated RASSF1A and APC in serum showed a poorer prognosis than those without it. Similar results have also been reported for lung cancer and colon cancer [10–13] , suggesting that the methylated genes in tu-mor tissues are released into the blood as circulating tu-mor genomes (CTGs) and that detection of CTGs might be clinically useful for the prediction of recurrence [14–17] .

In spite of its potential as a prognostic factor, detection of CTGs in serum by means of methylation-specific PCR (MSP) has yet to be successfully developed as a routine clinical test. To begin with, the level of total DNA in se-rum is very low and the process of DNA extraction from the serum results in a significant loss of DNA, while bi-sulfite treatment and the subsequent extraction of bisul-fite-treated DNA result in the degradation as well as a further loss of a significant amount of DNA [18, 19] . Be-cause of these drawbacks, it is thought that the conven-tional MSP assay (cMSP) has not been successfully devel-oped as a routine clinical test.

Very recently, we have been able to develop the one-step MSP (OS-MSP) assay which is a more sensitive meth-od for detection of met-DNA in serum of breast cancer patients [20] . In the OS-MSP assay, the first DNA extrac-tion step from the serum is eliminated and the incubation time with bisulfite is shortened, while the methylated genes (GSTP1 , RASSF1A , and RAR � 2) can be detected with a sensitivity about 200 times higher than that of the cMSP assay. In the study presented here, we applied this new assay to the detection of the methylated genes in se-rum and investigated whether the presence of such meth-ylated genes might be associated with a poor prognosis for breast cancer patients. We also examined total DNA in serum since it has been reported that breast cancer pa-tients have a significantly higher level of serum DNA than healthy controls [21–24] , so that total DNA in serum might also be an important prognostic factor.

Materials and Methods

Patients Primary invasive breast cancer patients (n = 336) who under-

went breast-conserving surgery or mastectomy at Osaka Univer-sity Hospital between March 2000 and October 2004 were retro-spectively included in this study. Serum samples were obtained

before surgery and tumor samples at surgery. Patients who had received neoadjuvant chemotherapy and/or hormonal therapy were excluded. Informed consent was obtained from each patient before blood and tumor tissue collection, and serum samples and tumor tissues were stored at –80   °   C until use. The median follow-up period was 90 months (range 12–127) and median age of the patients at surgery was 53 years (range 22–83). The clinicopatho-logical characteristics of the patients are summarized in table 1 . Patients were treated with adjuvant therapy according to the phy-sician’s discretion but essentially in compliance with the St. Gal-len recommendation [25, 26] . No adjuvant therapy was adminis-tered to 35, adjuvant hormonal therapy to 199, adjuvant chemo-therapy to 38, and adjuvant chemo-hormonal therapy to 64 patients. After surgery, patients were followed up every 3 months for 1–2 years, every 6 months for 3–5 years, and once every year thereafter. The frequency of hospital visits by patients treated with adjuvant chemotherapy and/or radiation therapy was in ac-cordance with the treatment schedule. Serum samples were also obtained from the 80 healthy women (median age 54 years; range 23–77) without breast cancer by physical examination and mam-mography and/or ultrasonography.

OS-MSP Assay for GSTP1, RASSF1A, and RAR � 2 Promoter Hypermethylation in Serum The OS-MSP assay was conducted as previously described

[20] . In brief, a total of 1,000 � l of serum from each patient was solubilized by incubation in lysis buffer (5 M guanidine-HCl and 0.65 mg/ml proteinase K) at 50   °   C for 1 h and then incubated with a 5 M bisulfite solution at 80   °   C for 40 min. Bisulfite-modified DNA was purified using a DNA purification kit (Qiagen, Valen-cia, Calif., USA) and eluted in 50 � l of dH 2 O. Modification by bisulfite was completed with 0.3 M NaOH treatment for 5 min at room temperature, after which bisulfite-modified DNA was ex-tracted by gel filtration (GE Healthcare, Princeton, N.J., USA) for use as the PCR template. Promoter hypermethylation of GSTP1 , RASSF1A , and RAR � 2 was then evaluated by MSP. Primer and probe sequences were as follows: GSTP1 forward primer, 5 � -CGTCGTGATTTAGTATTGGGGC-3 � ; GSTP1 reverse primer, 5 � -CTAATAACGAAAACTACGACGACGAAA-3 � ; GSTP1 probe,5 � -FAM-ATAAGGTTCGGAGGTCGCGAGGTTTTCGT - DDQ1-3 � ; RASSF1A forward primer, 5 � -ATAGTTTTTGTATTT - AGGTTTTTATTGCGC-3 � ; RASSF1A reverse primer, 5 � -GCT - AACAAACGCGAACCG-3 � ; RASSF1A probe, 5 � -FAM-TTGAA - GTCGGGGTTCGTTTTGTGGTTTCGT- DDQ1-3 � ; RAR � 2 for -ward primer, 5 � -GAATATCGTTTTTTAAGTTAAGTCGTC-3 � ; RAR � 2 reverse primer, 5 � -GAAACGCTACTCCTAACTCACG-3 � ; RAR � 2 probe, 5 � -FAM-AGGCGTAAAGGGAGAGAAGTT - GGTGTTTA- DDQ1-3 � . PCR amplifications were performed us-ing the Light Cycler 480 Real-Time PCR System (Roche Applied Science) under the following conditions: 1 cycle at 95   °   C for 10 min followed by 50 cycles at 95   °   C for 30 s, at 60   °   C for 30 s, and at 72   °   C for 30 s. Every sample was analyzed in a single assay for each gene.

Assay for Total DNA in Serum Quantification of total DNA was done as previously described

[20] . In brief, in order to quantify total DNA in serum after bisul-fite treatment, a genomic locus lacking a cytosine base was se-lected since such a locus is not affected by bisulfite treatment, and this locus was amplified by PCR using primers, probe, and stan-dard oligo DNA. Primer and probe sequences were as follows: the

DNA Methylation in Serum of Breast Cancer Patients

Oncology 2012;83:273–282 275

forward primer was 5 � -AGGGAGTAGAGAAAAAGTAGGAA - GATGAGT-3 � ; the reverse primer was 5 � -TCCAACATCACA - TCCAATCCA-3 � ; the probe was 5 � -FAM-AGGGTGATAATGA - GTGTGTTGGGAAATAGA-DDQ1-3 � , and standard oligo DNA was 5 � -AGGGAGTAGAGAAAAAGTAGGAAGATGAGTCCAGGGTGATAATGAGTGTGTTGGGAAATAGACCTGGATTGG

ATGTGATGTTGGA-3 � . PCR conditions have been mentioned above. Patients were divided into three equal groups according to the level of total DNA in serum (low, middle, and high), and those in the low and middle groups were combined and treated as the low total DNA group while those in the high group were treated as the high total DNA group.

Table 1. Relationship of met-DNA or total DNA in serum with clinicopathological parameters

n Met-DNA in serum T otal DNA in serum

met (–) met (+) p valuea lo w high p valuea

Total patients 336 303 (90) 33 (10) 224 (67) 112 (33) Menopausal status

Premenopausal 169 153 (91) 16 (10) 0.826 107 (63) 62 (37) 0.190 Postmenopausal 167 150 (90) 17 (10) 117 (70) 50 (30)

Tumor size t1 192 171 (89) 21 (11) 0.427 128 (67) 64 (33) 1.000 t2 144 132 (92) 12 (8) 96 (67) 48 (33)

Lymph node metastasis none 248 220 (89) 28 (11) 0.129b 170 (69) 78 (32) 0.219b

1–3 68 65 (96) 3 (4) 43 (63) 25 (37) ≥4 20 18 (90) 2 (10) 11 (55) 9 (45)

Histological grade G1 113 105 (93) 8 (7) 0.292c 76 (67) 37 (33) 0.658c

G2 163 146 (90) 17 (10) 110 (67) 53 (33) G3 59 51 (86) 8 (14) 38 (64) 21 (36) Unknown 1 1 (100) 0 (0) 0 (0) 1 (100)

ER Negative 77 64 (83) 13 (17) 0.018 49 (64) 28 (36) 0.521 Positive 259 239 (92) 20 (8) 175 (68) 84 (32)

PR Negative 117 104 (89) 13 (11) 0.562 80 (68) 37 (32) 0.627 Positive 219 199 (91) 20 (9) 144 (66) 75 (34)

HER2 Negative 250 228 (91) 22 (9) 0.094d 170 (68) 80 (32) 0.491 Positive 40 33 (83) 7 (18) 25 (63) 15 (38) Unknown 46 42 (91) 4 (9) 29 (63) 17 (37)

CEA Negative 330 297 (90) 33 (10) 1.000d 220 (67) 110 (33) 1.000d

Positive 6 6 (100) 0 (0) 4 (67) 2 (33) CA15-3

Negative 330 298 (90) 32 (10) 0.465d 220 (67) 110 (33) 1.000d

Positive 6 5 (83) 1 (17) 4 (67) 2 (33) Histological type

Invasive ductal carcinoma 313 283 (90) 30 (10) 0.093d 207 (66) 106 (34) 0.473d

Invasive lobular carcinoma 11 8 (73) 3 (27) 7 (64) 4 (36) Others 12 12 (100) 0 (0) 10 (83) 2 (17)

Treatment None 35 32 (91) 3 (9) 0.157d 25 (71) 10 (29) 0.665d

Hormone therapy 199 174 (87) 25 (13) 129 (65) 70 (35) Chemotherapy 38 35 (92) 3 (8) 24 (63) 14 (37) Hormone therapy and chemotherapy 64 62 (97) 2 (3) 46 (72) 18 (28)

Val ues are numbers with percentages in parentheses. met (–) = Met-DNA negative; met (+) = met-DNA positive. a �2 test. b None vs. 1–3 + >4. c G1 + G2 vs. G3. d Fisher’s exact test.

Fujita et al.   Oncology 2012;83:273–282276

DNA Extraction from Tumor Tissues DNA was also extracted as previously described [27] from

breast tumor tissues of patients who showed positive results for the OS-MSP assay in at least one of the three genes for determina-tion of the methylation status of the respective genes. One micro-gram of DNA was subjected to sodium bisulfite treatment using the EpiTect Bisulfite Kit (48; Qiagen) according to the manufac-turer’s protocol and was analyzed by MSP for promoter hyper-methylation of GSTP1 , RASSF1A , and RAR � 2 as previously de-scribed [20] .

Histological Grade, ER, PR, and HER2 Histological grade was determined using the Scarff-Bloom-

Richardson grading system [28] . ER and PR were classified as pos-itive when 6 10% of the tumor cells showed immunohistochemi-cally positive staining (ER: clone 6F11; PR: clone 16; Ventana Ja-pan K.K. and SRL Inc., Tokyo, Japan). HER-2 was determined immunohistochemically (Anti-human c-erbB-2 polyclonal anti-body; Nichirei Biosciences Inc., Tokyo, Japan) or by means offluorescence in situ hybridization (FISH) using PathVysion Her2 DNA Probe kits (SRL Inc.). When a tumor showed +3 immuno-staining or contained more than two genes per cell, it was consid-ered HER2 positive.

Statistical Analysis Associations of met-DNA or total DNA in serum with various

clinicopathological parameters were assessed by means of Pear-son’s � 2 test. Disease-free survival (DFS) was calculated as the time from surgery until the date of any recurrence of breast cancer (local or distant) or death of any cause. Overall survival (OS) was calculated as the time from surgery to the date of death of any cause. DFS and OS were assessed with the Kaplan-Meier method and log-rank tests. Univariate and multivariate analyses (Cox re-gression models) were used to evaluate the prognostic signifi-cance of various parameters. All statistical analyses were two-sid-ed and p ! 0.05 was judged to be significant. SPSS software (SPSS Inc., Chicago, Ill., USA) was used for all statistical analyses.

Results

Relationship between Met-DNA in Serum and Clinicopathological Parameters Promoter hypermethylation of GSTP1 , RASSF1A , and

RAR � 2 in serum at ratios of 7, 2 and 2%, respectively, was detected with the OS-MSP assay. When promoter hyper-methylation was found in at least one of these three genes, the OS-MSP assay result was considered to be positive for met-DNA in serum for subsequent analyses, which even-tually showed met-DNA positivity in serum of 10% of the patients. Associations of met-DNA in serum with various clinicopathological parameters are shown in table 1 . Pos-itivity of met-DNA in serum was significantly associated with ER-negative tumors (p = 0.018) but not with any oth-er parameters. The gene-basis analysis indicated that methylation of GSTP1 , but not of RASSF1A and RAR � 2 ,

was significantly (p = 0.038) associated with ER-negative tumors (online suppl. table 1; for all online suppl. mate-rial, see www.karger.com/doi/10.1159/000342083). Pro-moter methylation status of the methylation-positive marker genes of the 33 patients positive for met-DNA in serum was also analyzed in the corresponding tumor tis-sues. The gene of each promoter which was identified as methylated in serum DNA was also found to be methyl-ated in the corresponding tumor tissue of every patient without exception. Met-DNA in serum was positive in 2 (2.5%) of the 80 healthy women.

Total DNA in serum was 3.6 ng/ml (median; range 0.1–65.7) for breast cancer patients. The patients were di-vided into the three equal groups (high, middle, and low) according to the level of total DNA in serum. The middle and low groups were combined and treated as the low to-tal DNA group (n = 224), and the high group was treated as the high total DNA group (n = 112). The cutoff value for the high (n = 112) and low (n = 224) total DNA groups was 5.2 ng/ml. Patients in the high total DNA group were significantly more likely to be positive for met-DNA in serum than those in the low total DNA group (16.1 vs. 6.7%; p = 0.006). No other clinicopathological parameters were significantly associated with total DNA in serum ( table 1 ). Positivity was 1.8% for both CEA and CA15-3 and neither was significantly associated with met-DNA or total DNA.

Association of Prognosis with Met-DNA or Total DNA Patients positive for met-DNA in serum (n = 33)

showed significantly worse DFS and OS than those who were negative (n = 303; p = 0.032 and 0.002, respectively; fig. 1 a). Patients with high total DNA in serum (n = 112) also showed significantly worse DFS and OS than did those with low total DNA (n = 224; p = 0.001 and 0.001, respectively; fig. 1 b). Results of univariate and multivari-ate analyses of various parameters including met-DNA and total DNA in serum are shown in table 2 (DFS) and table 3 (OS). Met-DNA and total DNA in serum were sig-nificantly (p = 0.037 and 0.002, respectively) associated with DFS, while multivariate analysis demonstrated that met-DNA in serum was marginally (p = 0.052) and total DNA in serum significantly (p = 0.001) associated with DFS. Furthermore, univariate analysis showed that both met-DNA and total DNA in serum were significantly as-sociated with OS (p = 0.005 and 0.002, respectively), and multivariate analysis that both were also significantly as-sociated with OS (p = 0.029 and 0.003, respectively). Of the 80 healthy women, none was classified into the met-DNA positive and high total DNA group.

DNA Methylation in Serum of Breast Cancer Patients

Oncology 2012;83:273–282 277

a

b

Fig. 1. DFS and OS of breast cancer patients in relation to met-DNA in serum ( a ) and total DNA in serum ( b ). Met-DNA (–) = Met-DNA negative in serum; Met-DNA (+) = met-DNA positive in serum.

Table 2. Univariate and multivariate analysis of various prognostic factors for DFS

Parameters Univariate analysis Multivariate analysis M ultivariate analysis

HR 95% CI p value HR 95% CI p value HR 95% CI p value

Met-DNA in serum (positive vs. negative) 2.259 1.05–4.86 0.037 2.225 0.99–5.00 0.052Total DNA in serum (high vs. low) 2.556 1.41–4.63 0.002 2.698 1.47–4.94 0.001Menopausal status (post- vs. premenopausal) 1.361 0.75–2.47 0.310Histological grade (3 vs. 1, 2) 2.818 1.51–5.26 0.001 1.964 0.85–4.55 0.115 1.894 0.83–4.34 0.130ER (positive vs. negative) 0.479 0.26–0.89 0.019 1.148 0.44–2.98 0.778 1.133 0.44–2.92 0.796PR (positive vs. negative) 0.442 0.24–0.80 0.007 0.559 0.27–1.17 0.121 0.536 0.25–1.14 0.107HER2 (positive vs. negative) 3.136 1.63–6.02 0.001 2.308 1.11–4.80 0.025 2.466 1.19–5.11 0.015Tumor size (2 vs. 1) 1.264 0.70–2.29 0.438LN (positive vs. negative) 2.030 1.11–3.70 0.021 2.169 1.15–4.08 0.016 2.032 1.08–3.81 0.028Treatment (hormone therapy vs. none) 0.723 0.27–1.92 0.515Treatment (chemotherapy vs. none) 1.800 0.60–5.37 0.292Treatment (hormone therapy and chemotherapy vs. none) 0.962 0.32–2.87 0.945

HR = Hazard ratio; LN = lymph node metastasis.

Fujita et al.   Oncology 2012;83:273–282278

Fig. 2. DFS and OS of breast cancer patients in relation to combined met-DNA and total DNA in serum. Com-parison of patients positive for met-DNA and with high-level total DNA in serum (Met-DNA (+) and high total DNA group) with the other patients.

Fig. 3. Forest plot for comparison of hazard ratios for OS of patients positive for met-DNA and with high-level total DNA in serum (Met-DNA (+) and high total DNA group) compared with hazard ratios for the other pa-tients.

M et-DNA (+) & high total DNA group versus others

Events/total numbers HR 95% CI

Menopausal statusPre (3/10, 8/159) 7.22 1.91–27.25Post (2/8, 8/159) 5.96 1.26–28.18

Tumor sizet1 (4/13, 3/179) 21.23 4.74–95.08t2 (1/5, 13/139) 2.28 0.30–17.47

Lymph node metastasisNone (2/14, 11/234) 3.42 0.76–15.45≥1 (3/4, 5/84) 16.92 4.00–71.65

Histologic gradeG1, 2 (3/15, 10/261) 6.45 1.77–23.46G3 (2/3, 6/56) 6.55 1.32–32.56

ERNegative (3/8, 6/69) 4.45 1.11–17.82Positive (2/10, 10/249) 6.51 1.42–29.77

PRNegative (4/8, 11/109) 6.11 1.93–19.38Positive (1/10, 5/209) 4.96 0.58–42.43

HER2Negative (3/12, 9/238) 7.01 1.89–25.94Positive (2/4, 7/36) 3.64 0.73–18.09

0.1 1 10

Test for interaction effect p > 0.05

Met-DNA (+) & high totalDNA group worse

100

DNA Methylation in Serum of Breast Cancer Patients

Oncology 2012;83:273–282 279

Association of Prognosis with Combination ofMet-DNA and Total DNA After the results for met-DNA and total DNA in serum

were combined, their association with prognosis was an-alyzed. Patients who were positive for met-DNA and showed high total DNA in serum (n = 18) had a signifi-cantly worse prognosis than the others (n = 318) for both DFS and OS (p ! 0.001 and ! 0.001, respectively; fig. 2 ). Multivariate analysis demonstrated that the combined presence of met-DNA and total DNA in serum was a sig-nificant prognostic factor for both DFS and OS (p = 0.002 and 0.001, respectively) and that it was independent of the other parameters ( table 4 ). The forest plot analysis indi-

cated that the combination of met-DNA and total DNA in serum was prognostic for each subset since the test for the interaction effect was not significant ( fig. 3 ).

Discussion

In the present study, we investigated whether the de-tection of met-DNA in serum by the OS-MSP assay could be a new prognostic factor for breast cancer patients. In addition, total DNA in serum was determined simultane-ously since this has been reported to be elevated in breast cancer patients and might thus serve as an additional new

Table 3. Univariate and multivariate analysis of various prognostic factors for OS

Parameters Univariate analysis Multivariate analysis M ultivariate analysis

HR 95% CI p value HR 95% CI p value HR 95% CI p value

Met-DNA in serum (positive vs. negative) 3.944 1.53–10.17 <0.005 3.173 1.12–8.97 0.029Total DNA in serum (high vs. low) 4.077 1.65–10.11 <0.002 4.030 1.60–10.13 0.003Menopausal status (post- vs. premenopausal) 0.918 0.39–2.16 <0.845Histological grade (3 vs. 1, 2) 3.126 1.30–7.54 <0.011 1.870 0.52–6.69 0.336 2.164 0.64–7.32 0.215ER (positive vs. negative) 0.375 0.16–0.89 <0.026 1.933 0.49–7.65 0.348 1.758 0.47–6.58 0.402PR (positive vs. negative) 0.197 0.08–0.51 <0.001 0.226 0.08–0.67 0.007 0.228 0.08–0.69 0.009HER2 (positive vs. negative) 4.742 2.00–11.26 <0.001 2.503 0.93–6.77 0.070 2.454 0.96–6.27 0.060Tumor size (2 vs. 1) 2.817 1.14–6.99 <0.026 2.211 0.87–5.62 0.095 2.084 0.83–5.22 0.117LN (positive vs. negative) 1.752 0.73–4.23 <0.212Treatment (hormone therapy vs. none) 0.894 0.20–4.08 <0.885Treatment (chemotherapy vs. none) 2.481 0.48–12.79 <0.278Treatment (hormone therapy and chemotherapy vs. none) 1.114 0.20–6.09 <0.901

HR = Hazard ratio; LN = lymph node metastasis.

Table 4. Multivariate analysis of various prognostic factors for OS and DFS

Parametersa DFS OS

HR 95% CI p value HR 95% CI p value

Met-DNA and total DNA b 3.864 1.67–8.95 0.002 5.981 2.01–17.81 0.001 Histologic grade (3 vs. 1, 2) 2.105 0.92–4.83 0.079 2.097 0.61–7.20 0.240 ER (positive vs. negative) 1.169 0.46–3.00 0.745 2.023 0.53–7.70 0.301 PR (positive vs. negative) 0.575 0.27–1.21 0.146 0.226 0.08–0.67 0.007 HER2 (positive vs. negative) 2.245 1.10–4.60 0.027 2.455 0.94–6.42 0.067 Tumor size (2 vs. 1)c 2.489 0.97–6.37 0.057 LN (positive vs. negative)d 2.089 1.12–3.89 0.020

HR = Hazard ratio; LN = lymph node metastasis. a Only parameters significant by univariate analysis were included. b Met-DNA-positive and total DNA-high group vs. others. c Tumor size was significant in OS but not DFS by univariate analysis. d LN was signif-icant in DFS but not OS by univariate analysis.

Fujita et al.   Oncology 2012;83:273–282280

prognostic factor. We were able to demonstrate that 10% of breast cancer patients were positive for met-DNA in serum. Interestingly, while met-DNA in serum was not significantly associated with the conventional prognostic factors tumor size, nodal status, HER2, and histological grade, it was significantly associated with ER status in that patients with ER-negative tumors were more like - ly to be positive for met-DNA in serum. The gene-basis analysis indicated that methylation of GSTP1 , but not of RASSF1A and RAR � 2 , was significantly associated with ER-negative tumors (online suppl. table 1). It has been re-ported that GSTP1 methylation is more often seen in ER-positive than ER-negative breast tumors [29] . Such a re-port seems to contradict our finding, but it is possible that ER-negative tumors with GSTP1 methylation are more likely than ER-positive tumors to release tumor genomes into the blood, although the mechanism of this release is currently unknown.

We were further able to show by means of multivari-ate analysis that met-DNA in serum was marginally as-sociated with DFS and significantly with OS. We were also able to prove that the gene methylated in serum was also methylated in the corresponding tumor tissue, while we previously demonstrated that met-DNA in serum de-creases after surgery [20] . These results indicate that met-DNA in serum stems from tumor tissues and can serve as a new prognostic factor which is independent of the conventional prognostic factors. It is speculated that breast tumors with met-DNA in serum are biologically more aggressive than those without it. It has been re-ported that presence of circulating tumor cells is associ-ated with the presence of met-DNA in serum [30, 31] . This observation seems to be consistent with our specu-lation.

In addition to the prognostic value of met-DNA in se-rum, we also investigated that of total DNA. We first di-vided the patients into three equal groups according to the level of total DNA in serum (low, middle, and high) and found that prognosis for the patients in the middle group was almost identical to that for the low group (OS rates at 100 months were 97, 96, and 86% for low, middle, and high groups, respectively), and that patients in these two groups showed a significantly better prognosis than those in the high group. Thus, the patients in the low and middle groups were combined and treated as the low total DNA group and those in the high group were treated as the high total DNA group. The patients in the high total DNA group showed a significantly worse prognosis than those in the low total DNA group for both DFS and OS, and the multivariate analysis clearly demonstrated that

the total DNA in serum is an independent prognostic fac-tor for both DFS and OS.

Interestingly, the combination of met-DNA and total DNA in serum seems to be more effective for the predic-tion of patient prognosis since the difference in DFS and OS between the low-risk and high-risk groups was larger when the two factors were analyzed in combination than when they were analyzed alone, i.e. the difference in the OS rate at 100 months was 17% for met-DNA ( fig. 1 a), 11% for total DNA ( fig. 1 b), and 29% for the two combined ( fig. 2 ). Met-DNA is thought to represent CTGs, but total DNA not necessarily so, since it can also originate from inflammatory cells, endothelial cells, and fibroblasts in tumor tissues [32–34] . Although there was no significant association between total DNA in serum and clinico-pathological characteristics, it is possible that total DNA in serum may reflect a certain tumor biology related to tumor metastasis. It is also possible that circulating tu-mor cells [30, 31] as well as micrometastatic deposits of distant organs, such as the bone marrow and liver, may also contribute to total DNA [32, 35] .

Of 80 healthy women, 2 patients (2.5%) were positive for methylation of GSTP 1 in serum and no patient was positive for methylation of either RASSF1A or RAR � 2 in serum. Similar findings indicating the presence of meth-ylation of GSTP1 , RASSF1A , and RAR � 2 in the serum of a small percentage of healthy women have also been re-ported [7, 17] . Detection of met-DNA in serum of healthy women might indicate the methylation of normal cells due to any environmental factor. It seems to be interest-ing to study the correlation of met-DNA in serum and the risk for developing breast cancer by longitudinal epide-miologic studies.

The present study analyzed 336 serum samples includ-ing 64 samples which were used in a previous study to invent the OS-MSP assay [20] . However, we think that this fact does not bias our present observation on the prognostic value of the OS-MSP assay due to the follow-ing reason: in the present study, the serum samples ob-tained before surgery from primary breast cancer pa-tients (stage I and II, n = 336) treated from March 2000 to October 2004 were consecutively included and sub-jected to the OS-MSP assay which was conducted inde-pendently of the previous study in a blinded manner. Thus, the investigator in this study conducted the OS-MSP assay for all the serum samples (n = 336) without knowing the results of the 64 samples analyzed in the previous study [20] . Besides, no patient was excluded from the prognosis analysis. Thus, we believe our present observation on the prognostic value of the OS-MSP assay

DNA Methylation in Serum of Breast Cancer Patients

Oncology 2012;83:273–282 281

is not biased by the inclusion of the patients who were analyzed in the previous study to invent the OS-MSP as-say.

A limitation of this study is that, although ideally the actual prognostic value of met-DNA and total DNA in serum should be evaluated in patients not treated with any adjuvant therapy, in our study, it was evaluated in pa-tients most of whom had been treated with adjuvant hor-monal/chemotherapy (there were only 35 patients with-out any adjuvant therapy). Thus, it still remains to be es-tablished whether these factors are actual prognostic and/or predictive factors. Since stage III patients were gener-ally treated with neoadjuvant chemotherapy at our insti-tute, they were excluded from this study, so that only pa-tients with relatively early-stage disease were included in this study. Accordingly, positivity of CEA and CA15-3 was very low (1.8% for each) and neither was significant-ly associated with DFS or OS, indicating their poor po-tential as prognostic factors for such relatively early-stage patients.

Several reports have been available on total DNA in serum or plasma of breast cancer patients [21, 23, 30] . In these studies, median values of total DNA in serum or plasma are reported to range from 13 [30] , 39 [23] to 221 ng/ml [21] , and the median value was 3.6 ng/ml in the present study. This wide variation seems to result mostly from the methodological difference in the assay for the detection of serum DNA as well as in the difference in disease stage of the patients analyzed in each study. In

order to use total DNA in serum as a prognostic marker in the future, standardization of the assay for total DNA in serum needs to be attained.

In conclusion, we were able to demonstrate that met-DNA detected with the OS-MSP assay is a significant and independent prognostic factor, that total DNA in serum is also an independent prognostic factor, and that their combination seems to be even more effective for the pre-diction of DFS and OS of breast cancer patients. The re-sults presented here suggest that the OS-MSP assay devel-oped by us may be clinically useful for the molecular stag-ing of breast cancer and provide valuable information for prognosis. Future studies including a larger number of patients with sufficient follow-up time are needed to fur-ther validate the clinical utility of the OS-MSP assay.

Acknowledgement

This work was supported in part by a Grants-in-Aid from Comprehensive 10-Year Strategy for Cancer Control Program of the Ministry of Health, Labour and Welfare, Japan, and research fund from Sysmex Corporation.

Disclosure Statement

S.N. received research funding and S.J.K. received honoraria from Sysmex Corporation. N.Y. is an employee of Sysmex Corpo-ration.

References

1 Paik S: Development and clinical utility of a 21-gene recurrence score prognostic assay in patients with early breast cancer treated with tamoxifen. Oncologist 2007; 12: 631–635.

2 van’t Veer LJ, Dai H, van de Vijver MJ,He YD, Hart AA, Mao M, Peterse HL, van der Kooy K, Marton MJ, Witteveen AT,Schreiber GJ, Kerkhoven RM, Roberts C, Linsley PS, Bernards R, Friend SH: Gene ex-pression profiling predicts clinical outcome of breast cancer. Nature 2002; 415: 530–536.

3 Suijkerbuijk KP, van Diest PJ, van der Wall E: Improving early breast cancer detection: fo-cus on methylation. Ann Oncol 2010; 22: 24–29.

4 Brooks J, Cairns P, Zeleniuch-Jacquotte A: Promoter methylation and the detection of breast cancer. Cancer Causes Control 2009; 20: 1539–1550.

5 Muller HM, Widschwendter A, Fiegl H, Ivarsson L, Goebel G, Perkmann E, Marth C, Widschwendter M: DNA methylation in se-rum of breast cancer patients: an indepen-dent prognostic marker. Cancer Res 2003; 63: 7641–7645.

6 Gobel G, Auer D, Gaugg I, Schneitter A, Le-sche R, Muller-Holzner E, Marth C, Daxen-bichler G: Prognostic significance of methyl-ated RASSF1A and PITX2 genes in blood- and bone marrow plasma of breast cancer patients. Breast Cancer Res Treat 2011; 130: 109–117.

7 Sharma G, Mirza S, Parshad R, Srivastava A, Gupta SD, Pandya P, Ralhan R: Clinical sig-nificance of promoter hypermethylation of DNA repair genes in tumor and serum DNA in invasive ductal breast carcinoma patients. Life Sci 2010; 87: 83–91.

8 Lo PK, Sukumar S: Epigenomics and breast cancer. Pharmacogenomics 2008; 9: 1879–1902.

9 Martens JW, Margossian AL, Schmitt M, Foekens J, Harbeck N: DNA methylation as a biomarker in breast cancer. Future Oncol 2009; 5: 1245–1256.

10 Brock MV, Hooker CM, Ota-Machida E, Han Y, Guo M, Ames S, Glockner S, Pianta-dosi S, Gabrielson E, Pridham G, Pelosky K, Belinsky SA, Yang SC, Baylin SB, Herman JG: DNA methylation markers and early re-currence in stage I lung cancer. N Engl J Med 2008; 358: 1118–1128.

11 Ponomareva AA, Rykova E, Cherdyntseva NV, Skvortsova TE, Dobrodeev A, Litviakov NV, Zav’ialov AA, Tuzikov SA, Vlasov VV, Laktionov PP: [Assay of methylated gene RARBETA2 in circulating DNA of blood from patients with lung cancer as a potential prognostic marker]. Vopr Onkol 2011; 57: 302–307.

Fujita et al.   Oncology 2012;83:273–282282

12 Lofton-Day C, Model F, Devos T, TetznerR, Distler J, Schuster M, Song X, Lesche R, Liebenberg V, Ebert M, Molnar B, Grutzmann R, Pilarsky C, Sledziewski A: DNA methyla-tion biomarkers for blood-based colorectal cancer screening. Clin Chem 2008; 54: 414–423.

13 Shima K, Nosho K, Baba Y, Cantor M, Mey-erhardt JA, Giovannucci EL, Fuchs CS, Ogi-no S: Prognostic significance of CDKN2A (p16) promoter methylation and loss of ex-pression in 902 colorectal cancers: cohort study and literature review. Int J Cancer 2011; 128: 1080–1094.

14 Dulaimi E, Hillinck J, Ibanez de Caceres I, Al-Saleem T, Cairns P: Tumor suppressor gene promoter hypermethylation in serum of breast cancer patients. Clin Cancer Res 2004; 10: 6189–6193.

15 Fackler MJ, McVeigh M, Mehrotra J, Blum MA, Lange J, Lapides A, Garrett E, Argani P, Sukumar S: Quantitative multiplex methyla-tion-specific PCR assay for the detection of promoter hypermethylation in multiple genes in breast cancer. Cancer Res 2004; 64: 4442–4452.

16 Fiegl H, Millinger S, Mueller-Holzner E, Marth C, Ensinger C, Berger A, Klocker H, Goebel G, Widschwendter M: Circulating tumor-specific DNA: a marker for monitor-ing efficacy of adjuvant therapy in cancer pa-tients. Cancer Res 2005; 65: 1141–1145.

17 Hoque MO, Feng Q, Toure P, Dem A, Critchlow CW, Hawes SE, Wood T, Jeronimo C, Rosenbaum E, Stern J, Yu M, Trink B, Ki-viat NB, Sidransky D: Detection of aberrant methylation of four genes in plasma DNA for the detection of breast cancer. J Clin Oncol 2006; 24: 4262–4269.

18 Grunau C, Clark SJ, Rosenthal A: Bisulfite genomic sequencing: systematic investiga-tion of critical experimental parameters. Nucleic Acids Res 2001; 29:E65–E65.

19 Hayatsu H, Shiraishi M, Negishi K: Bisulfite modification for analysis of DNA meth - ylation. Curr Protoc Nucleic Acid Chem 2008;Chapter 6:Unit 6.10.

20 Yamamoto N, Nakayama T, Kajita M, Mi-yake T, Iwamoto T, Kim SJ, Sakai A, Ishiha-ra H, Tamaki Y, Noguchi S: Detection ofaberrant promoter methylation of GSTP1, RASSF1A, and RAR � 2 in serum DNA of pa-tients with breast cancer by a newly estab-lished one-step methylation-specific PCR assay. Breast Cancer Res Treat 2012; 132: 165–173.

21 Gal S, Fidler C, Lo YM, Taylor M, Han C, Moore J, Harris AL, Wainscoat JS: Quantita-tion of circulating DNA in the serum of breast cancer patients by real-time PCR. Br J Cancer 2004; 90: 1211–1215.

22 Zanetti-Dallenbach R, Wight E, Fan AX, Lapaire O, Hahn S, Holzgreve W, Zhong XY: Positive correlation of cell-free DNA in plas-ma/serum in patients with malignant and benign breast disease. Anticancer Res 2008; 28: 921–925.

23 Huang ZH, Li LH, Hua D: Quantitative anal-ysis of plasma circulating DNA at diagnosis and during follow-up of breast cancer pa-tients. Cancer Lett 2006; 243: 64–70.

24 Schwarzenbach H, Muller V, Milde-Lan-gosch K, Steinbach B, Pantel K: Evaluation of cell-free tumour DNA and RNA in patients with breast cancer and benign breast disease. Mol Biosyst 2011; 7: 2848–2854.

25 Goldhirsch A, Glick JH, Gelber RD, Coates AS, Senn HJ: Meeting highlights: interna-tional consensus panel on the treatment of primary breast cancer. Seventh international conference on adjuvant therapy of primary breast cancer. J Clin Oncol 2001; 19: 3817–3827.

26 Goldhirsch A, Wood WC, Gelber RD, Coates AS, Thurlimann B, Senn HJ: Meeting high-lights: updated international expert consen-sus on the primary therapy of early breast cancer. J Clin Oncol 2003; 21: 3357–3365.

27 Arai T, Miyoshi Y, Kim SJ, Taguchi T, Ta-maki Y, Noguchi S: Association of GSTP1 CPG islands hypermethylation with poor prognosis in human breast cancers. Breast Cancer Res Treat 2006; 100: 169–176.

28 Robbins P, Pinder S, de Klerk N, Dawkins H, Harvey J, Sterrett G, Ellis I, Elston C: Histo-logical grading of breast carcinomas: a study of interobserver agreement. Hum Pathol 1995; 26: 873–879.

29 Sunami E, Shinozaki M, Sim MS, Nguyen SL, Vu AT, Giuliano AE, Hoon DS: Estrogen receptor and HER2/neu status affect epige-netic differences of tumor-related genes in primary breast tumors. Breast Cancer Res 2008; 10:R46.

30 Van der Auwera I, Elst HJ, Van Laere SJ, Maes H, Huget P, van Dam P, Van Marck EA, Vermeulen PB, Dirix LY: The presence of cir-culating total DNA and methylated genes is associated with circulating tumour cells in blood from breast cancer patients. Br J Can-cer 2009; 100: 1277–1286.

31 Matuschek C, Bolke E, Lammering G, Ger-ber PA, Peiper M, Budach W, Taskin H, Pri-sack HB, Schieren G, Orth K, Bojar H: Meth-ylated APC and GSTP1 genes in serum DNA correlate with the presence of circulating blood tumor cells and are associated with a more aggressive and advanced breast cancer disease. Eur J Med Res 2010; 15: 277–286.

32 Schwarzenbach H, Hoon DS, Pantel K: Cell-free nucleic acids as biomarkers in cancer pa-tients. Nat Rev Cancer 2011; 11: 426–437.

33 Fleischhacker M, Schmidt B: Circulating nu-cleic acids (CNAs) and cancer – a survey. Biochim Biophys Acta 2007; 1775: 181–232.

34 Kowalewska M, Nowak R, Chechlinska M: Implications of cancer-associated systemic inflammation for biomarker studies. Bio-chim Biophys Acta 2010; 1806: 163–171.

35 Schwarzenbach H, Alix-Panabieres C, Mull-er I, Letang N, Vendrell JP, Rebillard X, Pan-tel K: Cell-free tumor DNA in blood plasma as a marker for circulating tumor cells in prostate cancer. Clin Cancer Res 2009; 15: 1032–1038.