mechanisms and reversal of elastin specific medial
TRANSCRIPT
Clemson UniversityTigerPrints
All Dissertations Dissertations
8-2014
MECHANISMS AND REVERSAL OFELASTIN SPECIFIC MEDIAL ARTERIALCALCIFICATIONYang LeiClemson University, [email protected]
Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations
This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations byan authorized administrator of TigerPrints. For more information, please contact [email protected].
Recommended CitationLei, Yang, "MECHANISMS AND REVERSAL OF ELASTIN SPECIFIC MEDIAL ARTERIAL CALCIFICATION" (2014). AllDissertations. 1307.https://tigerprints.clemson.edu/all_dissertations/1307
MECHANISMS AND REVERSAL OF ELASTIN SPECIFIC MEDIAL
ARTERIAL CALCIFICATION
A Dissertation
Presented to the
Graduate School of
Clemson University
In Partial Fulfillment
of the Requirements for the Degree
Doctor of Philosophy
Bioengineering
byYang Lei
August 2014
Accepted by: Dr. Narendra Vyavahare, Committee Chair
Dr. Jeoung Soo Lee Dr. Alexey Vertegel
Dr. Bruce Z. Gao
II
ABSTRACT
There are two distinctive types of vascular calcification: atherosclerotic intimal
calcification (AIC) and elastin specific medial arterial calcification (MAC). AIC occurs
in the context of atherosclerosis, associated with lipids, macrophages, and vascular
smooth muscle cells; whereas, MAC can exist independently of atherosclerosis and is
associated with elastin and vascular smooth muscle cells. The work presented here
focuses on the mechanisms and reversal of MAC. MAC, termed as Monckeberg’s
sclerosis, is a type of vascular calcification disease mostly occurs as linear deposits along
elastic lamellae. Vascular calcification, including medial calcification, is a strong
predictor of cardiovascular morbidity and mortality. Currently the only options to treat
vascular calcifications are surgical methods like directional atherectomy and placement
of stent grafts. These surgical methods are quite invasive and expensive, and currently
there is no available alternative to surgical therapy for reversal of vascular calcification.
One possible approach is EDTA chelation therapy. EDTA chelation therapy most often
involves the injection of disodium ethylene diamine tetraacetic acid (EDTA), a chemical
that binds, or chelate ionic calcium, trace elements and other divalent cations so as to
reverse calcification. However, chelation therapy is not yet accepted in US and not
approved by FDA as there is no clinical proof that it works and improves cardiovascular
function. Besides, it has severe side effects such as renal toxicity, hypercalcemia, and
bone loss.
III
Overall goal of our research is to understand the mechanisms of elastin specific
MAC, to evaluate efficacy of chelating agents to reverse elastin specific MAC, and to
develop a targeted delivery system to reverse elastin specific MAC and circumvent side
effects.
First, we investigated the mechanisms of elastin specific MAC, specifically cause-
and-effect relationship between the elastin-specific MAC and osteoblast-like
differentiation of vascular smooth muscle cells (VSMCs). It has been accepted for
decades that the pathology of vascular calcification resembles physiological bone
mineralization. However, the cause-and-effect relationship between calcification and
osteoblast-like differentiation of VSMCs is still unclear. We, for the first time, showed
that in response to the calcified matrix, for both hydroxyapatite crystals and calcified
aortic elastin, VSMCs lost their smooth muscle lineage markers and underwent
chondroblast/osteoblast-like differentiation. Interestingly, this phenotypic transition was
reversible and VSMCs restored their original linage upon reversal of calcification.
Secondly, we evaluated the efficacy of chelating agents to reverse elastin specific
MAC. We tested if chelating agents, such as disodium ethylene diamine tetraacetic acid
(EDTA), diethylene triamine pentaacetic acid (DTPA) and sodium thiosulfate (STS) can
remove calcium from hydroxyapatite (HA) and calcified tissues without damaging the
tissue architecture. Our results indicated that both EDTA and DTPA could effectively
remove calcium from hydroxyapatite and calcified tissues, while STS was not effective.
The tissue architecture was not altered during chelation.
IV
Thirdly, we investigated the therapeutic effects of systemic EDTA chelation
therapy for reversal of calcification and its possible side effects in vivo. We used CaCl2
mediated abdominal aorta injury in rats to mimic local aortic calcification similar to what
is observed in clinical cases. We demonstrated that systemic EDTA chelation therapy did
not reverse local aortic calcification. Moreover, systemic EDTA chelation therapy caused
adverse events for serum and urine calcium, specifically hypocalcemia and
hypercalciuria, but did not cause bone loss.
Finally, we developed a targeted delivery system to reverse elastin specific MAC
and to avoid side effects associated with systemic EDTA chelation therapy. We have
recently shown that the nanoparticles (NPs) coated with elastin-antibody can be targeted
to vascular calcification sites. This paved the way to design an elastin antibody coated
and EDTA loaded albumin NPs to reverse elastin-specific medial calcification and avoid
side effects. Our in vitro and in vivo results demonstrated that elastin antibody coated and
EDTA loaded albumin NPs had good therapeutic effect to reverse elastin specific MAC
and did not have side effects typically seen in systemic EDTA chelation therapy such as
hypocalcemia and bone loss.
In conclusion, our work led to enhanced understanding the possible mechanisms
of osteogenesis in vascular calcification and possible alternative therapy to reverse elastin
specific MAC without systemic side effects.
V
DEDICATION
I would like to dedicate this work to my parents and my brother. My family is my
greatest motivation to complete this dissertation.
VI
ACKNOWLEDGEMENTS
I would like to give special thanks to my advisor Dr. Naren Vyavahare for giving
me an opportunity to work with him on this project. My previous research background
during master’s and bachelor’s degree was related to materials science and engineering.
However, Dr. Vyavahare still trusted me and gave me great support to work on this
project in department of bioengineering. Dr. Vyavahare always encouraged me and was
available to answer my doubts and to give me insight into directions of research goals.
His rigorous academic attitude, friendly manner to colleagues and students set a good
example for my future academic career.
I am especially thankful to my PhD committee members Dr. Jeoung Soo Lee, Dr.
Alexey Vertegel, and Dr. Bruce Z. Gao. Dr. Jeoung Soo Lee taught me all cellular and
molecular biology analyses techniques. Dr. Alexey Vertegel helped me a lot for
nanoparticles’ techniques including preparation, characterization and optimization. Dr.
Bruce Z. Gao helped me a lot for optical imaging. I would also like to thank previous lab
member, Aditi Sinha, who always helped me with laboratory techniques and
troubleshooting.
I would also like to thank all other Cardiovascular ECM Stabilization and
Regeneration (CESR) Lab members including: Nasim Nosoudi, Pranjal Nahar, Saketh
Karamched, Vaideesh Parasaram, Hobey Tam, Linae Maganini and Aniqa Chowdhury
for their help for lab works; all administrative staff at department of Bioengineering at
Clemson University: Maria Torres, Leigh Humphries, Michelle Kirby, Sherri Morrison
VII
who always kindly to provide help; Linda Jenkins and Chad L. McMahan at department
of Bioengineering, Clemson University for histology lab work; Dr. Hamp Bruner for
histology examination; Dr. John Parrish, Travis Pruitt, Tina Parker and Stefanie Pardue at
Godley-Snell Research Center (Clemson, SC) of Clemson University for animal work;
Dr. Terri Bruce and Rhonda Powell at Clemson Light Imaging Facility (Clemson, SC) of
Clemson University for optical microscope work; Dr. Lax Saraf, Dr. Haijun Qian and
Dayton Cash at Clemson University Electron Microscopy Laboratory(Anderson, SC) for
electron microscope work; Dr. David Kwartowitz, Michael Jaeggli and Siyu Ma at
Clemson University for Micro-CT data analysis using Mevislab software; Luke
Pietrykowski at the Clemson University Biomedical Engineering Innovation Campus
(Greenville, SC) for mechanical test using Bose Electroforce 3200; Dr. Michael E. Ward
at Greenville Hospital System (Greenville, SC) for providing us samples of calcified
human aorta; Dr. Jonathon Nye, Margie Jones and Dr. Baowei Fei at Center for Systems
Imaging, Emory University School of Medicine (Atlanta, GA) for Micro-CT work.
I am also grateful to the Department of Bioengineering and Clemson University
for being my home for last four years in my PhD life. Finally, I would like to
acknowledge the funding provided by National Institutes of health (P20GM103444,
R01HL061652) and the Hunter Endowment (All awarded to Dr. Naren Vyavahare).
VIII
TABLE OF CONTENTS
TITLE PAGE ..................................................................................................................... I
ABSTRACT ...................................................................................................................... II
DEDICATION.................................................................................................................. V
ACKNOWLEDGEMENTS ........................................................................................... VI
TABLE OF CONTENTS ............................................................................................ VIII
LIST OF TABLES ....................................................................................................... XIII
LIST OF FIGURES ..................................................................................................... XIV
CHAPTERS ....................................................................................................................... 1
CHAPTER 1: INTRODUCTION .................................................................................... 1
CHAPTER 2: LITERATURE REVIEW ....................................................................... 7
2.1 Vascular architecture ................................................................................................. 7
2.1.1 Normal anatomy of blood vessel ........................................................................... 7
2.1.2 Structure of aortic elastin ....................................................................................... 8
2.2 Vascular diseases related to calcification ................................................................ 10
IX
2.2.1 Atherosclerosis ..................................................................................................... 10
2.2.2 Aortic aneurysms ................................................................................................. 12
2.3 Vascular calcification................................................................................................ 14
2.3.1 Medial arterial calcification (MAC) .................................................................... 14
2.3.2 Mechanisms of vascular calcification .................................................................. 15
2.3.3 Types and characteristics of vascular calcification .............................................. 18
2.3.4 Animal models for investigating vascular calcification ....................................... 21
2.3.5 Current or prospective therapies for treating vascular calcification .................... 27
2.4 Chelation therapy...................................................................................................... 30
2.4.1 Types and applications of chelation therapy ........................................................ 31
2.4.2 In vitro and animal studies of chelation therapy for vascular calcification ......... 34
2.5 EDTA chelation therapy........................................................................................... 37
2.5.1 Case studies and clinical trials of EDTA chelation therapy ................................ 37
2.5.2 Side effects with traditional systemic EDTA chelation therapy .......................... 41
2.5.3 Current opinions of EDTA chelation therapy for cardiovascular disease ........... 44
2.6 Targeted EDTA chelation therapy .......................................................................... 46
2.6.1 Local drug delivery in the vasculature ................................................................. 46
2.6.2 Albumin nanoparticles as drug carriers for different application ........................ 50
2.6.3 Targeted EDTA chelation therapy using EDTA loaded albumin nanoparticles .. 52
CHAPTER 3: PROJECT RATIONALE ...................................................................... 53
X
3.1 Project objective and aims ....................................................................................... 53
3.2 Specific aims and rationale ...................................................................................... 53
3.3 Clinical significance .................................................................................................. 56
CHAPTER 4: MECHANISMS OF ELASTIN SPECIFIC MEDIAL ARTERIAL
CALCIFICATION .......................................................................................................... 58
4.1 Introduction ............................................................................................................... 58
4.2 Materials and methods ............................................................................................. 59
4.3 Results ........................................................................................................................ 66
4.4 Discussion................................................................................................................... 77
4.5 Conclusion ................................................................................................................. 83
CHAPTER 5: EFFICACY OF CHELATING AGENTS TO REVERSE ELASTIN
SPECIFIC MEDIAL ARTERIAL CALCIFICATION .............................................. 86
5.1 Introduction ............................................................................................................... 86
5.2 Materials and methods ............................................................................................. 87
5.3 Results ........................................................................................................................ 93
5.4 Discussion................................................................................................................. 103
XI
5.5 Conclusion ............................................................................................................... 108
CHAPTER 6: SYSTEMIC EDTA CHELATION THERAPY FAILED TO
REVERSE MAC AND HAD SIDE EFFECTS .......................................................... 110
6.1 Introduction ............................................................................................................. 110
6.2 Materials and methods ........................................................................................... 111
6.3 Results ...................................................................................................................... 116
6.4 Discussion................................................................................................................. 121
6.5 Conclusions .............................................................................................................. 126
CHAPTER 7: TARGETED EDTA CHELATION THERAPY TO REVERSE
CALCIFICATION ........................................................................................................ 133
7.1 Introduction ............................................................................................................. 133
7.2 Materials and Methods ........................................................................................... 134
7.3 Results ...................................................................................................................... 147
7.4 Discussion................................................................................................................. 159
7.5 Conclusions .............................................................................................................. 164
CHAPTER 8: CONCLUSIONS AND RECOMMENDATIONS ............................. 174
XII
8.1 Conclusions .............................................................................................................. 174
8.2 Limitations of this project and recommendation for future work ..................... 176
CHAPTER 9: REFERENCES ..................................................................................... 179
SUPPLEMENTAL FILES ........................................................................................... 196
XIII
LIST OF TABLES
Table Page
Table 2.1. Types and characteristics of vascular calcification ......................................... 20
Table 2.2. Animal models of vascular calcification. ........................................................ 24
Table 2.3.Current or prospective therapies for treating vascular calcification. ................ 29
Table 2.4. Types and applications of chelation therapy. ................................................... 32
Table 2.5. EDTA’s binding constants to metal ions ........................................................ 33
Table 2.6. In vitro and animal studies for chelation therapy ............................................ 36
Table 2.7. Case studies and clinical trials of EDTA chelation therapy. ........................... 40
Table 2.8. Side effects of EDTA chelation therapy. ......................................................... 43
Table 2.9. Current opinions of EDTA chelation therapy for cardiovascular disease. ...... 45
Table 4.1. PCR primers used in the RT-PCR study. ......................................................... 62
Table 7.1. Characterization of nanoparticles. ................................................................. 148
Table 7.2. Organ distribution of fluorescent nanoparticles............................................. 154
XIV
LIST OF FIGURES
Figure Page
Figure 2.1. Structure of blood vessel. ................................................................................. 8
Figure 2.2. Structure of aortic elastin. ................................................................................. 9
Figure 2.3.Cut section of an artery showing atherosclerosis . .......................................... 11
Figure 2.4. Normal aorta and aorta with large abdominal aneurysm ............................... 13
Figure 2.5. H&E of a patient with MAC. ......................................................................... 15
Figure 2.6. Schematic illustrating four, non–mutually exclusive theories for vascular
calcification. ...................................................................................................................... 17
Figure 2.7. Osteo/chondrocytic differentiation of VSMC and vascular calcification ...... 18
Figure 2.8. Representative images for types of vascular calcification.. ........................... 21
Figure 2.9. Intra-luminal delivery devices ........................................................................ 47
Figure 2.10. Peri-adventital delivery methods .................................................................. 48
Figure 2.11. Novel sustained release vehicles .................................................................. 49
Figure 4.1. Characterization for calcified elastin .............................................................. 67
Figure 4.2. Expression of SMA and MHC in RASMCs cultured on hydroxyapatite and
calcified elastin at day 1 and day 7 ................................................................................... 70
Figure 4.3. Expression of osteogenic/chondrogenic markers in RASMCs cultured on
hydroxyapatite and calcified elastin elastin at day 1 and day 7. ....................................... 73
XV
List of Figures (Continued)
Figure Page
Figure 4.4. Expression of SMA and MHC in RASMCs after removal of calcified matrix.
........................................................................................................................................... 76
Figure 4.5. Expression of osteogenic/chondrogenic markers in RASMCs after removal of
calcified matrix ................................................................................................................. 77
Figure 4.6. Model of putative links between medial elastin-specific calcification and
chondro/osteoblast-like differentiation of VSMCs in the artery....................................... 82
Figure 4.7. Experimental design. ...................................................................................... 84
Figure 4.8. Graphical Abstract. ......................................................................................... 85
Figure 5.1. Demineralization of Hydroxyapatite. ............................................................. 94
Figure 5.2. Demineralization of calcified elastin .............................................................. 97
Figure 5.3. Demineralization of calcified human aorta. ................................................... 99
Figure 5.4. EDTA release profile from PLGA nanoparticles. ........................................ 101
Figure 5.5. Reversal of arterial calcification in vivo by EDTA ...................................... 102
Figure 5.6. Types of chlating agents and chemical structure. ......................................... 109
Figure 5.7. Surgery protocol and photos. ........................................................................ 109
Figure 6.1. Experimental protocol for CaCl2 injury model and EDTA treatment of rats..
......................................................................................................................................... 112
XVI
List of Figures (Continued)
Figure Page
Figure 6.2. Evaluation of aortic calcifications by stereomicroscope, histology and AAS.
......................................................................................................................................... 118
Figure 6.3. Ca quantification in serum and urine by AAS.............................................. 119
Figure 6.4. Bone integrity of EDTA-treated (study group) and untreated rats. .............. 121
Figure 6.5. H&E staining for rats’ kidneys. .................................................................... 127
Figure 6.6. One representative aorta’s Micro CT images from two groups. .................. 128
Figure 6.7. Three points bending test: before and after fracture. .................................... 129
Figure 6.8. Load – Displacement curve for three points bending. .................................. 130
Figure 6.9. Micro-CT for rats’ femoral bone. ................................................................. 131
Figure 6.10. Micro-CT for three slices of rats’ femoral bone. ........................................ 132
Figure 7.1. A: Schematic representation of antibody surface coating strategy for albumin
NPs. ................................................................................................................................. 141
Figure 7.2. Characterization for albumin NPs – optimization and function. .................. 150
Figure 7.3. Antibody binding and targeting efficacy in vitro ......................................... 151
Figure 7.4. Efficacy of EL-NPs targeting to damaged aorta in vivo. .............................. 153
Figure 7.5. Evaluation of aortic calcification for both systemic EDTA chelation therapy
and targeted EDTA chelation therapy. ............................................................................ 157
XVII
List of Figures (Continued)
Figure Page
Figure 7.6. Possible side effects with systemic EDTA chelation therapy and targeted
EDTA chelation therapy. ................................................................................................ 159
Figure 7.7. H&E staining for rats’ kidneys (All five groups). ........................................ 166
Figure 7.8. Flow chart for preparation of EDTA loaded albumin NPs. .......................... 167
Figure 7.9. Graphical abstract to show nanoparticle structure and targeting and chelation.
......................................................................................................................................... 168
Figure 7.10. DiR standard curve and release profile in vitro. ......................................... 169
Figure 7.11. NPs bio-distribution present by organs. ..................................................... 171
Figure 7.12. NPs bio-distribution present by individual rats .......................................... 172
Figure 7.13. One representative aorta’s Micro CT images from all five groups. ........... 173
1
CHAPTERS
CHAPTER 1: INTRODUCTION
Cardiovascular disease (CVD) refers to several types of conditions that affect the
heart and blood vessels. CVD is the leading cause of death in the world, responsible for
30% of all deaths globally, and 1 in 3 (over 800,000) deaths in the US [1]. Pathological
vascular calcification has been observed in many CVD and is recognized as a major risk
factor for various cardiovascular events including heart failure, pulmonary hypertension
(PTH), and death in chronic kidney disease (CKD) patients. Based on the location,
vascular calcification can be classified atherosclerotic intimal calcification (AIC), medial
arterial calcification (MAC) or Mönckeberg’s medial calcific sclerosis, aortic valve
calcification (AVC), and calcific uremic arteriolopathy(CUA) or calciphylaxis [2]. AIC
occurs in the context of atherosclerosis, associated with lipids, macrophages, and vascular
smooth muscle cells; whereas, MAC can exist independently of atherosclerosis and is
associated with elastic lamellae and vascular smooth muscle cells [3]. The work
presented here focuses on the mechanisms and reversal of MAC.
Currently the only option to treat vascular calcifications are surgical methods like
directional atherectomy to remove mineral physically and placement of stent grafts to
keep the artery open [4, 5]. These surgical methods are quite invasive and detrimental,
and there is no available alternative pharmacological treatment for reversal of vascular
calcification [6, 7]. One possible approach is EDTA chelation therapy. EDTA chelation
therapy most often involves the injection of disodium ethylene diamine tetraacetic acid
2
(EDTA), a chemical that binds, or chelate ionic calcium, trace elements and other
divalent cations so as to reverse calcification. There are, however, contradictory opinions
for its success in improving cardiovascular health in patients.
Overall goal of our research is to understand mechanisms of elastin specific
MAC, to evaluate efficacy of chelating agents to reverse elastin specific MAC and their
possible side effects, and to develop a targeted delivery system to reverse elastin specific
MAC that can circumvent side effects.
Over the last decade it has been well established that vascular calcification is not a
passive deposition of mineral but an active process that resembles physiologic skeletal
mineralization in that it shows the presence of many bone proteins and
osteo/chondrogenic cells. It has been reported that the vascular calcification process is
mineral-ion dependent and can be caused by either osteogenic transdifferentiation of
VSMCs or reduced levels of mineralization inhibitors. However, it is unclear if
calcification occurs first and that triggers osteoblast-like differentiation of vascular
smooth muscle cells (VSMCs) or vice versa. It is still unclear if there exists a
chronological occurrence between the osteoblast-like differentiation of VSMCs and
passive deposition of hydroxyapatite on elastin, or if both processes occur simultaneously
causing the eventual calcification of arteries. We, for the first time, showed that in
response to the calcified matrix, for both hydroxyapatite crystals and calcified aortic
elastin, VMCs lost their smooth muscle lineage markers and underwent
chondroblast/osteoblast-like differentiation. Interestingly, this phenotypic transition was
3
reversible and VSMCs restored their original linage upon reversal of calcification. Our
data supports the hypothesis that mineral deposition occurs first before osteogenic
transformation of VSMCs
EDTA chelation therapy has been touted as an effective treatment to reverse
vascular calcification; however, it has been controversial with opposing views [8-10]. At
present no systemic scientific studies prove that it could reverse cardiovascular
calcification or improve cardiovascular function [9]. Moreover, most chelating studies are
performed for atherosclerotic intimal calcification and no studies looked at whether such
therapy would work to reverse medical arterial calcification (MAC). First, we showed
that common chelating agents, such as disodium ethylene diamine tetraacetic acid
(EDTA), diethylene triamine pentaacetic acid (DTPA) and sodium thiosulfate (STS) can
remove calcium from hydroxyapatite (HA) and calcified tissues without damaging the
tissue architecture in vitro. EDTA and DTPA were more effective than STS. This paved a
way to test if such chelation can be used to reverse MAC in vivo.
Most of the EDTA chelation therapies include EDTA subcutaneous infusion, or
systemic application of EDTA solution at very high dose (around 40 ~ 50 mg/kg) [11-
17]. Many side effects have been found with such a high systemic dose of EDTA
chelation therapy including: renal toxicity [18-23] , hypocalcemia [14, 24, 25], and bone
loss [14, 26]. But results are quite controversial for side effects. On the basis of these
reports for EDTA chelation therapy and our own in vitro results showing its effectiveness
in reversing elastin-specific MAC, we performed an animal study to investigate whether
4
or not systemic EDTA chelation therapy could reverse local medial aortic calcification
(MAC). A CaCl2 mediated abdominal aortic injury model was used to induce local aortic
calcification in abdominal aortic region in rats [27, 28]. We demonstrated that systemic
EDTA chelation therapy did not reverse local aortic calcification. Not only it did not
reverse MAC, but it also caused adverse events for serum and urine calcium, specifically
hypocalcemia and hypercalciuria. Thus, our data showed that systemic infusion of EDTA
may not be a right option for reversal of MAC.
In contrast to systemic EDTA chelation therapy, nanoparticle-based targeted
EDTA delivery to the calcified aorta could lower dosage required due to improved
bioavailability and sustained release at the site [29]. Thus, we tested if we can load
EDTA in albumin based nanoparticles and target them to the aortic calcification sites in
vivo. We show that the elastin antibody coated nanoparticles can be targeted to vascular
calcification sites [30]. Our in vitro and in vivo studies demonstrated that elastin
antibody coated and EDTA loaded albumin NPs reversed elastin specific MAC and did
not cause side effects such as hypocalcemia and bone loss typically seen in systemic
EDTA chelation therapy.
Organization of dissertation
1) In Chapter 2, we present comprehensive overview of:
Vascular architecture: normal anatomy of blood vessel and structure of aortic
elastin.
5
Vascular disease: atherosclerosis, aortic aneurysms and medial arterial
calcification (MAC).
Vascular calcification: mechanisms. Types and characteristics, animal
models for investigating vascular calcification, current or prospective
therapies for treating vascular calcification.
Chelation therapy: types and applications of chelation therapy, in vitro and
animal studies of chelation therapy.
EDTA chelation therapy: case studies and clinical trials, side effects with
traditional systemic EDTA chelation therapy, current opinions of EDTA
chelation therapy for cardiovascular disease and targeted EDTA chelation
therapy.
Targeted EDTA chelation therapy: local drug delivery in the vasculature,
albumin nanoparticles as drug carriers for different application and targeted
EDTA chelation therapy using EDTA loaded albumin nanoparticles
2) Chapter 3 describes the project goals, scope, and rationale.
3) In Chapter 4, we investigate mechanisms of elastin specific MAC, specifically
cause-and-effect relationship between the elastin-specific MAC and osteoblast-
like differentiation of vascular smooth muscle cells (VSMCs).
4) In Chapter 5, we evaluate efficacy of chelating agents to reverse elastin specific
MAC. We show that chelating agents, such as disodium ethylene diamine
tetraacetic acid (EDTA), diethylene triamine pentaacetic acid (DTPA) and sodium
6
thiosulfate (STS) can remove calcium from hydroxyapatite (HA) and calcified
tissues without damaging the tissue architecture.
5) In Chapter 6, we investigate systemic EDTA chelation therapy’s therapeutic
effects in reversal of MAC and possible side effects in rat model of MAC.
6) Finally in Chapter 7, we developed a targeted delivery system to reverse elastin
specific MAC and circumvent side effects associated with systemic EDTA
chelation therapy. This study proved the concept that elastin antibody coated and
EDTA loaded albumin NPs might be a promising nanoparticle protein
engineering therapy to reverse elastin-specific medial calcification.
7
CHAPTER 2: LITERATURE REVIEW
2.1 Vascular architecture
2.1.1 Normal anatomy of blood vessel
The cardiovascular system consists of the heart, blood vessels, and the
approximately five liters of blood for humans. The heart is a muscular pumping organ
that circulates blood to the organs. There are two primary circuits in the human body: the
pulmonary circuit and the systemic Circuit. Pulmonary circuit consists of vessels that
carry blood from the heart to the lungs and back to the heart. Systemic circuit composed
of vessels that lead from the heart to all body parts (except the lungs) and back to the
heart.
Blood vessels are the body’s highways that allow blood to flow quickly and
efficiently from the heart to every region of the body and back again. The walls of
arteries and veins have three layers or tunics (Figure 2.1): 1) an outer layer (tunica
adventitia) of connective tissue with collagen fibers and fibroblast cells; 2) a middle layer
(tunica media), is mainly composed of smooth muscle cells and elastic fibers; 3) an inner
layer (tunica intima), is mainly composed of a monolayer of endothelial cells and a
basement membrane.
8
Figure 2.1. Structure of blood vessel [31].
2.1.2 Structure of aortic elastin
Elastin is the predominant structural protein of the arteries comprising of ~ 50%
of the arterial extracellular matrix (ECM) [32]. Elastin is primarily synthesized during
embryogenesis, rarely undergoes remodeling and has a very low turn-over rate.
9
Figure 2.2. Structure of aortic elastin. A: aorta stained by Verhoeff Van Gieson staining
10x magnification [33]; B: Depiction of elastic recoil [34]; C: Schematic representation
of elastin and microfibrils [35]; D: Structural features of elastin showing the repetitive
alternating sequence (square brackets) of β-hydrophobic domains and α-crosslinking
areas [36]; E: TEM of cross section of elastin and fibrillin fibers deposited by vascular
cells in culture [37]; F: TEM of longitudinal section of elastin. Elastin is stained in black
and is surrounded by microfibrils [38].
10
Structure of elastin with different scale is shown in Figure 2.2. Verhoeff Van
Gieson histological staining shows elastin in aorta as black wavy structures in cross-
section. Elastic lamina in the artery is structured as sheets similar to lasagna. (Figure
2.2A). Elastin is endowed with high resilience capable to undergoing cyclic stretching
(Figure 2.2B). Elastic fibers are composed of 90% elastin core and 10 % microfibrils
(Figure 2.2C). Elastin is a biopolymer with tropoelastin as its single repeating
monomeric unit. The typical amino acid composition consists of non-polar amino acids
with few polar side chain residues. Elastin contains alternating hydrophobic segments and
alanine and lysine rich segments (Figure 2.2D) [36]. Under transmission electron
microscope, elastin appears either in cross-section as amorphous clumps exhibiting low
electron density measuring 100-800 nm at the core (Figure 2.2E) [37] or as
longitudinally-aligned, laterally-associating bundles of elastin (Figure 2.2F) [38].
2.2 Vascular diseases related to calcification
2.2.1 Atherosclerosis
Atherosclerosis is a disease of the arteries in which cholesterol deposited in the
wall of an artery, resulting in inflammation and narrowing of the arterial lumen channel
that may eventually impair blood flow. Atherosclerosis is characterized as combination of
tear in artery wall, cholesterol deposits, macrophage cell, macrophage foam cells, fat
deposits and hydroxyapatite crystals [39] (Figure 2.3).
11
Figure 2.3. Cut section of an artery showing atherosclerosis [40].
The pathogenesis of atherosclerosis remains incompletely understood.
Accumulation of oxidized lipoproteins (oxLDL) within the vascular wall drives a related
immune response very early during the disease course. Such an immune response is self-
amplified and eventually escapes from physiologic control mechanisms [41].
Inflammation plays a large role in atherosclerosis. The process of inflammation regulates
the production of many chemokines and acute phase proteins. One of those acute phase
proteins is C-reactive proteins (CRP) [42]. CRP is a phylogenetically highly conserved
plasma protein, with homologs in vertebrates and many invertebrates, that participates in
the systemic response to inflammation. Recently, an association between minor CRP
elevation and future major cardiovascular events has been recognized [42].
Since atherosclerosis is an inflammatory disease, most treatments include
strategies to reduce inflammatory changes include interfere with the production of
reactive oxygen species or, more desirably, with protein kinase C and nuclear factor
kappa B (NF-kB) pathways [43]. From aspects of lifestyle and diet, a balanced diet
12
should be low in saturated fatty acids and enriched in polyunsaturated fatty acids –n-3
fatty acids in particular [44]. And more uptake of antioxidants (such as vitamins E and C)
[45], and polyphenols present in green tea and in red wine [46] would also be helpful.
Some available pharmaceutics include: 1) anti-inflammatory drugs such as
glucocorticoids and non-steroidal anti-inflammatory drugs [47], and aspirin [48]; 2) MG-
CoA reductase inhibitors (statins). Statins competitively inhibit HMG-CoA reductase, the
rate-limiting enzyme in cholesterol synthesis. Statins also have non-lipid-decreasing
effects include partial agonism of PPARα and PPARγ [49]. PPARs are nuclear receptors
that, after ligand-induced activation, form a heterodimer with a ligand-activated retinoic
acid receptor.
Surgical methods currently used include: bypass graft surgery [50], stented or
non-stented balloon angiography [51]. However, neither of these methods reverses
calcification.
2.2.2 Aortic aneurysms
Aortic aneurysm is a local dilatation of the aorta with respect to the original
arterial size or the adjacent area of the artery (Figure 2.4). As a convention, arterial
diameter greater than 1.5 times the normal size or greater than 3 cm in diameter, is
considered aneurysmal, although the definition may vary somewhat by age and body
surface area [52].
The gross characterization of aortic aneurysms include locally dilated aorta,
atheromatous plaque deposition and mural thrombosis, whereas typical histological
13
characterization include trans-mural inflammation, increased pro-inflammatory and
immune markers, extensive local proteolytic activity, apoptosis, local oxidative-stresses
and neovascularization.
Figure 2.4. Normal aorta and aorta with large abdominal aneurysm [53].
Currently advanced imaging techniques are used to detect and monitor aneurysms
include: ultrasonography, computed tomography (CT), and magnetic resonance imaging
(MRI). Ultrasonography is currently the safest, easiest and most economic examination
for the diagnosis of aneurysms. CT accurately demonstrates the size and extent of
aneurysms and also detects thrombus (crescent sign) effectively. MRI demonstrates
features without the need for a contrasting agent. MRI is completely non-invasive.
Currently there are two different methods to treat aneurysms in patients- an open
repair or an endovascular approach. There are no well-defined pharmacological therapies
for the treatment of aneurysms. Some available therapies have been tested including:
14
statins [54], Beta androgenic blockers [55], tetracyclines [56], anti-platelet therapy [57],
anti-oxidant therapy- Vitamin E [58], and anti-inflammatory agents [59].
2.3 Vascular calcification
Cardiovascular disease (CVD) refers to several types of conditions that affect the
heart and blood vessels. CVD is the leading cause of death in the world, responsible for
30% of all deaths globally, and 1 in 3 (over 800,000) deaths in the US[1]. Pathological
vascular calcification has been observed in many CVD and is recognized as a major risk
factor for various cardiovascular events including heart failure, pulmonary hypertension,
and increased blood pressure [60]. Based on the location, vascular calcification can be
classified as intimal calcification, medial calcification, valvular calcification, and
calciphylaxis [2]. Many animal models have been developed to study mechanisms of
vascular calcification, however; there is only little literature available about preventing or
reversing vascular calcification. We are mostly concerned here with medial arterial
calcification (MAC) in the present work.
2.3.1 Medial arterial calcification (MAC)
Calcification of the media or medial artery calcification (MAC), also known as
Monckeberg’s sclerosis is a pathological ossification of the medial part of arteries
(Figure 2.5). Intimal calcification occurs in the context of atherosclerosis, associated with
lipid, macrophages and vascular smooth muscle cells, whereas MAC can exist
15
independently of atherosclerosis and is associated with elastin and vascular smooth
muscle cells [3].
Figure 2.5. H&E of a patient with MAC. The arrow depicts calcium deposits within the
media of a peripheral artery [61].
MAC is frequently observed in patients with diabetes and is associated with
increased risk of nephropathy, retinopathy, lower limb amputation, and coronary artery
disease and all-cause mortality [62].
2.3.2 Mechanisms of vascular calcification
Pathologic calcification of cardiovascular structures, or vascular calcification, is
associated with a number of diseases including end-stage renal disease (ESRD) and
cardiovascular disease (CVD) [63].
Five different mechanisms for initiating vascular calcification are shown in
Figure 2.6 [63]. First, lack of or loss of inhibitors of mineralization, such as matrix Gla
protein (MGP), pyrophsophate in blood vessels normally expressed, have been shown
16
cause spontaneous vascular calcification [64, 65]. Second, osteogenic mechanisms may
also play a role in vascular calcification. Many bone proteins such as osteopontin [66],
osteocalcin [67], and BMP-2 [68] have been identified in calcified vascular lesions.
Third, the link between osteoporosis and vascular calcification is identified and loss of
bone in osteoporosis has been correlated with higher calcium content in the arteries
(REF). Bone turnover causing circulating nucleational complexes has been proposed to
explain the link between vascular calcification and osteoporosis in postmenopausal
women [69]. Fourth, cell death produce phospholipid rich membranous debris and
apoptotic bodies that may serve to nucleate apatite which induce vascular calcification
[70]. Finally, via thermodynamic mechanisms (also referred to as “passive” mechanisms),
elevated Ca and P, promote apatite nucleation and crystal growth and would also
exacerbate vascular calcification initiated by any of the other mechanisms described
above. These mechanisms are not mutually exclusive and some or all can occur
simultaneously in vascular calcification.
17
Figure 2.6. Schematic illustrating four, non–mutually exclusive theories for vascular
calcification [63]. 1) Loss of inhibition like matrix Gla protein (MGP), osteopontin
(OPN), fetuin, pyrophsophate, and others; 2) Induction of bone formation due to high
level of Pi, lipids, inflammatory cytokines, and others; 3) Circulating nucleational
complexes; 4) Cell death.
Current understanding of cause-and-effect relationship between
osteo/chondrocytic differentiation of VSMCs and vascular calcification is shown in
Figure 2.7 [71]. Normally, mesenchymal stem cells differentiate to adipocytes,
osteoblasts, chondrocytes, and vascular smooth muscle cells (VSMCs). In the setting of
chronic kidney disease, diabetes, aging, inflammation, and multiple other toxins, these
VSMC can dedifferentiate or transform into osteo/chondrocytic-like cells by upregulation
of transcription factors such as runt-related transcription factor 2 (RUNX-2) RUNX-2
and muscle segment homeobox 2 (MSX2). These cells lay down collagen and
noncollagenous proteins in the intima or media and incorporate calcium and phosphorus
18
into matrix vesicles to initiate mineralization and further mineralize into hydroxyapatite.
What triggers this dedifferentiation of VSMCs is currently unknown.
Our research is testing the hypothesis that vascular calcification might precede
osteo/chondrocytic differentiation of VSMCs. Detailed experimental rationale is
discussed in Chapter 3.
Figure 2.7. Osteo/chondrocytic differentiation of VSMC and vascular calcification [71].
Abbreviations: CKD-Chronic kidney disease; PPi-pyrophosphate; MGP-matrix Gla
protein; OP-osteopontin.
2.3.3 Types and characteristics of vascular calcification
Based on histoanatomy or location, vascular calcification can be mainly classified
as four types (Table 2.1, Figure 2.8): atherosclerotic intimal calcification (AIC), medial
19
arterial calcification (MAC) or Mönckeberg’s medial calcific sclerosis, Aortic valve
calcification (AVC), and calcific uremic arteriolopathy (CUA) or calciphylaxis.
AIC forms at the intimal layer of the blood vessel, and is mostly associated with
conditions of atherosclerosis, hyperlipidemia, and hypertension. ACI is characterized by
eccentric lumen-deformation, vessel remodeling, elastinolysis and increased oxidized
low-density lipoprotein (LDL) [68, 72-74].
MAC forms at the tunica media. MAC is mostly associated with type 2 diabetes
mellitus, end-stage renal disease (ESRD), hyperphosphatemia and Lower-extremity
amputations. MAC has circumferential calcium deposition in the arterial tunica media
along with the elastic lamina, adventitial inflammation, fibro-fatty expansion [75-79].
AVC forms at the aortic side of the leaflets and is usually associated with
hyperlipidemia, congenital bicuspid valve and rheumatic heart disease. AIC has fibro-
fatty expansion and inflammation of the lamina fibrosa, displaced and/or split elastic
lamina and nodular amorphous calcium phosphate accumulation via epitaxial deposition
[12, 80-82].
CUA refers to calcification formed in micro-vessels and is mainly associated with
end-stage renal disease (ESRD), and warfarin treatment. CUA is exhibited in arteriolar
(~ 0.6 mm diameter) medial calcification in dermal, pulmonary and mesenteric vessels.
CUA has fibroproliferative occlusion, secondary skin and dermal fat necrosis,
periarteriolar inflammation and bone morphogenetic protein 4 (BMP4) expression and
reduced Gla-modified matrix Gla protein (MGP) expression [83-86].
20
Table 2.1. Types and characteristics of vascular calcification (Modified from
Demer(2008)[87], Towler(2008)[88])
Type Location Associated
conditions
Histopathology
and unique serum
biochemistry
References
Atherosclerotic
intimal
calcification(AIC)
Intimal Atherosclerosis;
Hyperlipidemia;
Osteoporosis;
Hypertension
Eccentric lumen-
deformation;
Vessel remodeling,
elastinolysis;
Increased oxidized
LDL
Boström(1993)[68]
Parhami(1997)[72]
Tintut(2000)[73]
Abedin(2004)[74]
Medial arterial
calcification(MAC)
a.k.a “Mönckeberg's
medial calcific
sclerosis”
Tunica
media
Type 2 diabetes
mellitus;
ESRD;
Hyperphosphatemia;
Amputation
Circumferential
calcium deposition
in the arterial tunica
media;
Adventitial
inflammation,
fibro-fatty
expansion;
Elevated circulation
OPG;
Matrix vesicle
mediated
calcification
Nelson(1988)[75]
Lehto(1998)[76]
Top(2002)[77]
Bas(2006)[78]
Al-Aly(2007)[79]
Aortic valve
calcification(AVC)
Aortic
face of
the
leaflets
Hyperlipidemia;
Congenital bicuspid
valve;
Rheumatic heart
disease
Fibro-fatty
expansion and
inflammation of the
lamina fibrosa;
Displaced and/or
split elastic lamina;
Rajamannan(2003)[80]
Katz(2006)[81]
O’Brien(2006)[12]
Rajamannan(2007)[82]
Calcific uremic
arteriolopathy(CUA)
a.k.a “calciphylaxis”
Micro-
vessels
ESRD;
Warfarin
Arteriolar(~ 0.6
mm
diameter)medial
calcification in
dermal, pulmonary
and mesenteric
vessels;
Fibroproliferative
occlusion,
secondary skin and
dermal fat necrosis;
Coates(1998)[83]
Janigan(2000)[84]
Wilmer(2002)[85]
Griethe(2002)[86]
BMP4: bone morphogenetic protein 4; MGP: matrix Gla protein; ESRD: end-stage renal disease; LDL:
low-density lipoprotein;
OPG: osteoprotegerin
21
Figure 2.8. Representative images for types of vascular calcification. Top: photos or
radiograph. Scale bar: 1 cm. bottom: H&E staining images. Magnification: 100X, Scale
bar: 100 µm. A: Healthy non-calcified aorta as control; B: Severe atherosclerotic intimal
calcification; C: Medial arterial calcification; Top:Pelvic and lower extremity radiograph
shows extensive calcification of the femoral arteries; Bottom: Microphotography of
arterial wall with calcified (violet colour) atherosclerotic plaque; D: Aortic valve
calcification; E: Calcific uremic arteriolopathy; Calciphylaxis on the abdomen of a
patient with end stage renal disease. Markings are in cm. Images information and
resources: A (49 years old male patients) and B (Severe stherosclerotic patients, 75 years
old male patients) were from cadavers provided by Dr. Michael E. Ward at Greenville
Hospital System (Greenville, SC).
C:http://en.wikipedia.org/wiki/Monckeberg's_arteriosclerosis; D and E bottom: From
pathologist - Lang Lei at The Second Affiliated Hospital to Nanchang University (Jiang
Xi, P. R. China); E top: http://en.wikipedia.org/wiki/Calciphylaxis.
2.3.4 Animal models for investigating vascular calcification
Many animal models are developed to study vascular calcification. Table 2.2
summarizes these animal models based on specific treatment protocols, species studied,
and location of calcification. Treatments studied include calcium chloride (CaCl2) injury
of abdominal aorta [27, 28, 30, 89-91], local perfusion of pancreatic elastase [92-94],
balloon angioplasty[95], systemic delivery of warfarin plus vitamin K [30, 96, 97],
22
Vitamin D [78, 98-100], nicotine plus vitamin D [101-104], indoxyl sulphate [105], and
many types of gene knockout models [64, 106-108].
The calcium chloride (CaCl2) injury model has been used for rat, mice, and rabbit
[27, 28, 30, 89-91]. Local damage to the abdominal aorta (or other regions like carotid
artery or thoracic aorta) is caused by direct application of CaCl2 resulting in chemical
damage of the tissue. This type of localized medial calcification is pathologically similar
to clinical cases and minimal injury to the arterial wall. In this model, adult rat aorta is
exposed and inflammation is induced by a single, periarterial application of calcium
chloride. This acute insult to the artery induces an accelerated and extensive calcification
accompanied by intense inflammation and severe elastin degradation [109].
The warfarin plus vitamin K model for rat typically uses 20 mg/kg/day of
warfarin in drinking water and 15 mg/kg/day of Vitamin K by subcutaneous injection
every other day for a total period of three weeks [30, 96, 97]. This treatment will cause
systemic calcification in the aorta, major arteries and heart valves for rats. Warfarin
inhibits activation of MGP (an important inhibitor of calcification), and vitamin K
restores normal coagulation time to offset the anticoagulant side effects of warfarin.
The vitamin D model for rat typically uses daily intraperitoneal injections of
vitamin D (1µg/kg) or supra-physiological vitamin D doses in diet (7.5 mg/kg) [78, 98-
100]. This treatment also causes systemic calcification in the aorta and major arteries.
The vitamin D model was used to mimic vascular calcification disease related to
osteoporosis and hyperparathyroidism secondary to chronic kidney disease. Toxicity of
23
vitamin D is associated with hyperabsorption of calcium and phosphorus [100]. Vitamin
D exerts a stimulatory effect on vascular calcification through direct inhibition of the
expression of parathyroid hormone–related peptide (PTHrP) in VSMCs as an endogenous
inhibitor of vascular calcification [110].
24
Table 2.2. Animal models of vascular calcification.
Protocol Species Mechanisms Location Characteristics References
CaCl2; 0.15M ~ 0.5 M
Single peri-
adenticial delivery
Rat/mice /rabbit
Chemical damage Abdominal aorta;
Carotid artery;
Thoracic aorta
Localized medial calcification similar to
clinical cases;
Local calcification at injury area
Basalyga(2004)[27] Ikonomidis(2003)[89]
Gertz(1988)[90]
Lai(2013)[91] Lei(2013)[28]
Sinha(2014)[30]
Warfarin; 20 mg/kg/day in
drinking water
Vitamin K; 15 mg/kg/day,
subcutaneous
injection every other day, 3 weeks
Rat Warfarin inhibit activation of MGP;
Vitamin K restore
normal coagulation time
Systemically in aorta, major
arteries and
heart valves
Systemically induce all arteries’ calcification;
Warfarin in diet or in
drinking water is safer than injection
Price(1998)[96] Bouvet(2007)[97]
Sinha(2014)[30]
Vitamin D;
daily
intraperitoneal injections, 1µg/kg;
Or supra-
physiological vitamin D doses
(7.5 mg/kg) in diet
Rat Hyperabsorption of
calcium and
phosphorus
Systemically in
aorta and major
arteries
Currently used to mimic
osteoporosis and
hyperparathyroidism secondary to chronic
kidney disease
Boström(2000)[98]
Price(2001) [99]
Bas(2006)[78] Zittermann(2008)[100]
Nicotine; 25 mg/kg, 5
ml/kg,
oral
administration;
Mostly used
combined with vitamin D
Rat Nicotine amplifies the calcifying effects
of Vitamin D
Systemically in aorta and major
arteries
Associated with advancing age;
Accompanied with
systolic hypertension and
LV concentric
hypertrophy
Niederhoffer(1997)[101] Pan(2004)[102]
Park(2008)[103]
Zhou(2009)[104]
Indoxyl sulphate;
200 mg/kg in water
Rat Uremic toxins Aorta
Increase thickness of the
arcuate aorta, thoracic aorta and abdominal aortas
Adijiang(2008)[105]
Elastaste;
Intraluminal delivery,
5.23 U/mg
Swine/
rabbit
Chemical damage Local
abdominal aorta;
Associated with medial
calcification; Reproducibility is
controversial
Marinov(1997)[92]
Carsten(2001)[93] Ding(2006)[94]
Balloon angioplasty
Rabbit Mechanical damage Local aorta Mainly used to study restenosis
Gadeau(2001)[95]
Gene knockout
model;
FGF23 deficient;
Klotho deficient;
MGP knockout; OPG knockout;
Fetuin A knockout
Mice Gene knockout to
specific gene related
to regulation of
vascular calcification
Systemically in
arteries
Showed specific role of
proteins in the
calcification process
Kuro-o(1997)[106]
Luo(1997)[64]
Schäfer(2003)[107]
Razzaque(2006)[108]
FGF23, Fibroblast growth factor 23; LV: Left ventricular; MGP, Matrix Gla protein; OPG, Osteoprotegerin;
25
The nicotine plus vitamin D model for rat uses combination of vitamin D with
nicotine (25 mg/kg, 5 ml/kg) given by oral administration [101-104]. This treatment
causes systemic calcification in the aorta and major arteries. Nicotine is added in
conjunction to the vitamin D to amplify the calcification processes. The nicotine plus
vitamin D model mimics calcification disease associated with advancing age and is
accompanied by systolic hypertension and left ventricular (LV) concentric hypertrophy.
The indoxyl sulphate (IS) model for rat uses 200 mg/kg of indoxyl sulphate in
drinking water [105]. The IS model showed increase thickness of the aorta. IS promotes
aortic wall thickening and aortic calcification with colocalization of osteoblast - specific
proteins [105]. Administration of IS to 5/6 nephrectomized rats caused glomerular
sclerosis in the remnant kidney with a decline in renal function [111]. Furthermore, IS
stimulated transcription of genes related to renal fibrosis [112].
The elastase model has been studied in swine and rabbit [92-94]. By intraluminal
infusion of elastaste after surgical exposure of aorta, an important number of necrotic
lesions were observed, and they were associated with the development of calcium
deposits by 3 weeks [92]. Elastase degrades elastin in elastic lamina of arteries, which in
turn induces local calcification for abdominal aorta. Many surgical modified techniques
have been investigated to get reproducible elastase-induced aneurysms related
calcification, such as direct exposure of the origin of the right common carotid artery
(RCCA) with placement of a temporary aneurysm clip instead of an occlusion balloon for
26
isolation of the artery, and more extensive dissection of the RCCA, down to its origin
from the brachiocephalic artery [94].
The balloon angioplasty model for rabbit uses mechanical damage to induce local
calcification of abdominal aorta [95]. The aortic injury was rapidly followed by calcified
deposits that appeared in the media as soon as 2 days after injury and then accumulated in
zipper-like structures. This rapid aortic calcification model is good to study mechanisms
involved in the initiation step of the aortic calcification process but mainly related to
restenosis [45].
Many types of gene knockout models for mice have been studied including
Fibroblast growth factor 23(FGF23) deficient, Klotho deficient, matrix GLA protein
(MGP) knockout, OPG (Osteoprotegerin) knockout and fetuin A knockout model[64,
106-108]. Knocking out specific genes related to regulation of vascular calcification will
cause systemic calcification in arteries and will show the specific role of proteins in the
calcification process. Kuro-o et al. in 1997 showed that defect in klotho gene expression
in the mouse results in a syndrome that resembles human ageing, including a short
lifespan, arteriosclerosis, skin atrophy etc. The klotho gene encodes a membrane protein
that shares sequence similarity with theb-glucosidase enzyme [106]. Luo et al. in 1997
showed that mice that lack MGP develop to term but die within two months as a result of
arterial calcification which leads to blood vessel rupture and concluded that MGP is the
first inhibitor of calcification of arteries and cartilage to be characterized in vivo [64].
Schäfer et al. in 2003 identified the serum protein α2–Heremans-Schmid glycoprotein
27
(Ahsg, also known as fetuin-A) as an important inhibitor of ectopic calcification acting
on the systemic level. Ahsg-deficient mice were phenotypically normal, but develop
severe calcification of various organs on a mineral and vitamin D–rich diet [107].
Razzaque et al. in 2006 foung that FGF23 deficient mice exhibited numerous
biochemical and morphological features consistent with premature aging-like phenotypes,
along with severe atherosclerosis, widespread soft tissue calcifications [108].
2.3.5 Current or prospective therapies for treating vascular calcification
Current or prospective therapies for treating vascular calcification are summarized
in Table 2.3 (Modified from Kapustin (2009) [6], Wu (2013) [7]). These treatments are
often existing therapies for related conditions and could be classified as three categories
based on different targets and mechanisms of action: chronic kidney disease and
osteoporosis therapies, cardiovascular disease therapies, and experimental therapies.
Therapies for treating vascular calcification associated with chronic kidney
disease (CKD) and osteoporosis include: 1) treatments using bisphosphonates, sevelamer,
calcimimetics and thyroidectomy so as to target mineral imbalance, and 2) sodium
thiosulfate (STS) as a vasodilator, antioxidant, and calcium chelator [113-118]. The
treatments with bisphosphonates, sevelamer, calcimimetics and thyroidectomy were
proposed to maintain Ca and P serum levels, inhibit initialization and growth of calcium
apatite crystals and prevent osteo/chondrogenic transition of vascular smooth muscle cell
(VSMC). However, these treatments had complications and limitations such as crosstalk
with bone metabolism and require strict dialysis protocols; [116, 117, 119-122]. STS
28
treatment could improve local circulation, reduce inflammation and calcification. STS is
an established treatment for calciphylaxis. However, STS also has possible side effects
such as hypocalcemia and bone loss [119].
Most common therapies for treating vascular calcification associated with
cardiovascular diseases are statins. Statins are a group of drugs that help to lower serum
cholesterol by inhibiting 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA)
reductase in the liver, to help prevent the formation of atherosclerotic lesions. Statins
have been used to lower serum cholesterol and reduce arterial calcification [123-125].
Statin treatments prevent inflammation and increase VSMC survival and viability.
Callister et al. in 1998 demonstrated that treatment with HMG-CoA reductase inhibitors,
or statins can reduce the calcium-volume score and volume of calcified plaque in the
coronary arteries [123]. A retrospective study of 174 patients with mild to moderate
calcific aortic stenosis was conducted by Novaro et al. in 2001 [124]. Results showed that
statin-treated patients had reduced aortic stenosis progression compared with those not
treated with a statin [124]. Although statins could prevent atherosclerosis, it is ineffective
for diabetic CKD [125]. Besides, statin treatments had side effects with the immune
system and tissue remodeling [126, 127]. Statins were found to suppress the induction of
Major histocompatibility complex class II (MHC-II) molecules, which affect the immune
response and organ rejection after transplantation [126].
29
Table 2.3.Current or prospective therapies for treating vascular calcification(Modified
from Kapustin(2009)[6], Wu(2013)[7]).
Treatment Mechanisms of action Complication and limitation References
Chronic kidney disease and osteoporosis therapies
Bisphosphonates
Sevelamer Calcimimetics
Thyroidectomy
Target mineral imbalance;
Maintain Ca and P serum levels; Inhibition of initialization and
growth of the calcium apatite
crystal;
Side effects with bone metabolism;
Strict dialysis protocols
Hafner(1995)[113]
Asmus(2005)[114] Russell(2007)[115]
O'Neill(2008)[116]
O'Neill(2010)[117] Raggi(2011)[118]
Sodium thiosulfate A vasodilator, antioxidant, and
calcium chelator;
Improves local circulation,
reduces inflammation and calcification
Established treatment for
calciphylaxis;
Possible side effects such as
hypocalcemia and bone loss
Pasch(2008)[119]
O'Neill(2008)[116]
O'Neill(2010)[117]
Adirekkiat(2010)[120] Mathews(2011)[121]
Ong(2012)[122]
Vitamin K Increases activation of circulating MGP, an
inhibitor of calcification
Only worked for patients have vitamin K deficiency
Spronk(2004)[128] Holden(2010)[129]
Schlieper(2011)[130]
Westenfeld(2012)[131]
Cardiovascular disease therapies
Statins Prevent inflammation;
Increase VSMC survival and
viability
Side effects with immune system and
tissue remodeling;
Could prevent atherosclerosis but ineffective for diabetic CKD
Callister(1998)[123]
Novaro(2001)[124]
Wanner(2005)[125] Mach(2004)[126]
Greenwood(2006)[127]
Experimental therapies
Carbonic anhydrase II Induction of calcium deposit
resorption
Side effects with bone metabolism Rajachar(2009)[132]
Osteoclast-mediated demineralization
Main mineral-resorbing cells in the body;
Resorb abnormal minerals in
vascular calcification
Cells only migrated to the adventitial layer of the artery;
Successful delivery of the osteoclasts is
still a big challenge
Simpson(2007)[133]
EDTA Directly remove calcium from
calcified tissue
Binds serum calcium to reduce calcification;
Chelate toxic heavy metals;
Normalize calcium metabolism by reactivation of enzymes
inhibited by toxic heavy metals;
Anti-nanobacteria; Remove Fe and Cu to protect cell
membrane
Passible side effects including renal
toxicity, hypocalcemia, bone loss and
burning at injection site or along course
Bolick(1961)[134]
Maxwell(1963)[135]
Lufkin(1983)[136] Olszewer(1990)[137]
Guldager(1993)[14]
Cranton(2001)[138] Maniscalco(2004)[139]
Cavallotti(2004)[13]
Silay(2007)[140] Lamas(2013)[17]
Lei(2013)[28]
Treatments in italic type: clinical trials and are currently used; Treatments as listed not by italic type: hypothetical and experimental.
MGP: Matrix gla protein; VSMC: vascular smooth muscle cell
30
Finally, many experimental therapies were tested in animal models including: 1)
Carbonic anhydrase II [132]; 2) Osteoclast-mediated demineralization [133]; and 3)
EDTA chelation therapy [135-137] [13, 14, 138-140] [17]. Carbonic anhydrase II had
shown an induction of calcium deposit resorption but it had side effects on bone
metabolism [132]. Osteoclasts are the only mineral-resorbing cells in the body and
osteoclasts delivery was tried as a method to resorb abnormal minerals in vascular
calcification. However, the Osteoclast-mediated demineralization method showed that
cells only migrated to the adventitial layer of the artery and successful delivery of the
osteoclasts still remains a challenge [133].
2.4 Chelation therapy
Chelation therapy most often involves the injection of EDTA, a chemical that
binds, or chelates ionic calcium, trace elements, and other divalent cations [141]. At
present, whether or not chelation therapy reverses vascular calcification is quite
controversial [9]. There are many proposed mechanisms for EDTA chelation therapy to
reverse calcification. EDTA can directly remove calcium from calcified tissue [28, 134].
EDTA can bind serum calcium to reduce calcium levels and that way can prevent mineral
augmentation. It can also chelate toxic heavy metals and normalize calcium metabolism
by reactivation of enzymes inhibited by toxic heavy metals [135-138]. EDTA also been
shown as an anti-nanobacteria and can remove Fe and Cu to protect the cell membrane
[13, 139, 140]. However, systemic side effects including renal toxicity [18-23] ,
hypocalcemia [14, 24, 25], bone loss [14, 26] prevent it from being an accepted form of
treatment for vascular calcification. If one can reduce systemic side effects, EDTA
31
chelation therapy might still be a promising treatment for diseases of vascular
calcification. Site-specific targeted drug delivery has advantages such as lower toxicity,
higher therapeutic effect, thus one can envision such therapies for resorbing mineral from
arteries.
2.4.1 Types and applications of chelation therapy
Many types of chelators have been studied for medical applications including:
EDTA [17, 24, 142-144], calcium disodium EDTA (calcium disodium versante, CaNa2-
EDTA) [145-147], STS [120, 121, 148-151], diethylene triamine pentaacetic acid (DTPA)
[152, 153], dimercaprol (British anti-Lewisite; BAL) [145, 154], Dimercaptosuccinic
acid (DMSA) [145, 155], dimercapto-propane sulfonate (DMPS) [156, 157],
penicillamine [145, 158], deferoxamine and deferasirox [159, 160]. Current types and
applications of chelation therapy based on type of chelator are summarized in Table 2.4.
32
Table 2.4. Types and applications of chelation therapy.
Type of chelator Medical applications References
EDTA Hypercalcemia;
Prevent calcification of fixed tissue;
Cardiovascular disease include heart disease
and atherosclerosis
Spencer(1956)[24]
Clarke(1956)[142]
Robert(1980)[143]
Sucu(2006)[144]
Lamas(2013)[17]
Calcium disodium EDTA
(calcium disodium versenate;
CaNa2-EDTA)
mercury and lead poisoning Trevor(2007)[145]
Saxena(2004)[146]
Leckie(1958)[147]
Sodium thiosulfate(STS) Antioxidant;
Cyanide toxicity;
Skin diseases like acne and pityriasis
versicolor;
Carboplatin and cisplatin-induced oto- and
nephrotoxicity;
Calcific uremic arteriolopathy(CUA) a.k.a
“calciphylaxis”;
Decrease vascular calcification in ESRD;
Delay progress of CAC in hemodialysis
patients;
Hayden(2005)[148]
Dickey(2005)[149]
Pouyatos(2007)[150]
Hayden(2008)[151]
Mathews(2011)[121]
Adirekkiat(2010)[120]
DTPA MRI contrasting agents;
Treatment of radioactive materials such as
plutonium, americium, and other actinides
Caravan(1999)[152]
Brown(2012)[153]
Dimercaprol
(British anti-Lewisite; BAL)
Lewisite poisoning (for which it was
developed as an antidote);
Arsenic, mercury, lead poisoning
Goldman(1989)[154]
Trevor(2007)[145]
Dimercaptosuccinic acid
(DMSA)
Arsenic, mercury, lead poisoning Archbold(2004)[155]
Trevor(2007)[145]
Dimercapto-propane sulfonate
(DMPS)
severe acute arsenic, mercury poisoning Aposhian(1990)[156]
Gonzalez-
Ramirez(1998)[157]
Penicillamine Mainly in copper toxicity of Wilson's
disease;
Occasionally adjunctive therapy in: gold
toxicity, arsenic poisoning, lead poisoning
rheumatoid arthritis
Peisach(1969)[158]
Trevor(2007)[145]
Deferoxamine and Deferasirox
Acute iron poisoning;
Iron overload
Moeschlin(1964)[159]
Westlin(1966)[160]
CAC: coronary artery calcification; DTPA: diethylene triamine pentaacetic acid; ESRD: End-stage renal
disease; MRI: Magnetic resonance imaging
33
EDTA has been used in hypercalcemia, prevention of calcification for fixed tissue,
and as a treatment for cardiovascular diseases including atherosclerosis [17, 24, 142-144].
Tables 2.5 shows EDTA’s binding constants to metal ions (modified from Halstead
[103]), Rozema [104]). Higher binding constant indicates more potential of binding to the
metal ion. Clearly, EDTA binds strongly with iron, mercury and lead.
Table 2.5. EDTA’s binding constants to metal ions(modified from Halstead (1979[161]),
Rozema(1997)[162])
Metal cation Fe+++ Hg++ Cu++ Pb++ Ni++ Zn++ Cd++ Co++ Al+++ Fe++ Mn++ Ca++ Mg++
Log K 25.1 21.8 18.8 18.5 18.0 16.5 16.5 16.3 16.1 14.3 13.7 10.7 8.7
Calcium disodium EDTA (calcium disodium versenate, CaNa2-EDTA) [145-147]
has been used as treatment in mercury and lead poisoning and has been approved by US
Food and Drug Administration (FDA). STS has been used as an antioxidant, treatment
for cyanide toxicity, skin diseases like acne and pityriasis versicolor, carboplatin and
cisplatin-induced oto- and nephrotoxicity, calcific uremic arteriopathy(CUA) a.k.a
“calciphylaxis”. STS treatment has been shown to decrease vascular calcification in
ESRD and delay progress of CAC in hemodialysis patients [120, 121, 148-151].
DTPA has been used as magnetic resonance imaging (MRI) contrasting agents,
treatment of radioactive materials such as plutonium, americium, and other actinides [152,
153]. Dimercaprol (British anti-Lewisite; BAL) has been used for Lewisite poisoning (for
which it was developed as an antidote) and arsenic, mercury, lead poisoning [87, 96].
DMPS also has been used for severe acute arsenic, mercury poisoning [98, 99].
34
Penicillamine is mainly used in copper toxicity of Wilson's disease and occasionally
adjunctive therapy in: gold toxicity, arsenic poisoning, and lead poisoning rheumatoid
arthritis [87, 100]. Deferoxamine and deferasirox is mainly used in acute iron poisoning
and iron overload [101, 102].
2.4.2 In vitro and animal studies of chelation therapy for vascular
calcification
Few studies have been reported for chelation therapy using EDTA [134] [11, 13,
21, 28, 144, 163-165] and STS [119, 166] to prevent or reverse calcification (Table 2.6).
It has been shown in vitro that EDTA could remove calcium from human
calcified tissue. A modified form of EDTA, NH4-EDTA, provided a quantitative method
of decalcifying tissue [134]. EDTA also has been used as a pre-treatment for
bioprosthetic materials such as collagen-elastin matrix (CEM) and bovine pericardium
specimens and significantly decreased the calcification of these tissues in a rat subdermal
model [163] [144, 164]. One study of the mechanism of renal vacuologenesis induced by
EDTA systemic infusion (jugular vein injection, 1000 mg/kg, disodium Ca-EDTA)
showed EDTA-induced vacuologenesis is a reflection of the induction of pinocytosis by
the chelate [21].
EDTA treatment by direct infusion (50 mg/kg, 15 mg/minutes, total 20 infusions)
showed significantly less calcium in the aorta of the EDTA infused animals in an
atherosclerotic rabbit model (cholesterol diet and Vitamin D3 injection) [11]. However,
O'Brien et al. shown that EDTA treatment (40 mg/kg, daily intravenous injection, 4
35
weeks) caused a 74% increase in triglyceride levels and no benefit on arterial lesions in
an atherosclerotic, obese, diabetic rat model [165]. Cavallotti et al. showed that EDTA
treatment (40 mg/kg or 120 g/3 kg rabbit, daily intravenous injection, 10 days) showed a
marked decrease of the calcification in a rabbit calcification model [13]. We recently
compared chelating efficacy EDTA, DTPA and STS (1–10 mg/mL) to remove calcium
from hydroxyapatite (HA), calcified elastin and aortic tissue and showed that EDTA and
DTPA could effectively remove calcium from HA and calcified tissues, while STS was
not effective [28]. We further showed that EDTA-loaded PLGA nanoparticle pellets (30
mg) when placed periadventitially on calcified abdominal aorta could also reverse local
vascular calcification in vivo [28].
36
Table 2.6. In vitro and animal studies for chelation therapy
Chelating
agent
Study design Results References
EDTA NH4-EDTA and EDTA were used to remove calcium from human calcified tissue
Provided a quantitative method of decalcifying tissue
Bolick(1961)[134]
SD rats, n=5 in each group; 1000 mg/kg of
disodium Ca-EDTA; jugular vein injection;
Renal toxicity Schwartz(1970)[21]
Rat subdermal model; Collagen-elastin matrix
(CEM) were implant after pretreatment with various conditions of ethanol and EDTA
Significantly decreased the
calcification rate of CEM
Singla(2003)[163]
Rat subdermal model; Pericardium specimens were
treated with PBS containing 100 µg/ml EDTA
EDTA was useful in the
attenuation of calcification
Sucu(2006)[144]
Rat subdermal model; Freshly excised bovine
pericardium fixed in PBS solution containing 11%
EDTA for a period of 48 h (30 ml/g tissue)
Calcium content of EDTA-
treated pericardium was
significantly lower
Sucu(2004)[164]
Atherosclerotic rabbit model by cholesterol diet and
Vitamin D3 injection;
EDTA: 50 mg/kg, 15 mg/minutes, total 20 infusions
Significantly less calcium in
the aortas of the EDTA
infused animals
Kaman(1990)[11]
Atherosclerotic, obese, diabetic rat model; EDTA: 40 mg/kg, daily intravenous injection, 4
weeks
No benefit on arterial lesions; But produced in a 74%
increase in triglyceride levels
O'Brien(2000)[165]
Rabbit calcification model by a single dose of 8 mg
of dihydro-tachysterol(synthetic vitamin D analog); EDTA: 40 mg/kg(120 g/3 kg rabbit), daily
intravenous injection, 10 days
Marked decrease of the
calcification
Cavallotti(2004)[13]
EDTA, DTPA and STS(1–10 mg/mL) were used to remove calcium from hydroxyapatite calcified
tissue;
EDTA-loaded PLGA nanoparticle pellets (30 mg) were placed periadventitially on calcified abdominal
aorta
EDTA and DTPA could effectively remove Ca from
HA and calcified tissues,
while STS was not effective
Lei(2013)[28]
Sodium thiosulfate(S
TS)
Uremic rat model by adenine-induced nephropathy; STS: 0.4 g/kg intraperitoneally 3 times a week;
Prevent vascular calcifications in
uremic rats;
Side effects such as bone loss and transiently lowered
ionized calcium in blood
plasma
Pasch(2008)[119]
Aortic calcification model and hydroxyapatite formation in vitro;
STS: 1-2 mM;
Aimed to determine effect of thiosulfate on vascular calcification and hydroxyapatite formation
Thiosulfate inhibited vascular calcification through a direct
extracellular effect related to
cellular injury
O’Neill(2012)[166]
One recent study by O’Neill et al. using STS aimed to determine the effect of
thiosulfate on vascular calcification and hydroxyapatite formation using an aortic
37
calcification model and hydroxyapatite formation in vitro [166]. Their results showed that
thiosulfate prevented calcification of injured or devitalized aortas but not uninjured aortas.
Another animal study using systemic STS (0.4 g/kg intraperitoneally 3 times a week)
showed that STS treatment could prevent vascular calcifications in a uremic rat model by
adenine-induced nephropathy [119]. However, the STS treatment had side effects such as
bone loss and transiently lowered ionized calcium in blood plasma.
2.5 EDTA chelation therapy
2.5.1 Case studies and clinical trials of EDTA chelation therapy
Many case studies and clinical trials have been conducted for EDTA chelation
therapy (Summarized in Table 2.7). Results of all these studies are quite controversial.
On the positive side there are several studies that show improvement with chelation
therapy. Clarke et al. in 1956 [142] reported a case study of EDTA chelation therapy (5
g EDTA, intravenous infusion) with 20 patients with coronary heart disease showing 19
patients with improved symptoms post treatment with EDTA. They continued their
research with another bigger case study with 700 patients afflicted by coronary heart
disease and showed that 87% of the patients had improved symptoms post treatment with
EDTA [167]. Olszewer et al. in 1990 [137] did a pilot double blinded study with EDTA
chelation therapy (1.5 g EDTA, 20 intravenous infusion) with 10 patients (all male, aged
41 to 53 years) diagnosed with peripheral vascular disease. Results showed that EDTA
chelation therapy had substantial improvements for the walking test and master exercise
test. Rudolph et al. in 1991 [168] reported a case study with 30 patients diagnosed with
38
atherosclerotic vascular disease. EDTA chelation therapy (3 g EDTA, 30 intravenous
infusions, and 10 months) was shown to decrease intra-arterial obstruction and reduce in
stenosis post treatment with EDTA. Hancke et al. in 1993 [169] reported a case study
with 470 patients and showed that after EDTA chelation therapy (50 mg/kg, 30
intravenous infusions, 3-4 months) more than 80% of the patients had objective evidence
for improvement post treatment with EDTA. Maniscalco et al. in 2004 [139] reported a
case study with 100 patients who had stable coronary artery disease (CAD) using ComET
therapy, which is composed of (1) nutraceutical powder, (2) tetracycline HCl, and (3)
EDTA 1.5 g taken in a rectal suppository base. After ComET therapy, coronary artery
calcium (CAC) scores decreased. Shoskes et al. in 2005 [170] reported a case study with
16 male patients with recalcitrant chronic prostatitis/chronic pelvic pain syndrome(CPPS)
showing significant improvement of symptoms in the majority of men after ComET
therapy. Cacchio et al. in 2009 [171] reported a case study with 80 patients with
radiographically verified calcific tendinitis of the shoulder and after single-needle
mesotherapy (1 ml of 15%disodium EDTA) calcifications were greatly decreased.
However, there were four published randomized trials of EDTA chelation therapy
therapy that are not completely consistent with the aforementioned case studies. The first
randomized trial was done by Guldager et al. in 1993 [14] with a total of 54 patients (15
women and 39 men, aged 41 to 81 years) with intermittent claudication. Patients
underwent EDTA chelation therapy (3 g EDTA, 20 intravenous infusion, 5-9 weeks).
However, results in this study showed no differences in groups in any clinically relevant
parameter and the EDTA chelation therapy was accompanied by bone loss. A study by
39
Van et al. in 1994 [15] with 32 patients with intermittent claudication and also showed
that EDTA chelation therapy (3 g EDTA, intravenous infusion) had no significant
beneficial effects in patients with intermittent claudication but had some improvement in
resting ankle-brachial index. Knudtson et al. reported in 2002 [16] a case with 84 patients
who were at least 21 years old with coronary artery disease (CAD). This study showed
that EDTA chelation therapy (40 mg/kg EDTA, intravenous infusion) had no evidence to
support a beneficial effect. A recently study conducted by Lamas et al. in 2013 and
funded by NIH [17] with 1708 patients with myocardial infraction showed that EDTA
chelation therapy (50 mg/kg EDTA, intravenous infusion , one time a weeks, 40 weeks)
would modestly reduce the risk of adverse cardiovascular outcomes but the data did not
reach statistical significance. Moreover, this study did not highlight calcium score data.
40
Table 2.7. Case studies and clinical trials of EDTA chelation therapy.
Reference Sample size Study design Results
Clarke(1956)[142] 20 patients; with coronary heart disease
5 g EDTA, intravenous infusion 19 improved, 1 died
Clarke(1960)[167] 700 patients;
with coronary heart disease
NA 87% improved
Olszewer(1990) [137] 10 patients(all male, aged 41
to 53 years); pilot double blinded study;
with peripheral vascular
disease;
1.5 g EDTA, 20 intravenous infusion
Substantial improvements for
walking test, master exercise test
Rudolph(1991) [168] 30 patients;
with atherosclerotic vascular
disease
3 g EDTA, 30 intravenous infusions,
10 months
Intra-arterial obstruction
decreased;
Reduction in stenosis
Guldager(1993) [14] Total 54 patients(15 women
and 39 men, aged 41 to 81
years); randomized controlled trial;
with intermittent
claudication
3 g EDTA, 20 intravenous infusion, 5-
9 weeks
Accompanied by bone loss
Hancke(1993) [169] 470 patients 50 mg/kg EDTA, 30 intravenous
infusions, 3-4 months
more than 80% had objective
evidence for improvement
Van(1994)[15] 32 patients; randomized controlled trial;
with intermittent claudication
3 g EDTA, intravenous infusion No significant beneficial effects in patients with intermittent
claudication;
Some improvement in resting ankle-brachial index
Knudtson(2002) [16] 84 patients(at least 21 years
old); randomized controlled trial;
with CAD
40 mg/kg EDTA, intravenous
infusion;
No evidence to support a
beneficial effect ; Positive treadmill test for ischemia
Maniscalco(2004)[139] 100 patients; with stable CAD and positive
CAC scores
ComET therapy was composed of (1) Nutraceutical Powder (2) Tetracycline
HCl;(3) EDTA 1.5 g taken in a rectal
suppository base
CAC scores decreased during ComET therapy trial
Shoskes(2005) [170] 16 male patients;
with recalcitrant chronic prostatitis/chronic pelvic pain
syndrome(CPPS)
ComET therapy Significant improvement in the
symptoms of recalcitrant CPPS in the majority of men
Cacchio(2009) [171] 80 patients;
with radiographically verified calcific tendinitis of
the shoulder
1 ml of 15% EDTA, single-needle
mesotherapy
Calcifications greatly decreased
Lamas(2013)[17] 1708 patients; Randomized controlled trial;
myocardial infraction
50 mg/kg EDTA, intravenous infusion , one time a weeks, 40 weeks
Modestly reduced the risk of adverse cardiovascular
outcomes; Did not highlight
calcium score data
CAD: coronary artery disease; CAC: coronary artery calcium; CPPS: chronic pelvic pain syndrome; NA: not available
41
2.5.2 Side effects with traditional systemic EDTA chelation therapy
Many side effects have been found with traditional systemic EDTA chelation
therapy (Table 2.8), which include but are not limited to: renal toxicity [18-23] ,
hypocalcemia [14, 24, 25], bone loss [14, 26] and burning at injection site or along course
of vein [25].
The most important potential adverse event with EDTA chelation therapy is renal
toxicity [18-23]. Holland et al. in 1953 [18] reported that two instances of renal tubular
vacuolization following administration of sodium-EDTA. Schwartz et al. in 1966 [19]
showed that vacuolization also occurred and part of the chelate enters the cells via
pinocytosis post EDTA treatment. Doolan et al. in 1967 [20] also showed tubular
vacuolization produced in the rat by intraperitoneal injection of EDTA daily for 10 days;.
Schwartz et al. in 1970 [21] showed renal tubular cell vacuolization in the outer renal
cortex after EDTA chelation therapy (1000 mg/kg of disodium Ca-EDTA; Jugular vein
injection). Oliver et al. in 1984 [23] reported that patients have renal failure accompanied
with underlying renal disease after EDTA chelation therapy. However, McDonough et al.
in 1982 [22] did a study with 383 patients diagnosed with occlusive arterial disease and
showed that EDTA infusion (3 g EDTA; 10 intravenous infusion; 5 days between
infusions) is not nephrotoxic.
The second possible adverse event is hypocalcemia [14, 24, 25]. Spencer et al. in
1956 [24] showed transient hypocalcemia after EDTA chelation therapy. Meltzer et al. in
1961[25] showed that with 81 patients, 20 occurrences of mild hypocalcemia presented
42
after EDTA chelation therapy (2000 infusions given on alternate days over 2 years).
Guldager et al. in 1993 [14] conducted a randomized controlled trial with 15 women and
39 men (aged 41 to 81 years, 20 intravenous infusion, 5-9 weeks) and showed a decrease
in serum calcium after EDTA chelation therapy.
Some other side effects include bone loss [14, 26]. Results for bone loss are non-
consistent. Rudolph et al. in 1988 [26] conducted a case study with 61 patients and
showed that EDTA chelation therapy (3 g EDTA, 20 intravenous infusion, 5-9 weeks)
had no effect on bone density and may even enhance bone growth in patients with
osteoporosis. On the contrary, Guldager et al. in 1993 [14] did a randomized controlled
trial with total 54 patients (15 women and 39 men, aged 41 to 81 years) with intermittent
claudication and showed that EDTA chelation therapy (3 g EDTA, 20 intravenous
infusion, 5-9 weeks) increased bone resorption and was accompanied by bone loss.
43
Table 2.8. Side effects of EDTA chelation therapy.
Side effect Sample size Treatment
protocol
Results References
Renal toxicity 5; human NA Two instances of renal
tubular vacuolization
following administration of
sodium-EDTA have been
observed
Holland(1953)
[18]
NA NA Vacuolization occurred;
part of the chelate enters the
cell via pinocytosis
Schwartz(1966)
[19]
NA; rats NA Tubular vacuolization
produced in the rat by
intraperitoneal injection of
EDTA daily for 10 days;
Doolan(1967) [20]
SD rats, n=5
in each group
1000 mg/kg
disodium Ca-
EDTA, jugular
vein injection;
EDTA-induced
vacuologenesis is a
reflection of the induction of
pinocytosis by the chelate
Schwartz(1970)
[21]
383 patients;
3 g EDTA, 10
intravenous
infusion, 5 days
between infusions
EDTA infusion is not
nephrotoxic
McDonagh(1982)
[22]
NA NA Renal failure accompanied
with underlying renal
disease
Oliver(1984)[23]
Hypocalcemia NA NA Transient Hypocalcemia Spencer(1956)[24]
81 patients 2000 infusions
given on alternate
days over 2 years
20 occurrences of mild
Hypocalcemia
Meltzer(1961)[25]
Total 54
patients;
3 g EDTA, 20
intravenous
infusion, 5-9
weeks
Decreased in serum calcium Guldager(1993)
[14]
Bone loss 61 patients 3 g EDTA;
intravenous
infusion;
3 months
No effect to bone density;
Mayt enhance bone growth
in patients with osteoporosis
Rudolph(1988)
[26]
Total 54
patients;
with
intermittent
claudication
3 g EDTA, 20
intravenous
infusion, 5-9
weeks
Increased bone resorption;
Accompanied by bone loss
Guldager(1993)
[14]
NA: not available;
44
2.5.3 Current opinions of EDTA chelation therapy for cardiovascular disease
Current opinions of EDTA chelation therapy for cardiovascular disease are still
quite disputed (Table 2.9). There are many positive opinions from proponents [17, 141,
168, 172] but there are many negative opinions from opponents [173-176]. Proponents
stated that “EDTA chelation can significantly decrease atheromatous plaque” [168],
“modestly reduced the risk of adverse cardiovascular outcomes” [17]. On the contrary,
opponents stated that “It was not useful for CAD or PVD” [173], “Chelation therapy is
not recommended for the treatment of chronic angina or atherosclerotic cardiovascular
disease and may be harmful because of its potential to cause hypocalcaemia” [174]. Most
proponents highlight therapeutics effects of EDTA chelation therapy in aspects of
cardiovascular outcomes but whether or not it reverses calcification is not clear.
EDTA treatment to treat hypercalcemia is FDA approved but EDTA drugs for
purpose of chelation is not approved by FDA. FDA has not received statistically
significant clinical data sufficient to support either the safety or efficacy of EDTA drugs
when they are used for these "chelation" purposes [140].
45
Table 2.9. Current opinions of EDTA chelation therapy for cardiovascular disease.
References Organization Statements
Negative opinions from opponents
Soffer(1964)
[173]
Editor-in-Chief of both
Chest and Archives of
Internal Medicine
“It was not useful for CAD or PVD.”
Fraker(2007)
[174]
Cardiologist and professor
of clinical medicine at The
Ohio State University
Medical Center
“Chelation therapy (intravenous infusions of
ethylenediamine tetra-acetic acid or EDTA) is not
recommended for the treatment of chronic angina or
atherosclerotic cardiovascular disease and may be
harmful because of its potential to cause
hypocalcaemia.”
Jackson(2008)
[175]
Editor of International
Journal of Clinical Practice
“Chelation therapy is TACT-less, one wonders why it
is still widely used, given the lack of evidence of
benefit and potential to do harm (financial gain seems
the most likely reason).”
Atwood(2008)
[176]
Assistant Clinical Professor
at the Tufts University
School of Medicine
“We conclude that the TACT is unethical, dangerous,
pointless, and wasteful. It should be abandoned.”
“Chelation for atherosclerosis was condemned by the
Medical Letter, the American Heart Association
(AHA), and the American College of Physicians, the
American ....”
Positive opinions from proponents
Rudolph(1991)
[168]
Associate Professor and
Chairman in Biochemistry
Department of Texas
College of Osteopathic
Medicine
“EDTA chelation can significantly decrease
atheromatous plaque and the chance of cerebral
infraction.”
Cranton(2001)
[172]
President, American College
for Advancement in
Medicine, 1991-1992.
Editor-in-Chief, Journal for
Advancement in Medicine,
1986 to 1989.
"This therapy has been proven effective over and over
again in clinical practice."
"More than one million patients have received more
than twenty million infusions with no serious or lasting
adverse effects."
Lamas(2006,.
2013) [17, 141]
Chief, Division of
Cardiology at Mount Sinai
Medical Center, Columbia
University;
“EDTA chelation therapy meets evidence-based
medicine.”
“Among stable patients with a history of Myocardial
infarction (MI), use of an intravenous chelation
regimen with disodium EDTA, compared with placebo,
modestly reduced the risk of adverse cardiovascular
outcomes.”
CAD: coronary artery disease; MI: myocardial infarction; PVD: peripheral vascular disease; TACT: Trial
to Assess Chelation Therapy
46
2.6 Targeted EDTA chelation therapy
2.6.1 Local drug delivery in the vasculature
MAC occurs heterogeneously along vascular tree. Thus local drug delivery would
a good option for treating MAC. Ideally local drug delivery would: 1) maximize drug’s
therapeutic effects and also 2) minimize undesired systemic side effects.
Three possible approaches to delivers drug locally to vasculature can be classified
as: 1) intra-luminal delivery; 2) peri-adventitial delivery; and 3) Novel sustained release
vehicles as showed in Figure 2.9, Figure 2.10, and Figure 2.11.
Some current available intra-luminal delivery devices include: double balloon
catheter (Figure 2.9A) and periadventitial delivery using needle injection catheter
(Figure 2.9B). Jo̸rgensen et al. in 1989 did a study with 6 consecutive patients
undergoing percutaneous transluminal angioplasty (PTA) for superficial femoral artery
occlusion, with a 7-French double-balloon catheter. Recombined human tissue-type
plasminogen activator (rt-PA) and heparin were then infused into the enclosed space for
30 minutes, followed by intravenous heparin for 24 hours. Results showed that at 10 and
30 days all 6 patients had evidence of recanalisation and remission of symptoms [177].
Needle injection catheter used fine needles that penetrate the media to deliver drugs.
Although it is invasive, a study done by Ikeno et al. in 2004 with 17 swine by delivering
Oregon green-labeled paclitaxel (OGP) and tacrolimus with this method showed limited
injury and trauma and also had retention of drugs up to 96 hours [178].
47
Figure 2.9. Intra-luminal delivery devices. A: Double balloon catheter [144]; B:
Periadventitial delivery using needle injection catheter [178].
Several animal studies showed successful peri-adventitial delivery of therapeutics
in local vasculature. Peri-adventital delivery methods include: Drug eluting polymer wrap
(Figure 2.10A), and polyvinyl alcohol (PVA) foam sutured to the artery (Figure 2.10B).
Villa et al. in 1994 did a rat study using a silicone polymers wrapped around the common
carotid arteries for 3 weeks, and results showed that periadventitial local delivery of
dexamethasone markedly inhibits neointimal proliferation after balloon vascular injury
[179]. Researches also have used PVA foams loaded with drugs for peri-adventitial
delivery. Sho et al. in 2004 used a mini-osmotic pump loaded with doxycycline into
PVA foam in order to provide a continuous infusion via periaortic delivery system
(PDS) and showed that PDS (1.5 mg/kg/day) and subcutaneous (60 mg/kg/day) delivery
methods caused comparable reductions in abdominal aortic aneurysm (AAA) diameter
48
during the period of 14 days. PDS rats gained more weight during the postoperative
period, possibly as a result of reduced serum drug levels and systemic toxicity [56].
Figure 2.10. Peri-adventital delivery methods. A: Drug eluting polymer wrap [179]; B:
PVA foam sutured to the artery [56].
Above mentioned delivery methods, intra-luminal and peri-adventitial delivery of
drugs to the site of pathology are all one time single application. However, sustained
release of drugs might be an attractive option to optimize drug’s therapeutic effects.
Some examples are discussed below.
Ogata et al. in 2010 developed a doxycycline loaded controlled release
biodegradable fiber (DCRBF) for local administration in AAA tissue (Figure 2.11A, B
and C).These doxycycline incorporated poly-lactic acid fibers showed a controlled in-
vitro drug release of 28 days and in-vivo release of up to 84 days [180].
49
Franck et al. in 1998 successfully created hydrocortisone loaded microspheres and
delivered them via perforated balloon catheters into rabbit arteries after balloon
angioplasty [181]. Westedt et al. also formulated nanoparticles that were infused coupled
with porous balloon catheter (Figure 2.11D) [182].
Figure 2.11. Novel sustained release vehicles. A: gross appearance of DCBRF; B and
C:TEM images of DCBRF[180]. D: TEM showing the nanoparticles eluting out of the
porous balloon [182].
All above mentioned local delivery methods require surgical manipulation which
would be quite invasive for patients. Also for several vascular calcification diseases, the
diseased aorta is spread heterogeneously along vascular tree. Thus an ideal delivery
method should be able to be applied systemically and targeted to various sites of
calcification. One possible way is using targeted albumin nanoparticles as discussed
below.
50
2.6.2 Albumin nanoparticles as drug carriers for different application
Albumin, a versatile protein carrier for drug delivery, is nontoxic, non-
immunogenic, biocompatible and biodegradable [183]. Therefore, it is ideal material to
fabricate nanoparticles for drug delivery.
Types of albumin used as drug carrier in nanoparticles include: Ovalbumin,
Bovine serum albumin (BSA) and Human serum albumin (HSA). Bovine serum albumin,
with a molecular weight of 69 KDa and an isoelectric point of 4.7 in water (at 25 °C), is
widely used for drug delivery because of its medical importance, abundance, low cost,
ease of purification, unusual ligand-binding properties, and its wide acceptance in the
pharmaceutical industry [184]. BSA could be replaced by HSA in order to circumvent a
possible immunologic response in vivo. HSA has preferential uptake in tumor and
inflamed tissue and its ready availability, biodegradability and lack of toxicity make it an
ideal candidate for drug delivery [185].
Methods to prepare albumin nanoparticles include: desolvation [186],
emulsification [187], thermal gelation [188] and recently nano spray drying [189], nab-
technology [190] and self-assembly [191]. In desolvation process, nanoparticles are
obtained by a continuous dropwise addition of ethanol to an aqueous solution of albumin
(pH 5.5) under continuous stirring until the solution becomes turbid. During the addition
of ethanol into the solution, albumin is phase separated due to its diminished water-
solubility. Coacervates are hardened by crosslinking with glutaraldehyde where the
amino moieties in lysine residues and arginine moieties in guanidine side chains of
51
albumin are solidified by a condensation reaction with the aldehyde-group of
glutaraldehyde [192].
Many in vivo studies have shown BSA to be a suitable carrier to target gamma-
interferon (IFN-γ) to macrophages and thus potentiating their therapeutic activity [193].
In a platelet aggregometric study, Das et al. clearly showed that the amount of aspirin
diffused from aspirin-loaded BSA nanoparticles at the end of 48 h was sufficient to
prevent platelet aggregation [194].
Many surface-modified albumin nanoparticles using antibody have been
investigated for better targeting. It has been shown that many malignancies like colorectal,
head, neck, non-small cell lung ovarian, breast and prostate cancers, as well as glioma,
show an overexpression of the epidermal growth factor receptor (EGFR) on their surfaces.
Thus, cetuximab, a humanized IgG1 monoclonal antibody (mAb) targets EGFR and was
approved for the treatment of colorectal cancer by FDA in 2004 [195]. Therefore,
cetuximab-modified HSA nanoparticles are a promising carrier system for drug transport.
A specific accumulation targeting the EGFR could be shown in EGFR-expressing colon
carcinoma cells [195]. Besides, DI17E6, a monoclonal antibody directed against αv-
integrins, was covalently coupled to HSA nanoparticles loaded with doxorubicin [196].
The thiolated antibody was coupled with sulfhydryl-reactive nanoparticle suspension to
achieve a covalent linkage between antibody and the nanoparticle system. The target-
specific nanoparticles specifically targeted αvβ3 integrin positive melanoma cells
showing increased cytotoxic activity compared to the free drug [196]. Since many
52
antibody coated albumin nanoparticles have been approve by FDA and are in clinical use,
our strategy to use anti-elastin antibody coated albumin nanoparticles would be also have
great clinical relevance.
2.6.3 Targeted EDTA chelation therapy using EDTA loaded albumin
nanoparticles
Previous attempts at systemic chelation therapy with EDTA to reverse
calcification required high dosage and had many side effects such as hypocalcemia, renal
toxicity and bone loss [14, 18, 119]. We propose that targeted EDTA chelation therapy
might be a promising way to address issues accompanied with systemic chelation therapy.
Nanoparticle-based targeted drug delivery could lower dosage of EDTA required
and have many other advantages such as improved bioavailability and sustained release
of drugs [29]. We propose that nanoparticle protein engineering therapy using targeted
EDTA loaded albumin NPs with elastin antibody offers potential solutions to reverse
vascular calcification and also circumvent possible side effects from systemic chelation
therapy by reducing the high dosage that systemic infusion requires. More specific data
has been discussed in Chapter 7.
53
CHAPTER 3: PROJECT RATIONALE
3.1 Project objective and aims
Based on the literature reviewed earlier, the main objectives of this project are:
a) Understand mechanisms of elastin specific medial arterial calcification
(MAC), specifically cause-and-effect relationship between the elastin-
specific MAC and osteoblast-like differentiation of vascular smooth
muscle cells (VSMCs).
b) Evaluate the efficacy of several chelating agents to reverse elastin specific
MAC.
c) Evaluate the therapeutic effects of systemic EDTA chelation therapy in the
aspect of reversal of calcification and possible side effects.
d) Develop a targeted delivery system based on EDTA loaded nanoparticles
to reverse elastin specific MAC at low doses and to circumvent systemic
side effects.
3.2 Specific aims and rationale
Specific Aim 1:
Determine cause-and-effect relationship between the elastin-specific MAC and
osteoblast-like differentiation of vascular smooth muscle cells (VSMCs).
Rationale: Osteoblast-like differentiation of vascular smooth muscle cells
(VSMCs) has been found in vascular calcification sites in animal studies as well as in
54
clinical retrospective studies; however, whether this osteogenesis plays a major role in
the initiation of vascular calcification is unclear. We hypothesize that the initial
deposition of hydroxyapatite-like mineral in MAC occurs on degraded elastin first and
that causes osteogenic transformation of VSMCs. Thus, we wanted to test if rat aortic
smooth muscle cells (RASMCs) cultured on hydroxyapatite crystals and calcified aortic
elastin would transform to osteoblast like cells. Another interesting question is upon
removal of calcified conditions, whether or not differentiated cells would have the ability
to revert back to SMC-like cell behavior. This is important as we can then envision
demineralizing strategies to remove mineral from arteries and bring homeostasis to the
arterial structures.
Specific Aim 2:
Evaluate the efficacy of chelating agents to reverse elastin specific MAC.
Rationale: Chelation therapy has been touted as an effective treatment to reverse
vascular calcification; however, it has been controversial with opposing views [8-10].
Most of the previous work is focused on atherosclerotic intimal calcification and
unfortunately, the efficacy of various chelating agents in reversing elastin specific
calcification from the peripheral vascular tissue is not studied very well either in vitro or
in animal experiments. We want to assess the chelating ability of EDTA, DTPA, and STS
on removal of calcium from hydroxyapatite (HA) powder, calcified aortic elastin, and
calcified human aorta in vitro. We further want to assess whether or not that local
periadventitial delivery of EDTA loaded nanoparticles could reverse elastin specific
55
calcification in the aorta. This research will allow us to select the best chelating agent for
reversal of MAC in vivo.
Specific Aim 3:
Evaluate therapeutic effects of systemic EDTA chelation therapy for reversal of
elastin specific MAC and its possible systemic side effects.
Rationale: At present whether or not EDTA chelation therapy reverses vascular
calcification is still quite disputed [9]. Currently, most of the EDTA chelation therapies
studied were using EDTA by subcutaneous infusion, or systemic application of EDTA
solution at very high dose (around 40 ~ 50 mg/kg) [11-17]. Many side effects have been
found with such a high systemic dose of EDTA chelation therapy including: renal
toxicity [18-23] , hypocalcemia [14, 24, 25], and bone loss [14, 26]. But results are quite
varied for side effects. We want to investigate whether or not systemic EDTA chelation
therapy could reverse local aortic calcification in an animal model of MAC and test
possible side effects to serum Ca, urine Ca, and bone loss. This would provide an
important pre-clinical animal study investigating EDTA’s therapeutic as well as potential
side effects in the aspect of reversal of MAC.
Specific Aim 4:
Develop a targeted delivery system for EDTA to reverse elastin specific MAC
and to avoid side effects associated with systemic therapy.
56
Rationale: Systemic chelation therapy using EDTA or sodium thiosulfate to
reverse calcification requires high dosage and has side effects such as hypocalcemia,
bone loss, and renal toxicity [14, 18, 119]. If we can target EDTA to the local vascular
calcification sites, we could lower the dosage of EDTA and can also improve efficacy
and reduce side effects [29]. We have recently shown that the elastin antibody coated
nanoparticles (NPs) can be targeted to vascular calcification sites [30]. Thus, in this study
we want to test if albumin NPs may be a good drug carrier to load EDTA. By surface
coating of anti-elastin antibody, these elastin antibodies coated and EDTA loaded
albumin NPs could be a promising nanoparticle protein engineering therapy to reverse
elastin-specific medial calcification and reduce side effects associated with systemic
EDTA chelation therapy.
3.3 Clinical significance
Cardiovascular diseases (CVD) are the leading cause of death worldwide.
Pathological vascular calcification has been observed in many CVD and is recognized as
a major risk factor for mortality and morbidity in patients with diabetes and chronic
kidney disease. The mechanisms of medial arterial calcification (MAC) are not
understood well and currently there is no available alternative to surgical repair for
reversal of vascular calcification [6, 7]. One possible approach is EDTA chelation
therapy that has been tested in animals and in clinical trials. However, clinical trials did
not prove statistically significant improvement in cardiovascular function and thus such
therapies are not approved by FDA. Moreover, such chelation therapies have shown
57
many side effects such: renal toxicity [18-23] , hypocalcemia [14, 24, 25], and bone loss
[14, 26].
In this research we wanted to shed light on the mechanisms of elastin specific
MAC, specifically cause-and-effect relationship between the elastin-specific MAC and
osteoblast-like differentiation of vascular smooth muscle cells (VSMCs). This research
would pave the way for mechanistic based therapies for vascular calcification.
Secondly, although EDTA chelation therapy has been tried for atherosclerotic
calcification, no research has looked at its effectiveness in reversing elastin-specific
MAC. If successful, such therapies would help millions of patients with end stage renal
disease and diabetes where MAC is prevalent. The literature also suggests that chelation
therapies are not approved by FDA for vascular calcification due to its systemic side
effects. No research is performed so far to see if EDTA chelation can be targeted to
vascular calcification sites by some sort of drug delivery approaches. Our research
presented in this thesis could pave the way to target chelation therapies vascular
calcification sites and eliminate systemic side effects.
58
CHAPTER 4: MECHANISMS OF ELASTIN SPECIFIC MEDIAL ARTERIAL
CALCIFICATION
(This work has been published in
Experimental Cell Research 2014; 323:198-208)
4.1 Introduction
There are two distinctive types of vascular calcification: intimal atherosclerotic
plaque calcification and medial elastin-specific arterial calcification (MAC). Intimal
calcification occurs in the context of atherosclerosis, associated with lipids, macrophages,
and vascular smooth muscle cells; whereas, medial calcification can exist independently
of atherosclerosis and is associated with elastin and vascular smooth muscle cells[3]. In
this study we mainly focused on the mechanisms of MAC. It has been accepted for
decades that the pathology of vascular calcification resembles physiological bone
mineralization in that it shows the presence of bone proteins and osteo-chondrogenic cells
[197, 198]. However, mere presence of osteogenic cells and bone protein expression in
the calcified arterial tissue does not warrant the role of osteogenesis in the initiation of
elastin calcification. The scientific knowledge gap still exists about the cause-and-effect
relationship between the elastin-specific medial calcification and osteoblast-like
differentiation of vascular smooth muscle cells (VSMCs). It is still unclear if there exists
a chronological occurrence between the osteoblast-like differentiation of VSMCs and
passive deposition of hydroxyapatite on elastin, or if both processes occur simultaneously
causing the eventual calcification of arteries.
59
Based on our previous in vivo data [199, 200], we hypothesize that the initial
mineral deposition on elastin precedes the osteoblast-like differentiation of VSMCs,
which is a pathological response to elastin degradation and early arterial calcification. To
test this hypothesis, we exposed rat aortic smooth muscle cells (RASMCs) to calcified
conditions, by culturing them on hydroxyapatite and calcified elastin. We show when
exposed to a calcific environment, healthy RASMCs transform to osteoblast-like cells;
removal of calcific environment restores the native phenotype of SMCs.
4.2 Materials and methods
Cell culture and treatment
Primary rat aortic smooth muscle cells (RASMCs) were isolated from rat aorta
according to published protocol[201]. Passage numbers 5 to 8 were used for all
experiments. Cells were cultured in 60 mm tissue culture petri dish (2×106 cells/well) in
Dulbecco's Modified Eagle Medium (Cellgro-Mediatech, Manassas, VA), containing
10% fetal bovine serum (Cellgro-Mediatech, Manassas, VA), 100 units/ml penicillin and
100 units/ml streptomycin (Cellgro-Mediatech, Manassas, VA) in a humidifier incubator
(Innova® CO-170) at 37 ℃, with 5% CO2. Media was replenished every 3 days.
Hydroxyapatite powder (average size <200 um) was purchased from Aldrich Chemical
Company (Milwaukee, WI). One mg of hydroxyapatite was coated onto 60 mm tissue
culture Petri dish. Here the coating process was achieved by first placing a
hydroxyapatite suspension in sterile phosphate-buffered saline (PBS) on a Petri dish and
then drying it overnight under sterile cell culture hood. For control group, the RASMCs
60
were cultured in a Petri dish without hydroxyapatite coating. To better mimic the
calcified pathological situation, RASMCs were also cultured in a Petri dish with a coating
of calcified porcine aortic elastin fibers (10 mg per well) while a coating with non-
calcified elastin served as a control. The calcified porcine aortic elastin fibers were
prepared in vitro based on a modified protocol[202] and the average size for both the
pure and calcified elastin fiber were less than 200 µm (passed through 200 µm sieve).
Briefly purified elastin was suspended in a calcifying solution (Tris-HCl buffer PH7.4;
KCl 55 mmol/l; KH2PO4 35 mmol/l; CaCl2 35 mmol/l) for 7 days with shaking at 37℃.
Poorly crystalline hydroxyapatite was deposited on elastic fibers. The calcium deposition
was characterized by alizarin red stain and scanning electron microscope (SEM, Hitachi's
SU6600) with energy dispersive X-ray spectrometer (EDX) and quantified by atomic
absorption spectroscopy (Perkin-Elmer Model 3030, Norwalk, CT). Cells were grown on
top of calcified matrix for 1 day and 7 days. To study the RASMCs’ fate after removing
calcified conditions, the cells were first cultured for 7 days on calcified matrix
(specifically both hydroxyapatite and calcified elastin) followed by isolation and
placement on a 60 mm tissue culture Petri dish without calcified matrix for an additional
7 days, or 14 days total as referred to below (n=12 per group total, 3 for RNA isolation, 3
for protein isolation, 3 for cell immunofluorescence and another 3 for staining for
alkaline phosphatase). The experiments were repeated twice.
Gene expression
61
At each time point, cell monolayers were scraped and homogenized (n=3 per
group) using a homogenizer (PowerGen Model 125 Homogenizer, Fisher Scientific,
Atlanta, GA). The total RNA from the cells was isolated using the RNeasy Mini Kit
(Qiagen, MD). The concentration of the extracted RNA was quantified by UV
spectroscopy using Take3 Micro-Volume Plates from BioTek (Winooski, VT). One
microgram of RNA was reverse transcribed to cDNA by High Capacity cDNA Reverse
Transcription Kit (Applied Biosystems, Foster City, CA) using a Mastercycler gradient
(Eppendorf Scientific, Inc., Westbury, NY). The cDNA samples were further amplified
on a Rotor gene 3000 thermal cycler (Corbett Research, Mortlake, NSW, Australia) for
real - time polymerase chain reaction (PCR). The primers sequences for β-2microglobulin
(β2-MG)[200], alpha smooth muscle actin (SMA)[203], myosin heavy chain
(MHC)[204], aggrecan[205], collagen type II alpha 1(Col2a1)[206], alkaline phosphatase
(ALP)[200], Runt-related transcription factor 2 (RUNX-2)[200] and osteocalcin[200] are
listed in Table 4.1. Gene expression in each sample was normalized to the expression of
β2-MG as housekeeping gene and compared with control samples (for the hydroxyapatite
study group, the control was the cells grown on standard culture plates while for the
calcified elastin group, the control was the cells grown on non-calcified elastin coated
culture plates) using the 2-ΔΔC
T method[207] as follows: ΔΔC
T= (CT target gene-CT β-2
MG) study – (CT target gene-CT β-2 MG) control.
62
Table 4.1. PCR primers used in the RT-PCR study.
Name References Forward primer Reverse primer
β2 MG Lee et al[200]. CGTGATCTTTCTGGTGCTTGTC ACGTAGCAGTTGAGGAAGTTGG
SMA Simionescu et al[203] ACTGGGACGACATGGAAAAG CATACATGGCAGGGACATTG
MHC Low et al[204]. AAGCAGCTCAAGAGGCAG AAGGAACAAATGAAGCCTCGTT
Aggrecan Agung et al[205]. TAGAGAAGAAGAGGGGTTAGG AGCAGTAGGAGCCAGGGTTAT
Clo2a1 Zhang et al[206]. TCCTAAGGGTGCCAATGGTGA AGGACCAACTTTGCCTTGAGGAC
OCN Lee et al[200]. TATGGCACCACCGTTTAGGG CTGTGCCGTCCATACTTTCG
ALP Lee et al[200]. TCCCAAAGGCTTCTTCTTGC ATGGCCTCATCCATCTCCAC
RUNX2 Lee et al[200]. CAACCACAGAACCACAAGTGC CACTGACTCGGTTGGTCTCG
Immunofluorescence
The cells were fixed in 4% paraformaldehyde (Affymetrix, Cleveland, OH) for 15
minutes at room temperature, treated with 1% bovine serum albumin (Sigma, St. Louis,
MO)/0.2% Triton X-100 (MP Biomedicals, Solon, OH)/PBS for 1 hour at room
temperature to block non-specific binding. The primary antibodies used include: mouse
monoclonal Anti- SMA at 1:200 dilutions (Sigma, St. Louis, MO), mouse monoclonal
[1C10] to smooth muscle Myosin heavy chain I at 1:200 dilution (Abcam, Cambridge,
MA) and mouse anti-collagen type I at 5 µg/ml (Developmental Studies Hybridoma
Bank, Iowa City, IA). After overnight incubation at 4 °C, cells were stained for 2 hours at
room temperature in the dark with AlexaFlour 594 donkey anti-mouse IgG secondary
antibody (Molecular Probes, Eugene, OR) diluted to 10 µg/ml. All well plates were
mounted in VECTASHIELD HardSet Mounting Medium (VECTOR LABORATORIES,
INC, Burlingame, CA) with DAPI (4', 6-diamidino-2-phenylindole dihydrochloride) blue
fluorescent nuclear stain (Molecular Probes, Eugene, OR) and examined by fluorescence
microscopy.
63
Protein isolation
Cell monolayers were washed once with PBS and isolated in a mammalian
extraction buffer. To prepare the buffer, 1 tablet of protease inhibitor cocktail (Roche
Diagnostics, Indianapolis, IN) was added to 10ml of SoluLyse-M™ Mammalian Protein
Extraction Reagent (Genlantis, San diego, CA). SoluLyse-M™ reagent (500 µl) was
added into the 60 mm tissue culture petri dishes. Cells were incubated for 10 minutes at
25 ℃ with gentle rotation and then homogenized and centrifuged at 14,000 X g for 5
minutes. The supernatant was collected (preserved in -20℃ freezer) and assayed for
different proteins of interest. The total cellular protein was quantified by Pierce® BCA
protein assay kit (Thermo scientific, Rockford, IL).
Western blotting
Ten micrograms of protein from each sample and molecular weight standards
(Precision Plus Protein™ Kaleidoscope Standards, Bio Rad Life Science, Hercules, CA),
were loaded in duplicate on 10% sodium dodecyl sulfate-polyacrylamide gel
electrophoresis gels. After electrophoresis, the proteins were electro-transferred to
Immobilon-P membranes (Millipore Corporation, Bedford, MA). Membranes were
blocked in 2% nonfat dry milk (LabScientific, Inc., New Jersey) for 1 hour at room
temperature and then probed with primary antibody overnight at 4°C. Primary antibodies
used include: mouse monoclonal Anti- SMA at 1:1000 dilution (Sigma, St. Louis, MO),
mouse monoclonal [1C10] to smooth muscle Myosin heavy chain I at 1:1000 dilution
(Abcam, Cambridge, MA) and rabbit monoclonal [EP2978Y] to beta 2 Microglobulin
64
(Abcam, Cambridge, MA). The proteins were detected by enhanced chemiluminescence
according to the manufacturer’s recommendations (Roche, Indianapolis, IN) and
analyzed by densitometry using Image J software. The optical densities of the bands were
reported as relative density units (RDU) comparing to the control groups. Beta 2
Microglobulin antibodies were used as the loading control and the target protein’s band
densities were first normalized by beta 2 Microglobulin.
ALP assay – colorimetric quantification and cell stain
Cell lysates were analyzed for alkaline phosphatase (ALP) using p-nitrophenyl
phosphate (PNPP) as a substrate and diethanolamine buffer. Two PNPP tablets (Thermo
scientific, Rockford, IL) were dissolved in 10 ml diethanolamine substrate buffer (Pierce,
Rockford, IL). PNPP solution (200 µl) and protein samples (40 µl) were added into each
well of the 96-well plate. The plate was incubated at room temperature for 30 minutes or
until sufficient color developed. The reaction was stopped by adding 50 µl of 2N NaOH
to each well. The absorbance was measured at 405 nm. Alkaline phosphatase was
calculated using a p-nitrophenol (MP Biomedicals Inc, Solon, Ohio) standard curve and
was normalized to the total protein content. Additionally, cells in culture were stained to
corroborate the expression of ALP by the cells. Cells were stained with premixed
BCIP/NBT solution (Sigma Aldrich, St. Louis, MO). The premixed BCIP/NBT solution
contains 0.48 mM NBT (nitro blue tetrazolium), 0.56 mM BCIP (5-bromo-4-chloro-3-
indolyl phosphate), 10 mM Tris HCl, 59.3 mM MgCl2, and pH ~9.2. Cells were
65
incubated in the staining solution in the dark for 1 hour at room temperature and then
washed.
Osteocalcin Assay- Enzyme-linked immunosorbent assay (ELISA)
The total cellular protein samples were analyzed for osteocalcin using a Rat
Osteocalcin ELISA Kit (Biomedical Technologies Inc., Stoughton, MA) following the
manufacturer’s instructions. 25 µl of total protein sample, rat osteocalcin serial
standards(1.0, 2.5, 5.0, 10 and 20 ng/ml) and rat serum controls were pipetted into
osteocalcin antibody coated well plate strips followed by 100 µl of osteocalcin
antiserum(second antibody, goat polyclonal) at 37 °C for 2.5 hours. Donkey anti-goat
IgG peroxidase conjugate was used as secondary antibody and 3, 3′, 5, 5′-
Tetramethylbenzidine (TMB) was used as the peroxidase substrate. Levels of osteocalcin
were calculated by rat osteocalcin standard curve and then normalized to total protein
concentration.
Statistical Analysis
Results are expressed as means ± standard error of the mean (SEM). Statistical
analyses of the data were performed using single-factor analysis of variance. Differences
between means were determined using the least significant difference with an α value of
0.05. Asterisks in figures denote statistical significance (P < 0.05) for each group
compared with controls.
66
4.3 Results
Characterization of calcified elastin
Calcified elastin was prepared in vitro and the calcium level in the calcified
elastin fiber was detected as 15 ± 2 µg/mg using atomic absorption spectroscopy. The
calcium deposition was evenly distributed over the porcine elastin fiber as seen by
alizarin red stain, which stains calcium red while no staining was seen in the control pure
elastin (Figure 4.1A). The morphology of calcified elastin, as studied by scanning
electron microscopy, showed globular calcific deposits. These were confirmed as calcium
phosphates by Energy-dispersive X-ray spectroscopy (Figure 4.1B and 4.1C).
67
Figure 4.1. Characterization for calcified elastin. A: Alizarin red staining for pure elastin
(PE, left) and calcified elastin (CE, right). Calcium was stained red. Scale bar: 50µm. B:
Scanning electron microscope (SEM) image for pure elastin (PE, left) and calcified
elastin (CE, right). C: Energy-dispersive X-ray spectroscopy (EDX) pseudo colored
image for Ca and P element distribution (Ca purple and P red). Mineral deposition is
labeled with red arrows.
68
RASMCs lose smooth muscle lineage markers under calcified conditions
We analyzed gene and protein level expression of two typical smooth muscle
lineage markers: alpha smooth muscle actin (SMA)[208] and myosin heavy chain
(MHC)[209] in two different simulated calcified conditions: (1) pure hydroxyapatite; (2)
calcified elastin. These markers were studied at two time points (day 1 and day 7) to see
the changes compared to the control groups. Cellular localization based on
immunofluorescence stain of SMA showed that both hydroxyapatite and calcified elastin
groups had similar SMA expression at day 1 as controls; however, at day 7 they exhibited
very low expression of SMA protein (Figure 4.2A). Similarly, immunofluorescence stain
for MHC also showed little change at day 1 but a significant decrease was observed at
day 7 (Figure 4.2B).
69
70
Figure 4.2. Expression of SMA and MHC in RASMCs cultured on hydroxyapatite and
calcified elastin at day 1 and day 7. A and B: Immunofluorescence stains of SMA and
MHC respectively (red fluorescence). Nuclei were stained blue by DAPI. Scale bar:
100µm. Abbreviations: HA-hydroxyapatite; PE: pure elastin; CE: calcified elastin. D1:
day 1; D7: day 7. C and D: SMA and MHC gene expression respectively as measured by
RT-PCR. E: protein expression measured by western blot followed by densitometry as
relative density units (RDU) and expressed as relative percentage ratio comparing to
control groups (For HA treatment group the control was normal media while for CE
treatment group the control was PE). The band density was first normalized by loading
control protein- β2 MG. Results are presented as mean ± SEM (* p<0.05).
Furthermore, both hydroxyapatite and calcified elastin treated groups showed
decrease in the gene expression (quantified by RT-PCR) and protein expression (detected
by western blot) of SMA and MHC at day 7. Compared to respective control groups,
SMA gene expression decreased by 48 ± 18% in hydroxyapatite groups and 53 ± 5% in
calcified elastin groups (Figure 4.2C). Similarly, MHC gene expression decreased by 64
± 19% in hydroxyapatite groups and 60 ± 13% in calcified elastin groups (Figure 4.2D).
Western blotting results confirmed the down-regulation of translation of both SMC
markers. Compared to respective control groups, the SMA protein expression decreased
by 56 ± 2 % in hydroxyapatite groups and 48 ± 2% in calcified elastin groups (Figure
4.2E). The MHC protein expression decreased by 52 ± 6% in hydroxyapatite groups and
53 ± 2% in calcified elastin groups (Figure 4.2E).
RASMCs develop an osteogenic/chondrogenic phenotype under calcified conditions
We then analyzed expression of three typical osteogenic markers: Runt-related
transcription factor 2 (RUNX2) [210, 211], Alkaline phosphatase (ALP) and osteocalcin
(OCN)[208, 209, 212, 213] and two typical chondrogenic markers: aggrecan and
71
collagen type II alpha 1(Col2a1) to see whether RASMCs develop an
osteogenic/chondrogenic phenotype with the stimuli of hydroxyapatite and calcified
elastin. At day 1, we found significant upregulation of RUNX2 gene under mineralized
conditions, which is the earliest transcription factor involved in osteogenesis. No other
osteogenic markers were changed at day 1 as compared to controls (Figure 4.3A).
Compared to respective control groups, RUNX2 gene expression increased by 87 ± 43%
in hydroxyapatite groups and 116 ± 19% calcified elastin groups at day 7. Similarly, at
day 7, ALP gene expression increased by 41 ± 20% in hydroxyapatite groups and 188 ±
21% in calcified elastin groups while OCN gene expression increased by 111 ± 30% in
hydroxyapatite groups and 54 ± 21% in calcified elastin groups (Figure 4.3A).
72
73
Figure 4.3. Expression of osteogenic/chondrogenic markers in RASMCs cultured on
hydroxyapatite and calcified elastin elastin at day 1 and day 7. A: gene expression of
RUNX2, ALP and OCN. B: Histochemical staining of ALP activity in cells in four
groups (C-control, HA-hydroxyapatite, PE-pure elastin, CE-calcified elastin). Scale bar:
50µm. C: ALP protein quantification. D: OCN protein quantification. OCN was
determined by ELISA assay and expressed as ng osteocalcin /mg protein. The relative
protein expression for both ALP and OCN has been calculated compared to respective
control groups. E: Gene expression of chondrogenic markers – aggrecan. F: Gene
expression of chondrogenic markers – Col2a1. G: Immunofluorescence stains for
collagen type I (red fluorescence). Nuclei were stained blue by DAPI. Scale bar: 100µm.
Results are presented as mean ± SEM (* p<0.05).
Histochemical staining for ALP revealed intense purple coloration in both
hydroxyapatite and calcified elastin groups indicating greater ALP activity compared to
control groups (Figure 4.3B). Additionally, quantification of cellular ALP activity
showed an increase by 207 ± 35 % in hydroxyapatite groups and 72 ± 9 % in calcified
elastin groups at day 7 (Figure 4.3C). Osteocalcin protein expression increased by 97 ±
13 % in hydroxyapatite groups and 23 ± 12 % in calcified elastin groups respectively at
day 7 (Figure 4.3D). The ALP and OCN protein expression in calcified elastin groups
was much less elevated might because of relative lower concentration of hydroxyapatite
in elastin group, specifically one mg of of HA in hydroxyapatite versus only ~150 µg in
elastin group (10 mg of calcified elastin with mineral deposition of 15 ± 2 µg Ca /mg
tissue) (Figure 4.3C, 4.3D). It is also possible that HA crystal structure in two groups is
different and that can cause variation in relative expression.
For the chondrogenic markers, at day 7, compared to respective control groups,
Aggrecan gene expression increased by 125 ± 76% in hydroxyapatite groups and 179 ±
84% in calcified elastin groups (Figure 4.3E); Col2a1 gene expression increased by 613
74
± 108% in hydroxyapatite groups and 370 ± 141% in calcified elastin groups (Figure
4.3F).
RASMCs show up-regulation of Collagen Type I under calcified conditions
Immunofluorescent detection of collagen type I showed an intense signal both for
hydroxyapatite and calcified elastin treated group at day 7 (Figure 4.3 G). The increase
of collagen type I expression under calcified conditions, indicated more synthetic
phenotype of RASMCs under mineralized conditions.
RASMCs restore their original phenotype after removal of calcified matrix
In an independent set of experiments, RASMCs were cultured on calcified matrix
for 7 days and then were cultured for another 7 days without the calcified matrix to study
cellular behavior after removing calcified matrix. After 14 days (7 days post reversal)
both hydroxyapatite and calcified elastin treated group showed dramatic restoration of
VSMCs markers (comparable to control groups: for the hydroxyapatite study group, the
control was the cells grown on standard culture plates while for the calcified elastin
group; the control was the cells grown on non-calcified elastin coated culture plates at
day 14) as detected by immunofluorescence (Figure 4.4A, 4.4B) and RT-PCR and
western blotting (Figure 4.4C, 4.4D). All the earlier mentioned osteogenic/chondrogenic
markers including RUNX2, ALP, OCN, aggrecan and col2a1 decreased gene expression
at day 14 and restored close to normal level (Figure 4.5A, 4.5B). The protein expression
of ALP and OCN also decreased comparing to day 7 although still remained elevated
75
comparing to the normal control levels (Figure 4.5C). Histochemical staining for ALP
restored to normal level comparing to the controls (Figure 4.5D). Collagen type 1
expression also restored close to normal level (Figure 4.5E). These results indicate that
the phenotypic transition from smooth muscle cells to osteoblast-like cells is reversible
with reversal of calcification.
76
Figure 4.4. Expression of SMA and MHC in RASMCs after removal of calcified matrix.
Cells were cultured on calcified matrix for 7 days, then removed and cultured in normal
cell culture plate for additional 7 days (total 14 days of culture) A: Immunofluorescence
stains of SMA (red fluorescence). B: Immunofluorescence stains of MHC (red
fluorescence). Nuclei were stained blue by DAPI. Scale bar: 100µm. Abbreviations: C-
control, HA-hydroxyapatite; PE: pure elastin; CE: calcified elastin. D14: day 14. C:
SMA and MHC gene expression measured by RT-PCR. D: protein expression measured
by western blot followed by densitometry as relative density units (RDU) and expressed
as relative percentage ratio comparing to control groups (For HA treatment group the
control was normal media while for CE treatment group the control was PE). The band
density was first normalized by loading control protein- β2 MG. Results are presented as
mean ± SEM (* p<0.05).
77
Figure 4.5. Expression of osteogenic/chondrogenic markers in RASMCs after removal of
calcified matrix. Cells were cultured on calcified matrix for 7 days, then removed and
cultured in normal cell culture plate for additional 7 days (total 14 days of culture) A:
gene expression of RUNX2, ALP and OCN. B: gene expression of aggrecan and Col2a1.
C: protein quantification of ALP and OCN. D: Histochemical staining of ALP activity in
cells at in four groups(C, HA, PE, CE). Original magnification, 400X. Scale bar: 50µm.
E: Immunofluorescence stains for collagen type I (red fluorescence). Nuclei were stained
blue by DAPI. Scale bar: 100µm. Results are presented as mean ± SEM (* p<0.05).
4.4 Discussion
Our data shows that, in response to the calcified matrix, for both hydroxyapatite
crystals and calcified aortic porcine elastin, RASMCs lose their smooth muscle lineage
markers, specifically alpha smooth muscle actin (SMA) and myosin heavy chain (MHC).
In addition, RASMCs undergo chondroblast/osteoblast-like differentiation confirmed by
78
an increase in expression of typical bone-markers such as Runt-related transcription
factor 2 (RUNX2), alkaline phosphatase (ALP), osteocalcin (OCN), aggrecan, and
collagen type II alpha 1(Col2a1). RASMCs also turn synthetic as indicated by increased
expression of collagen type I. Interestingly, this phenotypic transition was reversible and
RASMCs restored their original linage upon reversal of calcification.
Putative relationship between osteoblast-like transformation of VSMCs and
vascular calcification is still under debate and the cause-and-effect relationship between
these two processes is unclear. It has been reported that the vascular calcification process
can be caused by osteoblast-like differentiation of VSMCs[214]. Chronic kidney disease
(CKD) related vascular calcification has often been associated with increase serum Ca
and P levels[71]. Elevated phosphate conditions could cause osteogenic/chondrogenic
differentiation of VSMC [208, 215]. In rat models of renal failure, animals with severe
calcification showed the presence of chondrocyte-like cells. Mature cartilage tissue and
major chondrogenic factors were found in the calcified vessels[216]. Osteoblast-like
differentiation of VSMCs was also reported in the aortas of transgenic mice, ubiquitously
expressing Msx2 (encodes an osteoblast-specific transcription factor), that were fed with
a high-fat diet. High-fat diets led to vascular calcification in these transgenic mice but not
in their non-transgenic littermates[217]. In type-2 diabetes related medial calcification,
BMP-2/Mxs2/Wnt signaling has been established[218]. Studies in patients with type 2
diabetes showed that medial calcification is a cell-mediated process characterized by a
phenotypic change of VSMCs to osteoblast-like cells[219]. Based on these studies, it is
79
thought that chondrogenic/osteogenic transformation of VSMCs is the earliest step in
vascular calcification.
Alternatively, there are many studies support that medial elastin-specific
calcification can occur due to degraded elastin without osteoblastic differentiation of
VSMCs. In early 1970s, Urry has shown that elastin has a specific calcium binding site
serving as the neutral nucleation site for calcium [220]. We previously showed that pure
aortic elastin when implanted subdermally in rats undergoes calcification with bone-
protein expression occurring only in the later stages of mineral propagation[200]. In
circulatory rat model, we confirmed that matrix metalloproteinases (MMPs) mediated
degradation of elastin, leads to elastic-lamina calcification in absence of cell-associated
calcification [199]. Price et al. have shown that in the presence of serum factors, arterial
elastin calcifies in vitro in absence of cells[221]. Furthermore, VSMCs have shown
osteoblast-like behavior in vitro when exposed to elastin peptides along with TGF-beta,
therefore suggesting a causative role of elastin degradation in VSMCs mediated
calcification [212]. Recently Murshed et al found in a MGP-deficient (Mgp−/−) mice
model, chondro/osteogenic markers are not up-regulated in the arteries prior to the
initiation of calcification[222]. One recent study found that calcium phosphate deposition
was a passive phenomenon and it was responsible for the osteogenic changes for the
VSMCs[223]. All these studies indicate that initial vascular calcification may be formed
without osteoblastic differentiation of VSMCs.
80
Our study was designed to investigate the effect of calcified matrix on RASMCs’
phenotypic change. We hypothesize that the initial mineral deposition on elastin precedes
the osteoblast-like differentiation which is a pathological response to elastin degradation
and early arterial calcification. Our results showed that RASMCs lose their smooth
muscle lineage markers like SMA and MHC (Figure 4.2) and undergo
chondrogenic/osteogenic transformation (Figure 4.3) under calcified conditions. It is
unclear as to how calcified matrix triggers this response in RASMCs and further study is
needed to test this. Calcium and phosphorus levels in the media were similar in controls
and calcified matrix groups (data not shown), thus osteoblast-like transformation seen on
our studies was not due to higher amounts of free ions as shown by others[71, 208, 215].
We speculate that RASMCs synthesize small quantities of bone proteins (they come from
same mesenchymal origin of osteoblasts). These proteins in healthy state do not
accumulate in the vessel media; however, calcified elastin matrix can bind to these
synthesized proteins[224, 225] and increase local concentration causing RASMCs to turn
to osteoblast-like cells. Interestingly, our work, for the first time shows that upon removal
of calcified conditions, cells have the ability to revert back to SMC-like cell behavior.
When calcified matrix was removed from culture conditions, SMA and MHC expression
increased to normal levels, whereas osteogenic/chondrogenic markers decreased to
normal levels (Figure 4.4, Figure 4.5). This is important as we can then envision
demineralizing strategies to remove mineral from arteries and bring homeostasis to the
arterial structures.
81
To summarize, there are possibilities of two distinctly different, yet
interconnected mechanisms to demonstrate the cause-and-effect relationship between
chondro/osteoblast-like differentiation of VSMCs and medial elastin-specific
calcification as shown in Figure 4.6. Model A: chondro/osteoblast-like differentiation of
VSMCs precedes medial elastin-specific calcification. Many factors could induce
VSMCs into osteoblast-like cells, such as elevated level of phosphate, lipids,
inflammatory cytokines and others[226]. Those differentiated osteoblast-like VSMCs
synthesize bone proteins such as osteocalcin, alkaline phosphatase to initiate mineral
deposition. This may be true in patients with chronic kidney disease and type-2 diabetes
where increase incidences of vascular medial calcification has been found[71, 219].
Model B: Medial elastin-specific calcification precedes chondro/osteogenic
differentiation of VSMCs. In ageing patients or in patients with diseases like aortic
aneurysm and arteriosclerosis, increased matrix metalloproteiases activity can lead to
accelerated elastic fiber degradation. This degradation would expose calcium binding
sites in elastin and allow initial mineral deposition[220]. This early mineral deposits may
anchor calcium binding proteins such as osteocalcin. This local increase in bone proteins
may lead to transformation of SMCs to osteoblast-like cells. It is also possible that these
two processes occur simultaneously and add mutually. Our current data mostly supported
Model B, that is, the first calcium deposition on elastin appear prior to the osteoblast-like
differentiation of RASMCs. Interestingly based on our data of reversal of osteogenic
markers, we hypothesize that demineralization of calcified arteries will return
homeostasis in arteries. In fact, recently we have shown that local delivery of chelating
82
agent such as ethylene diamine tetraacetic acid (EDTA) led to regression of arterial
calcification in rats[227].
Figure 4.6. Model of putative links between medial elastin-specific calcification and
chondro/osteoblast-like differentiation of VSMCs in the artery. A: chondro/osteoblast-
like differentiation of VSMCs precedes medial elastin-specific calcification. Elevated
levels of phosphate, lipids, inflammatory cytokines and many other factors could induce
chondro/osteoblast-like differentiation of VSMCs. B: Medial elastin-specific calcification
precedes chondro/osteoblast-like differentiation of VSMCs. The elastin degradation
happens due to inflammatory conditions and matrix metalloproteinases. This in turn
exposes calcium binding sites on elastin causing first calcific deposits. This early
calcification leads to osteoblast-like differentiation in VSMCs that can further augment
calcification process.
Limitations of Current Study
There are some limitations to our studies. First, we used reagent grade synthetic
hydroxyapatite to mimic the ectopic deposition of mineral in vascular calcification, which
might not be ideal to represent the real pathologic condition of vascular calcification,
which shows poorly crystalline hydroxyapatite crystals and other calcium phosphate
minerals. We also used porcine aortic elastin that was allowed to calcify in vitro. It
83
indeed showed poorly crystalline hydroxyapatite deposits along the elastin fibers. Finally,
we did the studies only for two time points: day 1, and day 7. It is still unknown if longer
exposure of RASMCs to calcified conditions would prevent reversal to normal
phenotype. More physiologic or animal studies are needed to further test the hypothesis
that medial elastin-specific calcification occurs first followed by cellular changes to
osteoblast like cells to augment mineral deposits.
4.5 Conclusion
In conclusion, our results demonstrate that hydroxyapatite and calcified elastin
induce chondrogenic and osteoblast-like differentiation of rat aortic smooth muscle cells,
and these studies support that elastin degradation and calcification may occur prior to
osteoblast-like transformation of VSMCs.
84
Supplemental Figures
Figure 4.7. Experimental design.
85
Figure 4.8. Graphical Abstract. At Day 0 rat aortic smooth muscle cells (RASMCs) were
seeded on petri dishes which have different substrate: two control groups, one was
normal media without substrate for hydroxyapatite (HA) study group, and another one
was pure elastin (PE) substrate for calcified elastin (CE). By Day 7 we found RASMCS
seeded on calcified matrix (Both HA and CE groups) had osteoblastic differentiation; at
Day 7 upon removal of calcified matrix, which was done by trypsinizing RASMCs first
and then re-seeding RASMCs on new petri dishes without any substrate but only normal
media, we found that differentiated RASMCs restored original phenotype by day 14.
86
CHAPTER 5: EFFICACY OF CHELATING AGENTS TO REVERSE ELASTIN
SPECIFIC MEDIAL ARTERIAL CALCIFICATION
(This work has been published in
Calcified Tissue International 93, no. 5 (2013): 426-435.)
5.1 Introduction
Pathological calcification is defined as ectopic deposition of poorly crystalline
hydroxyapatite in soft tissues as observed in blood vessels and cardiac valves [228], The
two areas of calcification seen in arterial tissues include intimal calcification, detected in
atherosclerotic plaque present in the intima, and medial artery calcification of elastic
layers (MAC), detected in patients with diabetes, renal failure, and old age [6]; which is
independent of atherosclerosis. Medial calcification, termed as Monckeberg’s sclerosis,
mostly occurs along the elastic fibers of the media. Its presence correlates well with risk
of cardiovascular events and leg amputation in diabetic patients [229]. Currently no
clinical therapy is available to prevent or reverse this type of vascular calcification. Some
possible targets to block and regress calcification include local and circulating inhibitors
of calcification as well as factors that may ameliorate vascular smooth muscle cell
apoptosis [6]. Many of these approaches were focused on atherosclerotic calcification.
Almost no research has targeted reversing of elastin specific medial calcification[6].
Chelation therapy most often involves the injection of disodium ethylene diamine
tetraacetic acid (EDTA), a chemical that binds, or chelate ionic calcium, trace elements
and other divalent cations [141]. Chelation therapy has been touted as an effective
87
treatment to reverse vascular calcification; however, it has been controversial with
opposing views [8-10]. At present no systemic scientific studies prove that it could
reverse cardiovascular calcification [9]. The Trial to Assess Chelation Therapy (TACT)
funded by the National Center for Complementary and Alternative Medicine began in
2003 to determine the safety and effectiveness of EDTA chelation therapy in individuals
with coronary artery disease has been finished by 2013. First published results showed
that intravenous chelation regimen with EDTA reduced the risk of adverse cardiovascular
outcomes but data was not sufficiently convincing to support the routine use of chelation
therapy for treatment of patients who have had an myocardial infarction [230].
Unfortunately, the efficacy of various chelating agents in reversing elastin specific
calcification from the peripheral vascular tissue is not studied very well either in vitro or
in animal experiments. Here we tested the hypothesis that common chelating agents, such
as disodium ethylene diamine tetraacetic acid (EDTA), diethylene triamine pentaacetic
acid (DTPA) and sodium thiosulfate (STS) can remove calcium from hydroxyapatite
(HA) and calcified tissues without damaging the tissue architecture.
5.2 Materials and methods
Chemicals
Hydroxyapatite, disodium ethylene diamine tetraacetic acid (EDTA), diethylene
triamine pentaacetic acid (DTPA) and sodium thiosulfate (STS), dichloromethane, were
all reagent grades and were purchased from Sigma-Aldrich Chemicals (St. Louis, MO).
Polyvinyl alcohol or PVA (Molecular Weight, M.W. = 15kDa) was purchased from MP
88
Biomedicals Inc. (Solon, OH). Poly (L-lactic-co-glycolic acid) or PLGA
(lactide:glycolide = 50:50, M.W.= 60~80kDa) was a gift from Ortec, Inc. (Piedmont,
SC). Stock solutions of EDTA, DTPA and STS with concentration of 1, 5, 10 mg/mL
were prepared and stored at room temperature. Five mg/mL EDTA had pH of 4.8 while
5 mg/mL DTPA in 0.1 M NaOH had a pH of 12.2.
Tissues Preparation
In order to study chelation effect on elastin specific calcification, we wanted to
avoid effect of cells and other extracellular matrix components. Thus, we obtained pure
aortic elastin from porcine aorta with standard methods of purification[231]. We used
porcine aorta because of easy access and large quantities of elastin could be obtained.
Elastin homology is maintained in all species. In previous study, we showed that when
pure aortic elastin is implanted subcutaneously in rats, it undergoes calcification[200].
Thus, this calcified elastin could be used to study demineralization of elastin specific
calcification by chelating agents.
Calcified porcine aortic elastin (20 days explanted sample, 160~180 µg Ca/mg
tissue) was prepared by subdermal implantation of pure porcine aortic elastin in rats as
described previously [200]. Briefly, in juvenile male Sprague-Dawley rats (21 days old,
35 to 40 g; Harlan, Indianapolis, IN) a small incision was made on the back, and two
subdermal pouches were formed by blunt dissection. Each rat received two 30- to 40-mg
purified elastin implants (one per pouch), which were rehydrated in sterile saline 1 to 2
hours before implantation. The rats were sacrificed by CO2 asphyxiation after 20 days
89
implantation and the implants were retrieved and stored at -80°C. Calcified human aorta
(100~300 µg Ca/mg tissue) was from cadavers (age 49-75, both male and female with
moderate or severe atherosclerosis) received from Greenville Hospital System
(Greenville, SC) following standard dissection technique. All samples were from the
abdominal aorta, just below the renal arteries.
Demineralization of Hydroxyapatite
To study optimal concentration chelating agents for best chelating efficacy, three
serial concentrations (1, 5 and 10 mg/ml) of chelating agents (STS, EDTA and DTPA)
were prepared. 10 mg of hydroxyapatite (HA) each was soaked in 1 ml chelating
solutions while the control was soaked in distilled and deionized water (DD water). For
the kinetic study of demineralization, Five mg of hydroxyapatite powder was suspended
in 30 mL solution of chelating agents (STS, EDTA, DTPA respectively, 5 mg/mL, n=3),
while the control group included DD water. At frequent intervals (2, 4, 6, 8, 24 hours), 1
mL of supernatant was withdrawn for Ca assay. Calcium content was measured by
atomic absorption spectroscopy (Perkin-Elmer Model 3030, Norwalk, CT) as described
previously [232]. Briefly, each sample (15–40 mg) was hydrolyzed in 1 ml of 6 N HCl in
a test tube at 70°C overnight and then the solution was completely evaporated at 70°C
with a continuous flow of nitrogen in the tube. The residue in the test tube was dissolved
in 1 ml of 0.01 N HCl. The hydrolyzed sample were diluted and analyzed by atomic
absorption spectroscopy with calcium standards.
Demineralization of Calcified Tissues
90
Calcified porcine aortic elastin and separately calcified human aorta (10 mg each)
were treated with 30 mL chelating solutions (5 mg/mL of STS, EDTA, and DTPA, n=3).
The control group was treated with DD water both for calcified porcine aortic elastin and
calcified human aorta. At certain intervals (2, 4, 6, 8, 24 hours for porcine elastin and 8,
12, 24, 36, 48 hours for human aorta), 1 mL of solution was withdrawn for calcium assay.
Calcium content was measured by atomic absorption spectroscopy (Perkin-Elmer Model
3030, Norwalk, CT).
Alizarin Red Stain for Calcium
Calcified elastin samples were treated with chelating agents as described
previously and were then embedded in paraffin blocks, sectioned, and stained for
qualitative analysis of calcium with Dahl’s alizarin red stain. Since the calcified porcine
aortic elastin sample had more even distribution of calcification, we did the chelation
treatment to the bulk calcified elastin first and then made sections and stained the calcium
by Dahl’s alizarin red stain. For human aorta sample, since the distribution of
calcification was non uniform, we first sectioned samples and located calcification site
and then did the chelation treatment as described. Calcified human aorta were fixed in
10% neutral buffered formalin at room temperature for 24 h, processed with an automatic
tissue processor (Tissue TEK VIP, Miles Inc., Mishawaka, IN) and 6 µm paraffin
sections (n=12 sections per sample) were soaked in chelating solutions (5 mg/mL of STS,
EDTA, and DTPA, n=3) respectively for 4 hours. The control group was treated with DD
water (n=3). And then the slides were stained for 3 minutes at room temperature with 1%
91
Alizarin red solution, and rinsed with distilled water. Sections were counterstained with
1% light green solution for 10 seconds and rinsed with distilled water and mounted.
Preparation of EDTA-loaded PLGA nanoparticles
EDTA-loaded poly(lactic-co-glycolic acid) (PLGA) nanoparticles were prepared
by double emulsion method [233]. PLGA (200 mg) was dissolved in 2 mL
dichloromethane. EDTA (100 mg) was dissolved in 1 mL deionized water. For the
control group, no EDTA was used. Water-in-oil (W1/O) emulsion was prepared with an
Omni Ruptor 4000 ultrasonic homogenizer by 20 watts for 5 minutes. This prepared
primary emulsion was subsequently added to 10 mL of 1 % (w/v) PVA solution and the
second emulsion was prepared with homogenizer (20 watts, 5 minutes) to obtain water-
in-oil-in-water (W1/O/W2) emulsion. The nanoparticles were isolated by solvent
evaporation with stirring overnight at room temperature. After threes wash of deionized
water, the nanoparticles were lyophilized and stored at 4 ℃.
Measurement of loading efficiency and release profile of EDTA in PLGA
nanoparticles
5 mg EDTA-loaded poly (lactic-co-glycolic acid) (PLGA) nanoparticles were
dissolved in 1 mL of dichloromethane and 5 mL distilled water was added and solutions
were vortexed for 30 minutes. After centrifugation at 13,000 rpm for 5 minutes the
supernatant were collected and the concentration of EDTA was spectrophotometrically
measured at 257 nm [234]. The loading efficiency is calculated by equation: EDTA
92
loading efficiency = The amout of EDTA in nanoparticles/weight of nanoparticle *100%.
Five (5) mg EDTA-loaded PLGA nanoparticles were enclosed in dialysis units (Slide-A-
Lyzer® MINI Dialysis Units. Thermo Scientific, Rockford, IL) and incubated in 30 ml
PBS at 37 ℃ with mild agitation. At determined time intervals 1 ml sample was
withdrawn for quantification of EDTA release.
Local EDTA treatment in CaCl2 injury model of vascular calcification
Calcium chloride (CaCl2) injury model was used to create local arterial
calcification (abdominal aortic region) in rats [235]. 10 male Sprague-Dawley (SD) rats
(5-6 weeks old) were placed under general anesthesia (2% to 3% isoflurane), and the
infrarenal abdominal aorta was exposed and treated periadventitially with 0.20 mol/L
CaCl2 by placing CaCl2-soaked sterile cotton gauze on the aorta for 15 minutes. The area
was flushed with warm saline and wound site was closed with sutures. Animals were
allowed to recover and placed on normal diet. One week after first surgery, the abdominal
aorta was re-exposed in order to provide a treatment directly to the aorta. EDTA loaded
poly (lactic-co-glycolic acid) (PLGA) nanoparticle pellet (30 mg, with 5% EDTA
loading, n=5), and pure PLGA particle pellet (No EDTA entrapped, n=5) were placed
periadventitially. The rats were allowed to recover. After 1 week, rats were euthanized
and tissues (aorta) and blood were harvested and frozen in liquid nitrogen for plasma
calcium and phosphorus quantification. Calcium and Phosphorus level were measured by
atomic absorption spectroscopy as described previously [232].
Statistical Analysis
93
Results are expressed as means ± SEM (standard error of the mean). Statistical
analyses of the data were performed using single-factor analysis of variance. Differences
between means were determined using the least significant difference with an α value of
0.05. Asterisks in Figures denote statistical significance (P < 0.05).
5.3 Results
Chelation of calcium from hydroxyapatite (HA)
Three series of concentration (1, 5, 10 mg/ml) of chelating agent solutions (STS,
EDTA and DTPA) were prepared in order to optimize the concentration needed for
efficient demineralization. HA powders (10 mg in each group) were suspended with
aqueous chelating agent solutions and the percentage HA solubilization was calculated
(Figure 5.1A). EDTA & DTPA were stronger chelating agent than STS, and could
remove more calcium from HA (Figure 5.1A). The chelating capacity was dependent on
concentrations of chelating agents with 10 mg/mL showing highest activity. 1 mg STS or
EDTA or DTPA chelate 1.3 mg HA, that is, 1 mole of STS, EDTA, DTPA chelate 0.41,
0.88, 1.02 mole of HA respectively.
94
Figure 5.1. Demineralization of Hydroxyapatite. A: Effect of concentration of chelating
agents on dissolving calcium from hydroxyapatite powder. B: Kinetics of
demineralization of hydroxyapatite. All data are presented as means ±SEM, n=3 per
group.
95
The concentration of 5 mg/mL of chelating agents were used for further studies
[236]. The kinetics of demineralization of hydroxyapatite is shown in Figure 5.1B. Most
of the chelation and removal of calcium occurred in first 2 hours and continued slowly up
to 24 hours for EDTA and DTPA. The chelating ability was: EDTA>DTPA>STS. Since
EDTA and DTPA solution as prepared had pH 4.8 and pH 12.2 respectively, we
examined the effect of pH on the demineralization of HA. HA was suspended in pH
buffers (pH 4.8 buffer: 59.0 mL 0.2M Sodium acetate and 41.0 mL 0.2M acetic acid; pH
12.2 buffer: 50 mL 0.2 M KCl and 20.4mL 0.2 M NaOH ). Calcium was not released
from HA in the pH range of 4.8 to 12.2 thus suggesting pH did not play a role in calcium
chelation. We also neutralized pH to 7.4 for all chelating solutions and still found similar
results of chelation (data not shown).
Chelation of calcium from calcified elastin
Calcified aortic elastin (3~5 mg, implanted subdermally in rats to calcify and then
isolated) were immersed in 1 mL solution of STS, EDTA, and DTPA with concentrations
of 5 and 1 mg/mL for 24 hours under vigorous shaking while the control group was
immersed in DD water (n=3 each group). Remnant calcium levels in the treated elastin
fiber were measured by atomic absorption spectroscopy. All chelating agents (STS,
EDTA and DTPA) could remove calcium from the calcified porcine elastin, with the
chelating ability sequence: EDTA ≥DTPA>STS (Figure 5.2A). This is consistent to the
previous HA results. For the EDTA treatment we calculated the percentage of calcium
loss by using the equation: the percentage of calcium loss = (the total calcium in calcified
96
elastin - the remnant calcium in calcified elastin)/ the total calcium in calcified
elastin*100. Treatment with 1 mg/mL chelating agent for EDTA resulted in about 53 %
removal of calcium (Figure 5.2A), while higher EDTA concentration (5 mg/mL) was
effective in removing 75% of calcium (Figure 5.2A). Such increase in calcium
dissolution was not found in DTPA and STS groups after increasing chelating agent
concentrations (Figure 5.2A).
The kinetics of demineralization of calcified elastin for chelating agents with the
concentration of 5 mg/mL is shown in Figure 5.2B (n=3 in each group). Both EDTA and
DTPA were effective in removal of calcium from calcified porcine elastin while STS was
not effective, which corroborated with the result of hydroxyapatite. However; kinetics of
calcium removal from calcified elastin was much slower than HA. Longer incubation
times lead to continuous removal of calcium so that within 24 hours EDTA could remove
almost all calcium from calcified elastin (Figure 5.2B). Dahl’s alizarin red stain at 24
hours of treatment further confirmed that EDTA treatment could remove all calcium
while DTPA was partially successful and STS treatment was ineffective (Figure 5.2C).
97
Figure 5.2. Demineralization of calcified elastin. A: Optimal concentration of chelating
agents needed to remove Ca from calcified elastin. B: Kinetics of demineralization of
calcified porcine elastin. All data are presented as means ±SEM, n=3 per group. c: Dahl’s
alizarin red stain for porcine elastin after chelation treatments. Alizarin red stains calcium
red. Only EDTA treatment removed calcium from calcified elastin.
98
Chelation of calcium from calcified human aorta
The kinetics of extraction of calcium from calcified human aorta after treating
with chelating agents for 48 hours, showed that EDTA and DTPA were most effective in
removing calcium while STS was not effectively similar to what was observed in HA and
elastin studies presented above (Figure 5.3A). The kinetics of calcium dissolution was
slower probably due to denser nature of aortic tissue. To study tissue architecture after
chelation, 6 µm sections of human aorta were treated with chelating solutions for 4 hours.
Dahl’s alizarin red stain (Figure 5.3B) for the human aorta sections showed that EDTA
and DTPA removed the calcium while STS treatment was not effective. The tissue
sections maintained their typical arterial integral structure. Chelation treatment did not
cause delamination or removal of certain parts of artery for all chelating agents treated
group (STS, EDTA, and DTPA) comparing to the control group.
99
Figure 5.3. Demineralization of calcified human aorta. A:Kinetics of demineralizaion of
calcified human aorta. All data are presented as means ±SEM, n=3 per group. B: Dahl’s
alizarin red stain for human aorta sections after treatment with chelating agents showing
efficacy of EDTA and DTPA in removal of calcium.
100
Reversal of arterial calcification in vivo by EDTA
As EDTA was found to be most successful in removing calcium in vitro, we
tested its efficacy in removing calcium from calcified aorta in vivo. We prepared PLGA
nanoparticles loaded with EDTA so that prolonged (24 hour) controlled release of EDTA
could be achieved when the nanoparticles are placed close to the calcified aorta. Our in
vitro release profile showed that EDTA could be released from PLGA nanoparticles
within 3 days (Figure 5.4). Next, we tested if local delivery of EDTA could remove
calcium from calcified rat aorta in vivo. We have shown previously that when abdominal
aorta of rats were exposed to chemical injury with calcium chloride, it lead to elastin
specific medial arterial calcification with time [199]. We used 7 day time point after
injury for EDTA therapy as substantial calcification is seen in this model at that time
[15]. After 7 days, EDTA loaded PLGA nanoparticle pellets (30 mg with 5% EDTA
loading, thus dosage was 0.01 g EDTA/kg) were placed on the aorta. We observed that
the PLGA particles were spontaneously absorbed onto the wet abdominal aorta. Seven
days after initial EDTA treatment rats were sacrificed to test if local EDTA therapy
would reverse elastin calcification. In vivo studies were continued for 7 days to make sure
all of the EDTA could be released and available to remove calcium. Both calcium and
phosphorous level were significantly lower in the EDTA treated group as compared the
control group with blank nanoparticles (Figure 5.5A). Histology analysis also showed
that the aortic calcification was greatly reversed in the EDTA treated group (Figure
5.5B). The calcium and phosphorus level of the blood plasma in both groups were also
quantified and there was no statistical significant difference between the EDTA treated
101
group and pure PLGA control group (Figure 5.5C). Clearly suggesting that local delivery
of EDTA did not change serum calcium levels, which is often the case with systemic
delivery.
Figure 5.4. EDTA release profile from PLGA nanoparticles. All data are
presented as means ±SEM, n=3 per group.
102
Figure 5.5. Reversal of arterial calcification in vivo by EDTA. A: Calcium and
phosphorus level of the harvested abdominal aorta after treatment of PLGA particles.
Study group: EDTA-loaded PLGA. Control group: PLGA alone. Asterisks in Figures
denote statistical significance (P < 0.05) comparing to control group without EDTA
entrapped. B: Alizarin Red stains for the harvested aorta treated by EDTA-loaded PLGA
particles and control PLGA particles. C: Calcium and phosphorus level of the rats’
plasma after treatment of PLGA particles. There is no statistical significant difference
(P>0.05) comparing to control group without EDTA entrapped. All data are presented as
means ±SEM, n=5
103
5.4 Discussion
This is the first study to compare three types of chelating agents (STS, EDTA, and
DTPA) used for chelation therapy and their chelating efficiency to remove calcium from
the hydroxyapatite, calcified aortic porcine elastin and calcified human aorta. We found
an optimal concentration (1~10 mg/mL) of chelating agents works very well to remove
calcium. Our results indicate that both EDTA and DTPA could effectively remove
calcium from hydroxyapatite and calcified tissues, while STS was not effective. The
tissue architecture was not altered during chelation. Furthermore, our in vivo study
demonstrates the proof of the concept for the first time that local delivery of chelating
agents such as EDTA could be used to reverse medial aortic calcification which is found
in arteriosclerosis.
Chelating agents’ effectiveness in removing plaques has been advertised and used
in certain countries, however, the treatment is not FDA approved in US because lack of
substantial conclusive data. The actual published data is very scarce in both animals and
human patients and no comparative in vitro or animal studies have been performed to
demonstrate the calcium chelating ability of different types of chelating agents (STS,
DTPA and EDTA). Pasch et al [119] found that STS could probably chelate calcium by
forming soluble calcium thiosulfate complex. They found that it prevents vascular
calcification in uremic rats. But systemic treatment of STS also lowered the bone strength
in animals probably due to STS chelation of bone HA. They proved direct calcium
104
chelation by STS through a decline of serum ionized calcium concentrations when
exposed to STS in vivo and in vitro. Adirekkiat et al[120] demonstrated that STS could
remove calcium from precipitated minerals and delayed the progression of coronary
artery calcification(CAC) in hemodialysis patients. Patients with a CAC score≥300 were
included to receive intravenous sodium thiosulfate infusion twice weekly post-
hemodialysis for 4 months. They found that CAC score did not change significantly in
the STS treatment but increased substantially in the control group. Our present study
shows that the chelating ability of EDTA and DTPA was superior to STS to remove
calcium from hydroxyapatite like mineral from calcified elastic tissue.
Disodium EDTA is an amino acid used to sequester divalent and trivalent metal
and mineral ions (e.g., lead, mercury, arsenic, aluminum, cobalt, calcium etc.). EDTA
binds to metals via 4 carboxylate and 2 amine groups [237]. Diethylene triamine
pentaacetic acid (DTPA) is consisting of a diethylenetriamine backbone with five
carboxymethyl groups. The molecule can be viewed as an expanded version of EDTA
and it is used similarly for metal chelation. Cavallotti et al [238] found that intravenous
injection of EDTA substantially reduced the extent of calcium deposits in the aortic wall.
The general decalcifying mechanism of EDTA may derive from its affinity for divalent
ions, especially calcium. Maniscalco et al [239] demonstrated that calcification in
coronary artery disease could be reversed by EDTA–tetracycline long-term therapy.
Their hypothesis was that calcification is caused by nanobacteria (NB). In that study,
EDTA was given as a rectal suppository base every evening, which was shown to result
in high blood EDTA levels sustained for a long time. They proposed that NB were
105
sensitive in vitro to tetracycline and its action is increased by EDTA dissolving NB
apatitic protective coat. Thus, they concluded that combination of these drugs might offer
a novel treatment for calcific atherosclerotic disease. EDTA has also been proven to
reduce the risk of calcific tendinitis of the shoulder [237] if used as a chelating agent. In
that study EDTA was administered through single needle mesotherapy and 15 minutes of
pulsed-mode 1 MHz-ultrasound. Calcifications disappeared completely in 62.5% of the
patients in the study group and partially in 22.5%; calcifications partially disappeared in
only 15% of the patients in the control group, and none displayed a complete
disappearance.
Despite these clinical studies and other EDTA chelation therapies that have gone
to clinical trials since 2003[240], little basic research is done to study chelation of
hydroxyapatite like mineral in vitro and in animal studies. This might be one of the
reasons why lots of negative opinions directed toward the chelation therapy for removal
of calcium from atherosclerotic plaques. Dr. Jackson[8], the editor of International
Journal of Clinical Practice, stated that “Chelation therapy is TACT-less, one wonders
why it is still widely used, given the lack of evidence of benefit and potential to do harm
(financial gain seems the most likely reason)”. Atwood et al[9] concluded that “…TACT
is unethical, dangerous, pointless, and wasteful. It should be abandoned.” Fraker et al[10]
concluded that “Chelation therapy (intravenous infusions of ethylenediamine tetra-acetic
acid or EDTA) is not recommended for the treatment of chronic angina or atherosclerotic
cardiovascular disease and may be harmful because of its potential to cause
hypocalcaemia.” First randomized clinical trial results published this year for EDTA
106
chelation therapy for coronary artery disease showed some improvements but the data
was not statistically significant to warrant use of chelation therapy for all patients with
myocardial infarction [8]. In all clinical studies, chelation therapy was tested to remove
calcium from atherosclerotic plaque and improve heart function. Atherosclerotic plaque
calcium deposits are due to necrotic tissue core and removal of calcium from plaque may
not remove cholesterol laden fatty deposits, thus may not be very effective in reducing
heart burden. Some have suggested that calcification make plaques more stable and
removal of calcium may make them vulnerable to rupture and that may have led to
negative connotations. Our present study with chelating agents is necessary and
significant because such therapy was never tested suitably to remove calcium from
medial arterial calcification that occurs in absence of atherosclerotic plaques in patients
with diabetes, end stage renal disease, and old age. In those cases calcification is
observed along the medial elastic layers that make arteries stiff. We envision using
chelation therapy for such type of calcification.
Our current results show that both EDTA and DTPA could effectively remove
calcium from calcified aortic elastin and calcified human aorta, while STS is not so
effective. We have demonstrated that vascular elastin specific calcification could be
reversed by chelating agents in vitro. Our in vivo study in the CaCl2 injury model, for the
first time, shows proof of the concept that chelating agent loaded PLGA nanoparticles
could reverse medial elastin-specific aortic calcification. One criticism of chelation
therapy is its effects on serum calcium and bone HA. One previous study of systemic
administration of STS in rats showed that such systemic chelation treatment led to the
107
decrease of serum calcium, phosphate and also compromised bone integrity. STS
treatment group required significantly lower load to fracture the femurs as compared to
controls[236]. Another study in humans also showed that systemic administration of
chelation agent caused decrease in serum calcium and serum phosphate levels and caused
bone loss by increasing endogenous parathyroid hormone secretion[14]. We consider
chelation therapy could be useful in patients with diabetes and old age to remove elastin
specific calcification if chelating agents such as EDTA are protected in polymeric
capsules (such as nanoparticles) and delivered at the site or targeted to vascular
calcification. Such treatment would prevent serum calcium chelation and undesired effect
on bone density. Our result in rats study showed such local EDTA treatment with PLGA
nanoparticles, completely reversed calcification without damaging vascular structure.
This is for the first time anyone has shown effectiveness of local therapy in reversal of
calcification. Such local EDTA treatment also did not change serum calcium and
phosphorus levels; thus could be used without systemic effects. This is because local
delivery method used in this study had much lower dose of chelating agents, specifically
0.01 g EDTA/kg rats comparing to those systemic administration of 0.4 g STS/kg
rats[236] and 0.04 g EDTA/kg human[230].Our long term goal is to develop site-specific
delivery of the chelating agents with targeted nanoparticles to reverse vascular
calcification without causing the negative impact on blood chemistry and bone integrity.
108
Limitations of Our Study
There are some limitations of our current study. Firstly, for in vivo chelation study
we did not measure plasma level of other biochemically important metal ions such as
chromium, zinc, cobalt, and copper and toxic metals, such as cadmium and lead, which
might be affected by the chelation treatment [241]. We used local delivery of small
concentrations of EDTA and thus systemic concentrations of chelating agent would be
negligible and may not affect other metal ions. Secondly, our animal study results might
not be directly applicable to patients with chronic kidney disease or patients on dialysis.
In our animal study, the rats had normal kidney function while those patients with
arteriosclerosis typically have non-regulated plasma level of calcium, phosphorus and
other ions[242]. Finally, we did not look at the bone integrity which might affected by the
EDTA treatment. Again, because we used local therapy of EDTA at very low
concentrations (4 fold lower than used in clinical trials, per kg basis) instead of systemic
delivery, we hypothesize that it will not affect bone integrity.
5.5 Conclusion
In conclusion, we did a comparative in vitro study for three types of chelating
agents (STS, EDTA and DTPA) and showed that EDTA and DTPA could effectively
remove calcium from calcified aortic elastin and calcified human aorta. We, for the first
time, show that local EDTA treatment with PLGA nanoparticles could reverse
calcification without causing vascular damage and change in the normal plasma level of
calcium and phosphorus.
109
Supplemental Figures
Figure 5.6. Types of chlating agents and chemical structure.
Figure 5.7. Surgery protocol and photos.
Reversal of aortic calcification in vivo by EDTA
110
CHAPTER 6: SYSTEMIC EDTA CHELATION THERAPY FAILED TO
REVERSE MAC AND HAD SIDE EFFECTS
6.1 Introduction
Vascular calcification is an independent risk factor for cardiovascular morbidity
and mortality. Vascular calcification occurs at two different sites- intima and media.
Intimal calcification is generally associated with atherosclerotic plaques and
inflammation and can occlude the lumen while medial calcification (MAC) occurs in the
elastin lamina of medium and large arteries in patients with chronic kidney disease (CKD)
or diabetes causing increase in arterial stiffness. Surgical methods like directional
atherectomy and stent grafts are used to treat atherosclerosis and intimal calcification and
to open occluded arteries [4, 5]. However, there are no treatments available for medial
elastin-specific calcification.
EDTA (disodium, ethylenediamine tetraacetic acid) chelation therapy has been
tried for reversing intimal vascular calcification with some success [17, 168, 172]. EDTA
binds or chelates ionic calcium (Ca), trace metals, and other divalent cations [141]. Many
possible mechanisms are proposed for EDTA chelation therapy to reverse calcification.
These mechanisms include: directly removing calcium deposits from calcified arteries
[134], binding serum calcium to reduce calcification, chelating heavy metals, and
normalizing Ca metabolism by reactivation of enzymes inhibited by toxic heavy metals
[135-138]. However, at present effectiveness of EDTA chelation therapy is still disputed
[9]. Most of the EDTA treatments were performed by subcutaneous infusion, or systemic
111
application of EDTA solution at very high dose (around 40 ~ 50 mg/kg) [11-17]. Many
side effects have been found with such a high systemic dose of EDTA chelation therapy
including: renal toxicity [18-23] , hypocalcemia [14, 24, 25], and bone loss [14, 26];
however, side effects are variable.
No animal studies are performed as yet to test if systemic EDTA therapy can
reverse elastin specific medial calcification (MAC). We created vascular medial elastin
specific calcification by abdominal application of calcium chloride to the abdominal aorta
of rats and tested if systemic EDTA therapy can reverse this type of calcification [27, 28].
We also analyzed possible side effects to serum Ca, urine Ca, bone loss, and kidney
toxicity.
6.2 Materials and methods
CaCl2 injury model and EDTA administration
An illustration of the experimental design is shown in Figure 6.1. All procedures
and treatments in animal studies were approved by the Institutional Animal Care and Use
Committees (IACUC) at Clemson University.
112
Figure 6.1. Experimental protocol for CaCl2 injury model and EDTA treatment of rats.
CaCl2 injury model (represent as symbol of arrow) was bone by a single periadventitial
0.5 M CaCl2 injury to abdominal aorta (15 minutes treatment) at starting time point of
experiment (Day 0, week 0). There were two treatment groups: 1) saline as control group
(n=5, 5 rats), tail vein injections with saline 2 times a week for another 2 weeks. 2)
EDTA as study group (n=5, 5 rats), tail vein injections with EDTA (50 mg/kg) 2 times a
week for another 2 weeks. Rats were placed in metabolic cages for urine collection for 24
hours (Day 21); after that all rats were given another injection (Day 22) of saline or
EDTA (depending on individual treatment groups) and then urine samples were taken at
time points of 1, 2, 3 and 4 hours post injection; finally rats were euthanized and organs
were harvested (represent as symbol of six-point stars).
CaCl2 injury model was used to mimic local aortic calcification at the abdominal
aortic region following previous protocol [27, 28]. Briefly, ten male Sprague-Dawley (SD)
rats (6 to 8 weeks old) were anesthetized by 2-3% isoflurane. A ventral laparotomy
exposed the peritoneal cavity. A 15 mm section of the infrarenal abdominal aorta was
exposed and injury was created by placing 0.5 M CaCl2 soaked sterile cotton gauze on
top of the aorta for 15 minutes. After CaCl2 application, the gauze was removed and the
area was briefly flushed with warm saline. Incisions were then closed with continuous
113
sutures (Abdominal and subcutaneous) and surgical staples. Then rats were allowed to
recover and maintained in standard chow conditions for one week.
One week after CaCl2 injury, rats were randomly separated into two groups: 1)
control saline group and 2) EDTA group (n=5/group). Either saline or EDTA (50 mg/kg
EDTA in saline) was delivered intravenously 2 times a week, for 2 weeks by tail vein
injections The dosage for EDTA was chosen based on other animal studies and clinical
trials for EDTA therapy [11-17].
On the final day of treatments (Day 21), all rats were placed in metabolic cages
(fasting for a day - removal of food only, water supply not removed) for urine collection.
The day immediately following fasting (Day 22), all rats were given another injection of
saline or EDTA (depending on individual treatment groups) and then urine samples were
taken at time points of 1, 2, 3, and 4 hours post injection and kept in – 80 ℃ for further
analysis. Immediately after urine collection all rats were euthanized by CO2 asphyxiation
and all organs including the aorta (from the heart to the iliac bifurcation), blood, femoral
bone, kidney, heart, liver and spleen were harvested. Heparin (10 units/ml blood) was
used as anti-coagulant for blood samples and serum was isolated and stored at – 80 ℃ for
further assay. Aorta, kidney, heart, liver and spleen were fixed in 10% buffered formalin
for further analysis.
Evaluation of aortic calcification
Aortic calcifications were evaluated by stereomicroscope micro-computed
tomography (micro-CT) scanner, histology, and atomic absorption spectrometry (AAS).
114
Aortas from all 10 rats were cleaned of all adherent tissues by blunt forceps after
formalin fixation. Plastic tube (PE, 1 mm outside diameter) was inserted into the cleaned
aortas for easier handling during imaging.
Whole aortas were imaged by stereomicroscope (Leica M80 stereo microscope,
Leica Microsystems Inc. Buffalo Grove, IL) both before and after alizarin red staining
[96, 243, 244]. Briefly, whole aortas were soaked in freshly made 2% alizarin red
solution (pH 4.1-4.3, pH) for 10 minutes and washed by distilled and deionized water for
another 5 minutes. Then aortas were then imaged by stereomicroscope.
Micro-CT imaging for harvested aortas was based on modified protocol [237,
239]. Micro-CT was done by using Siemens Inveon microPET/CT scanner (Preclinical
Solutions, Siemens Healthcare Molecular Imaging, USA). Briefly, a 360-degree axial
scan was collected at a peak tube potential of 80kVp and tube current of 500uA. Data
were reconstructed to 100 μm pixel size using a Feldkamp cone beam algorithm. Virtual
2D cross-sections and 3D maximum intensity projection views were created using
MeVisLab software (MeVisLab, Mevis, Bremen, Germany). Exported movies from
MeVisLab were further edited by video-editing software- Corel VideoStudio Pro
X7(Corel Inc, Mountain View, CA). (Available as online video supplement 1).
Following the non-invasive imaging by stereomicroscope and micro-CT scanner
mentioned above, aortas were processed for histology with alizarin red staining for
visualization of calcium. Briefly, aortas were fixed in 10% buffered formalin, processed
with an automatic tissue processor (Tissue TEK VIP; Miles, Mishawaka, IN) and then
115
sectioned into 6 μm paraffin sections for Alizarin red staining. Slides were stained in
freshly made 2% alizarin red solution (pH 4.1-4.3) for 3 minutes, washed by distilled and
deionized water and then counterstained with 1% light green solution for 10 sec and
mounted for optical microscope examination.
Remaining parts of abdominal aortas were used for Ca quantification by AAS. [28,
232]. Briefly, 2 ~ 10 mg of abdominal aortas were hydrolyzed in 1mL of 6N Ultrex HCl
(Baker Company, Phillipsburg, NJ) and then re-suspended in 0.01N Ultrex HCl.
Hydrolyzed samples were diluted and analyzed with AAS for calcium.
Calcium in serum and urine
Serum and urine samples were diluted before Ca quantification by AAS. Same
protocols were used as mentioned above for AAS.
Bone Analysis by Micro-CT and three points bending
The rat femoral bones were dissected and fixed in 10% buffered formalin from
both groups (saline group and EDTA group, n=5 each). The integrity of femoral bone
was evaluated by Micro-CT and by functional stiffness and fracture studies. Stiffness and
maximum load were tested based on three points bending mechanical test. Micro-CT for
rat femoral bones was performed by the same protocol as aortas mentioned earlier.
Representative scanning data for the whole 2D view slices from each group (saline group
and EDTA group) is available as an online supplement video 2.
116
Three points bending test was performed using Bose test machine (Electroforce
3200, Bose, MN, USA) equipped with a 450N load cell. Rat femoral bones were placed
in the machine (available as online supplement video 3 to show the fixture and fracture
locations). The stiffness was tested by measuring bone displacement (in mm) at a given
force (N). Later, bones were exposed to higher force until fracture occurred from which
the maximum enduring load (N) was determined.
Statistical analysis
Results are expressed as means ± standard deviation (SD). Statistical analyses of
the data were conducted using single-factor analysis of variance. Differences between
means were determined using the least significant difference with an α value of 0.05.
Asterisks in Figures represent statistical significance (P < 0.05).
6.3 Results
Systemic EDTA chelation therapy did not reverse aortic calcification
Periarterial application of calcium chloride led to medial elastin specific
calcification in the abdominal aorta. Whole rat aorta when stained with alizarin red
showed intense red staining for calcification where injury was created. Histology of
cross-sections of aorta confirmed elastin specific medial calcification (Figure 6.2A). Two
weeks of systemic EDTA chelation therapy did not reverse aortic calcification (Figure
6.2) as assessed by stereomicroscopy of whole aorta, histology, and calcium
quantification methods (AAS). Results showed no visible difference in calcification level
between saline study group and EDTA study group (Figure 6.2A). Ca quantification in
117
aortas by AAS also did not show statistical differences (P = 0.6491, n = 5) between
EDTA treated group and saline group confirming that 2 weeks of EDTA treatment was
ineffective in removal of aortic calcium (Figure 6.2B).
118
Figure 6.2. Evaluation of aortic calcifications by stereomicroscope, histology and AAS.A:
Photos for aortas took by stereomicroscope both before and after staining with alizarin
red and also one representative images of histological section after alizarin red staining
(n=5). B: Ca quantification in aortas by AAS. Micro-CT data were available as online
video supplementary materials.
Micro-CT results for aorta corroborated histology and no visible differences
between saline study group and EDTA study group were found (online video supplement
1).
Systemic EDTA chelation therapy led to hypocalcemia and hypercalciuria
Systemic EDTA chelation therapy caused side effects that influenced the Ca
amounts in serum and urine (Figure 6.3). Ca amount in the rats’ serum for EDTA study
group were significantly lower than the saline control group (Figure 6.3A, P = 0.0045, n
= 5). On the contrary, Ca amount in rats’ urine at the end (Day 22) after two weeks
EDTA treatment were significantly higher than saline control group (Figure 6.3B, P =
0.0001, n = 5). After EDTA application, urinary total Ca excretion increased
continuously for 4 hours (Figure 6.3C).
119
Figure 6.3. Ca quantification in serum and urine by AAS. A: Ca amounts in serum. B: Ca
amounts in urine at the end day (Day 22). C: Changes in urinary Ca concentrations post
saline and EDTA application.
Systemic EDTA chelation therapy did not cause bone loss
Since hypercalciuria (excessive urinary calcium excretion) induced by EDTA
application can potentially cause bone loss, we did morphology and functional test for
rats’ femoral bones both for EDTA treated and untreated groups. Micro-CT for rat
femoral bones selectively at 15 mm below the trochanter major showed no visible
difference, such as reduced mineralization or cystic transformation, between EDTA-
120
treated and untreated groups (Figure 6.4A). 2D imaging of virtual-slices (Total about 500
slices, 100 μm resolution) of rats’ femoral bones also indicated no visible differences for
all virtual-slices (online supplement video 2). Functional studies on bone integrity by
three points bending test revealed no significant changes to stiffness (measured as bone
displacement at a given force, N/mm) of rat femoral bones for EDTA treated group
compared to untreated group (Figure 6.4B, P = 0.8309, n = 3). Interestingly, EDTA
treated groups even had slightly higher maximum load compared to untreated group
(Figure 6.4C, P = 0.0273, n = 3).
121
Figure 6.4. Bone integrity of EDTA-treated (study group) and untreated rats. A: Rats’
femoral bone morphology by Micro-CT. No visible difference were seen such as reduced
mineralization or cystic transformation for EDTA-treated and untreated groups. B:
Stiffness of rats’ femoral bones analyzed from three point bending test. C: Maximum
(Max) load of rats’ femoral bones analyzed from three point bending test.
6.4 Discussion
The present study demonstrates that systemic EDTA chelation therapy does not
reverse local elastin-specific medial aortic calcification in rats. We further show that
systemic EDTA chelation therapy caused hypocalcemia (low serum calcium levels) and
hypercalciuria (excessive urinary calcium excretion) but did not cause bone loss. These
122
results indicated that systemic EDTA chelation therapy might not have therapeutic effects
in aspects of reversal of elastin-specific medial calcification that is found in patients with
CKD and chronic diabetes.
One of the proposed mechanisms for EDTA chelation therapy to reverse
calcification suggests that EDTA could directly remove calcium deposits from calcified
arteries [134]. We recently have demonstrated that EDTA could effectively remove Ca
from hydroxyapatite and calcified elastin and human aorta tissue In vitro [28]. Animal
studies with EDTA treatment have shown mixed results. For example, Kaman et al and
Cavallotti et al. showed that systemic infusion of EDTA significantly reduces calcium in
aortas in atherosclerotic rabbit model [11, 13]. But O'Brien et al showed that EDTA
chelation therapy (40 mg/kg, daily intravenous injection, 4 weeks) showed a 74%
increase in triglyceride levels but no benefit on arterial lesions in an atherosclerotic,
obese, diabetic rat model [165].
Many clinical studies have investigated the therapeutic effects of EDTA chelation
therapy with mixed results [15, 16, 142, 167]. Most of them were focused on other
aspects such as improvement in clinical symptoms such as cardiac output but not on
specifically reversal of calcification. Olszewer et al. in 1990 [137] did a pilot double
blinded study with EDTA chelation therapy (1.5 g/ EDTA per patient, 20 intravenous
infusion) with 10 patients (all male, aged 41 to 53 years) diagnosed with peripheral
vascular disease. Results showed that EDTA chelation therapy had substantial
improvements for the walking test and master exercise test. In 2005, Shoskes et al. [170]
123
reported a case study involving 16 male patients with recalcitrant chronic
prostatitis/chronic pelvic pain syndrome (CPPS) showing significant improvement of
symptoms of recalcitrant CPPS in the majority of the men after ComET therapy, which
was a combined EDTA chelation therapy with other drugs. One recent randomized trial
done by Lamas et al. in 2013 [17] with 1708 patients with myocardial infraction showed
that EDTA chelation therapy (50 mg/kg EDTA, intravenous infusion , one time a week,
40 weeks) would modestly reduce the risk of adverse cardiovascular outcomes but the
results did not lead to statistical significance. Further, this study did not highlight calcium
score data.
None of the previous studies, either in animals or in a clinical study, looked at
whether EDTA can remove calcium from medial elastin specific medial crterial
calcification (MAC). This condition can cause significant increase in arterial stiffness and
hypertension in patients. Thus, we tested EDTA chelation in an animal model where
elastin specific medical calcification is observed [27]. Local periadventitial treatment of
infrarenal aorta allowed us to induce elastin specific arterial calcification independent of
atherosclerosis similar to what is found in CKD patients. We chose EDTA doses similar
to dose used previously in other animal studies and in chelation therapy in patients [11-
17]. However, the two week treatment period of our study was shorter than others who
investigated 4 week [12] to 9 week [14] treatment periods. We chose shorter period due
to less severe calcification seen in our model at seven days. Our results indicated EDTA
chelation therapy by systemic infusion might not be effective to reverse elastin-specific
medial calcification possibly due to site of calcification, which is in the medial layer of
124
the artery and may not accessible to systemically delivered EDTA under high blood flow
conditions in the aorta. The half-life of EDTA in human beings was 20 to 60 minutes and
that EDTA was excreted primarily by the kidneys with about 50% excreted in one hour
and over 95% with 24 hours [245]. Similar data for rats is not available at this time but
half-life could be even less than humans. Thus, intravenously delivered EDTA may not
be as effective.
Many side effects are associated with systemic EDTA chelation therapy due to
high dosage. The side effects include are but not limited to: hypocalcemia [14, 24, 25],
bone loss [14, 26] and renal toxicity [18-23]. Our current results in rats also showed side
effects of hypocalcemia (low serum calcium levels) and hypercalciuria (excessive urinary
calcium excretion) (Figure 6.3). However, our results did not show any bone loss either
by morphology using Micro-CT or functional test using three points bending mechanical
test (Figure 6.4). Rudolph et al. in 1988 [26] conducted a case study with 61 patients and
showed that EDTA chelation therapy (3 g EDTA, 20 intravenous infusion, 5-9 weeks)
had no effect on bone density and may even enhance bone growth in patients with
osteoporosis. One proposed mechanism for EDTA’s effect on bone integrity is that
EDTA chelation therapy will lower serum calcium, and this would stimulate the
parathyroid to release parathormone thus pulling Ca out of the bones. However, because
the release of parathormone is pulsatile, an increase, rather than decrease, of new bone
formation would occur [172]. Whether this theory was correct or not is still unclear.
However, our present results indicated that bone loss was not a major adverse event for
EDTA chelation therapy。 In fact we did find slight increase in maximum load for bone
125
fracture in EDTA group suggesting increase in bone density. However, the major
possible side effects for EDTA chelation therapy were hypocalcemia, and hypercalciuria
in our study. However, we did not see EDTA treatment induced renal toxicity (Shown in
supplementary data, H&E staining of rats’ kidney) such as renal tubular vacuolization
and pinocytosis by the chelate as shown by others [18-23]. This might because our 2
weeks’ EDTA treatment is too short to induce renal toxicity.
Since systemic EDTA chelation therapy has so many possible side effects, it
would be important to further investigate how to avoid such side effects. One possible
way is using targeted EDTA chelation therapy. In fact, we previously showed that local
placement of EDTA loaded nanoparticles close to calcified aorta in calcium chloride
mediated injury model could reverse aortic calcification without causing side effects like
hypocalcemia [28]. Of course, such surgical approach is too invasive and would not be
feasible clinically. Our lab is currently working on targeted delivery of EDTA loaded
nanoparticles, which may provide a promising therapy to reverse elastin-specific arterial
calcification at much lower doses thus preventing systemic side effects.
Limitations of Current Study
There are some limitations to our studies. Firstly, our EDTA chelation therapy
was performed for a period of only two weeks. We do not know if long-term EDTA
treatment will have therapeutic effects to reverse vascular medial calcification. Secondly,
we did not investigate possible side effects besides serum calcium, urine calcium, and
bone loss. More kidney functional evaluation might be necessary such as serum
126
creatinine level. Finally, we only evaluated EDTA chelation therapy in rat CaCl2 injury
model, which induces local medial calcification at the site of injury. Patients have
calcification dispersed throughout arterial tree thus calcification animal models such as
warfarin [96]or vitamin D [99] application where calcification is seen at various places
such as aortic arch and renal and femoral bifurcation might be necessary in order to
investigate EDTA chelation therapy’s therapeutic effects.
6.5 Conclusions
Our results demonstrated that systemic EDTA chelation therapy for 2 week period
did not reverse local elastin specific aortic calcification in rats. We also showed that such
therapy caused side effects of hypocalcemia and hypercalciuria but it did not cause bone
loss. Thus, reversal of medial elastin calcification may not be achieved by short-term
systemic EDTA therapy. As such calcification is seen patients with CKD who already
have diseased kidney, further toxicity caused by EDTA could be detrimental to patients’
health.
127
Supplemental Figures
Figure 6.5. H&E staining for rats’ kidneys. No treatment induced histological change
was found.
128
Figure 6.6. One representative aorta’s Micro CT images from two groups.
129
Figure 6.7. Three points bending test: before and after fracture.
130
Figure 6.8. Load – Displacement curve for three points bending.
131
Figure 6.9. Micro-CT for rats’ femoral bone.
132
Figure 6.10. Micro-CT for three slices of rats’ femoral bone.
133
CHAPTER 7: TARGETED EDTA CHELATION THERAPY TO REVERSE
CALCIFICATION
7.1 Introduction
Medial arterial calcification (MAC), termed as Monckeberg’s sclerosis, is a type
of vascular calcification disease that mostly occurs as linear deposits along elastic
lamellae [3]. Vascular calcification, including MAC, is a strong predictor of
cardiovascular morbidity and mortality [98]. Almost no research except one recent study
from our laboratory has been directed at reversing of elastin specific MAC [6, 28]. Our
previous studies showed EDTA might be a promising chelating agent to reverse elastin
calcification both in vitro [28]. One recent clinical trial in the US from 2008 to 2013,
named Trial to Assess Chelation Therapy (TACT), aimed to determine the safety and
effectiveness of EDTA chelation therapy by systemic infusion in individuals with
coronary artery disease [240]. Published results of TACT showed that intravenous
chelation regimen with EDTA modestly reduced the risk of adverse cardiovascular
outcomes but did not specifically highlight EDTA chelation therapy whether or not could
reverse vascular calcification [246].
Systemic chelation therapy using chelating agents such as EDTA or sodium
thiosulfate to reverse calcification requires a high dosage and has side effects such as
hypocalcemia, bone loss and renal toxicity [14, 18, 119]. Due to these reasons and short
half-life of EDTA in circulation, no conclusive evidence is available about reversing
arterial calcification by chelation therapy. Our results in previous chapter with systemic
134
EDTA therapy did not show reversal of MAC when delivered systemically as intravenous
injection. It also caused loss of blood calcium and increase in urine calcium. We
hypothesize that nanoparticle-based targeted chelating agent delivery could lower the
dosage required and have many other advantages such as improved bioavailability and
sustained release of drugs [29]. We have recently shown that the elastin antibody coated
nanoparticles can be targeted to vascular calcification sites [30].
Albumin based nanoparticles (NPs) have been shown as a promising nontoxic,
non-immunogenic drug carrier [183]. Nanoparticle protein engineering therapy using
albumin NPs offers potential solutions to many of the problems like toxicities associated
with the solvent-based formulations [247].
Thus, in this study we tested if albumin NPs may be a good EDTA carrier to
deliver EDTA to the calcification sites. By surface coating with anti-elastin antibody, we
show reversal of elastin specific MAC in vitro or in vivo without side effects associated
with systemic EDTA chelation therapy.
7.2 Materials and Methods
Preparation of EDTA loaded albumin NPs
Albumin NPs were prepared by ethanol desolvation methods [183, 186, 248].
Briefly, 200 mg bovine serum albumin was dissolved in 4 mL of distilled and deionized
water (DD water) and then the pH was adjusted to 8.5 with 6N NaOH. EDTA was added
to this solution at various concentrations (25, 50, 100 or 200 mg) for loading optimization
experiments. The aqueous solution was added drop-wise to 16 mL ethanol under probe
135
sonication (20 Watts, Omni Ruptor 400 Ultrasonic Homogenizer, Omni International Inc,
Kennesaw, GA) to prepare NPs. The particles were stabilized by fixation with 4%
glutaraldehyde (100 μL) for 1 hour and washed 3 times with DD water. The prepared
NPs were then lyophilized and stored at 4 ℃ for further use. For NP tracking
experiments, NPs were loaded with a fluorescent dye (2.5 mg, DiR, 1, 1-dioctadecyl-3, 3,
3, 3-tetramethylindotricarbocyanine iodide, Biotium, Inc., Hayward, CA) instead of
EDTA.
Characterization of EDTA loaded albumin NPs
Particle size and Zeta potential in suspension was determined using 90Plus
Particle Size Analyzer (Brookhaven Instruments Co, Holtsville, NY). 10 µl of
nanoparticle suspension was diluted in 3 ml of HPLC-grade water in a disposable plastic
cuvette. Particle size was also measured by transmission electron microscope (TEM,
H7600, Japan). Briefly, 20 µl of nanoparticle suspension (0.1 mg/ml) was added on a
formvar-coated copper grid and allowed to be dried overnight under reduced vacuum,
and then copper grid was loaded into the sample chamber of the TEM.
EDTA loading efficiency:
The drug loading efficiency was calculated using the formula:
Loading efficiency (%) = (
) ⑴
The amount of entrapped EDTA was back calculated by subtracting the amount of
non-entrapped EDTA in NPs mixture after separation of synthesized EDTA loaded
136
albumin NPs. The supernatant wash solution mentioned above during NPs preparation
was collected for calculation of non-entrapped EDTA amount. EDTA was analyzed
based on a standard curve using EDTA-FeCl3 complex by Ultraviolet–visible(UV-Vis)
spectroscopy with peak absorption at 257 nm[249].
In vitro EDTA release
In vitro release studies were performed by incubating 2 mg EDTA loaded albumin
NPs nanoparticles in 1ml of 0.1M Phosphate buffered saline (PBS) at pH 7.4. The NP
suspension was shaken continuously at 37 ℃. At pre-selected times (2, 4, 8, 24, 48, 72,
96 and 120 hours), the supernatant was collected for EDTA quantification.
Determination of cell toxicity and uptake of NPs
For cellular cytotoxicity concentrations of 100, 1000 µg EDTA loaded albumin
NPs /ml cell culture media were used to evaluate possible toxicity to rat aortic smooth
muscle cells (RAMSCs, passage 6). Briefly, RAMSCs were seeded at 10,000 cells/cm2.
When reached at 70% confluency, RAMSCs were incubated with nanoparticles for 4
hours. Then cell viability was determined using a LIVE/DEAD Cell Viability assay
(Molecular Probes, Grand Island, NY). The live controls are cells cultured on normal
media while dead controls are cells treated by 70% ethanol. Cells that have green
fluorescence are considered alive while cells that have red fluorescence are considered
dead in this stain.
137
Cellular cytotoxicity was also evaluated using MTT (3-(4,5-Dimethyl-2-
thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide) assay. Briefly, 5 mg of MTT (Sigma
Aldrich, St.Louis, MO) was dissolved in 10 ml of PBS and then were added to RAMSCs.
After 4 hours, PBS was carefully aspirated and the insoluble formazan dye was collected
with dimethyl sulfoxide (DMSO) (Sigma Aldrich, St. Louis, MO). Absorbance was read
at 560 nm and normalized to control (normal media) readings.
To visualize cellular uptake of NPs (After antibody coating, described later), NPs
with same concentrations of 100 µg NPs/ml media and 1000 µg NPs /ml media were
tested. DiR dye (Biotium, Inc., Hayward, CA) was used to label the NPs. 24 hours after
DiR-labeled NPs’ incubation, the cells were thoroughly washed with PBS three times to
remove unbound nanoparticles, fixed with 4 % formaldehyde, labeled with the lipophilic
membrane stain DiI (or 1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine
Perchlorate, Invitrogen, Carlsbad, CA). Imaging of cells was performed using fluorescent
microscopy (EVOS fl. Microscope, Advanced Microscopy Group, Bothell, WA).
Demineralization of calcified tissue in vitro
Calcified porcine aortic elastin (160~180 µg Ca/mg tissue) was prepared by
subdermal implantation of pure porcine aortic elastin in rats as described in earlier
publication [200].
Calcified human aortas (100~300 µg Ca/mg tissue) from cadavers (age 49-75,
both male and female with moderate or severe atherosclerosis) were received from the
138
Greenville Hospital System (Greenville, SC) following standard dissection technique. All
samples were from the abdominal aorta, just below the renal arteries.
To determine EDTA loaded albumin NPs’ efficacy to remove calcium from
calcified tissue, calcified porcine aortic elastin and separately calcified human aorta (10
mg each) were soaked in 10 ml EDTA loaded albumin NPs dispersion (10 mg/ml in PBS,
n=3) with constant shaking at 37 ℃. The control groups were soaked in 10 ml blank
albumin NPs without EDTA loading (10mg/ml in PBS, n=3). 3 days after treatments all
tissue samples were embedded in paraffin blocks, sectioned, and stained for qualitative
analysis of calcium with Dahl’s alizarin red stain.
Antibody coated EDTA loaded albumin NPs – preparation and optimization for antibody
binding
The antibody surface coating strategy for albumin NPs is illustrated in Figure
7.1A. Antibody thiolation: 10 µg of antibodies were thiolated using 34 µg of freshly
prepared Traut’s reagent (G-Biosciences, Saint Louis, MO) in 0.1 ml of PBS for 1 hour.
Antibodies used include Alexa-Fluor 555 goat anti-mouse IgG (Molecular Probes,
Carlsbad, CA), rabbit anti-rat IgG antibody (Thermo Scientific, Rockford, IL) and rabbit
anti-rat elastin antibody (United States Biological, Swampscott, MA). Thiolated
antibodies were washed three times with PBS and dialyzed through 10 kDa MWCO
filters to remove Traut’s reagent.
Albumin NPs conjugate to Maleimide-PEG- NHS ester: EDTA loaded albumin
NPs were prepared as described earlier. Albumin NPs were activated with
139
heterobifunctional crosslinker α-maleimide-ω-N-hydroxysuccinimide ester poly (ethylene
glycol) (Maleimide-PEG- NHS ester, MW 2000 Da, Nanocs Inc.,NY, USA) in order to
achieve a sulfhydryl-reactive particle system. 2.5 mg of Maleimide-PEG- NHS ester
solution was added into 10 mg albumin NPs dispersion. Then the mixture was left under
shaking for 1 hour at room temperature.
Albumin NPs conjugate to antibodies: purified and thiolated antibodies were then
added to the activated albumin NPs and incubated overnight at room temperature for
conjugation. Samples were centrifuged and the supernatant was analyzed using
fluorescent spectrometry (n=3). A calibration curve was plotted from standard solutions
(0.1-25µg of Alexa-Fluor 555 goat anti-mouse IgG in 1 ml of PBS). The bound dye was
back calculated by subtracting the amount of unbound dye in the supernatant.
140
141
Figure 7.1. A: Schematic representation of antibody surface coating strategy for albumin
NPs. 1) Antibody thiolation using traut’s reagent to produce a terminal sulfhydryl group
on antibody. 2) Albumin NPs conjugated to NHS ester-PEG-Maleimide with amide bond.
3) Antibody conjugated to albumin NPs with maleimide – sulfhydryl reaction. B:
Experimental protocol for CaCl2 injury model and treatments of rats. CaCl2 injury model
(represented as a symbol of arrows) was created at starting time point of experiment (Day
0, week 0). There were total five treatment groups with following treatments by tail vein
injection (two times a week, two weeks): 1) saline as control group (n=5, 5 rats); 2) High
dose (HD) EDTA group (n=5, 5 rats, 50 mg/kg EDTA); 3) Low dose(LD) EDTA group
(n=3, 3 rats, 2.5 mg/kg EDTA); 4) IgG-NPs/EDTA group (n=5, 5 rats, 5 mg of NPs for
each rat at each injection); 5) EL-NPS/EDTA group (n=5, 5 rats, 5 mg of NPs for each rat
at each injection). Rats were placed in metabolic cages for urine collection for 24 hours
(Day 21); then all rats were given another injection on Day 22 (depending on individual
treatment groups) and then urine samples were taken at time points of 1, 2, 3 and 4 hours
post injection; right after that rats were euthanized and organs were harvested
(represented as a symbol of six-point stars).
Immunostaining to visualize antibody coating on NPs
Rabbit anti-rat IgG antibody coated albumin NPs (IgG-NPs) were prepared as
described earlier. 0.1 ml of NPs (1 mg/ml) without antibody coating and IgG-NPs (2 µg
IgG/mg NPs, 1 mg/ml) were incubated with 0.1 ml of 10 nm gold stained goat-anti-
142
rabbit IgG (Sigma Aldrich, St.Louis, MO) overnight in 0.01M tris buffered saline (TBS),
with 0.05% bovine serum albumin and 15% glycerol and 7.5 mM sodium azide. NPs
were washed twice with TBS to remove unbound antibodies at 14,000 × g for 15 minutes
after incubation. Then 20 µl of NPs’ suspension (1 mg/ml) was added on a formvar-
coated copper grid and allowed to be dried overnight under reduced vacuum. Antibody
surface conjugation was then analyzed by TEM.
Ex-vivo nanoparticle targeting studies using elastase damaged aorta
Aortas from Sprague-Dawley rats (Pel-Freez Biologicals, Rogers, AR) were used
in these studies (n=2, 2 samples in each group, total 8 groups). High purity porcine
pancreatic elastase (Elastin products company, Owensville, Missouri) was prepared
(5U/ml) in 100mM Tris Buffer, 1mM calcium chloride, 0.02% sodium azide, pH 7.8.
Elastase damaged aortas were prepared by injecting elastase intra-luminally for 1 hour to
mimic a damaged aorta in medical calcification [30]. Intra-luminal injection was done by
clamping both ends of the aorta during injection.
Rabbit anti-rat elastin antibody coated albumin NPs (EL-NPs) or rabbit anti-rat
IgG antibody coated albumin NPs (IgG-NPs) loaded with DiR dye were prepared by
following the same method as described earlier, Antibody coated NPs were injected
either in control fresh healthy aortas (without elastase treatment) or with elastase
damaged aortas. Following injection, the aortas were thoroughly washed 3 times with
PBS to minimize non-specific adherence of nanoparticles. The bound NPs (DiR dye
fluorescence) in aortas were quantified by Caliper IVIS Lumina XR image system
143
(Hopkinton, MA) with Ex/Em of 745/810 nm. The dry weights of the aortas were
recorded for fluorescent density normalization.
In vivo nanoparticle targeting studies based on local periadventitial CaCl2 injury model
CaCl2 injury model was used to mimic local aortic calcification at the abdominal
aortic region following previous protocol [27, 28]. Briefly, 6 male Sprague-Dawley (SD)
rats (6 to 8 weeks old) were anesthetized by 2-3% isoflurane. A ventral laparotomy
exposed the peritoneal cavity. A 15 mm section of the infrarenal abdominal aorta was
exposed and injury was created by placing 0.5 M CaCl2 soaked sterile cotton gauze on
top of the aorta for 15 minutes. After CaCl2 application, the gauze was removed and the
area was briefly flushed with warm saline. Incisions were then closed with continuous
sutures (Abdominal and subcutaneous) and surgical staples. Then rats were allowed to
recover and maintained in standard chow conditions for one week.
After one week (when calcification in injured site is seen), rats were anesthetized
and EL-NPs/IgG-NPs were injected through the tail vein (10 mg of NPs/kg body weight
in 0.1 ml saline). Rats were euthanized 24 hours after the injection.
Only organs that showed fluorescent signal were lyophilized and used to calculate
bio-distribution, which include aorta, heart, lung, liver, kidney, spleen. All other organs
and tissue such as brain, muscle, skin, and blood did not have detectable fluorescent
signal.
Percentage of targeting for each organ was calculated as follows:
144
%targeting
) / (dry weight of organ))*100
In vivo nanoparticle therapeutic efficacy studies based on local periadventitial CaCl2
injury model
An illustration of experimental design for this animal study was shown in Figure
7.1B. Firstly at starting time point (Day 0) CaCl2 injury was created same as mentioned
above. CaCl2 injury model mimics local elastin specific MAC. One week later rats were
divided into five groups for the following treatments by tail vein injection (two times a
week, two weeks): 1) saline as control group (n=5); 2) High dose (HD) EDTA group
(n=5, 50 mg/kg EDTA); 3) Low dose (LD) EDTA group (n=3, 2.5 mg/kg EDTA); 4)
IgG-NPs/EDTA group (n=5, 5 mg of NPs for each rat at each injection); 5) EL-
NPS/EDTA group (n=5, 5 mg of NPs for each rat at each injection). Rats were placed in
metabolic cages for urine collection for 24 hours at the end of the treatment day (Day 21).
Then all rats were given another injection on Day 22 (depending on individual treatment
groups) and then urine samples were taken at time points of 1, 2, 3 and 4 hours post
injection and were kept in – 80 ℃ for further analysis. Right after that rats were
euthanized by CO2 asphyxiation and organs were harvested including the aorta (from the
heart to the iliac bifurcation), blood, femoral bone, kidney, heart, liver and spleen.
Heparin (10 units/ml blood) was used as anti-coagulant for blood samples and serum was
removed and stored at – 80 ℃ for further assay. Aorta, kidney, heart, liver and spleen
were fixed in 10% buffered formalin for further analysis.
145
Aortic calcifications were evaluated by stereomicroscope (Leica M80 stereo
microscope, Leica Microsystems Inc. Buffalo Grove, IL), micro-computed tomography
(micro-CT) scanner (Siemens Inveon microPET/CT preclinical scanner, Siemens
Healthcare Molecular Imaging, USA), histology and atomic absorption spectrometry
(AAS). Aortas from all rats were cleaned of all adherent tissues by blunt forceps after
formalin fixation. Plastic tube (PE, 1 mm outside diameter) was inserted into the cleaned
aortas for easier handling during imaging. Whole aortas were imaged by
stereomicroscope (Leica M80 stereo microscope, Leica Microsystems Inc. Buffalo Grove,
IL) both before and after alizarin red staining [96, 243, 244]. Briefly, whole aortas were
soaked in freshly made 2% alizarin red solution (pH 4.1-4.3, pH) for 10 minutes and
washed by distilled and deionized water for another 5 minutes. Then aortas were imaged
by stereomicroscope. Micro-CT for harvested aortas in vitro was based on modified
protocol [237, 239]. Briefly, a 360-degree axial scan was collected at a peak tube
potential of 80kVp and tube current of 500uA. Data were reconstructed to 100 μm pixel
size using a Feldkamp cone beam algorithm. Virtual 2D cross-sections and 3D maximum
intensity projection views were created using MeVisLab software (MeVisLab, Mevis,
Bremen, Germany, http://www.mevislab.de). Exported movies from MeVisLab were
further edited by video-editing software- Corel VideoStudio Pro X7(Corel Inc, Mountain
View, CA) (Available as online video supplement 4).
Following the non-invasive imaging by stereomicroscope and micro-CT scanner
mentioned above, aortas were processed for histology with alizarin red staining for
visualization of calcium. Remaining parts of abdominal aortas were then used for Ca
146
quantification by atomic absorption spectroscopy, AAS [28, 232]. Briefly, 2 ~ 10 mg of
abdominal aortas ware hydrolyzed in 1ml of 6N Ultrex HCl (Baker Company,
Phillipsburg, NJ) and then re-suspended in 0.01N Ultrex HCl. Hydrolyzed samples were
diluted and analyzed with AAS. Serum and urine samples were thawed and diluted
before Ca quantification by AAS.
Rats’ femoral bones were dissected and fixed in 10% buffered formalin. The
integrity of femoral bone was evaluated by Micro-CT and by functional mechanical test.
Stiffness and maximum load were tested based on three points bending test. Micro-CT
for rats’ femoral bones was done by same protocol as aortas mentioned earlier (One
representative scanning data for the whole 2D view slices from each group is available as
online supplement video 5). Three points bending test was done using Bose test machine
(Electroforce 3200, Bose, MN, USA) equipped with a 450N load cell. First, stiffness was
tested by measuring bone displacement (in Millimeter, mm) at a given force (in Newton,
N). Second, bones were exposed to higher force until fracture occurred and the maximum
enduring load (N) was determined.
Statistical analysis
Results are expressed as means ± standard deviation (SD). Statistical analyses of
the data were performed using single-factor analysis of variance. Differences between
means were determined using the least significant difference with an α value of 0.05.
Asterisks in Figures indicate statistical significance (P < 0.05).
147
7.3 Results
Characterization for EDTA loaded albumin NPs – optimization and function
The size of NPs was dependent on sonication time; 10, 45 and 60 minutes of
sonication resulted in 1207.9 ± 177.3, 144.1±10.6 and 121.9 ± 13.5 nm size NPs
respectively (Figure 7.2A, 7.2B). Studies have shown that particle size with ~200 nm
could get sufficient retention of nanoparticles in the extracellular matrix and also
minimum cellular uptake by VSMCs [182, 250, 251]. So all NPs used later were prepared
by 45 minutes of probe sonication to get particles with ~200 nm size. Zeta potential of
NPs after antibody modification is shown in Table 7.1. As we wanted to target
extracellular matrix elastin and reduce cellular uptake, all NPs used in the animal study
were negatively charged (due to the inherent negative charge on the mammalian cell
membrane, negatively charged particles are repelled) (Table 7.1). EDTA loading
increased with initial EDTA concentration used but plateaued to ~ 22 % with no further
increase in loading with additional starting EDTA concentration (Figure 7.2 C). Release
profile for EDTA loaded albumin NPs showed initial burst and then continuous release
for up to 5 days (Figure 7.2 D) both before and after antibody modification. The amount
of total EDTA was slightly lower after antibody modification because of loss during
washing steps in antibody coating.
EDTA loaded albumin NPs did not cause cytotoxicity to RASCMs based on
Live/Dead assay and MTT assay in the range of 100 µg NPs/media to 1000 µg
NPs/media (Figure 7.2 E and 7.2 F). EDTA loaded albumin NPs did not show cellular
148
uptake in the concentration range between 100 µg NPs/media to 1000 µg NPs/media
(Figure 7.2 G). EDTA loaded albumin NPs could remove calcified mineral efficiently
both from calcified elastin and calcified human aorta samples as shown by Alizarin red
stain (Figure 7.2 H). The blank albumin NPs without EDTA loading were unable to
regress calcification (Figure 7.2 H).
Table 7.1. Characterization of nanoparticles.
Type of
nanoparticle
Size ±
SEM(nm)
Poly dispersity
index
ζ- potential ± SD
(mV)
IgG-NPs/DiR 177.9 ± 21.6 0.795 - 22.89 ± 5.28
EL-NPs/DiR 144.1± 10.6 0.479 - 31.72 ± 3.44
149
150
Figure 7.2. Characterization for albumin NPs – optimization and function. A: Particle
size measured by 90Plus Particle Size Analyzer with sonication times of 10, 45, and 60
minutes. B: Images showed particle size measured by TEM with corresponding
sonication times. C: Loading efficiency with serials of EDTA and albumin ratios. D:
Release profile for EDTA loaded albumin NPs before and after antibody modification.
Ab: antibody. E: LIVE/DEAD cell viability assay. Live control - normal media; Dead
control - treated by 70% ethanol; 100 µg NPs/ml media and 1000 µg NPs /ml media are
two studies groups. Magnification: 100X. Scale bar: 400µm. F: Cell viability determined
by MTT assay. G: Cellular uptake study with two NPs’ concentrations of 100 µg NPs/ml
media and 1000 µg NPs /ml media. Red fluorescence: cell membrane stained by
lipophilic membrane stain DiI (Excitation/Emission: 549/565nm). Purple fluorescence:
albumin NPs stained by DiR near-infrared dye (Excitation/Emission: 745/810 nm).
Magnification: 100X. Scale bar: 400µm. H: Demineralization of calcified elastin and
calcified human aorta. Blank albumins NPs without EDTA were control groups. EDTA
loaded albumin NPs were study groups. Alizarin red stains calcium as red and
counterstained by light green. Magnification: 100X. Scale bar: 100 µm.
Antibody coated EDTA loaded Albumin NPs – antibody binding and targeting efficacy
in vitro
Antibody binding yield was assessed by Alexa-flour 555 labeled IgG based on
standard curve (data not shown) of Alexa-fluor 555 conjugated IgG with
excitation/emission: 555/595 nm. The amount of IgG bound to albumin NPs increased
with more starting amount of antibody added but the bound percentage peaked around 5
µg IgG / mg albumin NPs (Figure 7.3 A and 7.3 B). Successful antibody coating was
also verified by gold immune-staining under TEM showing 10 nm gold particles on the
surface in the IgG-NPs (2 µg/mg IgG-NPs) while no gold particles presented in the
control NPs without antibody coating (Figure 7.3 C).
Control healthy aortas without NPs treatment showed no auto-fluorescence
(Figure 7.3 D); Control healthy aortas without elastase damage showed little
151
fluorescence. This indicated that either IgG-NPs or EL-NPs would not bind to healthy
aortas. Only damaged aortas (with antibody concentration of 1, 2.5, 5 and 10 µg/mg EL-
NPs) had strong fluorescence. The relative percentages of EL-NPs bound to damaged
aortas were normalized to control samples (1 µg/mg IgG-NPs). Fluorescent density was
quantified based on IVIS fluorescent counts (Figure 7.3E) and showed that antibody
concentration in range of 1 to 5 µg/mg EL-NPs could increase NPs binding to 159.8 % (1
µg/mg EL-NPs) or 176.1% (5 µg/mg EL-NPs). 2.5 µg/mg EL-NPs had good targeting
efficacy (Figure 7.3E) and higher ratio of antibody to NPs did not significantly increase
targeting efficacy so this ratio was chosen for later animal studies.
Figure 7.3. Antibody binding and targeting efficacy in vitro. A: Amount of IgG antibody
bound in 1 mg of albumin NPs with serials of starting ratio of antibody and albumin NPs
(1, 5, 10, 25 µg IgG/mg NPs). B: Percentage of IgG antibody bound with albumin NPs
152
with serials of starting ratio of antibody and albumin NPs (1, 5, 10, 25 µg IgG/mg NPs).
C: Gold immune-stained albumin NPs by TEM. Left: NPs without antibody coating
serviced as negative control. Right: NPs with IgG antibody coating, antibody
concentration used: 2 µg/mg IgG-NPs. Small black dots on NPs’ surface (right) represent
10 nm gold stained IgG. D: Fluorescent image for aortas by IVIS image system. Aortas
of numbers 1 to 8 are controls. Aortas of numbers 9 to 16 are study groups. Samples 7 to
16 in red rectangle area were used for DiR quantification. E: Quantification of EL-NPs
bound percentage by fluorescent density from IVIS images. C in horizontal axle: control
groups of sample 7 and 8(Damaged aortas and treated with 1 µg/mg IgG-NPs).
Fluorescent density of study groups (aortas numbers 9 to 16) were normalized to control
groups of sample 7 and 8.
Efficacy of EL-NPs targeting to damaged aorta in vivo
Most of the DiR dye was entrapped permanently in albumin NPs (data not shown),
thus NP tracking with fluorescence was possible for bio-distribution in animal studies.
Photography, fluorescence and X-ray image for all six aortas has been shown in Figure
7.4A. Red rectangle areas show where injury caused elastin damage and calcification in
the abdominal aortas. Those areas showed considerably more fluorescent signal in the
study groups (treated with EL-NPs/DiR) and no fluorescence for IgG-NPs/DiR.
Representative histological sections from damaged aortas both from EL-NPs/DiR and
EL-NPs/DiR treated groups showed that EL-NPs had better targeting efficacy and could
infiltrate from lumen to adventitia in damaged blood vessel (More purple fluorescence
from DiR dye labeled as red arrows in Figure 7.4B). Green fluorescence was auto-
fluorescence from aortic tissue section. EL-NPs treated groups had more NPs distribution
in aortas (15.98% in EL-NPs versus 5.75% in IgG-NPs) while less in spleen, kidney, lung
and heart comparing to control IgG-NPs treated groups (Table 7.2).
153
Figure 7.4. Efficacy of EL-NPs targeting to damaged aorta in vivo. A: Photography,
fluorescent image and X-ray image taken by IVIS image system. IgG-NPs/DiR: rabbit
anti-rat IgG antibody modified albumin NPs entrapped with DiR dye. EL-NPs/DiR:
rabbit anti-rat elastin antibody modified albumin NPs entrapped with DiR dye. The red
rectangle areas were calcified and damaged region detected by X-ray. B: Fluorescent
microscopy of abdominal aorta from representative histological section. Purple
fluorescence: albumin NPs stained by DiR near-infrared dye (Excitation/Emission:
745/810 nm). Green fluorescence: auto-fluorescence from aortic tissue section. Red
arrows indicated area with more purple fluorescence. Left: aortic section from IgG-
NPs/DiR groups as control. Right: aortic section from EL-NPs/DiR groups which
indicated that EL-NPs had better targeting efficacy and could infiltrate from lumen to
adventitia in damaged blood vessel.
154
Table 7.2. Organ distribution of fluorescent nanoparticles.
Organ % total fluorescence/g dry weight
(IgG-NP/DiR)
% total fluorescence/g dry weight
(EL-NP/DiR)
Aorta 5.75 ± 0.54 15.9 8 ± 0.87
Liver 32. 47 ± 0.83 36.60 ± 8.44
Spleen 35.55 ± 3.55 30.84 ± 5.48
Kidne
y 14.38 ± 1.81 11.59 ± 2.77
Lung 6.76 ± 0.23 3.37 ± 0.49
Heart 5.10 ± 3.18 1.61 ± 0.30
Therapeutic effects of targeted EDTA chelation therapy to reverse calcification
Aortic calcification for both systemic EDTA chelation therapy and targeted
EDTA chelation therapy is shown in Figure 7.5. Aortic calcification evaluated by
stereomicroscope before and after whole aorta’s alizarin red stain, Micro CT, and
histological stain by alizarin red showed that EL-NPs/EDTA groups showed best
therapeutic effects to reverse aortic calcification (Figure 7.5A). Four out of five aortas
showed complete reversal of calcification. No other groups including IgG NPs, low and
high EDTA systemic injections showed any significant reduction in calcification of the
aorta (Figure 7.5 A). These staining results corroborated calcium quantification in aorta
by AAS. Quantitative calcium results also showed that EL-NPs/EDTA groups had best
155
therapeutic effect to reverse aortic calcification and had lowest Ca amount in the aorta
(Figure 7.5B, P = 2.63E-06, n =5).
156
157
Figure 7.5. Evaluation of aortic calcification for both systemic EDTA chelation therapy
and targeted EDTA chelation therapy. A: Aortic calcification evaluated by
stereomicroscope before and after whole aorta’s alizarin red stain, Micro CT and
histological stain by alizarin red. Here showed results of IgG-NPs/EDTA and EL-
NPs/EDTA groups. B: Ca quantification in aorta by AAS for all five treatment groups
(For IgG-NPS/EDTA and EL-NPs/EDTA groups, P = 2.63E-06, n =5).
Targeted EDTA chelation therapy did not have side effects associated with systemic
EDTA chelation therapy
Possible side effects with both systemic EDTA chelation therapy and targeted
EDTA chelation therapy are shown in Figure 7.6. Results showed no side effects to
serum and urine Ca as seen in high dose EDTA treated groups in EL-NPs/EDTA groups,
or targeted EDTA chelation therapy groups, (Figure 7.6A, P = 0.0045, n = 5; Figure
7.6B, P = 0.0001, n = 5; Figure 7.6C). Similarly, there were no bone losses seen in all
treated groups both from morphology and from functional test of stiffness and fracture
stability (Figure 7.6D; 7.6E; 7.6F, P = 0.027, n =3).
158
159
Figure 7.6. Possible side effects with systemic EDTA chelation therapy and targeted
EDTA chelation therapy. A: Serum Ca quantification for all five treatment groups (For
Saline and HD EDTA groups, P = 0.0045, n = 5). B: Urine Ca quantification for all five
treatment groups (For Saline and HD EDTA groups, P = 0.0001, n = 5). C: Urine kinetic
Ca quantification after tail vein injection of all five different reagents up to four hours. D:
Bone morphology analyzed by Micro CT showing 15 mm below the trochanter major of
femoral bone for all five treatment groups. E: Stiffness of femoral bone for all five
treatment groups. F: Maximum load of femoral bone for all five treatment groups (For
Saline and HD EDTA groups, P = 0.027, n =3).
7.4 Discussion
To our knowledge this is the first time anyone has shown that targeted
nanoparticles when injected systemically can bind to calcified artery and regress
calcification in vivo. Vascular calcification occurs at two different sites- intima and media.
160
Intimal calcification is generally associated with atherosclerotic plaques and
inflammation and can occlude the lumen while medial calcification occurs in the elastin
lamina of medium and large arteries in patients with chronic kidney disease (CKD) or
diabetes causing increase in arterial stiffness. Surgical methods like directional
atherectomy and stent grafts are used to treat atherosclerosis and intimal calcification and
to open occluded arteries [4, 5]. However, there are no treatments available for medial
elastin-specific calcification.
Chelation therapy has been touted to remove calcification of arteries, mostly for
intimal atherosclerotic calcification; however, very few animal studies have been
performed and none of the clinical studies have proven its effectiveness in improving
cardiovascular function [174, 176]. We wanted to test if elastin-specific medial
calcification can be removed by targeted chelation therapy. We chose EDTA as our
previous comparative study of three chelating agents: EDTA, sodium thiosulfate and
DTPA (diethylene triamine pentaacetic acid) showed that EDTA worked best to remove
calcium from hydroxyapatite and calcified tissue [28]. In the same study, we have also
shown that local placement of EDTA loaded poly(lactic-co-glycolic) acid (PLGA),
nanoparticles on top of calcified aorta after exposing calcified abdominal aorta by ventral
laparotomy, could effectively reverse elastin-specifically medical calcification in a rat
calcification model [28]. However, such invasive procedure cannot be translated for
human use. In an attempt to target drugs to diseased arteries, we recently discovered that
specifically designed NPs with elastin-targeting antibodies on the surface were able to
deliver agents to the site of elastic-lamina damage [30]. Elastin fibers in elastic lamina in
161
healthy artery are covered with microfibrillar glycoproteins and thus not accessible to
elastin antibody targeted to elastin. In most vascular diseases, elastic lamina gets
damaged and elastic fibers get exposed. We used this knowledge to create NPs that
specifically targeted to diseased site in artery [30]. These previous studies paved the way
to design an elastin antibody coated and EDTA loaded albumin NPs to reverse elastin-
specific MAC and to avoid side effects associated with systemic EDTA chelation therapy.
We choose albumin nanoparticles instead of polymeric nanoparticles like PLGA or PLA
(Polylactic acid) because albumin NPs are less toxic as no organic solvents are used in
preparation and used frequently in clinical applications [183, 247]. We could also load
significant amount of EDTA in albumin NPs rather than PLGA NPs.
We optimized surface charge and size of albumin NPs so that they are not taken
up by cells and remain in the extracellular matrix. Others have shown that small particle
size less than 100 nm would have more uptake in vascular smooth muscle cells [250]
while big particles larger than 500 nm could not effectively penetrate endothelium and
basement membrane in blood vessels. Previous results in our lab indicated that
nanoparticles of ~200 nm size were able to penetrate both the endothelium and the
basement membrane and also limited cellular uptake [30]. The size of EDTA loaded
albumin NPs was quite dependent on the duration of sonication time and we found that
45 minutes of probe sonication resulted in 150~200 nm size. Since mammalian cell
membrane has negative charge, negatively charged particles show less cellular uptake
[252]. Our result showed that our negatively charged albumin NPs with size of 150~200
nm have limited cellular uptake. We could load up to 20 % EDTA (wt/wt) and NPs
162
sustained release of EDTA for up to 5 days. We found EDTA loaded albumin NPs did
not cause significant cell death or uptake. Next we checked if such NPs can remove
calcium from calcified elastin and human aorta in vitro. Indeed, EDTA releasing NPs
when incubated with calcified tissues removed calcium both from calcified elastin and
calcified human aorta in vitro. Once the charge, size, and targeting and therapeutic
efficiency was tested in vitro , we next designed in vivo experiments to test if such NPs
can deliver EDTA to the calcified aorta under high shear and blood flow present in the
aorta. We injected NPs through rat tail vein and allowed them to circulate and target to
the site. We clearly found that NPs (with DiR dye) with elastin antibody on the surface
(EL-NPs/DiR) did accumulate at the inured aortic site while IgG-NPs with DiR did not.
We then injected NPs containing chelating agent EDTA with either elastin antibody on
the surface (EL-NPs/EDTA) or irrelevant IgG antibody (IgG-NPs/EDTA). We decided to
inject NPs 2 times a week based on in vitro release profile for EDTA. Within 2 weeks of
injections (total 4 injections) we could observe complete removal of calcium from 4 out
of 5 arteries in EL-NPs EDTA group as confirmed by alizarin red staining, microCT, and
quantitative calcium scores. Not only calcium was removed but the elastic lamina seemed
to be less damaged after removal of calcium. On the other hand EDTA loaded IgG NPs
did not target to the site and did not remove any calcium. We also injected EDTA
systemically in the same manner NPs were delivered (2 times a week), either in high dose
(similar to what is used clinical studies) or low dose (based on how much total EDTA
was delivered through NPs). In both of these direct injection cases, EDTA failed to
remove calcium from the arteries as there was no change in calcification seen by alizarin
163
red staining, quantitative calcium results, and microCT experiments. Moreover, we found
that EDTA dose similar to what used clinically (50 mg/kg) caused significant adverse
events for serum and urine calcium, specifically hypocalcemia and hypercalciuria. Our
NPs contained 20 times lower EDTA (which was protected) and it was released slowly
over a period of five days. Thus, we did not find any systemic toxicity for nanoparticle
groups. Thus, elastin antibody coated and EDTA loaded albumin NPs might be a
promising nanoparticle protein engineering therapy to reverse elastin-specific medial
calcification. This targeted nanoparticle delivery method will lower the dosage required
for chelating agent - EDTA so as to avoid side effects associated with systemic
intravenous infusion such as hypocalcemia and bone loss [14, 18, 119]. It is a safe and
non-invasive method to reverse calcification compared to surgical methods. Antibody-
mediated tissue targeting of albumin NPs for clinical practice has been approved by the
FDA for other drugs [253, 254] so our antibody coated albumin NPs have great potential
clinical relevance.
Limitations of Our Study: There are some limitations to our studies. First, our
EDTA chelation therapy was performed for a period of only two weeks. We do not know
if calcification will return after halting the therapy and also we do not know long the NPs
will stay at the of calcification after intravenous injection. Secondly, we did not
investigate possible side effects besides serum calcium, urine calcium, and bone loss.
More kidney functional evaluation might be necessary such as serum creatinine level.
Finally, we only evaluated EDTA chelation therapy in rat CaCl2 injury model, which
induces local medial calcification at the site of injury. Patients have calcification
164
dispersed throughout arterial tree thus calcification animal models such as warfarin
[96]or vitamin D [99] application where calcification is seen at various places such as
aortic arch and renal and femoral bifurcation might be necessary in order to investigate
EDTA chelation therapy’s therapeutic effects. Careful risk-benefit analysis needs to done
before use in individual human patients.
7.5 Conclusions
We prepared EDTA loaded albumin NPs with optimized size of 150~200 nm,
zeta potential of – 22.89 ~ - 31.72 mV, loading efficiency of 15~ 20 %, and a sustained
release of EDTA for up to 5 days. Both ex-vivo study and in vivo study using aortic
calcification model showed that elastin antibody coated and EDTA loaded albumin NPs
could have good targeting efficacy and also therapeutic effects to reverse elastin-specific
medial calcification. EDTA loaded albumin NPs did not cause side effects of serum and
urine Ca, as seen in high dose EDTA treated groups. There was no bone loss in all treated
groups. Elastin antibody coated and EDTA loaded albumin NPs might be a promising
nanoparticle protein engineering therapy to reverse calcification in elastin-specific medial
calcification and to avoid side effects associated with traditional EDTA chelation therapy
by systemic intravenous infusion.
165
Supplemental figures
166
Figure 7.7. H&E staining for rats’ kidneys (All five groups). No treatment induced
histological change was found.
167
Figure 7.8. Flow chart for preparation of EDTA loaded albumin NPs.
168
Figure 7.9. Graphical abstract to show nanoparticle structure and targeting and chelation.
A: nanoparticle schematic. EDTA (yellow) was encapsulated into albumin nanoparticles
(NPs, green). EDTA was chelating agent to chelate calcium complex deposition along
elastic lamina fibers. NHS ester-PEG-Maleimide was bifunctional spacer. NHS ester
formed a stable amide bond through amine group on albumin. Reaction of a sulfhydryl on
antibody (blue) to the maleimide group results in formation of a stable thioether linkage.
B: NPs targeting and chelation schematic. Elastic fibers are formed by 90% mature cross-
linked elastin core and 10% microfibrils (arrows) components. In disease state
mircofibrils degrade and calcium complex depositions occur along elastic lamina fibers.
Exposed elastin allows elastin antibody coated albumin NPs (EL-NPs) targeting and
released EDTA chelates calcium complex depositions (purple) eventually reverse elastin-
specific medial calcification.
169
Figure 7.10. DiR standard curve and release profile in vitro.
Methods for figure 7.9: Characterization of antibody coated EDTA loaded albumin
NPs - DiR release profile in vitro
170
A DiR standard curve was plotted using a serial of standard solution (0, 0.05, 0.10, 0.15,
0.25 mg DiR/ml in DD water) by fluorescent spectrometry (Excitation/Emission of
745/810 nm). 5 mg of NPs (n =3, prepared as described earlier, after antibody coating)
were soaked in 1ml of PBS at pH 7.4. The NPs suspension was continuously shaken at
37 ℃. At pre-selected times (2, 4, 6, 8, and 24 hour), The supernatant was collected for
DiR quantification. After 24 hours the NPs were homogenized by Powered 125
homogenizer (Fisher Scientific, MA) and Omni Ruptor 400 Ultrasonic Homogenizer
(Omni International Inc, Kennesaw, GA) to extract non-released DiR in PBS. The
supernatant was collected to detect entrapped DiR after 24 hours. Our data showed that
DiR release was less than 30% (data not shown) within in 24 hours. Most of the DiR dye
would still be entrapped in albumin NPs after 24 hours. So the near-infrared fluorescent
signal from DiR dye could be used to track the albumin NPs bio-distribution in animal
studies.
171
Figure 7.11. NPs bio-distribution present by organs. A summary of all 6 rats’ NPs
distribution based on near-infrared fluorescent signal based on DiR dye (Ex: 745 nm, Em:
810 nm/ICG).
172
Figure 7.12. NPs bio-distribution present by individual rats. A summary of all 6 rats’
NPs distribution based on near-infrared fluorescent signal based on DiR dye (Ex: 745 nm,
Em: 810 nm/ICG).
173
Figure 7.13. One representative aorta’s Micro CT images from all five groups.
174
CHAPTER 8: CONCLUSIONS AND RECOMMENDATIONS
8.1 Conclusions
The broad goal of this project was to understand mechanisms of elastin specific
MAC, to evaluate efficacy of chelating agents to reverse elastin specific MAC, to
evaluate therapeutic effects of systemic disodium ethylene diaminetetraacetic acid
(EDTA) chelation therapy in the aspect of reversal of calcification and possible side
effects, and to develop a targeted delivery system to reverse elastin specific MAC and to
avoid side effects.
We show the following:
1) In aim 1, we demonstrate that RASMCs lose their smooth muscle lineage markers
like alpha smooth muscle actin (SMA) and myosin heavy chain (MHC) and undergo
chondrogenic/osteogenic transformation in presence of mineral deposits. This is
indicated by an increase in the expression of typical chondrogenic proteins such as
aggrecan, collagen type II alpha-1 (Col2a1) and bone proteins such as runt-related
transcription factor 2 (RUNX2), alkaline phosphatase (ALP) and osteocalcin (OCN).
Furthermore, when calcified conditions are removed, cells return to their original
phenotype. Our data supports the hypothesis that elastin degradation and calcification
precedes VSMCs’ osteoblast-like differentiation.
2) In aim 2, we show that both EDTA and diethylene triamine pentaacetic acid (DTPA)
could effectively remove calcium from HA and calcified tissues, while sodium
thiosulfate (STS) was not effective. The tissue architecture was not altered during
175
chelation. In the animal model of aortic elastin-specific calcification, we further
show that local periadventitial delivery of EDTA loaded in to poly (lactic-co-glycolic
acid) (PLGA) nanoparticles regressed elastin specific calcification in the aorta.
Collectively, the data indicate that elastin-specific medial vascular calcification could
be reversed by chelating agents.
3) In aim 3, we demonstrated that systemic EDTA chelation therapy did not reverse
local aortic calcification. Systemic EDTA chelation therapy caused adverse events
for serum and urine calcium, specifically hypocalcemia and hypercalciuria, but did
not cause bone loss or affect kidney function may be due to short treatment times of
two weeks. These results indicated that systemic EDTA chelation therapy might not
have therapeutic effects in the aspect of reversal of calcification and a strict protocol
is required for safety dosage.
4) In aim 4, we developed EDTA loaded albumin Nanoparticles (NPs) that could
release EDTA slowly. We prepared EDTA loaded albumin NPs with optimized size
of 150~200 nm, zeta potential of – 22.89 ~ - 31.72 mV, loading efficiency of 15~ 20
%, and a sustained release up to 5 days. We further show that when such NPs were
decorated on the surface with elastin antibody, they could be targeted to degraded
elastic lamina efficiently when administrated by intravenous injection. Both ex-vivo
study and in-vivo study using local aortic calcification model showed that elastin
antibody coated and EDTA loaded albumin NPs have good targeting efficacy and
also therapeutic effects to reverse elastin-specific medial calcification. Such NPs
delivery did not cause systemic side effects that were seen for direct injection of
176
EDTA. Elastin antibody coated and EDTA loaded albumin NPs might be a
promising nanoparticle protein engineering therapy to reverse calcification in elastin-
specific medial calcification and avoid side effects associated with traditional EDTA
chelation therapy by systemic intravenous infusion.
8.2 Limitations of this project and recommendation for future work
1) Mechanisms of how calcified matrix trigger osteogenic response in VSMCs
It is unclear as to how calcified matrix triggers VSMCs transformation to
osteoblast like cells and further cellular pathway studies are needed to test this. Calcium
and phosphorus levels in the media were similar in controls and calcified matrix groups
(data not shown), thus osteoblast-like transformation seen on our studies was not due to
higher amounts of free ions as shown by others[71, 208, 215]. We speculate that VSMCs
synthesize small quantities of bone proteins (they come from same mesenchymal origin
of osteoblasts). These proteins in healthy state do not accumulate in the vessel media;
however, calcified elastin matrix can bind to these synthesized proteins[224, 225] and
increase local concentration causing VSMCs to turn to osteoblast-like cells. We further
speculate that local increase in bone morphogenetic proteins (BMPs) can activate BMP
receptor pathway in SMCs thus causing osteogenic dedifferentiation.
2) Long term therapeutic effects and side effects of systemic EDTA chelation
therapy
EDTA chelation therapy in this work was performed for a period of only two
weeks. Thus, we do not know if long-term EDTA treatment will have therapeutic effects
177
to reverse vascular calcification or more severe systemic side effects. Others have shown
that long-term EDTA chelation therapy does cause systemic side effects. Secondly, we
did not investigate possible side effects besides serum calcium, urine calcium, and bone
loss. More kidney functional evaluation might be necessary such as serum creatinine
level.
3) Targeted EDTA chelation therapy to reverse calcification using elastin
antibody coated and EDTA loaded albumin NPs
We have clearly shown in chapter 7 that systemic delivery of EDTA loaded NPs
remove calcium from arteries in rats. A lot more work needs to be done to guarantee
limited variation for nanoparticle size, loading efficiency and release between batch-to-
batch preparations for EDTA loaded EL-NPs.
We also do not know whether calcification would return after nanoparticles
deliver all EDTA and resorb calcification. A long term animal study is needed to confirm
that once calcium is removed, it does not return. We also did not test cellular
dedifferentiation in vivo. It would be interesting to see if VSMCs surrounding calcified
matrix show osteoblast-like behavior and whether they return to their native smooth
muscle cell behavior after removal of calcium in vivo similar to what was observed in
vitro in cell cultures.
Only one animal model was used in our current study, where MAC was induced
by chemical treatment. We need to test it different animal models of vascular
calcification, such as animal model for systemic vascular calcification (warfarin +
178
vitamin K injections in rats) [96], and atherosclerosis (fat-fed apoE-/- mice) [255] by
collaboration with other labs.
In our NPs’ bio-distribution study, we only examined it after 24 hours of
injection of NPs, longer time points, 3 or 7 days, might be necessary to see how long the
NPs could stay. Also, more toxicity tests need to be done on animals such as renal
toxicity, liver toxicity, and trace metal deficiency. Careful risk-benefit analysis needs to
done before use in individual human patients.
179
CHAPTER 9: REFERENCES
1. Valderrama, A.L., et al., Million Hearts: Strategies to Reduce the Prevalence of
Leading Cardiovascular Disease Risk Factors- United States, 2011. Morbidity
and Mortality Weekly Report, 2011. 60(36).
2. Johnson, R., J. Leopold, and J. Loscalzo, Vascular Calcification: Pathobiological
Mechanisms and Clinical Implications (vol 99, pg 1044, 2006). Circulation
Research, 2009. 105(6): p. E8-E8.
3. Proudfoot, D. and C.M. Shanahan, Biology of Calcification in Vascular Cells:
Intima versus Media. Herz, 2001. 26(4): p. 245-251.
4. MacIsaac, A.I., et al., High speed rotational atherectomy: outcome in calcified
and noncalcified coronary artery lesions. Journal of the American College of
Cardiology, 1995. 26(3): p. 731-736.
5. Coselli, J.S., L.D. Conklin, and S.A. LeMaire, Thoracoabdominal aortic
aneurysm repair: review and update of current strategies. The Annals of thoracic
surgery, 2002. 74(5): p. S1881-S1884.
6. Kapustin, A. and C.M. Shanahan, Targeting vascular calcification: softening-up a
hard target. Current opinion in pharmacology, 2009. 9(2): p. 84-89.
7. Wu, M., C. Rementer, and C.M. Giachelli, Vascular calcification: an update on
mechanisms and challenges in treatment. Calcified tissue international, 2013.
93(4): p. 365-373.
8. Jackson, G., Chelation therapy is TACT-less. International Journal of Clinical
Practice, 2008. 62(12): p. 1821-1822.
9. Atwood, K.C., et al., Why the NIH Trial to Assess Chelation Therapy (TACT)
should be abandoned. Medscape J Med, 2008. 10(5): p. 115.
10. Fraker, T.D. and et al., 2007 Chronic Angina Focused Update of the ACC/AHA
2002 Guidelines for the Management of Patients With Chronic Stable Angina.
Circulation, 2007. 116(23): p. 2762-2772.
11. Kaman, R.L., et al., Effect of EDTA chelation therapy on aortic calcium in rabbits
on atherogenic diets: quantitative and histochemical studies. J Adv Med, 1990.
3(1): p. 13.
12. O’Brien, K.D., Pathogenesis of Calcific Aortic Valve Disease A Disease Process
Comes of Age (and a Good Deal More). Arteriosclerosis, thrombosis, and
vascular biology, 2006. 26(8): p. 1721-1728.
13. Cavallotti, C., et al., Experimental calcification of the aorta in rabbits: effects of
chelating agents and glucagon. J Lab Anim Sci, 2004. 31: p. 215-219.
14. Guldager, B., et al., Effects of intravenous EDTA treatment on serum parathyroid
hormone (1-84) and biochemical markers of bone turnover. Danish medical
bulletin, 1993. 40(5): p. 627-630.
15. Van Rij, A.M., et al., Chelation therapy for intermittent claudication. A double-
blind, randomized, controlled trial. Circulation, 1994. 90(3): p. 1194-1199.
16. Knudtson, M.L., et al., Chelation therapy for ischemic heart disease: a
randomized controlled trial. JAMA, 2002. 287(4): p. 481-486.
180
17. Lamas, G.A., et al., Effect of disodium EDTA chelation regimen on
cardiovascular events in patients with previous myocardial infarction: the TACT
randomized trial. JAMA, 2013. 309(12): p. 1241-1250.
18. Holland, J.F., E. Danielson, and A. Sahagian-Edwards, Use of ethylene diamine
tetra acetic acid in hypercalcemic patients. Experimental Biology and Medicine,
1953. 84(2): p. 359-364.
19. Schwartz, S.L., et al., Studies of the nephrotoxicity of ethylenediaminetetraacetic
acid. Biochemical pharmacology, 1966. 15(3): p. 377-389.
20. Doolan, P.D., et al., An evaluation of the nephrotoxicity of
ethylenediaminetetraacetate and diethylenetriaminepentaacetate in the rat.
Toxicology and applied pharmacology, 1967. 10(3): p. 481-500.
21. SCHWARTZ, S.L., C.B. JOHNSON, and P.D. DOOLAN, Study of the
Mechanism of Renal Vacuologenesis Induced in the Rat by
Ethylenediaminetetraacetate Comparison of the Cellular Activities of Calcium
and Chromium Chelates. Molecular pharmacology, 1970. 6(1): p. 54-60.
22. McDonagh, E., C. Rudolph, and E. Cheraskin, The effect of EDTA chelation
therapy plus supportive multivitamin-trace mineral supplementation upon renal
function: A study in serum creatinine. J Holistic Med, 1982. 4(2): p. 146-151.
23. Oliver, L., R. Mehta, and H. Sarles, Acute renal failure following administration
of ethylenediamine-tetraacetic acid (EDTA). Texas medicine, 1984. 80(2): p. 40.
24. Spencer, H., et al., Studies on the effect of ethylenediaminetetraacetic acid in
hypercalcemia. J Lab Clin Med, 1956. 47(1): p. 29-41.
25. Meltzer, L.E., J. Kitchell, and F. PALMON JR, The long term use, side effects,
and toxicity of disodium ethylenediamine tetraacetic acid (EDTA). The American
journal of the medical sciences, 1961. 242(2): p. 11-17.
26. Rudolph, C., E. McDonagh, and D. Wussow, The effect of intravenous disodium
ethylenediaminetetraacetic acid (EDTA) upon bone density levels. Journal of
Advancement in Medicine, 1988. 1(2): p. 79-85.
27. Basalyga, D.M., et al., Elastin Degradation and Calcification in an Abdominal
Aorta Injury Model Role of Matrix Metalloproteinases. Circulation, 2004.
110(22): p. 3480-3487.
28. Lei, Y., et al., Efficacy of Reversal of Aortic Calcification by Chelating Agents.
Calcified tissue international, 2013. 93(5): p. 426-435.
29. Singh, R. and J.W. Lillard Jr, Nanoparticle-based targeted drug delivery.
Experimental and Molecular Pathology, 2009. 86(3): p. 215-223.
30. Sinha, A., et al., Nanoparticle targeting to diseased vasculature for imaging and
therapy. Nanomedicine: Nanotechnology, Biology and Medicine, 2014.
31. http://www.phschool.com/. Available from:
http://www.phschool.com/science/biology_place/biocoach/cardio2/structure.html.
32. Rosenbloom, J., W. Abrams, and R. Mecham, Extracellular matrix 4: the elastic
fiber. The FASEB Journal, 1993. 7(13): p. 1208-1218.
33. http://histologistics.com/. Available from:
http://histologistics.com/2013/07/14/elastic-fiber-pictures/.
181
34. http://helpfromthedoctor.com/. Available from:
http://helpfromthedoctor.com/blog/2010/07/27/what-is-a-protein/.
35. http://www.visualphotos.com/. Available from:
http://www.visualphotos.com/image/1x9082695/elastin_and_microfibrils.
36. Isenburg, J.C., D.T. Simionescu, and N.R. Vyavahare, Elastin stabilization in
cardiovascular implants: improved resistance to enzymatic degradation by
treatment with tannic acid. Biomaterials, 2004. 25(16): p. 3293-3302.
37. Ramamurthi, A. and I. Vesely, Evaluation of the matrix-synthesis potential of
crosslinked hyaluronan gels for tissue engineering of aortic heart valves.
Biomaterials, 2005. 26(9): p. 999-1010.
38. Sinha, S., et al., Expression of latent TGF-beta binding proteins and association
with TGF-beta1 and fibrillin-1 following arterial injury. Cardiovascular Research,
2002. 53(4): p. 971-983.
39. Murie, J.A., Vascular surgery–5th edition, RB Rutherford (ed.), 285× 222 mm.
Pp. 2266. Illustrated. 1999. Philadelphia, Pennsylvania: WB Saunders.£ 199.00.
2000, Wiley Online Library.
40. http://www.cphospital.org/. Available from: http://www.cphospital.org/adam/In-
Depth%20Reports/10/000249.php.
41. Groyer, E., et al., [Immunological aspects of atherosclerosis]. Presse medicale
(Paris, France: 1983), 2006. 35(3 Pt 2): p. 475-486.
42. Black, S., I. Kushner, and D. Samols, C-reactive protein. Journal of Biological
Chemistry, 2004. 279(47): p. 48487-48490.
43. van Oostrom, A.J., J.P. van Wijk, and M.C. Cabezas, Lipaemia, inflammation and
atherosclerosis: novel opportunities in the understanding and treatment of
atherosclerosis. Drugs, 2004. 64(2): p. 19-41.
44. De Caterina, R., J.K. Liao, and P. Libby, Fatty acid modulation of endothelial
activation. The American journal of clinical nutrition, 2000. 71(1): p. 213S-223S.
45. Cummings, P.M., K. Giddens, and B.A. Nassar, Oral glucose loading acutely
attenuates endothelium-dependent vasodilation in healthy adults without
diabetes: an effect prevented by vitamins C and E. Journal of the American
College of Cardiology, 2000. 36(7): p. 2185-2191.
46. Carluccio, M.A., et al., Olive oil and red wine antioxidant polyphenols inhibit
endothelial activation antiatherogenic properties of mediterranean diet
phytochemicals. Arteriosclerosis, thrombosis, and vascular biology, 2003. 23(4):
p. 622-629.
47. D'Acquisto, F., M.J. May, and S. Ghosh, Inhibition of nuclear factor kappa B
(NF-B). Molecular interventions, 2002. 2(1): p. 22.
48. Kopp, E. and S. Ghosh, Inhibition of NF-kappa B by sodium salicylate and
aspirin. Science, 1994. 265(5174): p. 956-959.
49. Grip, O., S. Janciauskiene, and S. Lindgren, Atorvastatin activates PPAR-γ and
attenuates the inflammatory response in human monocytes. Inflammation
Research, 2002. 51(2): p. 58-62.
182
50. Frick, M.H., et al., Prevention of the angiographic progression of coronary and
vein-graft atherosclerosis by gemfibrozil after coronary bypass surgery in men
with low levels of HDL cholesterol. Circulation, 1997. 96(7): p. 2137-2143.
51. Nordmann, A.J., et al., Balloon angioplasty or medical therapy for hypertensive
patients with atherosclerotic renal artery stenosis? A meta-analysis of
randomized controlled trials. The American journal of medicine, 2003. 114(1): p.
44-50.
52. Lloyd-Jones, D., et al., Heart disease and stroke statistics—2010 update A report
from the American Heart Association. Circulation, 2010. 121(7): p. e46-e215.
53. http://www.wecareindia.com/. Available from:
http://www.wecareindia.com/general-surgery/aortic-aneurysm-surgery.html.
54. Steinmetz, E.F., et al., Treatment with simvastatin suppresses the development of
experimental abdominal aortic aneurysms in normal and hypercholesterolemic
mice. Annals of surgery, 2005. 241(1): p. 92.
55. Brophy, C.M., J.E. Tilson, and M.D. Tilson, Propranolol stimulates the
crosslinking of matrix components in skin from the aneurysm-prone blotchy
mouse. Journal of Surgical Research, 1989. 46(4): p. 330-332.
56. Sho, E., et al., Continuous periaortic infusion improves doxycycline efficacy in
experimental aortic aneurysms. Journal of vascular surgery, 2004. 39(6): p. 1312-
1321.
57. Dai, J., et al., Effect of blocking platelet activation with AZD6140 on development
of abdominal aortic aneurysm in a rat aneurysmal model. Journal of vascular
surgery, 2009. 49(3): p. 719-727.
58. Gavrila, D., et al., Vitamin E inhibits abdominal aortic aneurysm formation in
angiotensin II–infused apolipoprotein E–deficient mice. Arteriosclerosis,
thrombosis, and vascular biology, 2005. 25(8): p. 1671-1677.
59. Walton, L.J., et al., Inhibition of Prostaglandin E2 Synthesis in Abdominal Aortic
Aneurysms Implications for Smooth Muscle Cell Viability, Inflammatory
Processes, and the Expansion of Abdominal Aortic Aneurysms. Circulation, 1999.
100(1): p. 48-54.
60. Go, A.S., et al., Executive Summary: Heart Disease and Stroke Statistics—2013
Update A Report From the American Heart Association. Circulation, 2013.
127(1): p. 143-152.
61. Lau, W.L. and J.H. Ix. Clinical Detection, Risk Factors, and Cardiovascular
Consequences of Medial Arterial Calcification: A Pattern of Vascular Injury
Associated With Aberrant Mineral Metabolism. in Seminars in nephrology. 2013:
Elsevier.
62. Everhart, J., et al., Medial arterial calcification and its association with mortality
and complications of diabetes. Diabetologia, 1988. 31(1): p. 16-23.
63. Giachelli, C.M., Vascular calcification mechanisms. Journal of the American
Society of Nephrology, 2004. 15(12): p. 2959-2964.
64. Luo, G., et al., Spontaneous calcification of arteries and cartilage in mice lacking
matrix GLA protein. 1997.
183
65. Rutsch, F., et al., Mutations in ENPP1 are associated with'idiopathic'infantile
arterial calcification. Nature genetics, 2003. 34(4): p. 379-381.
66. Giachelli, C.M., et al., Osteopontin is elevated during neointima formation in rat
arteries and is a novel component of human atherosclerotic plaques. Journal of
Clinical Investigation, 1993. 92(4): p. 1686.
67. Levy, R.J., et al., Biologic determinants of dystrophic calcification and
osteocalcin deposition in glutaraldehyde-preserved porcine aortic valve leaflets
implanted subcutaneously in rats. The American journal of pathology, 1983.
113(2): p. 143.
68. Boström, K., et al., Bone morphogenetic protein expression in human
atherosclerotic lesions. Journal of Clinical Investigation, 1993. 91(4): p. 1800.
69. Price, P.A., J.M. Caputo, and M.K. Williamson, Bone Origin of the Serum
Complex of Calcium, Phosphate, Fetuin, and Matrix Gla Protein: Biochemical
Evidence for the Cancellous Bone‐Remodeling Compartment. Journal of Bone
and Mineral Research, 2002. 17(7): p. 1171-1179.
70. Tanimura, A., D.H. McGregor, and H.C. Anderson, Matrix vesicles in
atherosclerotic calcification. Experimental Biology and Medicine, 1983. 172(2):
p. 173-177.
71. Moe, S.M. and N.X. Chen, Mechanisms of Vascular Calcification in Chronic
Kidney Disease. Journal of the American Society of Nephrology, 2008. 19(2): p.
213-216.
72. Parhami, F., et al., Lipid oxidation products have opposite effects on calcifying
vascular cell and bone cell differentiation A possible explanation for the paradox
of arterial calcification in osteoporotic patients. Arteriosclerosis, thrombosis, and
vascular biology, 1997. 17(4): p. 680-687.
73. Tintut, Y., et al., Tumor necrosis factor-α promotes in vitro calcification of
vascular cells via the cAMP pathway. Circulation, 2000. 102(21): p. 2636-2642.
74. Abedin, M., Y. Tintut, and L.L. Demer, Vascular calcification mechanisms and
clinical ramifications. Arteriosclerosis, thrombosis, and vascular biology, 2004.
24(7): p. 1161-1170.
75. Nelson, R.G., et al., Lower-extremity amputations in NIDDM: 12-yr follow-up
study in Pima Indians. Diabetes care, 1988. 11(1): p. 8-16.
76. Lehto, S., et al., Medial Artery Calcification: A Neglected Harbinger of
Cardiovascular Complications in Non–Insulin-Dependent Diabetes Mellitus.
Arteriosclerosis, thrombosis, and vascular biology, 1996. 16(8): p. 978-983.
77. Top, C., et al., Mönckeberg's Sclerosis: An Unusual Presentation A Case Report.
Angiology, 2002. 53(4): p. 483-486.
78. Bas, A., et al., Reversibility of Calcitriol‐Induced Medial Artery Calcification in
Rats With Intact Renal Function. Journal of Bone and Mineral Research, 2006.
21(3): p. 484-490.
79. Al-Aly, Z., et al., Aortic Msx2-Wnt Calcification Cascade Is Regulated by TNF-
α–Dependent Signals in Diabetic Ldlr−/− Mice. Arteriosclerosis, thrombosis, and
vascular biology, 2007. 27(12): p. 2589-2596.
184
80. Rajamannan, N.M., et al., Human aortic valve calcification is associated with an
osteoblast phenotype. Circulation, 2003. 107(17): p. 2181-2184.
81. Katz, R., et al., Features of the metabolic syndrome and diabetes mellitus as
predictors of aortic valve calcification in the Multi-Ethnic Study of
Atherosclerosis. Circulation, 2006. 113(17): p. 2113-2119.
82. Rajamannan, N.M., R.O. Bonow, and S.H. Rahimtoola, Calcific aortic stenosis:
an update. Nature clinical practice Cardiovascular medicine, 2007. 4(5): p. 254-
262.
83. Coates, T., et al., Cutaneous necrosis from calcific uremic arteriolopathy.
American journal of kidney diseases, 1998. 32(3): p. 384-391.
84. Janigan, D.T., et al., Calcified subcutaneous arterioles with infarcts of the
subcutis and skin (“calciphylaxis”) in chronic renal failure. American journal of
kidney diseases, 2000. 35(4): p. 588-597.
85. Wilmer, W.A. and C.M. Magro. Calciphylaxis: emerging concepts in prevention,
diagnosis, and treatment. in Seminars in dialysis. 2002: Wiley Online Library.
86. Griethe, W., et al., Bone morphogenic protein-4 expression in vascular lesions of
calciphylaxis. Journal of nephrology, 2002. 16(5): p. 728-732.
87. Demer, L.L. and Y. Tintut, Vascular calcification pathobiology of a multifaceted
disease. Circulation, 2008. 117(22): p. 2938-2948.
88. Towler, D.A., Vascular calcification: a perspective on an imminent disease
epidemic. IBMS BoneKEy, 2008. 5(2): p. 41-58.
89. Ikonomidis, J.S., et al., A murine model of thoracic aortic aneurysms. Journal of
Surgical Research, 2003. 115(1): p. 157-163.
90. Gertz, S.D., A. Kurgan, and D. Eisenberg, Aneurysm of the rabbit common
carotid artery induced by periarterial application of calcium chloride in vivo.
Journal of Clinical Investigation, 1988. 81(3): p. 649.
91. Lai, C.-H., et al., Recombinant human thrombomodulin suppresses experimental
abdominal aortic aneurysms induced by calcium chloride in mice. Annals of
surgery, 2013. 258(6): p. 1103-1110.
92. Marinov, G.R., et al., Can the infusion of elastase in the abdominal aorta of the
Yucatan miniature swine consistently produce experimental aneurysms?
Investigative Surgery, 1997. 10(3): p. 129-150.
93. Carsten III, C.G., et al., Elastase is not sufficient to induce experimental
abdominal aortic aneurysms. Journal of vascular surgery, 2001. 33(6): p. 1255-
1262.
94. Ding, Y.H., et al., Modified technique to create morphologically reproducible
elastase-induced aneurysms in rabbits. Neuroradiology, 2006. 48(8): p. 528-532.
95. Gadeau, A.-P., et al., Time course of osteopontin, osteocalcin, and osteonectin
accumulation and calcification after acute vessel wall injury. Journal of
Histochemistry & Cytochemistry, 2001. 49(1): p. 79-86.
96. Price, P.A., S.A. Faus, and M.K. Williamson, Warfarin causes rapid calcification
of the elastic lamellae in rat arteries and heart valves. Arteriosclerosis,
thrombosis, and vascular biology, 1998. 18(9): p. 1400-1407.
185
97. Bouvet, C., et al., A new rat model of diabetic macrovascular complication.
Cardiovascular Research, 2007. 73(3): p. 504-511.
98. Boström, K. and L.L. Demer, Regulatory mechanisms in vascular calcification.
Critical reviews in eukaryotic gene expression, 1999. 10(2): p. 151-158.
99. Price, P.A., et al., Osteoprotegerin inhibits artery calcification induced by
warfarin and by vitamin D. Arteriosclerosis, thrombosis, and vascular biology,
2001. 21(10): p. 1610-1616.
100. Zittermann, A. and R. Koerfer, Protective and toxic effects of vitamin D on
vascular calcification: clinical implications. Molecular aspects of medicine, 2008.
29(6): p. 423-432.
101. Niederhoffer, N., et al., Aortic calcification produced by vitamin D3 plus nicotine.
Journal of vascular research, 1997. 34(5): p. 386-398.
102. Pan, C.S., et al., The role of adrenomedullin and its receptor system in
cardiovascular calcification of rat induced by Vitamin D3 plus nicotine. Peptides,
2004. 25(4): p. 601-608.
103. Park, J.-H., et al., Relationship between arterial calcification and bone loss in a
new combined model rat by ovariectomy and vitamin D3 plus nicotine. Calcified
tissue international, 2008. 83(3): p. 192-201.
104. Zhou, Y.-B., et al., Lanthanum Acetate Inhibits Vascular Calcification Induced by
Vitamin D3 Plus Nicotine in Rats. Experimental Biology and Medicine, 2009.
234(8): p. 908-917.
105. Adijiang, A., et al., Indoxyl sulphate promotes aortic calcification with expression
of osteoblast-specific proteins in hypertensive rats. Nephrology Dialysis
Transplantation, 2008. 23(6): p. 1892-1901.
106. Kuro-o, M., et al., Mutation of the mouse klotho gene leads to a syndrome
resembling ageing. nature, 1997. 390(6655): p. 45-51.
107. Schäfer, C., et al., The serum protein α2–Heremans-Schmid glycoprotein/fetuin-A
is a systemically acting inhibitor of ectopic calcification. Journal of Clinical
Investigation, 2003. 112(3): p. 357-366.
108. Razzaque, M.S., et al., Premature aging-like phenotype in fibroblast growth
factor 23 null mice is a vitamin D-mediated process. The FASEB Journal, 2006.
20(6): p. 720-722.
109. Gertz, S.D., A. Kurgan, and D. Eisenberg, Aneurysm of the rabbit common
carotid artery induced by periarterial application of calcium chloride in vivo. J
Clin Invest, 1988. 81(3): p. 649-56.
110. Jono, S., et al., 1,25-Dihydroxyvitamin D3 Increases In Vitro Vascular
Calcification by Modulating Secretion of Endogenous Parathyroid Hormone–
Related Peptide. Circulation, 1998. 98(13): p. 1302-1306.
111. Niwa, T. and M. Ise, Indoxyl sulfate, a circulating uremic toxin, stimulates the
progression of glomerular sclerosis. Journal of Laboratory and Clinical Medicine,
1994. 124(1): p. 96-104.
112. Miyazaki, T., et al., Indoxyl sulfate increases the gene expressions of TGF-β1,
TIMP-1 and pro-αl (I) collagen in uremic rat kidneys. Kidney International
Supplement, 1997(62).
186
113. Hafner, J., et al., Uremic small-artery disease with medial calcification and
intimal hyperplasia (so-called calciphylaxis): a complication of chronic renal
failure and benefit from parathyroidectomy. Journal of the American Academy of
Dermatology, 1995. 33(6): p. 954-962.
114. Asmus, H.-G., et al., Two year comparison of sevelamer and calcium carbonate
effects on cardiovascular calcification and bone density. Nephrology Dialysis
Transplantation, 2005. 20(8): p. 1653-1661.
115. Russell, R.G.G., et al., Bisphosphonates. Annals of the New York Academy of
Sciences, 2007. 1117(1): p. 209-257.
116. O'Neill, W.C., Treatment of vascular calcification. Kidney international, 2008.
74(11): p. 1376-1378.
117. O'Neill, W.C. and K.A. Lomashvili, Recent progress in the treatment of vascular
calcification. Kidney international, 2010. 78(12): p. 1232-1239.
118. Raggi, P., et al., The ADVANCE study: a randomized study to evaluate the effects
of cinacalcet plus low-dose vitamin D on vascular calcification in patients on
hemodialysis. Nephrology Dialysis Transplantation, 2011. 26(4): p. 1327-1339.
119. Pasch, A., et al., Sodium thiosulfate prevents vascular calcifications in uremic
rats. Kidney international, 2008. 74(11): p. 1444-1453.
120. Adirekkiat, S., et al., Sodium thiosulfate delays the progression of coronary artery
calcification in haemodialysis patients. Nephrology Dialysis Transplantation,
2010. 25(6): p. 1923-1929.
121. Mathews, S.J., et al., Effects of sodium thiosulfate on vascular calcification in
end-stage renal disease: a pilot study of feasibility, safety and efficacy. American
journal of nephrology, 2011. 33(2): p. 131-138.
122. Ong, S. and I. Coulson, Diagnosis and treatment of calciphylaxis. Skinmed, 2012.
10(3): p. 166-170.
123. Callister, T.Q., et al., Effect of HMG-CoA reductase inhibitors on coronary artery
disease as assessed by electron-beam computed tomography. New England
Journal of Medicine, 1998. 339(27): p. 1972-1978.
124. Novaro, G.M., et al., Effect of hydroxymethylglutaryl coenzyme a reductase
inhibitors on the progression of calcific aortic stenosis. Circulation, 2001.
104(18): p. 2205-2209.
125. Wanner, C., et al., Atorvastatin in patients with type 2 diabetes mellitus
undergoing hemodialysis. New England Journal of Medicine, 2005. 353(3): p.
238-248.
126. Mach, F., Statins as immunomodulatory agents. Circulation, 2004. 109(21 suppl
1): p. II-15-II-17.
127. Greenwood, J., L. Steinman, and S.S. Zamvil, Statin therapy and autoimmune
disease: from protein prenylation to immunomodulation. Nature Reviews
Immunology, 2006. 6(5): p. 358-370.
128. Spronk, H., et al., Tissue-specific utilization of menaquinone-4 results in the
prevention of arterial calcification in warfarin-treated rats. Journal of vascular
research, 2004. 40(6): p. 531-537.
187
129. Holden, R.M., et al., Vitamins K and D status in stages 3–5 chronic kidney
disease. Clinical Journal of the American Society of Nephrology, 2010. 5(4): p.
590-597.
130. Schlieper, G., et al., Circulating nonphosphorylated carboxylated matrix gla
protein predicts survival in ESRD. Journal of the American Society of
Nephrology, 2011. 22(2): p. 387-395.
131. Westenfeld, R., et al., Effect of Vitamin K< sub> 2</sub> Supplementation on
Functional Vitamin K Deficiency in Hemodialysis Patients: A Randomized Trial.
American journal of kidney diseases, 2012. 59(2): p. 186-195.
132. Rajachar, R.M., et al., Role of carbonic anhydrase II in ectopic calcification.
Cardiovascular Pathology, 2009. 18(2): p. 77-82.
133. Simpson, C.L., et al., Toward cell therapy for vascular calcification: osteoclast-
mediated demineralization of calcified elastin. Cardiovascular Pathology, 2007.
16(1): p. 29-37.
134. Bolick, L.E. and D.H. Blankenhorn, A quantitative study of coronary arterial
calcification. The American journal of pathology, 1961. 39(5): p. 511.
135. Maxwell, G., R. Elliott, and E. Robertson, The effect of Na< sub> 3</sub>
EDTA-induced hypocalcemia upon the general and coronary hemodynamics of
the intact animal. American heart journal, 1963. 66(1): p. 82-87.
136. Lufkin, E.G., R. Kumar, and H. Heath III, Hyperphosphatemic Tumoral
Calcinosis: Effects of Phosphate Depletion on Vitamin D Metabolism, and of
Acute Hypocalcemia on Parathyroid Hormone Secretion and Action*. The
Journal of Clinical Endocrinology & Metabolism, 1983. 56(6): p. 1319-1322.
137. Olszewer, E., F.C. Sabbag, and J.P. Carter, A pilot double-blind study of sodium-
magnesium EDTA in peripheral vascular disease. Journal of the National Medical
Association, 1990. 82(3): p. 173.
138. Cranton, E.M., Bypassing Bypass Surgery: A Non-surgical Treatment for
Reversing Arteriosclerosis, Improving Blocked Circulation, and Slowing the
Aging Process. 2001: Hampton Roads Publishing.
139. Maniscalco, B.S. and K.A. Taylor, Calcification in coronary artery disease can
be reversed by EDTA–tetracycline long-term chemotherapy. Pathophysiology,
2004. 11(2): p. 95-101.
140. Silay, M.S. and C. Miroglu, The risk of urolithiasis recurrence may be reduced
with anti-nanobacterial therapy. Medical hypotheses, 2007. 68(6): p. 1348-1350.
141. Lamas, G.A. and S.J. Hussein, EDTA chelation therapy meets evidence-based
medicine. Complementary Therapies in Clinical Practice, 2006. 12(3): p. 213-215.
142. Clarke, N.E., C.N. Clarke, and R.E. Mosher, Treatment of angina pectoris with
disodium ethylene diamine tetraacetic acid. The American journal of the medical
sciences, 1956. 232(6): p. 654-666.
143. Robert Jr, C., Agent affecting calcification, Calcium, parathyroid hormone,
calcitonin, vitamin D and other compound. Goodman Gillman’s the
pharmacological basis of therapeutics. 7th ed. New York: Macmillan Publishing
Co, 1980: p. 1496-522.
188
144. Sucu, N., et al., Two stage EDTA anti-calcification method for bioprosthetic heart
valve materials. Medical science monitor: international medical journal of
experimental and clinical research, 2006. 12(6): p. MT33-8.
145. Trevor, A.J., B.G. Katzung, and S.B. Masters, Katzung & Trevor's Pharmacology
Examination and Board Review. 2007: McGraw-Hill Education.
146. Saxena, G. and S. Flora, Lead‐ induced oxidative stress and hematological
alterations and their response to combined administration of calcium disodium
EDTA with a thiol chelator in rats. Journal of biochemical and molecular
toxicology, 2004. 18(4): p. 221-233.
147. Leckie, W. and S. Tompsett, The diagnostic and therapeutic use of edathamil
calcium disodium (EDTA, Versene) in excessive inorganic lead absorption. QJM,
1958. 27(1): p. 65-82.
148. Hayden, M.R., et al., Vascular ossification–calcification in metabolic syndrome,
type 2 diabetes mellitus, chronic kidney disease, and calciphylaxis–calcific
uremic arteriolopathy: the emerging role of sodium thiosulfate. Cardiovascular
diabetology, 2005. 4(1): p. 4.
149. Dickey, D.T., et al., Protection against cisplatin-induced toxicities by N-
acetylcysteine and sodium thiosulfate as assessed at the molecular, cellular, and
in vivo levels. Journal of Pharmacology and Experimental Therapeutics, 2005.
314(3): p. 1052-1058.
150. Pouyatos, B., et al., Oxidative stress pathways in the potentiation of noise-induced
hearing loss by acrylonitrile. Hearing research, 2007. 224(1): p. 61-74.
151. Hayden, M.R., et al., Calciphylaxis: calcific uremic arteriolopathy and the
emerging role of sodium thiosulfate. International urology and nephrology, 2008.
40(2): p. 443-451.
152. Caravan, P., et al., Gadolinium (III) chelates as MRI contrast agents: structure,
dynamics, and applications. Chemical reviews, 1999. 99(9): p. 2293-2352.
153. Brown, M.A., A. Paulenova, and A.V. Gelis, Aqueous complexation of thorium
(IV), uranium (IV), neptunium (IV), plutonium (III/IV), and cerium (III/IV) with
DTPA. Inorganic chemistry, 2012. 51(14): p. 7741-7748.
154. Goldman, M. and J.C. Dacre, Lewisite: its chemistry, toxicology, and biological
effects, in Reviews of environmental contamination and toxicology. 1989,
Springer. p. 75-115.
155. Archbold, G., R.M. McGuckin, and N. Campbell, Dimercaptosuccinic acid
loading test for assessing mercury burden in healthy individuals. Annals of
clinical biochemistry, 2004. 41(3): p. 233-236.
156. Aposhian, H.V. and M.M. Aposhian, Meso-2, 3-dimercaptosuccinic acid:
chemical, pharmacological and toxicological properties of an orally effective
metal chelating agent. Annual review of pharmacology and toxicology, 1990.
30(1): p. 279-306.
157. Gonzalez-Ramirez, D., et al., DMPS (2, 3-dimercaptopropane-1-sulfonate,
dimaval) decreases the body burden of mercury in humans exposed to mercurous
chloride. Journal of Pharmacology and Experimental Therapeutics, 1998. 287(1):
p. 8-12.
189
158. Peisach, J. and W. Blumberg, A mechanism for the action of penicillamine in the
treatment of Wilson’s disease. Molecular pharmacology, 1969. 5(2): p. 200-209.
159. Moeschlin, S. and U. Schnider, Treatment of primary and secondary
haemochromatosis and acute iron poisoning with a new, potent iron-eliminating
agent (desferrioxamine B), in Iron Metabolism. 1964, Springer. p. 525-550.
160. Westlin, W.F., Deferoxamine in the Treatment of Acute Iron Poisoning Clinical
Experiences with 172 Children. Clinical pediatrics, 1966. 5(9): p. 531-535.
161. Halstead, B.W., The scientific basis of EDTA chelation therapy. 1979: Golden
Quill Publishers.
162. Rozema, T.C., The protocol for the safe and effective administration of EDTA and
other chelating agents for vascular disease, degenerative disease, and metal
toxicity. Journal of Advancement in Medicine, 1997. 10(1): p. 5-100.
163. Singla, A. and C.H. Lee, Inhibition of CEM calcification by the sequential
pretreatment with ethanol and EDTA. Journal of Biomedical Materials Research
Part A, 2003. 64(4): p. 706-713.
164. Sucu, N., et al., The effect of ethylenediaminetetraacetic acid on calcific
degeneration in bovine pericardium. Heart and vessels, 2004. 19(2): p. 89-93.
165. O'Brien, S., et al., Chelation therapy in the JCR: LA-cp rat: experimental
assessment of a putative antiatherosclerotic treatment. Clinical and investigative
medicine. Medecine clinique et experimentale, 2000. 23(2): p. 124-131.
166. O’Neill, W.C. and K.I. Hardcastle, The chemistry of thiosulfate and vascular
calcification. Nephrology Dialysis Transplantation, 2012. 27(2): p. 521-526.
167. Clarke Sr, N.E., Atherosclerosis, occlusive vascular disease and EDTA. The
American journal of cardiology, 1960. 6(2): p. 233-236.
168. Rudolph, C., E. McDonagh, and R. Barber, A non-surgical approach to
obstructive carotid stenosis using EDTA chelation. J Adv Med, 1991. 4(3): p.
157.
169. Hancke, C. and K. Flytlie, Benefits of EDTA chelation therapy in arteriosclerosis:
a retrospective study of 470 patients. Journal of Advancement in Medicine, 1993.
6(3): p. 161-171.
170. Shoskes, D.A., K.D. Thomas, and E. Gomez, ANTI-NANOBACTERIAL
THERAPY FOR MEN WITH CHRONIC PROSTATITIS/CHRONIC PELVIC
PAIN SYNDROME AND PROSTATIC STONES: PRELIMINARY EXPERIENCE.
The Journal of Urology, 2005. 173(2): p. 474-477.
171. Cacchio, A., et al., Effectiveness of treatment of calcific tendinitis of the shoulder
by disodium EDTA. Arthritis Care & Research, 2009. 61(1): p. 84-91.
172. Cranton, E.M., A textbook on EDTA chelation therapy. 2001: Hampton Roads
Publishing.
173. Soffer, A., Chelation therapy for cardiovascular disease. Chelation Therapy,
Springfield, Illinois, Charles C. Thomas, 1964: p. 15-33.
174. Fraker, T.D. and S.D. Fihn, 2007 Chronic Angina Focused Update of the
ACC/AHA 2002 Guidelines for the Management of Patients With Chronic Stable
AnginaA Report of the American College of Cardiology/American Heart
Association Task Force on Practice Guidelines Writing Group to Develop the
190
Focused Update of the 2002 Guidelines for the Management of Patients With
Chronic Stable Angina. Journal of the American College of Cardiology, 2007.
50(23): p. 2264-2274.
175. Jackson, G., Chelation therapy is TACT‐less. International Journal of Clinical
Practice, 2008. 62(12): p. 1821-1822.
176. Atwood IV, K.C., et al., Why the NIH Trial to Assess Chelation Therapy (TACT)
should be abandoned. The Medscape Journal of Medicine, 2008. 10(5): p. 115.
177. Jo̸rgensen, B., et al., Femoral artery recanalisation with percutaneous
angioplasty and segmentally enclosed plasminogen activator. The Lancet, 1989.
333(8647): p. 1106-1108.
178. Ikeno, F., et al., Novel percutaneous adventitial drug delivery system for regional
vascular treatment. Catheterization and cardiovascular interventions, 2004. 63(2):
p. 222-230.
179. Villa, A.E., et al., Local delivery of dexamethasone for prevention of neointimal
proliferation in a rat model of balloon angioplasty. Journal of Clinical
Investigation, 1994. 93(3): p. 1243.
180. Yamawaki-Ogata, A., et al., A doxycycline loaded, controlled-release,
biodegradable fiber for the treatment of aortic aneurysms. Biomaterials, 2010.
31(36): p. 9554-9564.
181. Valéro, F., et al., Intramural injection of biodegradable microspheres as a local
drug-delivery system to inhibit neointimal thickening in a rabbit model of balloon
angioplasty. Journal of cardiovascular pharmacology, 1998. 31(4): p. 513-519.
182. Westedt, U., et al., Deposition of nanoparticles in the arterial vessel by porous
balloon catheters: localization by confocal laser scanning microscopy and
transmission electron microscopy. AAPS PharmSci, 2002. 4(4): p. 206-211.
183. Elzoghby, A.O., W.M. Samy, and N.A. Elgindy, Albumin-based nanoparticles as
potential controlled release drug delivery systems. Journal of Controlled Release,
2012. 157(2): p. 168-182.
184. Tantra, R., J. Tompkins, and P. Quincey, Characterisation of the de-
agglomeration effects of bovine serum albumin on nanoparticles in aqueous
suspension. Colloids and Surfaces B: Biointerfaces, 2010. 75(1): p. 275-281.
185. Kratz, F., Albumin as a drug carrier: design of prodrugs, drug conjugates and
nanoparticles. Journal of Controlled Release, 2008. 132(3): p. 171-183.
186. Langer, K., et al., Optimization of the preparation process for human serum
albumin (HSA) nanoparticles. International journal of pharmaceutics, 2003.
257(1): p. 169-180.
187. Patil, G.V., Biopolymer albumin for diagnosis and in drug delivery. Drug
development research, 2003. 58(3): p. 219-247.
188. Yu, S., et al., Nanogels prepared by self‐ assembly of oppositely charged
globular proteins. Biopolymers, 2006. 83(2): p. 148-158.
189. Lee, S.H., et al., Nano spray drying: a novel method for preparing protein
nanoparticles for protein therapy. International journal of pharmaceutics, 2011.
403(1): p. 192-200.
191
190. Desai, N., Nanoparticle albumin bound (< i> nab</i>) technology: targeting
tumors through the endothelial gp60 receptor and SPARC. Nanomedicine:
Nanotechnology, Biology and Medicine, 2007. 3(4): p. 339.
191. Xu, R., M. Fisher, and R. Juliano, Targeted albumin-based nanoparticles for
delivery of amphipathic drugs. Bioconjugate chemistry, 2011. 22(5): p. 870-878.
192. Merodio, M., et al., Ganciclovir-loaded albumin nanoparticles: characterization
and in vitro release properties. European journal of pharmaceutical sciences,
2001. 12(3): p. 251-259.
193. Segura, S., et al., Gamma interferon loaded onto albumin nanoparticles: in vitro
and in vivo activities against Brucella abortus. Antimicrobial agents and
chemotherapy, 2007. 51(4): p. 1310-1314.
194. Das, S., R. Banerjee, and J. Bellare, Aspirin loaded albumin nanoparticles by
coacervation: implications in drug delivery. Trends Biomater Artif Organs, 2005.
18(2): p. 203-212.
195. Wagner, S., et al., Enhanced drug targeting by attachment of an anti αv integrin
antibody to doxorubicin loaded human serum albumin nanoparticles.
Biomaterials, 2010. 31(8): p. 2388-2398.
196. Löw, K., et al., Targeted human serum albumin nanoparticles for specific uptake
in EGFR-Expressing colon carcinoma cells. Nanomedicine: Nanotechnology,
Biology and Medicine, 2011. 7(4): p. 454-463.
197. Bini, A., et al., Noncollagenous Bone Matrix Proteins, Calcification, and
Thrombosis in Carotid Artery Atherosclerosis. Arteriosclerosis, thrombosis, and
vascular biology, 1999. 19(8): p. 1852-1861.
198. Dhore, C.R., et al., Differential Expression of Bone Matrix Regulatory Proteins in
Human Atherosclerotic Plaques. Arteriosclerosis, thrombosis, and vascular
biology, 2001. 21(12): p. 1998-2003.
199. Basalyga, D.M., et al., Elastin Degradation and Calcification in an Abdominal
Aorta Injury Model: Role of Matrix Metalloproteinases. Circulation, 2004.
110(22): p. 3480-3487.
200. Lee, J.S., et al., Elastin Calcification in the Rat Subdermal Model Is Accompanied
by Up-Regulation of Degradative and Osteogenic Cellular Responses. The
American journal of pathology, 2006. 168(2): p. 490-498.
201. Stegemann, J.P. and R.M. Nerem, Altered response of vascular smooth muscle
cells to exogenous biochemical stimulation in two-and three-dimensional culture.
Experimental cell research, 2003. 283(2): p. 146-155.
202. Mavrilas, D., et al., Development of bioprosthetic heart valve calcification in vitro
and in animal models: morphology and composition. Journal of Crystal Growth,
1999. 205(4): p. 554-562.
203. Simionescu, A., D.T. Simionescu, and N.R. Vyavahare, Osteogenic Responses in
Fibroblasts Activated by Elastin Degradation Products and Transforming Growth
Factor-β1: Role of Myofibroblasts in Vascular Calcification. The American
journal of pathology, 2007. 171(1): p. 116-123.
204. Low, R.B., et al., Age dependence of smooth muscle myosin expression by
cultured rat aortic smooth muscle cells. Differentiation, 1999. 65(3): p. 151-159.
192
205. Agung, M., et al., Mobilization of bone marrow-derived mesenchymal stem cells
into the injured tissues after intraarticular injection and their contribution to
tissue regeneration. Knee Surgery, Sports Traumatology, Arthroscopy, 2006.
14(12): p. 1307-1314.
206. Zhang, M., et al., IGF-1 regulation of type II collagen and MMP-13 expression in
rat endplate chondrocytes< i> via</i> distinct signaling pathways. Osteoarthritis
and Cartilage, 2009. 17(1): p. 100-106.
207. Livak, K.J. and T.D. Schmittgen, Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2< sup>− ΔΔCT</sup> Method.
methods, 2001. 25(4): p. 402-408.
208. Steitz, S.A., et al., Smooth Muscle Cell Phenotypic Transition Associated With
Calcification: Upregulation of Cbfa1 and Downregulation of Smooth Muscle
Lineage Markers. Circulation Research, 2001. 89(12): p. 1147-1154.
209. Giachelli, C.M., et al., Regulation of Vascular Calcification: Roles of Phosphate
and Osteopontin. Circulation Research, 2005. 96(7): p. 717-722.
210. Franceschi, R.T., The Developmental Control of Osteoblast-Specific Gene
Expression: Role of Specific Transcription Factors and the Extracellular Matrix
Environment. Critical Reviews in Oral Biology & Medicine, 1999. 10(1): p. 40-
57.
211. Ducy, P., et al., Osf2/Cbfa1: A Transcriptional Activator of Osteoblast
Differentiation. Cell, 1997. 89(5): p. 747-754.
212. Simionescu, A., K. Philips, and N. Vyavahare, Elastin-derived peptides and TGF-
β1 induce osteogenic responses in smooth muscle cells. Biochemical and
Biophysical Research Communications, 2005. 334(2): p. 524-532.
213. Oshima, A., et al., A novel mechanism for the regulation of osteoblast
differentiation: Transcription of periostin, a member of the fasciclin I family, is
regulated by the bHLH transcription factor, twist. Journal of Cellular
Biochemistry, 2002. 86(4): p. 792-804.
214. Demer, L.L. and Y. Tintut, Vascular Calcification: Pathobiology of a
Multifaceted Disease. Circulation, 2008. 117(22): p. 2938-2948.
215. Jono, S., et al., Phosphate Regulation of Vascular Smooth Muscle Cell
Calcification. Circulation Research, 2000. 87(7): p. e10-e17.
216. Neven, E., et al., Endochondral bone formation is involved in media calcification
in rats and in men. Kidney international, 2007. 72(5): p. 574-581.
217. Shao, J.-S., et al., Msx2 promotes cardiovascular calcification by activating
paracrine Wnt signals. Journal of Clinical Investigation, 2005. 115(5): p. 1210-
1220.
218. Towler, D.A., Angiogenesis and marrow stromal cell fates: roles in bone
strength. Osteoporosis international, 2003. 14(5): p. 46-53.
219. Chen, N.X., et al., High glucose increases the expression of Cbfa1 and BMP-2
and enhances the calcification of vascular smooth muscle cells. Nephrology
Dialysis Transplantation, 2006. 21(12): p. 3435-3442.
220. Urry, D.W., Neutral Sites for Calcium Ion Binding to Elastin and Collagen: A
Charge Neutralization Theory for Calcification and Its Relationship to
193
Atherosclerosis. Proceedings of the National Academy of Sciences, 1971. 68(4):
p. 810-814.
221. Price, P.A., et al., The Elastic Lamellae of Devitalized Arteries Calcify When
Incubated in Serum: Evidence for a Serum Calcification Factor. Arteriosclerosis,
thrombosis, and vascular biology, 2006. 26(5): p. 1079-1085.
222. Khavandgar, Z., et al., Elastin haploinsufficiency impedes the progression of
arterial calcification in MGP‐deficient mice. Journal of Bone and Mineral
Research, 2013.
223. Villa-Bellosta, R., A. Millan, and V. Sorribas, Role of calcium-phosphate
deposition in vascular smooth muscle cell calcification. American Journal of
Physiology - Cell Physiology, 2011. 300(1): p. C210-C220.
224. Hoang, Q.Q., et al., Bone recognition mechanism of porcine osteocalcin from
crystal structure. nature, 2003. 425(6961): p. 977-980.
225. Reinholt, F.P., et al., Osteopontin--a possible anchor of osteoclasts to bone.
Proceedings of the National Academy of Sciences, 1990. 87(12): p. 4473-4475.
226. Speer, M.Y. and C.M. Giachelli, Regulation of cardiovascular calcification.
Cardiovascular Pathology, 2004. 13(2): p. 63-70.
227. Lei, Y., et al., Efficacy of Reversal of Aortic Calcification by Chelating Agents.
Calcified Tissue International, 2013: p. 1-10.
228. Liu, Y., et al., Cortistatin attenuates vascular calcification in rats. Regulatory
Peptides, 2010. 159(1-3): p. 35-43.
229. Shanahan, C.M., et al., Medial Localization of Mineralization-Regulating
Proteins in Association With Mönckeberg’s Sclerosis: Evidence for Smooth
Muscle Cell–Mediated Vascular Calcification. Circulation, 1999. 100(21): p.
2168-2176.
230. Lamas Ga, G.C.B.R. and et al., Effect of disodium edta chelation regimen on
cardiovascular events in patients with previous myocardial infarction: The tact
randomized trial. JAMA, 2013. 309(12): p. 1241-1250.
231. Partridge, S. and F. Keeley, Age related and atherosclerotic changes in aortic
elastin, in Arterial Mesenchyme and Arteriosclerosis. 1974, Springer. p. 173-191.
232. Vyavahare, N., et al., Elastin calcification and its prevention with aluminum
chloride pretreatment. The American journal of pathology, 1999. 155(3): p. 973-
982.
233. Labhasetwar, V., C. Song, and R.J. Levy, Nanoparticle drug delivery system for
restenosis. Advanced Drug Delivery Reviews, 1997. 24(1): p. 63-85.
234. Cagnasso, C.E., et al., Development and validation of a method for the
determination of EDTA in non-alcoholic drinks by HPLC. Journal of Food
Composition and Analysis, 2007. 20(3–4): p. 248-251.
235. Basalyga, D.M., et al., Elastin Degradation and Calcification in an Abdominal
Aorta Injury Model. Circulation, 2004. 110(22): p. 3480-3487.
236. Pasch, A., et al., Sodium thiosulfate prevents vascular calcifications in uremic
rats. Kidney Int, 2008. 74(11): p. 1444-1453.
194
237. Postnov, A.A., et al., Possibilities and limits of X-ray microtomography for in
vivo and ex vivo detection of vascular calcifications. The International Journal of
Cardiovascular Imaging, 2009. 25(6): p. 615-624.
238. C Cavallotti, F.M.T.L., M Artico, Experimental calcification of the aorta in
rabbits: Effects of chelating agents and glucagon. Journal of Laboratory Animal
Science, 2004. 31(4): p. 215-219.
239. Persy, V., et al., High-Resolution X-Ray Microtomography Is a Sensitive Method
to Detect Vascular Calcification in Living Rats With Chronic Renal Failure.
Arteriosclerosis, thrombosis, and vascular biology, 2006. 26(9): p. 2110-2116.
240. Lamas, G.A., et al., Design of the Trial to Assess Chelation Therapy (TACT).
American Heart Journal, 2012. 163(1): p. 7-12.
241. Waters, R.S., et al., EDTA chelation effects on urinary losses of cadmium,
calcium, chromium, cobalt, copper, lead, magnesium, and zinc. Biological trace
element research, 2001. 83(3): p. 207-221.
242. Shroff, R.C. and C.M. Shanahan. Vascular calcification in patients with kidney
disease: The vascular biology of calcification. in Seminars in dialysis. 2007:
Wiley Online Library.
243. Hanken, J. and R. Wassersug, A new double-stain technique reveals the nature of
the hard tissues. Funct. Photog, 1981. 16: p. 22-26.
244. Rosa-Molinar, E., et al., Whole-mount procedures for simultaneous visualization
of nerves, neurons, cartilage and bone. Brain Research Protocols, 1999. 4(2): p.
115-123.
245. Foreman, H. and T. Trujillo, The metabolism of C14 labeled
ethylenediaminetetraacetic acid in human beings. The Journal of laboratory and
clinical medicine, 1954. 43(4): p. 566.
246. Lamas, G.A., et al., Effect of disodium edta chelation regimen on cardiovascular
events in patients with previous myocardial infarction: The tact randomized trial.
JAMA, 2013. 309(12): p. 1241-1250.
247. Hawkins, M.J., P. Soon-Shiong, and N. Desai, Protein nanoparticles as drug
carriers in clinical medicine. Advanced drug delivery reviews, 2008. 60(8): p.
876-885.
248. Wartlick, H., et al., Highly specific HER2-mediated cellular uptake of antibody-
modified nanoparticles in tumour cells. Journal of drug targeting, 2004. 12(7): p.
461-471.
249. Cagnasso, C.E., et al., Development and validation of a method for the
determination of EDTA in non-alcoholic drinks by HPLC. Journal of Food
Composition and Analysis, 2007. 20(3): p. 248-251.
250. Sivaraman, B. and A. Ramamurthi, Multifunctional nanoparticles for doxycycline
delivery towards localized elastic matrix stabilization and regenerative repair.
Acta biomaterialia, 2013. 9(5): p. 6511-6525.
251. Song, C., et al., Arterial uptake of biodegradable nanoparticles for intravascular
local drug delivery: results with an acute dog model. Journal of Controlled
Release, 1998. 54(2): p. 201-211.
195
252. Cho, E.C., et al., The Effects of Size, Shape, and Surface Functional Group of
Gold Nanostructures on Their Adsorption and Internalization by Cells. Small,
2010. 6(4): p. 517-522.
253. Schrama, D., R.A. Reisfeld, and J.C. Becker, Antibody targeted drugs as cancer
therapeutics. Nature Reviews Drug Discovery, 2006. 5(2): p. 147-159.
254. Kaminski, M.S., et al., Radioimmunotherapy of B-cell lymphoma with [131I] anti-
B1 (anti-CD20) antibody. New England Journal of Medicine, 1993. 329(7): p.
459-465.
255. Lessner, S.M., et al., Atherosclerotic lesions grow through recruitment and
proliferation of circulating monocytes in a murine model. The American journal
of pathology, 2002. 160(6): p. 2145-2155.
196
SUPPLEMENTAL FILES
Supplemental videos online：
1) Micro CT for rat aortas of 2 groups (Saline and HD EDTA).
2) Micro CT rat femoral bone of 2 groups (Saline and HD EDTA).
3) Three points bending test.
4) Micro CT for rat aortas of 5 groups (Saline, HD EDTA, LD EDTA, IgG-
NPs/EDTA, and EL-NPs/EDTA).
5) Micro CT rat femoral bone of 5 groups (Saline, HD EDTA, LD EDTA, IgG-
NPs/EDTA, and EL-NPs/EDTA).