Md

PJa

Ab

c

d

e

a

ARR2AA

KMBPMPGF

1

sto[dtmwaacp

oof

0d

Reproductive Toxicology 33 (2012) 374– 381

Contents lists available at SciVerse ScienceDirect

Reproductive Toxicology

journa l h o me pag e: www.elsev ier .com/ locate / reprotox

aternal undernutrition reduces P-glycoprotein in guinea pig placenta andeveloping brain in late gestation

oh S. Sooa, Jennifer Hiscockb, Kimberley J. Bottinga,c, Claire T. Robertsd, Andrew K. Daveyb,e,anna L. Morrisona,c,∗

Early Origins of Adult Health Research Group, School of Pharmacy and Medical Sciences, Sansom Institute for Health Research, University of South Australia, Adelaide, SA 5001,ustraliaSchool of Pharmacy and Medical Science, University of South Australia, Adelaide, SA 5001, AustraliaDiscipline of Physiology, School of Medical Sciences, Faculty of Health Sciences, The University of Adelaide, Adelaide, SA 5005, AustraliaDiscipline of Obstetrics and Gynaecology, School of Paediatrics and Reproductive Health, University of Adelaide, SA 5005, AustraliaSchool of Pharmacy & Research Centre for the Molecular Basis of Disease, Griffith Health Institute, Griffith University, Gold Coast, Queensland 4222, Australia

r t i c l e i n f o

rticle history:eceived 28 September 2011eceived in revised form3 December 2011ccepted 31 January 2012vailable online 9 February 2012

eywords:

a b s t r a c t

Poor nutrition is a major cause of fetal growth restriction which increases neonatal morbidity and mor-tality, as well as the risk of adult onset diseases. The objective of the study was to determine the effectof maternal undernutrition on P-glycoprotein (P-gp) expression in the placenta and the brain of boththe mother and the fetus. Maternal undernutrition in guinea pigs caused placental restriction, and thusdecreased fetal weight. Pups in the maternal undernutrition (UN) group had fewer capillaries in theplacenta and more capillaries in the brain of the fetus. Placental, maternal and fetal brain MDR1 mRNAexpression was the same in the Control and UN groups. Maternal undernutrition resulted in a significant

aternal undernutritionlood–brain barrier-glycoproteinDR1

lacenta

decrease in P-gp protein expression in the placenta and fetal brain, but not the maternal brain. Thesefindings indicate that maternal undernutrition may impact on fetal exposure to drugs administered tothe mother during pregnancy due to changes in placental transfer.

© 2012 Elsevier Inc. All rights reserved.

uinea pigetus

. Introduction

In Australia, approximately 96% of pregnant women use pre-cription and over-the-counter drugs [1]. Drugs administered tohe mother can, to varying degrees, cross the placenta dependingn their structure, lipid solubility, polarity and molecular weight2,3]. These drugs, however, may be recognised as xenobiotics byrug transporters present in the placenta which then act to limitheir entry into the fetal compartment. One of the most com-

only studied drug transporters is P-glycoprotein (P-gp). P-gp isidely expressed in tissues such as gut, liver, kidney, brain and

drenal gland [4]. P-gp acts as an efflux transporter to drugs that

re amphipathic and lipophilic which include synthetic glucocorti-oids (dexamethasone and betamethasone), which are commonlyrescribed to pregnant women at risk of threatened preterm labour

∗ Corresponding author at: Early Origins of Adult Health Research Group, Schoolf Pharmacy and Medical Sciences, Sansom Institute for Health Research, Universityf South Australia, GPO Box 2471, Adelaide, SA 5001, Australia. Tel.: +61 8 8302 2166;ax: +61 8 8302 2389.

E-mail address: Janna.Morrison@unisa.edu.au (J.L. Morrison).

890-6238/$ – see front matter © 2012 Elsevier Inc. All rights reserved.oi:10.1016/j.reprotox.2012.01.013

[5,6]. P-gp is present in the endothelial cells of the blood–brainbarrier and trophoblast cells of the placenta where it regulatesthe transport of a range of exogenous and endogenous substances[4,7].

P-gp in the placenta serves as the first line of defence againstfetal exposure to endogenous and exogenous substances from thematernal circulation. P-gp is a ATP-dependant efflux pump encodedby the multi-drug resistance 1 (MDR1) gene. In pregnant micelacking MDR1 transporters in the placenta, the fetuses were moresusceptible to teratogenic substances, even in small concentrations,because of increased transfer of drugs that P-gp would normallyremove from the fetal circulation [8,9]. The ability of P-gp to protectthe fetus from drugs and other xenobiotics can vary during gesta-tion. Recent studies in human, mouse and guinea pig have shownthat MDR1 gene expression in the placenta decreases with increas-ing gestational age [10–12]. Conversely, in the rat an increase inplacental MDR1 has been observed with increasing gestational age[13]. The potential effect of these changes in P-gp expression cou-

pled with a low nutrition environment during pregnancy has notbeen evaluated.

Small-for-gestational (SGA) babies are at a greater risk of neona-tal complications and diseases in adult life such as cardiovascular

e Toxi

dursbhIatttpPwitisteb

2

2

CwIsi

Mwtbt3ooci

2

wLoseRwfiplt

2

2

p4iSfC

P.S. Soo et al. / Reproductiv

isease and metabolic syndrome [14,15]. In addition, SGA fetusesndergo a range of neuroendocrine and cardiovascular changes inesponse to a reduction in substrate supply [16]. Notably, brainparing (maintained brain growth despite a reduction in overallody growth) has been observed in SGA babies, but no studiesave investigated the impact of SGA on brain drug transporters.

n addition to its role in the placenta, P-gp has been shown to ben important component in protecting the brain from exposureo toxic xenobiotics [17]. These babies are likely to be exposedo drugs that would normally be removed by P-gp, such as syn-hetic glucocorticoids for lung development in cases of threatenedreterm labour. It is known that some drugs that are extruded by-gp, such as synthetic glucocorticoids, are themselves associatedith lower birth weight [18]. If P-gp in the blood–brain barrier

s affected by SGA, this has implications in terms of the potentialoxicity of drugs used in the management of the condition. Thempact of reduced oxygen and/or nutrient supply on P-gp expres-ion in the placenta and blood–brain barrier is unknown. Thereforehe aim of this study was to determine the impact of UN on P-gpxpression in the placenta and the maternal and fetal blood–brainarrier.

. Materials and methods

.1. Animals and feeding regimen

All experiments were conducted with the approval of the IMVS Animal Ethicsommittee. Adult female IMVS/Dunkin Hartley guinea pigs entered the study at aeight of 350–400 g. The animals were fed standard guinea pig/rabbit chow (Milling

ndustries Stockfeeds, Murray Bridge, South Australia) with free access to tap waterupplemented with Vitamin C (400 mg/l) [19]. The animals were housed individuallyn cages in a 12/12 light/dark cycle and an ambient temperature of 21 ◦C.

Female guinea pigs were randomly assigned to either the Control (n = 6) oraternal Undernutrition (UN; n = 7) groups. Control animals were fed ad libitumith standard laboratory chow (Laucke Mills, Daveyston, Australia). The animals in

he UN group received 85% of the average daily ad libitum food intake per kilogramody weight of the Controls for an average of 151 ± 15 d prior to conception andhroughout pregnancy. Food intake and body weight of each animal was monitored

times weekly before and after conception. Guinea pigs were given a set amountf food on each of these days and the remaining food was weighed on the followingccasion. Guinea pigs were also weighed on each of these occasions to allow for thealculation of weight gain. The food intake per gram of body weight was determinedn Control guinea pigs using the following equation [20]:

Feed intake per gram of body weight

= amount of food allocated − amount of food remainingguinea pig body weight

.2. Post mortem and tissue collection

Pregnant dams were humanely killed at 60–62 days gestation (term, 68 days)ith an overdose of sodium pentobarbitone (325 mg/ml, Virbac (Australia) Pty.

td., Peakhurst, Australia). The uterus was removed and the first fetus at the tipf the right horn of the uterus was designated fetus A, the next was fetus B ando on depending on the number of pups in the litter. The placenta and brain ofach fetus and the maternal brain were dissected, weighed and then stored inNALater (20 mM EDTA, 25 mM sodium citrate, 5.3 M ammonium sulphate in MQater) at −20 ◦C for gene and protein expression (Pup A). Pup B was perfusionxed through the aorta with 4% formaldehyde then stored in freshly prepared 4%araformaldehyde in 0.1 M phosphate buffer for subsequent processing and histo-

ogical analyses. Tissue was collected from Pups C and D (if present) but not used inhis study.

.3. Placental and brain capillarisation and P-gp protein expression

.3.1. Placental capillarisationTo differentiate between fetal capillaries, maternal blood space and tro-

hoblasts, one randomly selected paraffin embedded placental section (4 �m) from

Control and 6 UN (Pup B) pups was dewaxed and subjected to antigen retrieval by

ncubating the section in 0.03% protease (Sigma, St. Louis, USA) for 15 min at 37 ◦C.ections were then blocked for endogenous peroxidase activity with 3% H2O2 andor non-specific antibody binding with protein blocking serum (Vector, Burlingame,A, USA) for 30 min each. Human vimentin (3B4, Dako, Denmark) and human pan

cology 33 (2012) 374– 381 375

cytokeratin (C2562, Sigma, St. Louis, USA) primary antibodies were used to iden-tify fetal capillaries and trophoblast, respectively [21]. The placental section wasfirst incubated with 1:50 mouse anti vimentin diluted with 10% guinea pig serumand 1% bovine serum albumin overnight at room temperature (RT). After washingthree times in PBS, sections were incubated with 1:500 biotinylated goat anti-mouse secondary anti IgG F(ab′)2 fragment (Dako, Denmark) for 30 min, followedby PBS washes. The strepavidin–peroxidase label (Zymed, San Francisco, USA) wasapplied for 30 min. The sections were washed with PBS as above and incubated withdiaminobenzidine with 2% ammonium nickel (II) sulphate (Sigma, St. Louis, USA) for10 min. The same process was then used for the second antibody (anti-cytokeratin)but the chromogen step did not include nickel leaving a brown precipitate. Lastly,the section was treated with haematoxylin and red cytoplasmic staining. A negativecontrol was similarly treated without applying primary antibody [21]. Measurementof volume densities (proportions) of trophoblasts, fetal capillaries and maternalblood space within the labyrinth of the placenta were calculated using the followingformula:

Volume density, Vd = PaPT

where Pa is the total number of points falling on that component and PT is thetotal number of points applied to the section [21,22]. The volume of trophoblasts,fetal capillaries and maternal blood space were determined by multiplying Vd byplacental weight. The assessor was blinded to treatment groups.

2.3.2. Brain capillarisationCapillaries were identified by staining brain sections with haematoxylin and

eosin and viewed with an Olympus CX40 light microscope with a Video Image Anal-ysis system (Soft Imaging Solutions, Münster, Germany). An area in the anteriorcerebral cortex was chosen at random to determine the proportion of capillaries inthe brain using point counting as above [21,22].

2.3.3. Placental and brain P-gp protein expressionParaffin embedded brain and placenta sections were dewaxed and treated with

antigen retrieval [10 min in 10 mM Citrate buffer (pH 6.0)] prior to the immunohis-tochemical procedure [23]. Following three washes in PBS, sections were incubatedwith 10% normal donkey serum (Sigma–Aldrich, Missouri, USA) to reduce non-specific binding, then followed by overnight incubation with mouse monoclonalanti-C219 primary antibody (1:20; Covance Research Products, Denver, PA) at 4 ◦C.Sections were washed three times in PBS, placed in 3% H2O2 (15 min) and then incu-bated with biotinylated donkey anti mouse IgG (1:200; Jackson ImmunoResearchLab Inc., West Grove, PA) for 2 h followed by 1 h in CY-3 Streptavidin (1:500; JacksonImmunoResearch Lab Inc., West Grove, PA). Negative controls, which excluded anti-C219, were similarly treated. Photomicrographs were obtained by viewing with aLeica SP5 confocal microscope using the 561 nm argon ion laser for excitation. A z-series of each capillary was obtained at 0.5 �m intervals using the 63× objective at2× zoom; photographs were composite of the 18–22 optical sections using AnalySIS(Soft Imaging Solutions, Münster, Germany).

2.4. Placental and brain MDR1 gene expression

2.4.1. RNA extraction and cDNA synthesisRNA was extracted and purified from 50 to 100 mg (Control = 6; UN = 7; Pup A)

of placenta and cerebral cortex of the brain, because MDR1 is located in trophoblastcells of the former, and endothelial cells of the latter [24,25], using Trizol reagent(Invitrogen Life Technologies, USA) and purified using the RNeasy Mini Kit (QIAGENPty Ltd.-Australia, Doncaster, Australia) according to the manufacturer’s protocol.The purity and concentration of RNA was measured at 260 and 280 nm using aspectrophotometer and the integrity of the RNA was determined using agarose gelelectrophoresis. The cDNA was synthesised using Superscript III (Invitrogen, USA)reverse transcription.

2.4.2. Quantitative real time reverse transcription-PCR (qRT-PCR)Initially, gene expression of 6 housekeeping genes (18S, B2M, �-actin,

Cyclophilin, RpP0 and Ywhaz) was studied to determine a set of housekeepinggenes with minimal variability under our different experimental conditions. ThegeNorm [26] component of qbaseplus 2.0 [http://www.qbaseplus.com] [27] was usedto determine the most stable reference genes and the minimum number requiredto calculate a stable normalisation factor. The 3 housekeeping genes were deter-mined to be the most suitable reference genes (B2M, Ywhaz and Cyclophilin) anda normalisation factor was calculated on the geometric mean of the Ct value ofthese genes against which our genes of interest were normalised using qbaseplus.The expression of MDR1 mRNA was determined in the placenta and the brains offetuses and dams using the ViiA7 Sequence Detection System (PE Applied Biosys-tems, Foster City, CA). Primers were designed using the Primer-BLAST software(National Center for Biotechnology Information, USA) and were synthesised by

Geneworks, Australia (Table 1). As the MDR1 sequence for guinea pig has notbeen published, MDR1 mRNA sequence from several species were blasted to theguinea pig genome using Ensembl (http://www.ensembl.org/index.html) to ensureprimers were designed specifically to a complimentary guinea pig MDR1 mRNAsequence. All PCR products were sequenced prior to the experiment to ensure

376 P.S. Soo et al. / Reproductive Toxicology 33 (2012) 374– 381

Table 1Primer sequences used for quantitative Real Time (qRT-PCR).

Gene Forward primer 5′–3′ Reverse primer 5′–3′ Accession number

Multi drug resistance 1(MDR1)

GATTTACACGTGGTTGGAA TTGCAGCTGATAGTCCAAG

18S GCGACGACCCATTCGAACGTCT GCCTGCTGCCTTCCTTGGATGT M11188B2M (beta-2microglobulin)

CCCGTCACCCAGCAGAAAATGG CGACTTCAATCTGGGGTGGATGG NM 001172856.1

RpP0 (acidic ribosomalprotein P0)

CCACCCTGAAGTGCTTGACAT AGGCAGATGGATCAGCCA BT021080

Cyclophilin CCTGCTTTCACAGAATAATTCCA CATTTGCCATGGACAAGATGCCA BC105173Ywhaz (tyrosine 3-monooxygenase/tryptophan5-monooxygenase

CCAAACTGGCCGAGCAGGCT ACCCTCCAAGATGACCTACGGGC BC094305

TCACGATGCCAGTGGTGCGG NM 001172909

tfcwgc

Ggoow

ttwt

Table 2Maternal weight at conception and post mortem, litter number and fetuses age atpost-mortem and maternal brain P-gp gene expression.

Control (n) UN (n)

Maternal weight at conception (g) 856 ± 23 (6) 756 ± 30 (7)*

Maternal weight at post mortem (g) 1165 ± 15 (6) 1016 ± 37 (7)*

Litter size (number of pups) 3.2 ± 0.25 (6) 3.3 ± 0.21 (7)Gestational age at post mortem (days) 61.6 ± 0.16 (6) 61.0 ± 0.31 (7)Brain MDR1 gene expression 2.19 ± 0.34 (6) 2.40 ± 0.53 (7)Brain P-gp expression (OD × 106) 1.53 ± 0.45 (5) 0.99 ± 0.12 (7)

All data are mean ± SEM. Data were analysed using Student’s t-test.

Fi

activation protein, zetapolypeptide)�-Actin (beta-actin) AGCACCCTGTGCTGCTGACG

he authenticity of the DNA product and a qRT-PCR melt curve analysis was per-ormed to demonstrate amplicon homogeneity. The primer concentrations wereonsistent for all genes, and the r2 for the amplification efficiency of all primersas 0.994–0.996 and at least three technical replicates were performed for each

ene. Two quality controls were included on each plate in order to verify inter-plateonsistency.

Each qRT-PCR reaction well (6 �l total volume) contained 3.8 �l of a 2× Sybrreen Master Mix (PE Applied Biosystems, Foster City, CA), 0.6 �l of each primeriving a final concentration of 50 or 450 nM, 0.8 �l of molecular grade H2O and 1 �lf a 30 ng/�l dilution of the stock cDNA. The cycling conditions consisted of 40 cyclesf 95 ◦C for 15 s and 60 ◦C for 1 min. At the end of each run dissociation melt curvesere measured.

The abundance of each mRNA transcript was measured and expression relativeo the 3 most stable housekeeper genes for each organ was calculated accordingo geNorm analysis. The absence of genomic contamination in the extracted RNAas verified by including a control in which no reverse transcriptase was added in

he RT reaction. These samples were subsequently subjected to qRT-PCR in order

ig. 1. Maternal undernutrition results in a smaller placenta (A). There is a significant reln the maternal undernutrition group (C) and they have relatively larger brains (D). Contr

* Significant difference between nutritional groups at 60–62 days gestation,P < 0.05.

ationship between placental weight and fetal body weight (B). Fetuses are smallerol, open bars; maternal undernutrition, filled bars: *P < 0.05.

P.S. Soo et al. / Reproductive Toxi

Fig. 2. Western blot analysis of placental P-gp in Control (open bar) and UN (filledbar) at 60–62 days gestation. P-gp expression was quantified by Western blot-ting with monoclonal C219 antibody. (A) Upper panel: representative immunoblotshowing 170 kDa P-gp bands in guinea pig placenta. (B) Lower panel: P-gp in the UNplacenta was less than Control. Bands were measured in optical density (OD) units.Mean ± SEM; Control, open bars (n = 6); UN, filled bar (n = 7).*P < 0.05.

Fig. 3. Localisation of fetal capillaries, trophoblasts and maternal blood spaces in the pgestation. Representative images of the localisation of P-glycoprotein in the placenta oMagnification 200× (A–D). Scale bar 50 �m (A–D). Note: stereological measurement show

cology 33 (2012) 374– 381 377

to verify that there was no amplification. The Ct value was taken as the loweststatistically significant [>10 standard deviation (SD)] increase in fluorescence abovethe background signal in an amplification reaction.

2.5. Protein extraction and Western blotting for P-gp

In a subset of animals (Control = 6; UN = 7; Pup A), approximately 50–100 mg ofthe placenta and cerebral cortex of the brain were each homogenised with hyper-tonic NP-40 extraction buffer containing 50 mM Tris–HCl (pH = 8), 150 mM sodiumchloride, 1% NP-40, 1 mM sodium orthovanadate, 30 mM sodium fluoride, 10 mMsodium pyrophosphate, 10 mM EDTA and 1 tablet of protease inhibitor (Roche Diag-nostic, Germany). The homogenates were centrifuged at 14,300 × g for 14 min at4 ◦C. The resultant supernatant was used for detection of P-gp. The protein concen-tration was determined by using Micro BCA Protein Assay Kit (Thermo Scientific,USA). Samples were diluted to a concentration of 1 mg/ml in sodium dodecyl sulfate.Coomassie blue, a general protein stain, was applied to a gel to confirm a consistentconcentration of protein for all diluted samples [28].

Twenty microgram of placental and 30 �g of brain protein were added to eachlane and separated by electrophoresis on 10% polyacrylamide SDS gels at 40 Vovernight. Proteins were transferred onto nitrocellulose membrane at 0.8 A for 4 h.The membrane was blocked with 5% bovine serum albumin overnight at 4 ◦C. Afterwashing with TBST, membranes were incubated with mouse monoclonal anti-C219primary antibody (1:500; Covance Research Products, Denver, PA) overnight at4 ◦C. Membranes were then washed and treated with horseradish-labelled goat antimouse IgG antibody (1:2000, Cell Signalling Technology, USA) for 1 h. Immunore-

active bands were visualised by enhanced chemiluminescence (ECL) and the digitalimages were then analysed using ImageQuant LAS 4000 program. This gave a rela-tive protein density for each sample. For each blot, two standards (50 and 100 �g)were loaded to ensure appropriate transfer and that the ECL signal changed in alinear manner [28].

lacenta of Control (A) and maternal undernutrition (B) guinea pigs at 60–62 daysf Control (C) and maternal undernutrition (D) guinea pigs at 60 days gestation.s decrease in maternal blood space not evident from view of tissue.

3 e Toxicology 33 (2012) 374– 381

2

AfCAp

3

3a

ulnCCrsUtca

3U

ddaga(

euwdnT

3i

i(

TEg

A

Fig. 4. Western blot analysis of P-gp in the brain of Control (white bar) and maternalundernutrition (black bar) at 60–62 days gestation. P-gp expression was quantifiedby Western blotting with monoclonal C219 antibody. (A) Upper panel: represen-tative immunoblot showing 170 kDa P-gp bands in guinea pig placenta. (B) Lower

78 P.S. Soo et al. / Reproductiv

.6. Statistical analyses

Data are expressed as mean ± standard error of the mean (SEM). Two wayNOVA (factors: treatment and sex nested for litter) was used to analyse placenta,

etal and maternal body and brain weight data from all animals (Stata 11, Stataorp. LD., Texas, USA). There were no significant sex differences in any experiments.ll other data included only 1 pup from each litter and thus a Student’s t-test waserformed. P < 0.05 was considered statistically significant.

. Results

.1. Effect of maternal undernutrition on maternal and fetal brainnd placental weight

Maternal weight was the same in the Control and UN groupspon entry to this study. Maternal undernutrition resulted in a

ower maternal body weight at conception (13%), throughout preg-ancy and at post mortem (12%; 60–62 d gestation) compared withontrols (Table 2). Placental weight was lower in UN than in theontrol group (P < 0.05; Fig. 1A). There was a significant (P < 0.05)elationship between placental weight and fetal weight (Fig. 1B)uch that UN fetuses were 26% lighter than Controls (Fig. 1C). AllN fetuses had a body weight below the 10th centile of the Con-

rols. Fetal relative brain weight was increased in the UN groupompared to the Control group (P < 0.05; Fig. 1D), a characteristiclso seen in human growth restricted fetuses [14].

.2. Placental P-gp expression and morphometry in Control andN

MDR1 mRNA was detected in the guinea pig placenta at 60–62ays gestation. The expression of placental MDR1 mRNA was notifferent between the UN and Control groups (Table 3). A band ofpproximately 170 kDa, corresponding to the molecular size of P-p, was observed for all placentas (Fig. 2A). Based on densitometricnalysis, P-gp expression in the placenta was significantly reduced1.7-fold) in UN fetal guinea pigs (P < 0.05; Fig. 2B).

Immunohistochemical assessment demonstrated that P-gp wasxpressed in the placental trophoblast (Fig. 3C and D). The vol-me density and weight of trophoblasts at 60–62 d of gestationere unaltered by UN (Table 3). The weights, but not the volumeensities, of the maternal blood space and fetal capillaries were sig-ificantly reduced within the labyrinth of the UN placenta (P < 0.05;able 3).

.3. Maternal and fetal brain P-gp expression and morphometryn Control and UN

The expression of MDR1 mRNA was not significantly differentn either the maternal or fetal brains of UN and Control groupsTable 2 and 4). Bands of approximately 170 kDa, corresponding

able 3ffect of maternal undernutrition on the placenta cell composition and MDR1 inuinea pigs at 60–62 days gestation.

Control (n) UN (n)

Volume density of fetalcapillaries

0.306 ± 0.017 (4) 0.317 ± 0.013 (6)

Volume of fetal capillaries (g) 1.52 ± 0.09 (4) 1.21 ± 0.09 (6)*

Volume density of maternalblood space

0.270 ± 0.009 (4) 0.267 ± 0.030 (6)

Volume of maternal bloodspace (g)

1.347 ± 0.082 (4) 0.992 ± 0.051 (6)*

Volume density of trophoblast 0.416 ± 0.024 (4) 0.416 ± 0.031 (6)Volume of trophoblast (g) 2.089 ± 0.23 (4) 1.637 ± 0.22 (6)Placenta MDR1 mRNA 1.73 ± 0.15 (6) 1.85 ± 0.20 (7)

ll data are mean ± SEM. Data were analysed by Student’s t-test.* Significant difference between treatment groups at 60 days gestation, P < 0.05.

panel: P-gp in the UN brain was less than Control. Bands were measured in opticaldensity (OD) units. Column graph data are mean ± SEM, open bars (n = 6); UN, filledbar (n = 7). *P < 0.05.

to the molecular size of P-gp, were observed for all brains (Fig. 4A).Based on densitometric analysis, P-gp expression in the maternalbrain was not different between Control and UN group. However,UN fetal brain had a significantly lowered (1.8-fold) P-gp expressioncompared to Control (P < 0.05; Fig. 4B) at 60–62 days gestation.

P-gp was detected on capillaries in the fetal brain (Fig. 5C andD). Maternal undernutrition increased the volume density of fetalbrain capillaries in UN group, but the weight of brain capillarisationwas unaltered between groups (Table 4).

4. Discussion

In this study, we have demonstrated that maternal undernu-trition (85% of ad libitum Control) reduced placental and hence,fetal growth and changed placental and brain morphometry in thefetus at 60–62 days gestation. Consistent with other studies, wehave also shown that P-gp is predominantly expressed in the tro-phoblast cells of the placenta and the capillaries in the brain [12,29].The most important observation was that the placental and brainP-gp protein expression were reduced when maternal undernutri-tion was induced. This is a significant finding because a decrease inP-gp in the placenta and fetal brain may suggest that the SGA fetusis more vulnerable to drug exposure in late gestation.

As a model of human development, the guinea pig is well-established for the study of placental transfer and fetal growthrestriction [20,21,30–32]. Relevant to this study, guinea pigs aresimilar to humans not only in terms of placental structure and

Table 4Effects of maternal undernutrition on the brain capillarisation and MDR1 geneexpression in guinea pigs fetuses at 60–62 days gestation.

Control (n) UN (n)

Volume density of fetal capillaries 0.068 ± 0.004 (4) 0.091 ± 0.003 (6)*

Volume of fetal capillaries (g) 0.176 ± 0.012 (4) 0.201 ± 0.008 (6)Fetal brain MDR1 mRNA 2.14 ± 0.41 (6) 1.84 ± 0.20 (7)

All data are mean ± SEM. Data were analysed by Student’s t-test.* Significant difference between nutritional groups at 60–62 days gestation,

P < 0.05.

e Toxi

pbioit

wIftpocc7p1tt

ltb

F5D

P.S. Soo et al. / Reproductiv

lacental transport barrier, but also in the organisation of the bloodrain barrier [21,33]. In addition, guinea pig fetal development

s similar to human fetal development with maturation of manyrgans occurring prior to birth. Consistent with previous stud-es, restricting food intake of the pregnant guinea pig before andhroughout pregnancy resulted in fetal growth restriction [19,21].

The placenta serves as an important nutrient exchange site asell as a barrier against xenobiotics from the maternal circulation.

n the current study, maternal undernutrition to 85% of Controlood intake before conception and through pregnancy decreasedhe volume of maternal blood space and fetal capillaries within thelacenta. However, no changes in the volume density and weightf trophoblast cells in the UN guinea pig were found, which is inontrast to Roberts et al. [21] who reported reduced trophoblastell volume density and weight with maternal undernutrition to0% from −2 to 5 weeks and then 85% to term. This decrease inlacental weight is due to maternal plasma concentrations of IGF-

and regulation of its’ action by IGFBP-1 and -3 [34]. Together,hese studies show that the effects of maternal undernutrition onhe placenta are graded according to the degree of undernutrition.

Maternal undernutrition increases the volume density of capil-aries in the brain of UN compared to Control fetuses. This indicateshat the brain of the UN fetus was more vascularised than therain of Control fetuses. Previous studies have shown that placental

ig. 5. Haematoxylin and eosin staining of fetal capillaries in the brain of control (A) and U0 �m (A and B). Confocal fluorescent image of P-glycoprotein in the brain capillary of co).

cology 33 (2012) 374– 381 379

restriction induced by uterine artery ligation in guinea pigs resultsin lower blood flow and arterial oxygen content in the fetal braincompared to Control [32]. The increase in the density of brain capil-laries observed in the present study may be a result of adaptationswhich may improve nutrient delivery to brain tissue.

It is well established that P-gp is a major mechanism for lim-iting drug transfer in the placenta and brain [8,9,17]. We havedemonstrated that maternal undernutrition significantly reducesP-gp protein expression in the placenta and the brain of the fetus,but not the brain of the mother. The low expression of P-gp proteinin the placenta and fetal brain may lead to increased susceptibilityto xenobiotic damage in SGA fetuses, as a decrease in P-gp proteinlevel has been shown to have a direct correlation with an increasein P-gp substrate entry into the fetal circulation [35]. Many stud-ies (for reviews [36,37]) have shown that P-gp can be regulatedthrough either oxidative stress or inflammation-induced transduc-tion pathways by activation of tumor necrosis factor-� (TNF-�) inrat brain capillaries [38,39]. Stimulation of TNF-� can trigger a cas-cade of signalling pathways which activate transcription factorssuch as nuclear factor-�B or activator protein-1 to increase P-gp

protein expression in the brain endothelial cells [38,39]. Placentaand fetal brain TNF-� protein levels were increased and decreased,respectively, in response to maternal undernutrition [40].Furthermore, a 40% reduction in food intake in pregnant guinea pigs

N (B) guinea pigs at 60–62 days gestation. Magnification 200× (A and B). Scale barntrol (C) and UN (D) fetal guinea pigs at 60 days gestation. Scale bar 25 �m (C and

3 e Toxi

wayimn

aMmmsgifntc

aewrcgfissftot[ptt

pMiotadbdfffit

A

aWbtA

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

80 P.S. Soo et al. / Reproductiv

as found to elevate plasma cortisol concentrations in the mothernd the fetus throughout pregnancy compared to Controls [41]. It iset to be established what factors trigger the change in P-gp proteinn SGA, and the changes in other transporters that regulate move-

ent of substances between the mother and fetus in SGA are alsoot known.

Despite the changes in P-gp protein expression in the placentand brain of the fetus, no significant changes were observed inDR1 mRNA expression. Amongst several possible reasons is thataternal undernutrition may alter post-translational regulation orRNA stability of MDR1 [42,43]. In support of this view, recent

tudies in pregnant mice also found a significant decrease in P-p protein expression in the placenta but no significant changesn MDR1 mRNA expression [35,44]. Estradiol has been identifiedor its potential to change transcription of MDR1 [35]. Althoughot measured in this study, other studies of maternal undernutri-ion have shown increases in maternal circulating plasma estradioloncentrations [30,40].

While several studies in rat hepatocytes have found that dex-methasone does not change MDR1 mRNA expression [45], Kalabist al. [12] more recently found that pregnant guinea pigs treatedith betamethasone at 40/41 and 50/51 days gestation have

educed MDR1 mRNA and P-gp protein expression in the pla-enta. The present study has shown that undernutrition in pregnantuinea pigs decreased P-gp protein expression in the placenta andetal brain. Together, these are significant findings because approx-mately 50% of women at risk of preterm labour are treated withingle or multiple doses of synthetic glucocorticoids (betametha-one or dexamethasone) [46]. In addition, the growth restrictedetus has a higher risk of being born preterm [47]. Experimen-al studies in various animals have shown that multiple dosesf synthetic glucocorticoids cause adverse effects such as hyper-ension, alteration in endocrine and neurological development48–50]. Administering dexamethasone or betamethasone to thereterm growth restricted fetus may further decrease the pro-ective effects of P-gp, but further studies are required to verifyhis.

In summary, maternal undernutrition resulted in a smallerlacenta and thus a growth restricted fetus with brainsparing.aternal undernutrition not only changed placental and brain cap-

llary density, but also lowered P-gp protein expression. Thesebservations improve our understanding of the impact of a subop-imal intrauterine environment on P-gp expression in the placentand the brain of the developing fetus, enabling us to identifyifferences in fetal susceptibility to potential adverse effect of xeno-iotics during in utero development. Given that 96% of women userugs during pregnancy, that many of these drugs are removedrom the fetal circulation by P-gp and that the growth restrictedetus has a reduced ability to eliminate these drugs, the safety pro-le of many drugs may be different for the normally grown versushe small fetus.

cknowledgements

The authors thank Melissa Walker, Jayne Skinner, Bang Hoangnd Kimberley Wang for their assistance with tissue collection.e also thank Stacey Dunn for her assistance with the Western

lot. JLM was supported by fellowships from the Heart Founda-ion (CR10A4988), NHMRC (Biomedical CDA 511341) and Southustralian Cardiovascular Research Network (CR10A4988).

eferences

[1] Henry A, Crowther C. Patterns of medication use during and prior to preg-nancy: the MAP study. Australian and New Zealand Journal of Obstetrics andGynaecology 2000;40:165–72.

[

cology 33 (2012) 374– 381

[2] Audus KL. Controlling drug delivery across the placenta. European Journal ofPharmaceutical Sciences 1999;8:161–5.

[3] Ceckova-Novotna M, Pavek P, Staud F. P-glycoprotein in the placenta:expression, localization, regulation and function. Reproductive Toxicology2006;22:400–10.

[4] Croop JM, Raymond M, Haber D, Devault A, Arceci RJ, Gros P, et al. The threemouse multidrug resistance (mdr) genes are expressed in a tissue-specific man-ner in normal mouse tissues. Molecular and Cellular Biology 1989;9:1346–50.

[5] Schinkel AH. P-Glycoproteina gatekeeper in the blood–brain barrier. AdvancedDrug Delivery Reviews 1999;36:179–94.

[6] Roberts D, Dalziel S. Antenatal corticosteroids for accelerating fetal lung mat-uration for women at risk of preterm birth. Cochrane Database of SystematicReviews 2006 [review].

[7] Cordon-Cardo C, O’Brien JP, Casals D, Rittman-Grauer L, Biedler JL, MelamedMR, et al. Multidrug-resistance gene (P-glycoprotein) is expressed by endothe-lial cells at blood–brain barrier sites. Proceedings of the National Academy ofSciences of the United States of America 1989;86:695–8.

[8] Lankas GR, Wise LD, Cartwright ME, Pippert T, Umbenhauer DR. Placental P-glycoprotein deficiency enhances susceptibility to chemically induced birthdefects in mice. Reproductive Toxicology 1998;12:457–63.

[9] Smit JW, Huisman MT, Van Tellingen O, Wiltshire HR, Schinkel AH. Absenceor pharmacological blocking of placental P-glycoprotein profoundly increasesfetal drug exposure. Journal of Clinical Investigation 1999;104:1441–7.

10] Sun M, Kingdom J, Baczyk D, Lye SJ, Matthews SG, Gibb W. Expression of themultidrug resistance P-glycoprotein, (ABCB1 glycoprotein) in the human pla-centa decreases with advancing gestation. Placenta 2006;27:602–9.

11] Petropoulos S, Kalabis GM, Gibb W, Matthews SG. Functional changes ofmouse placental multidrug resistance phosphoglycoprotein (ABCB1) withadvancing gestation and regulation by progesterone. Reproductive Sciences2007;14:321–8.

12] Kalabis GM, Petropoulos S, Gibb W, Matthews SG. Multidrug resistancephosphoglycoprotein (ABCB1) expression in the guinea pig placenta: Devel-opmental changes and regulation by betamethasone. Canadian Journal ofPhysiology and Pharmacology 2009;87:973–8.

13] Novotna M, Libra A, Kopecky M, Pavek P, Fendrich Z, Semecky V, et al. P-glycoprotein expression and distribution in the rat placenta during pregnancy.Reproductive Toxicology 2004;18:785–92.

14] McMillen IC, Adams MB, Ross JT, Coulter CL, Simonetta G, Owens JA,et al. Fetal growth restriction: adaptations and consequences. Reproduction2001;122:195–204.

15] Ergaz Z, Avgil M, Ornoy A. Intrauterine growth restriction – etiology and con-sequences: what do we know about the human situation and experimentalanimal models? Reproductive Toxicology 2005;20:301–22.

16] Kingdom J, Huppertz B, Seaward G, Kaufmann P. Development of the placentalvillous tree and its consequences for fetal growth. European Journal of Obstet-rics & Gynecology and Reproductive Biology 2000;92:35–43.

17] Schinkel AH, Mayer U, Wagenaar E, Mol CAAM, Van Deemter L, Smit JJM,et al. Normal viability and altered pharmacokinetics in mice lacking mdr1-type(drug-transporting) P-glycoproteins. Proceedings of the National Academy ofSciences of the United States of America 1997;94:4028–33.

18] Bevilacqua E, Brunelli R, Anceschi MM. Review and meta-analysis: benefits andrisks of multiple courses of antenatal corticosteroids. Journal of Maternal-Fetaland Neonatal Medicine 2010;23:244–60.

19] Kind KL, Simonetta G, Clifton PM, Robinson JS, Owens JA. Effect of maternal feedrestriction on blood pressure in the adult guinea pig. Experimental Physiology2002;87:469–77.

20] Nguyen LT, Muhlhausler BS, Botting KJ, Morrison JL. Maternal undernutritionalters fat cell size distribution, but not lipogenic gene expression, in the visceralfat of the late gestation guinea pig fetus. Placenta 2010;31:902–9.

21] Roberts CT, Sohlstrom A, Kind KL, Earl RA, Khong TY, Robinson JS, et al. Maternalfood restriction reduces the exchange surface area and increases the barrierthickness of the placenta in the guinea-pig. Placenta 2001;22:177–85.

22] Weibel ER. Morphometry of the human lung: the state of the art after twodecades. Clinical Respiratory Physiology 1979;15:999–1013.

23] Shi SR, Imam SA, Young L, Cote RJ, Taylor CR. Antigen retrieval immunohisto-chemistry under the influence of pH using monoclonal antibodies. Journal ofHistochemistry and Cytochemistry 1995;43:193–201.

24] Kwan P, Sills GJ, Butler E, Gant TW, Brodie MJ. Differential expression of mul-tidrug resistance genes in naïve rat brain. Neuroscience Letters 2003;339:33–6.

25] Liu H, Liu X, Jia L, Liu Y, Yang H, Wang G, et al. Insulin therapy restores impairedfunction and expression of P-glycoprotein in blood–brain barrier of experimen-tal diabetes. Biochemical Pharmacology 2008;75:1649–58.

26] Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al.Accurate normalization of real-time quantitative RT-PCR data by geometricaveraging of multiple internal control genes. Genome biology 2002:3.

27] Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J. qBase rela-tive quantification framework and software for management and automatedanalysis of real-time quantitative PCR data. Genome Biology 2007:8.

28] Muhlhausler BS, Duffield JA, Ozanne SE, Pilgrim C, Turner N, Morrison JL, et al.The transition from fetal growth restriction to accelerated postnatal growth:A potential role for insulin signalling in skeletal muscle. Journal of Physiology2009;587:4199–211.

29] Warren MS, Zerangue N, Woodford K, Roberts LM, Tate EH, Feng B, et al. Com-parative gene expression profiles of ABC transporters in brain microvesselendothelial cells and brain in five species including human. PharmacologicalResearch 2009;59:404–13.

e Toxi

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

P.S. Soo et al. / Reproductiv

30] Owen D, Matthews SG. Prenatal glucocorticoid exposure altershypothalamic–pituitary–adrenal function in juvenile guinea pigs. Journal ofNeuroendocrinology 2007;19:172–80.

31] Carter AM. Current topic: restriction of placental and fetal growth in the guinea-pig. Placenta 1993;14:125–35.

32] Detmer A, Gu W, Carter AM. The blood supply to the heart and brain inthe growth retarded guinea pig fetus. Journal of Developmental Physiology1991;15:153–60.

33] Keightley MC, Fuller PJ. Anomalies in the endocrine axes of the guinea pig: rel-evance to human physiology and disease. Endocrine Reviews 1996;17:30–44.

34] Roberts CT, Kind KL, Earl RA, Grant PA, Robinson JS, Sohlstrom A, et al. Circu-lating insulin-like growth factor (IGF)-I and IGF binding proteins -1 and -3 andplacental development in the guinea-pig. Placenta 2002;23:763–70.

35] Coles LD, Lee IJ, Hassan HE, Eddington ND. Distribution of saquinavir,methadone, and buprenorphine in maternal brain, placenta, and fetus duringtwo different gestational stages of pregnancy in mice. Journal of PharmaceuticalSciences 2009;98:2832–46.

36] Scotto KW. Transcriptional regulation of ABC drug transporters. Oncogene2003;22:7496–511.

37] Callaghan R, Crowley E, Potter S, Kerr ID. Review/drug metabolism andtransport: P-glycoprotein: so many ways to turn it on. Journal of Clinical Phar-macology 2008;48:365–78.

38] Hartz AMS, Bauer B, Block ML, Hong JS, Miller DS. Diesel exhaust particlesinduce oxidative stress, proinflammatory signaling, and P-glycoprotein up-regulation at the blood–brain barrier. FASEB Journal 2008;22:2723–33.

39] Hartz AMS, Bauer B, Fricker G, Miller DS. Rapid modulation of P-glycoprotein-

mediated transport at the blood–brain barrier by tumor necrosis factor-� andlipopolysaccharide. Molecular Pharmacology 2006;69:462–70.

40] Shen Q, Li ZQ, Sun Y, Wang T, Wan CL, Li XW, et al. The role of pro-inflammatoryfactors in mediating the effects on the fetus of prenatal undernutrition: impli-cations for schizophrenia. Schizophrenia Research 2008;99:48–55.

[

cology 33 (2012) 374– 381 381

41] Dwyer CM, Stickland NC. The effects of maternal undernutrition on maternaland fetal serum insulin-like growth factors, thyroid hormones and cortisol inthe guinea pig. Journal of Developmental Physiology 1992;18:303–13.

42] Yagüe E, Armesilla AL, Harrison G, Elliott J, Sardini A, Higgins CF, et al. P-glycoprotein (MDR1) expression in leukemic cells is regulated at two distinctsteps, mRNA stabilization and translational initiation. Journal of BiologicalChemistry 2003;278:10344–52.

43] Gómez-Martínez A, García-Morales P, Carrato A, Castro-Galache MD, SotoJL, Carrasco-García E, et al. Post-transcriptional regulation of P-glycoproteinexpression in cancer cell lines. Molecular Cancer Research 2007;5:641–53.

44] Zhang H, Wu X, Wang H, Mikheev AM, Mao Q, Unadkat JD. Effect of preg-nancy on cytochrome P450 3a and P-glycoprotein expression and activity inthe mouse: mechanisms, tissue specificity, and time course. Molecular Phar-macology 2008;74:714–23.

45] Baker EK, El-Osta A. MDR1, chemotherapy and chromatin remodeling. CancerBiology and Therapy 2004;3:819–24.

46] Crowley PA. Antenatal corticosteroid therapy: a meta-analysis of the ran-domized trials, 1972 to 1994. American Journal of Obstetrics and Gynecology1995;173:322–35.

47] Miller SL, Chai M, Loose J, Castillo-Meléndez M, Walker DW, Jenkin G, et al. Theeffects of maternal betamethasone administration on the intrauterine growth-restricted fetus. Endocrinology 2007;148:1288–95.

48] Sloboda DM, Newnham JP, Challis JRG. Repeated maternal glucocorticoidadministration and the developing liver in fetal sheep. Journal of Endocrinology2002;175:535–43.

49] Lindsay RS, Lindsay RM, Edwards CRW, Seckl JR. Inhibition of 11�-

hydroxysteroid dehydrogenase in pregnant rats and the programming of bloodpressure in the offspring. Hypertension 1996;27:1200–4.

50] Uno H, Eisele S, Sakai A, Shelton S, Baker E, DeJesus O, et al. Neurotoxic-ity of glucocorticoids in the primate brain. Hormones and Behavior 1994;28:336–48.