m humayun et al. nature 000 , 1-4 (2013) doi:10.1038/nature12764

1

M Humayun et al. Nature 000, 1-4 (2013) doi:10.1038/nature12764 Gusev rock and soil analyses 13 have systematically higher Zn abundances than both Martian meteorites and NWA 7533.

Upload: angus

Post on 05-Jan-2016

38 views

Category:

Documents

1 download

Report

Download

Embed Size (px):

DESCRIPTION

Gusev rock and soil analyses 13 have systematically higher Zn abundances than both Martian meteorites and NWA 7533. M Humayun et al. Nature 000 , 1-4 (2013) doi:10.1038/nature12764. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: M Humayun et al. Nature 000 , 1-4 (2013) doi:10.1038/nature12764

M Humayun et al. Nature 000, 1-4 (2013) doi:10.1038/nature12764

Gusev rock and soil analyses13 have systematically higher Znabundances than both Martian meteorites and NWA 7533.

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Mucosal Immunology (2013) 6 , 522-534; doi:10.1038/mi.2012.92

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/NPHYS3211 Supplementary Information for

GI Motility online (May 2006) | doi:10.1038/gimo48

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo6

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

17 September 2009 doi:10.1038/nature08355 LETTERS

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

GI Motility online (May 2006) | doi:10.1038/gimo12

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature12886 Neanderthal from the Altai

GI Motility online (May 2006) | doi:10.1038/gimo46

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature , 2008, Doi:10.1038/nature07103

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

doi:10.1038/nature05202 LETTERS

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

Nature Biotechnology: doi:10.1038/nbt

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112