m galeazzi et al. nature 000 , 1-3 (2014) doi:10.1038/nature13525

1

M Galeazzi et al. Nature 000, 1-3 (2014) doi:10.1038/nature13525 Fit to DXL and ROSAT data.

Upload: kylee-shaw

Post on 31-Dec-2015

14 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

DESCRIPTION

Fit to DXL and ROSAT data. M Galeazzi et al. Nature 000 , 1-3 (2014) doi:10.1038/nature13525. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: M Galeazzi et al. Nature 000 , 1-3 (2014) doi:10.1038/nature13525

M Galeazzi et al. Nature 000, 1-3 (2014) doi:10.1038/nature13525

Fit to DXL and ROSAT data.

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

Published in Nature Materials (2016) doi:10.1038/nmat4569

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

GI Motility online (May 2006) | doi:10.1038/gimo48

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

doi:10.1038/nature06481 LETTERS

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo6

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

doi:10.1038/nature12886 Neanderthal from the Altai

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

DOI: 10.1038/ncomms1280 molecular dynamics of single

GI Motility online (May 2006) | doi:10.1038/gimo12

doi:10.1038/nature05202 LETTERS

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Mucosal Immunology (2013) 6 , 522-534; doi:10.1038/mi.2012.92

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

doi:10.1038/nature05150 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

Nature Biotechnology: doi:10.1038/nbt