Link of NTR-Mediated Spliceosome Disassembly with DEAH-BoxATPases Prp2, Prp16, and Prp22

Hsin-Chou Chen,a,b Chi-Kang Tseng,b Rong-Tzong Tsai,b* Che-Sheng Chung,b Soo-Chen Chenga,b

Institute of Microbiology and Immunology, National Yang-Ming University, Taipei, Taiwana; Institute of Molecular Biology, Academia Sinica, Taipei, Taiwanb

The DEAH-box ATPase Prp43 is required for disassembly of the spliceosome after the completion of splicing or after the discardof the spliceosome due to a splicing defect. Prp43 associates with Ntr1 and Ntr2 to form the NTR complex and is recruited to thespliceosome via the interaction of Ntr2 and U5 component Brr2. Ntr2 alone can bind to U5 and to the spliceosome. To under-stand how NTR might mediate the disassembly of spliceosome intermediates, we arrested the spliceosome at various stages ofthe assembly pathway and assessed its susceptibility to disassembly. We found that NTR could catalyze the disassembly of affini-ty-purified spliceosomes arrested specifically after the ATP-dependent action of DEAH-box ATPase Prp2, Prp16, or Prp22 butnot at steps before the action of these ATPases or upon their binding to the spliceosome. These results link spliceosome disas-sembly to the functioning of splicing ATPases. Analysis of the binding of Ntr2 to each splicing complex has revealed that thepresence of Prp16 and Slu7, which also interact with Brr2, has a negative impact on Ntr2 binding. Our study provides insightsinto the mechanism by which NTR can be recruited to the spliceosome to mediate the disassembly of spliceosome intermediateswhen the spliceosome pathway is retarded, while disassembly is prevented in normal reactions.

Introns are removed from precursor mRNAs (pre-mRNAs) viatwo transesterification reactions. The reactions take place on a

large ribonucleoprotein complex called the spliceosome, which iscomposed of five small nuclear RNAs (snRNAs) and numerousprotein factors. These factors bind to the pre-mRNA in a sequen-tial manner to assemble the spliceosome into a functional com-plex for catalysis (for reviews, see references 1 to 4). After comple-tion of the splicing reaction, the mature message is released andthe spliceosome is disassembled to recycle its components.

Extensive structural rearrangement of the spliceosome, includ-ing exchange of RNA base-pairing and protein components (1, 2,4–9), is associated with each step of the spliceosome assemblyprocess. DEXD/H-box RNA helicases have been proposed to me-diate structural changes of the spliceosome in distinct steps (10–15). In the budding yeast Saccharomyces cerevisiae, eight DEXD/H-box proteins are required for splicing. Prp5 and Sub2 areinvolved in early steps of spliceosome assembly to facilitate theformation of the prespliceosome (16–18). Prp28 and Brr2 are re-quired in releasing U1 and U4, respectively, for the activation ofthe spliceosome (11, 15). Prp2 and Prp16 are required for thecatalytic steps, and their activities are associated with the release ofU2 components SF3a and SF3b (SF3a/b) and step-one factorsYju2 and Cwc25, respectively (19–24). After the completion ofsplicing, Prp22 is required for the release of mature mRNA andPrp43 for the disassembly of the spliceosome to recycle spliceo-somal components (25–28). Although some of these proteins havebeen shown to unwind the RNA duplex in vitro, none show sub-strate specificity. Nevertheless, the DEXD/H-box proteins are reg-ulated to function at precise stages of the splicing pathway. It hasbeen shown that the RNA-unwinding activity of Brr2 is stimulatedby a carboxy-terminal fragment of Prp8 (29), while Prp43 is acti-vated by an amino-terminal fragment of Ntr1 containing the G-patch domain (30), suggesting that the function of the DEXD/H-box proteins might be regulated by associated splicing factors. TheU5 component Snu114 has also been shown to serve as a signal-dependent switch to regulate spliceosome dynamics via regulationof Brr2 activity (32). Posttranslational modification of other splic-

ing factors or of the DEXD/H-box proteins themselves has alsobeen implicated in regulating the function of these helicases dur-ing spliceosome assembly (31, 33–35).

A protein complex termed NTR has been shown previously tomediate the disassembly of the spliceosome after the release ofmature mRNA (36). NTR, which contains Ntr1 (also calledSpp382), Ntr2, and the DEAH-box RNA helicase Prp43, interactswith U5 snRNP in a dynamic manner via the interaction of Ntr2and U5 component Brr2. Such interactions may mediate the re-cruitment of NTR to the spliceosome by U5 snRNP (37). Since U5is associated with the spliceosome early in the assembly pathway,the recruitment of NTR by U5 can occur early before the comple-tion of the reaction. In support of this notion, Prp43 has recentlybeen shown to be required for the disassembly of discarded spli-ceosome intermediates (38, 39). Nevertheless, NTR normally doesnot function until the mature message is released from the spli-ceosome after the completion of splicing, suggesting that the in-teraction of NTR with U5 is temporally regulated.

We investigated how NTR can mediate the disassembly of spli-ceosome intermediates and how the disassembly is prevented un-der normal splicing conditions. We found that NTR could specif-ically catalyze the disassembly of the spliceosome arrested at stepsafter the action of DEAH-box RNA helicase Prp2, Prp16, or Prp22but not at steps before the action of these proteins or upon their

Received 8 August 2012 Returned for modification 14 September 2012Accepted 8 November 2012

Published ahead of print 19 November 2012

Address correspondence to Soo-Chen Cheng, mbscc@ccvax.sinica.edu.tw.

* Present address: Rong-Tzong Tsai, Institute of Biochemistry and Biotechnology,Chung Shan Medical University, Taichung, Taiwan.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/MCB.01093-12.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/MCB.01093-12

514 mcb.asm.org Molecular and Cellular Biology p. 514–525 February 2013 Volume 33 Number 3

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

binding. The actions of Prp2, Prp16, and Prp22 are known to beassociated with the release of SF3a/b, Yju2/Cwc25, and Prp22/Prp18/Slu7, respectively (21, 23, 24, 46). Since these factors bindto the catalytic center of the spliceosome, near the branch site orthe 3= splice site, at each specific stage, the susceptibility of thespliceosome to disassembly might require the removal of thesefactors from the catalytic center. Analysis of Ntr2 binding revealedthat splicing complexes exhibit differential binding affinity forNtr2, generally in accordance with their susceptibility to disas-sembly, but not all complexes that bind Ntr2 well are susceptible.Our results demonstrate that NTR can be recruited to the spliceo-some only at defined stages, and only when specific componentsthat bind to the catalytic center are removed is the spliceosomesusceptible to disassembly. Furthermore, the binding of Ntr2 tospliceosome intermediates is competitively inhibited by the pres-ence of Prp16 and Slu7. Thus, our results provide a mechanism forprevention of the disassembly of spliceosome intermediates undernormal conditions.

MATERIALS AND METHODSYeast strains. The yeast strains used were BJ2168 (mata prc1 prb1 pep4leu2 trp1 ura3), YSCC5 (mata prc1 prb1 pep4 leu2 trp1 ura3 YJU2-V5),YSCC10 (mata prc1 prb1 pep4 leu2 trp1 ura3 dbr1::LEU2), YSCC16 (mataprc1 prb1 pep4 leu2 trp1 ura3 URA3::GAL.PRP16), YSCC701 (mata prc1prb1 pep4 leu2 trp1 ura3 SLU7-V5), SS304 (mata ura3 trp1 his3 ade2 prp2-1), and prp22 (mata ura3 trp1 his3 ade2 prp22-1).

Antibodies and reagents. The anti-V5 antibody was purchased fromSerotec Inc. The antibody against hemagglutinin (HA) was produced byimmunizing mice with a keyhole limpet hemocyanin (KLH)-conjugatedHA peptide (unpublished data). Anti-Prp16, anti-Prp22, anti-Slu7, anti-Ntr2, and anti-Cwc25 polyclonal antibodies were produced by immuniz-ing rabbits with recombinant Prp16, Prp22, Slu7, Ntr2, and Cwc25 pro-teins, respectively. Dinucleotides 4-thio-UpG and UpG were purchasedfrom Dharmacon. RNasin and SP6 RNA polymerase are from Promega,nuclease P1 from Sigma, and RNA ligase 1 from New England Biolabs.Protein A-Sepharose and the Ni-nitrilotriacetic acid (NTA) affinity col-umn were obtained from Amersham Biosciences and Qiagen, respec-tively.

Oligonucleotides. The following oligonucleotides were used: A1(CTTCATCACCAACGTAG), A8 (TGTTAGTACATGAGAC), A9 (GCAACAAAAAGAATGAAGCAATCGTACATGAGACTTAGTAACA), S6 (TACGATTTAGGTGACAC), P2-6 (CTTTAAAATTGCTTATATCATTAGCAACAATGAACGCAAAAAA), P2-7 (TTTTTTGCGTTCATTGTTGCTAATGATATAAGCAATTTTAAAG), P16-5 (GATAAATATTCGTGTGTTATTATTGCTGAAGCTCATGAAAGGTCATTAAAT), and P16-6 (ATTTAATGACCTTTCATGAGCTTCAGCAATAATAACACACGAATATTTATC).

Purification of Prp2, prp2-S378L, prp16, prp16-D473A, prp22,prp22-S635A, Ntr2-HA, and Slu7-V5. The PRP2 gene encoding a proteintagged with 4 copies of the V5 epitope at the amino terminus (41) and 2copies of the HA epitope at the carboxyl terminus was cloned intopET15b. A serine-to-leucine mutation at position 378 was introduced bysite-directed mutagenesis using primers P2-6 and P2-7. Both the wild-type protein and the prp2-S378L mutant recombinant protein were puri-fied by consecutive chromatography on a nickel affinity column and an-ti-HA antibody-conjugated protein A-Sepharose beads. To purify Prp2from yeast, extracts were prepared from a strain harboring plasmid pYES-HIS-PRP2 (a gift from R.-J. Lin) and were fractionated by chromatogra-phy on a nickel affinity column. The PRP16 gene encoding a proteintagged with 3 copies of HA at the carboxyl terminus was subcloned intopET28b for expression of the recombinant protein. An aspartate-to-ala-nine mutation at position 473 was introduced by site-directed mutagen-esis using primers P16-5 and P16-6. Both the wild-type protein and theprp16-D473A mutant recombinant protein were purified as described for

Prp2. Prp22 and the prp22-S635A mutant protein were purified accord-ing to the method of Tseng and Cheng (42). The NTR2 gene encoding aprotein tagged with HA at the carboxyl terminus and the SLU7 gene en-coding a protein tagged with V5 at the amino terminus were individuallycloned into plasmid pSUMO for the expression of SUMO fusion proteins.After purification by chromatography on a nickel affinity column, thefusion proteins were treated with SUMO protease to remove SUMO.

Depletion of Cwc25, Slu7, Prp16, Prp22, and NTR. To immunode-plete a factor from yeast extract, 25 mg of protein A-Sepharose was swol-len in 1 ml of NET-2 buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl,0.05% NP-40) and was conjugated with a specific antibody. For Cwc25depletion, 200 �l of a polyclonal anti-Cwc25 antibody was conjugated to100 �l of protein A-Sepharose and used for depletion of 200 �l of extracts.For Prp16 depletion, 100 �l of a polyclonal anti-Prp16 antibody was used.For Ntr1 depletion, 50 �l of a polyclonal anti-Ntr1 antibody was used. ForSlu7 depletion, 100 �l of a polyclonal anti-Slu7 antibody was used. Forcodepletion of Slu7 and Prp22, 100 �l of an anti-Slu7 antibody and 2.6 �gof a purified anti-Prp22 antibody were used. Extracts were incubated withantibody-conjugated protein A-Sepharose at 4°C for 1 h, and superna-tants were collected as depleted extracts.

Arrest of spliceosome intermediates. For the precatalytic spliceo-some, splicing was carried out in heat-inactivated prp2-1 mutant extracts.For the Prp2-associated spliceosome, splicing was carried out in heat-inactivated prp2-1 mutant extracts, and the reaction mixture was depletedof ATP by incubation at 25°C for 5 min following the addition of 10 mMglucose. Then 100 ng of recombinant wild-type Prp2 or prp2-S378L, or 28ng of Prp2 purified from yeast, was added to each 10 �l of the reactionmixture. For the post-Prp2 spliceosome, splicing was carried out in Yju2-depleted extracts as described previously (41). For the pre-Prp16 spliceo-some, splicing was carried out in Prp16-depleted extracts. For the Prp16-associated spliceosome, splicing was carried out in Prp16-depletedextracts, and the reaction mixture was depleted of ATP by incubation at25°C for 5 min following the addition of 10 mM glucose. Then 100 ng ofrecombinant wild-type Prp16 or prp16-D473A, or 0.5 �l of Prp16-over-expressing yeast extracts, was added to each 10 �l of the reaction mixture.To arrest the Prp22-associated spliceosome containing splicing interme-diates, splicing was carried out with the 3= splice site mutant ACAC pre-mRNA. To arrest the postcatalytic spliceosome, splicing was carried out inthe presence of 50 to 200 ng of recombinant prp22-S635A for each 10 �l ofthe reaction mixture (42). To arrest the terminal-stage spliceosome, splic-ing was carried out in NTR-depleted extracts by using an anti-Ntr1 anti-body as described previously (36).

Spliceosome disassembly assays. Spliceosome disassembly assayswere performed according to the method of Tsai et al. (36) with slightmodifications. The splicing reaction was carried out under normal con-ditions by using actin precursor mRNA as the substrate, and the spliceo-some was isolated by precipitation of 10 �l of the reaction mixture with 1�l of an anti-Ntc20 antibody conjugated to 10 �l of protein A-Sepharose.The isolated spliceosome was then incubated under splicing conditions at25°C for 20 min with 30 �l of a buffer containing 8 mM HEPES (pH 7.9),60 mM KPO4 (pH 7.0), 20 mM NaCl, 0.08 mM EDTA, 1 mM spermidine,3% polyethylene glycol (PEG) 8000, 8% glycerol, 2 mM ATP, and 4 mMMgCl2, with or without 5 �l of purified NTR. After centrifugation, super-natant and pellet fractions were collected for RNA analysis. Sedimentationanalysis on glycerol gradients was performed as described by Tsai et al.(36).

Ntr2 binding assays. To assay for Ntr2 binding, splicing reactionswere carried out as described above to arrest the spliceosome at specificstages. To each 10 �l of the reaction mixture, 0, 20, 50, 100, 200, or 500 ngrecombinant Ntr2-HA was then added. The reaction mixture was thenprecipitated with 1 �l of an anti-Ntc20 antibody or 80 �l of an anti-HAantibody. To assay for competition between Ntr2 and Prp16, splicing wascarried out in Prp16-depleted extracts. Premixed recombinant prp16-D473A-HA and Ntr2-HA were then added to reaction mixtures at prp16-D473A-HA/Ntr2-HA molar ratios of 0, 0.04, 0.1, 0.2, and 0.4, with a final

Spliceosome Disassembly and DEAH ATPases

February 2013 Volume 33 Number 3 mcb.asm.org 515

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

concentration of 0.5 �M for Ntr2-HA, and the mixtures were subjected toimmunoprecipitation with an anti-Ntr2 or anti-Prp16 antibody. To assayfor competition between Ntr2 and Slu7, splicing reactions were carriedout with ACAC pre-mRNA in extracts immunodepleted of Slu7 and met-abolically depleted of Ntr2. Premixed recombinant Slu7-V5 and Ntr2-HAwere then added to reaction mixtures at Slu7-V5/Ntr2-HA molar ratios of0, 0.04, 0.1, 0.2, and 0.4, with a final concentration of 1 �M for Ntr2-HA,and the mixtures were subjected to immunoprecipitation with an anti-Ntr2 or anti-V5 antibody. After immunoprecipitation, RNA was ex-tracted from each reaction product, analyzed by gel electrophoresis, andquantified by using a phosphorimager.

RESULTSNTR mediates the disassembly of spliceosome intermediates.Under normal splicing conditions, NTR mediates spliceosomedisassembly after mature mRNA is released. We first askedwhether the spliceosome could be disassembled before mRNArelease by using extracts prepared from the prp22-1 mutant. Prp22is required both for the release of mRNA from the spliceosomeafter the completion of splicing and for the second catalytic reac-

tion (26, 40). In order to isolate spliceosomes for the disassemblyassay, we used antibodies against Ntc20 to precipitate the spliceo-some, since Ntc20 binds stably to the spliceosome at various stagesand remains associated with the spliceosome until the completionof the reaction (43). The precipitated spliceosomes were then in-cubated with NTR in the presence of ATP to determine whethersubstrate RNAs were released from beads (36). A scheme for theassay procedure is shown in Fig. 1A. The results of control exper-iments using an anti-Ntr1 antibody for the depletion of NTR areshown for the disassembly assay in the presence (Fig. 1B, lanes 5and 6) or absence (lanes 3 and 4) of NTR (36). Immunoprecipi-tation with an anti-Ntc20 antibody revealed that splicing in heat-inactivated prp22-1 extracts results in the accumulation of splicedproducts as well as more splicing intermediates on the spliceo-some (Fig. 1B, lane 8), suggesting that both mRNA release andsplicing reactions were affected in the prp22-1 mutant extract.When NTR was added to the precipitated spliceosome in order toassay for disassembly, approximately 40 to 60% of all species ofRNA was found in the supernatant (Fig. 1B, lanes 11 and 12).

FIG 1 Disassembly of the spliceosome formed in prp22-1 mutant extracts. (A) Scheme showing the procedure of the disassembly assay. (B) Spliceosomes formedin NTR-depleted (lanes 1 to 6) or heat-inactivated prp22-1 mutant (lanes 7 to 12) extracts were precipitated with an anti-Ntc20 antibody (lanes 2 and 8), and thepellets were incubated in the presence (lanes 5, 6, 11, and 12) or absence (lanes 3, 4, 9, and 10) of NTR. (C) After incubation, the supernatant fractions fromheat-inactivated prp22-1 mutant extracts (corresponding to panel B, lanes 10 and 12), as well as total RNA isolated from the splicing reaction mixture, werefractionated on 10-to-30% glycerol gradients. (D) RNA was extracted from each gradient fraction and was analyzed on denaturing polyacrylamide gels. IP,immunoprecipitation; dNTR, NTR-depleted extracts; �prp22, heat-inactivated prp22-1 mutant extracts; R, reaction; T, total precipitates; P, pellet; S, superna-tant.

Chen et al.

516 mcb.asm.org Molecular and Cellular Biology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

Smaller amounts of RNA were found in the supernatant after in-cubation in the absence of NTR (lanes 9 and 10). The dissociatedmaterials were analyzed by sedimentation on 10-to-30% glycerolgradients (Fig. 1C), and the RNA contents of each gradient frac-tion were further analyzed by gel electrophoresis (Fig. 1D). Whilethe RNA that was dissociated from beads after incubation in theabsence of NTR (Fig. 1D, center) consisted primarily of intactspliceosome (fractions 5 to 9), the majority of the RNA that wasdissociated in the presence of NTR (Fig. 1D, top) cosedimentedwith RNA extracted from the splicing reaction mixture (Fig. 1D,bottom) near the top of the gradient (fractions 12 to 15), indicat-ing that RNA was dissociated due to spliceosome disassembly(36). These results suggest that NTR can also mediate the disas-sembly of the spliceosome containing pre-mRNA or splicing in-termediates, and they raise the question whether NTR can associ-ate with the spliceosome at multiple stages if spliceosomeassembly is retarded. To determine whether all splicing complexesof assembly intermediates are susceptible to NTR-mediated dis-assembly, we blocked spliceosome assembly at different stages andisolated various splicing complexes by immunoprecipitation withan anti-Ntc20 antibody for disassembly assays.

Besides inhibiting mRNA release, the prp22-1 mutant dis-played a general splicing defect, as evidenced by concomitant ac-cumulation of a higher level of splicing intermediates. To specifi-cally block mRNA release without affecting other splicing steps,we used a dominant negative mutant of Prp22, prp22-S635A. TheS635A mutant is defective in RNA unwinding activity and cannotcatalyze mRNA release but is functional for the second catalyticstep and remains stably associated with the spliceosome (44).Splicing in the presence of recombinant prp22-S635A protein re-sulted in the accumulation of a large amount of lariat intron (Fig.2A, lane 3), and the spliceosome formed was resistant to disassem-bly upon incubation with NTR (Fig. 2B, lanes 9 to 12). This resultsuggests either that the dissociation of mRNA is a prerequisite forthe susceptibility of the spliceosome to NTR or that the presenceof the Prp22 protein prevents NTR association. Considering thatthe mRNA-containing spliceosome formed in heat-inactivatedprp22-1 mutant extracts was susceptible to disassembly, it is lesslikely that the association of mRNA prevented disassembly.

Binding of Prp22 and Slu7 prevented NTR-mediated spliceo-some disassembly. To determine whether the presence of Prp22would inhibit NTR-mediated spliceosome disassembly, the 3=splice site mutant ACAC pre-mRNA (45) was used for the splicingreaction. The spliceosome formed with ACAC pre-mRNA accu-mulates splicing intermediates, with Prp22 retained on the spli-ceosome (42). Incubation of the affinity-purified spliceosomewith NTR resulted in the disassembly of a very small amount of thespliceosome containing splicing intermediates (Fig. 2C, lanes 3 to7). We then depleted the extract of Prp22 in order to determinewhether the disassembly efficiency could be enhanced. Since sta-ble association of Prp22 with the spliceosome requires Slu7 (46),Slu7 was codepleted to minimize the binding of residual Prp22.An immunoblot of extracts depleted of one or both proteins isshown in Fig. 2D. Nearly 30% of the spliceosome formed in thePrp22- and Slu7-codepleted extract was disassembled (Fig. 2C,lanes 10 to 14), indicating that the presence of Prp22 and Slu7 onthe spliceosome indeed prevented NTR-mediated spliceosomedisassembly. In the absence of Prp22 and Slu7, the spliceosome issusceptible to NTR even before the completion of the splicingreaction.

Notably, the amount of the spliceosome precipitated by theanti-Ntc20 antibody from Prp22- and Slu7-depleted extracts wasconsistently much lower than that from mock-treated extracts(Fig. 2C, compare lanes 3 and 10). We reasoned that a fraction ofthe spliceosome might have been disassembled during the splicingreaction prior to immunoprecipitation. Hence, we performed asedimentation analysis to determine whether released splicing in-termediates were present in the reaction mixture. To prevent deg-radation of the released lariat intermediate, we used extracts pre-pared from a debranchase-deficient (dbr1�) strain for thisexperiment. Splicing reactions were carried out with ACAC pre-mRNA in dbr1� extracts, and the reaction mixtures were sub-jected to glycerol gradient sedimentation (Fig. 2E). In mock-treated extracts, the majority of substrate RNA was associated withthe spliceosome in fractions 5 and 6, with a small peak in lighterfractions 11 and 12. The lighter peak increased, with a decrease inthe spliceosome peak, when the extract was depleted of Prp22 andSlu7 but did not increase significantly when NTR was also de-pleted to prevent disassembly, suggesting that the lighter peak wasthe product of the disassembled spliceosome. This was confirmedby RNA analysis of gradient fractions by gel electrophoresis, whichshowed that fractions 11 and 12 contained pre-mRNA and lariatintermediate, while fractions 13 and 14 contained the excised exon1. These results indicate that the ACAC spliceosome is more sus-ceptible to disassembly in the absence of Prp22 and Slu7.

Link of Prp2 and Prp16 to spliceosome disassembly. The sus-ceptibility of the ACAC spliceosome to disassembly confirmedthat spliceosome intermediates could undergo disassembly. Wethen systematically analyzed different spliceosome intermediatesto see whether all complexes or only specific complexes are sus-ceptible to NTR-mediated disassembly. Each catalytic step of thesplicing reaction involves an ATP-dependent structural change ofthe spliceosome, which requires DEAH-box RNA helicases Prp2and Prp16, respectively, and an ATP-independent catalytic reac-tion, which requires several other proteins (19, 20, 41, 46–48). Wefirst asked whether the spliceosome was susceptible to disassemblywhen arrested before the action of Prp16. The spliceosome formedin Prp16-depleted extracts accumulated splicing intermediates(Fig. 3A, lane 1), which could be isolated by precipitation with ananti-Ntc20 antibody (lane 2). Incubation of the spliceosome withNTR did not significantly promote disassembly (Fig. 3A, lanes 2 to6), suggesting that the spliceosome that was arrested before thePrp16 step was not susceptible to disassembly. We then testedwhether the spliceosome was susceptible to disassembly after thebinding of Prp16. The ATPase mutant of Prp16, prp16-D473A,which can bind to the spliceosome but cannot dissociate from it,was used for the formation of the Prp16-associated spliceosome(49) (see Fig. S1A in the supplemental material). Splicing reac-tions were carried out in Prp16-depleted extracts, and the reactionmixtures were exhausted of ATP by incubation in the presence ofglucose before the addition of Prp16. Subsequently, the spliceo-some was precipitated with an anti-Ntc20 antibody for disassem-bly assays. Under these conditions, Prp16 was retained on thespliceosome. However, upon incubation with NTR and ATP fordisassembly assays, Prp16 could hydrolyze ATP to promote astructural change of the spliceosome and could be released fromthe spliceosome (see Fig. S1B in the supplemental material) to-gether with Yju2 and Cwc25. In contrast, the D473A mutant pro-tein would be retained on the spliceosome (see Fig. S1C in thesupplemental material). These results show that while the pres-

Spliceosome Disassembly and DEAH ATPases

February 2013 Volume 33 Number 3 mcb.asm.org 517

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

ence of the prp16-D473A mutant protein prevented the disassem-bly of the spliceosome (Fig. 3A, lanes 12 to 16), wild-type Prp16promoted a structural change of the spliceosome into a form sus-ceptible to NTR-mediated disassembly (lanes 7 to 11). The result-ing structure of the post-Prp16 spliceosome is presumably likethat formed in Prp22- and Slu7-codepleted extracts (see thescheme in Fig. 5A).

To determine whether precatalytic spliceosomes are also sus-ceptible to NTR, we formed the spliceosome in heat-inactivatedprp2-1 mutant extracts and precipitated the spliceosome with ananti-Ntc20 antibody (Fig. 3B, lane 2). The spliceosome that wasformed before the action of Prp2 was not disassembled when in-cubated with NTR (Fig. 3B, lanes 2 to 6). We then tested whether

the precatalytic spliceosome that was formed with Prp2 associatedor after the action of Prp2 was susceptible to disassembly by per-forming an experiment similar to that described above for Fig. 3A.Splicing was carried out in heat-inactivated prp2-1 extracts, andthe reaction mixtures were depleted of ATP before the addition ofrecombinant Prp2 to allow Prp2 binding. When the spliceosomethat was precipitated with an anti-Ntc20 antibody was incubatedwith NTR, ca. 40% of the spliceosome was disassembled (Fig. 3B,lanes 7 to 11), presumably due to a prior structural change of thespliceosome catalyzed by Prp2 in the presence of ATP. This resultsuggests that the spliceosome is transformed into a state that issusceptible to disassembly after the action of Prp2. The dominantnegative mutant protein prp2-S378L, which carries a mutation in

FIG 2 Binding of Prp22 and Slu7 prevented the disassembly of the spliceosome. (A) Splicing in the presence of recombinant Prp22 (lane 2) or prp22-S635A (lane3). (B) Spliceosomes formed in NTR-depleted extracts (lanes 1 to 6) or in the presence of prp22-S635A (lanes 7 to 12) were isolated by precipitation with ananti-Ntc20 antibody for disassembly assays, performed by incubation in the presence (lanes 5, 6, 11, and 12) or absence (lanes 3, 4, 9, and 10) of NTR. (C)Spliceosomes formed in mock-depleted (lanes 1 to 7) or Prp22- and Slu7-codepleted extracts (lanes 8 to 14) using ACAC pre-mRNA were isolated byprecipitation with an anti-Ntc20 antibody for disassembly assays, performed by incubation in the presence (lanes 6, 7, 13, and 14) or absence (lanes 4, 5, 11, and12) of NTR. The reaction mixtures were also precipitated with an anti-Prp22 antibody to reveal the presence (lane 2) or absence (lane 9) of Prp22. R, reaction;T, total precipitates; P, pellet; S, supernatant; �-22, anti-Prp22 antibody; �-Ntc20, anti-Ntc20 antibody. (D) Immunoblot of extracts depleted of Slu7 (lane 2),Prp22 (lane 3), or both Prp22 and Slu7 (lane 4). (E) The splicing reaction was carried out in mock-treated, Prp22/Slu7-depleted, or Prp22/Slu7/NTR-depleteddbr1� extracts with ACAC pre-mRNA, and the reaction mixtures were fractionated on 10-to-30% glycerol gradients. RNA was isolated from gradient fractionsand was analyzed on 8% polyacrylamide– 8 M urea gels. T, total reaction mixture.

Chen et al.

518 mcb.asm.org Molecular and Cellular Biology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

the helicase motif, can bind to the spliceosome but cannot disso-ciate from it (50). When prp2-S378L was used, the spliceosomewas resistant to disassembly (Fig. 3B, lanes 12 to 16), indicatingthat the Prp2-associated spliceosome is not susceptible to disas-sembly but that the action of Prp2 is required to render the spli-ceosome susceptible.

Taken together, our results demonstrate that the NTR complexcan catalyze the disassembly of the spliceosome arrested specifi-cally after the action of Prp2 or Prp16 but not at steps before theiractions or upon their binding to the spliceosome. To exclude thepossibility that the presence of substrate RNAs in the supernatantfractions in the disassembly assay was due to nonspecific dissoci-ation of the spliceosome from beads during incubation, weshowed that the release of substrate RNAs depends on functionalPrp43 by using the NTR complex reconstituted with Prp43 ATPasemutant prp43-T123A (27, 37), which did not promote the releaseof substrate RNA from beads (see Fig. S2 in the supplementalmaterial). We further analyzed the supernatant fraction from thepost-Prp16 spliceosome on glycerol gradients to reveal that thereleased RNAs sedimented as naked RNAs, indicative of a disas-sembled spliceosome (see Fig. S3 in the supplemental material).

Removal of Cwc25 is required for disassembly of the precata-lytic spliceosome. It is interesting that NTR mediates spliceosomedisassembly only after the action of DEAH-box proteins. The

functions of Prp2 and Prp16 have recently been shown to be as-sociated with the release of SF3a/b and Yju2/Cwc25, respectively(21, 23, 24). Both SF3b and Cwc25 are implicated in binding to thespliceosome at the catalytic center. SF3b binds directly to thebranch site at early steps of spliceosome assembly and is releasedupon the action of Prp2 (21, 24). Cwc25 binds to the spliceosomeafter the release of SF3a/b to promote the first catalytic reactionand is then released from the spliceosome upon the action ofPrp16 (23, 47). The binding of Cwc25 to the spliceosome is inhib-ited by mutations at the branch point, suggesting that Cwc25might bind to the pre-mRNA near the branch site (23). This issupported by site-specific photo-cross-linking of Cwc25 to pre-mRNA carrying a single 4-thiouridine (4sU) residue 3 basesdownstream of the branch point (see Fig. S4 in the supplementalmaterial). In this context, the spliceosome may be susceptible todisassembly only when specific factors binding to the catalyticcenter are removed. We tested whether the spliceosome assembledin Cwc25-depleted extracts is susceptible to disassembly. Cwc25 isrecruited to the spliceosome immediately before the first catalyticreaction. Spliceosomes formed in Cwc25-depleted extracts con-tain all the other factors required to promote the reaction and canbe chased to yield splicing intermediates upon the addition ofrecombinant Cwc25 (47). When NTR was added to the spliceo-some isolated by precipitation with an anti-Ntc20 antibody,nearly half of the precatalytic spliceosome was dissociated frombeads (Fig. 4A, lanes 5 and 6). The spliceosome formed in Cwc25-depleted extracts is at the post-Prp2 stage, at which SF3b has beenremoved from the branch site. To exclude the possibility that the

FIG 3 Disassembly of spliceosomes formed after the actions of Prp16 andPrp2. (A) The splicing reaction was carried out in Prp16-depleted extracts.Following the depletion of ATP, either no Prp16 (lanes 1 to 6), wild-type Prp16(lanes 7 to 11), or prp16-D473A (lanes 12 to 16) was added to the reactionmixture, and the spliceosome was isolated by precipitation with an anti-Ntc20antibody for disassembly assays, performed by incubation in the presence(lanes 5, 6, 10, 11, 15, and 16) or absence (lanes 3, 4, 8, 9, 13, and 14) of NTR.(B) The splicing reaction was carried out in heat-inactivated prp2-1 mutantextracts. Following the depletion of ATP, either no Prp2 (lanes 1 to 6), wild-type Prp2 (lanes 7 to 11), or prp2-S378L (lanes 12 to 16) was added to thereaction mixture, and the spliceosome was isolated for disassembly assays asdescribed for panel A. R, reaction; T, total precipitates; P, pellet; S, supernatant.

FIG 4 NTR can disassemble the spliceosome in the absence of Cwc25. (A) Thesplicing reaction was carried out in Cwc25-depleted extracts, and the spliceo-some was isolated for disassembly assays by precipitation of the reaction mix-ture (lane 1) with an anti-Ntc20 antibody (lane 2), followed by incubation inthe presence (lanes 5 and 6) or absence (lanes 3 and 4) of NTR. (B) The splicingreaction was carried out in Cwc25-depleted Yju2-V5 extracts, and the spliceo-some was isolated for disassembly assays by precipitation of the reaction mix-ture (lane 1) with an anti-V5 antibody (lane 2), followed by incubation in thepresence (lanes 5 and 6) or absence (lanes 3 and 4) of NTR. (C) The splicingreaction was carried out with brC pre-mRNA, and the spliceosome was iso-lated for disassembly assays by precipitation of the reaction mixture (lane 1)with an anti-Ntc20 antibody (lane 2), followed by incubation in the presence(lanes 5 and 6) or absence (lanes 3 and 4) of NTR. R, reaction; T, total precip-itates; P, pellet; S, supernatant.

Spliceosome Disassembly and DEAH ATPases

February 2013 Volume 33 Number 3 mcb.asm.org 519

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

fraction of the spliceosome susceptible to disassembly representsthat without Yju2 bound, we specifically isolated a Yju2-contain-ing spliceosome for disassembly assays. The spliceosome formedin Cwc25-depleted Yju2-V5 extracts was precipitated with an an-ti-V5 antibody and was incubated with NTR in order to examinedisassembly (Fig. 4B). More than half of the spliceosome was dis-sociated from beads (Fig. 4B, lanes 5 and 6), indicating that theassociation of Yju2 did not prevent disassembly. Together, theseresults suggest that disassembly of the precatalytic spliceosomerequires only the preclusion of Cwc25 binding.

We have shown previously that stable association of Cwc25with the spliceosome is greatly affected by mutations at the branchpoint sequence and that in the absence of ATP hydrolysis, thebinding of Prp16 stabilizes the association of Cwc25 to promotethe reaction (23). In the presence of ATP, Prp16 promotes thedissociation of Cwc25 from the spliceosome to prevent splicingupon ATP hydrolysis. Conceivably, the spliceosome assembled onbranch point mutant pre-mRNA, particularly in the absence ofPrp16, is susceptible to disassembly due to poor binding of Cwc25.Indeed, when the spliceosome that was formed on pre-mRNAcarrying an A-to-C mutation at the branch point (brC) was pre-cipitated with an anti-Ntc20 antibody, ca. 40% was dissociatedfrom beads after incubation with NTR (Fig. 4C, lanes 5 and 6).This further finding confirms that prevention of the binding ofCwc25 to the spliceosome is critical for NTR-mediated disassem-bly of the precatalytic spliceosome.

Differential affinity of Ntr2 for different spliceosome inter-mediates. We next addressed the question of whether the suscep-tibility of splicing complexes to disassembly correlates with theirability to recruit NTR. We have shown previously that Ntr2 me-diates the recruitment of NTR to the spliceosome via its interac-tion with Brr2 and that Ntr2 alone can bind the spliceosome (37).The capacity of splicing complexes for Ntr2 binding may reflecttheir ability to recruit NTR. To assay for Ntr2 binding of differentsplicing complexes, splicing was carried out under various condi-tions to arrest the spliceosome at different stages. Increasingamounts of recombinant Ntr2-HA were then added to the reac-tion mixtures, followed by precipitation with an anti-HA or anti-Ntc20 antibody (Fig. 5A). For precatalytic steps, spliceosomeswere arrested by using heat-inactivated prp2-1 mutant extracts(Fig. 5Aa), by the addition of Prp2, purified from Prp2-overex-pressing extracts, to the splicing reaction mixture after ATP deple-tion (Fig. 5Ab), or by the depletion of Yju2 from extracts (Fig.5Ac). For poststep 1, spliceosomes were arrested by the depletionof Prp16 (Fig. 5Ad), by the addition of diluted Prp16-overexpress-ing extracts, which overproduce Prp16 around 20-fold (see Fig. S5in the supplemental material), to the splicing reaction mixtureafter ATP depletion (Fig. 5Ae), by the depletion of Slu7 (Fig. 5Af),or by using ACAC pre-mRNA (Fig. 5Ag). For postcatalytic spli-ceosomes, splicing was performed in the presence of prp22-S635A(Fig. 5Ah). For terminal-stage spliceosomes, splicing was carriedout in Ntr1-depleted extracts (Fig. 5Ai). The amounts of Ntr2-bound spliceosomes were quantified by a phosphorimager andwere normalized to those of Ntc20-bound spliceosomes (Fig. 5A,lanes 2) after subtraction of the amount of RNA precipitated in theabsence of Ntr2-HA (lanes 3). The percentages of the Ntr2-boundspliceosome were then plotted against the amounts of Ntr2-HAadded (Fig. 5B).

It is noteworthy that the percentage of the Ntr2-bound spliceo-some may be slightly underestimated due to the presence of en-

dogenous Ntr2, which is estimated at approximately 8 ng in eachreaction mixture, except for Ntr1-depleted extracts (Fig. 5Ai), inwhich Ntr2 was codepleted (36). Nevertheless, the results showthat the splicing complexes can be classified into three groupsbased on their affinities for Ntr2. The terminal-stage spliceosome,which is the original substrate of the NTR complex in normalsplicing reactions, bound Ntr2 with the highest affinity (indicatedby a black circle), and approximately 30% or 40% of the Ntc20-bound spliceosome contained Ntr2-HA when 20 ng or 200 ng,respectively, of Ntr2-HA was added (Fig. 5Ai). Spliceosome inter-mediates susceptible to disassembly (post-Prp2 [Fig. 5Ac] andpost-Prp16 [Fig. 5Af]) bound Ntr2 with intermediate affinity (in-dicated by black squares), with approximately 20% of the Ntc20-bound spliceosome containing Ntr2-HA when 200 ng of Ntr2-HAwas added. These splicing complexes can also bind the NTR com-plex, as revealed by the binding of exogenously added mutantprp43-T123A to the spliceosome formed in Yju2-depleted orSlu7-depleted extracts (see Fig. S6 in the supplemental material).In contrast, only barely detectable amounts of the spliceosomewere precipitated in the presence of 20 ng of Ntr2, and less than10% of the Ntc20-bound spliceosome contained Ntr2-HA, with asmuch as 500 ng of Ntr2 added for pre-Prp2 (Fig. 5Aa), Prp2-bound (Fig. 5Ab), Prp16-bound (Fig. 5Ae), and Prp22-bound(Fig. 5Ag and h) spliceosomes, none of which are susceptible todisassembly. To exclude the possibility that the HA epitope ofNtr2-HA was not as accessible to the antibody in these spliceo-somes as in the others, poor binding of Ntr2 to these spliceosomeswas further confirmed by their inability to efficiently recruitprp43-T123A to the spliceosome (see Fig. S7 in the supplementalmaterial). As an exception, the pre-Prp16 spliceosome, which re-tained Yju2 and Cwc25 and was not susceptible to disassembly,bound Ntr2 with intermediate affinity (Fig. 5Ad). Furthermore,the purified NTR complex could also bind to the pre-Prp16 spli-ceosome in the absence of ATP (Fig. 5C, lane 8). These resultssuggest that splicing complexes that do not bind Ntr2 well aregenerally not susceptible to disassembly, but not all of the com-plexes that are able to bind NTR well are susceptible. Taken to-gether, our results reveal two important structural features of thespliceosome that is susceptible to disassembly: (i) the ability tobind Ntr2 with good affinity and (ii) the removal of specific pro-teins that bind at the catalytic center.

Competitive inhibition of Ntr2 binding by Prp16 and Slu7.The results discussed above show that NTR can mediate the dis-assembly of the spliceosome when it is arrested at the post-Prp2 orpost-Prp16 stage, yet NTR needs to be precluded in order to avoidthe disassembly of spliceosome intermediates under normal splic-ing reactions. Conceivably, splicing factors from various steps ofthe pathway may compete with Ntr2 to prevent its binding to thespliceosome. Brr2 has been shown, by yeast two-hybrid analysis,to interact with Prp2, Prp16, and Slu7 via the second helicasedomain (51). As with Ntr2, such interactions might play roles inrecruiting these proteins to the spliceosome during the catalyticsteps. We first used two-hybrid assays to determine whether Ntr2also interacts with the second helicase domain of Brr2 (Fig. 6A).The Brr2 protein is roughly divided into five regions carrying theamino-terminal (N), first helicase (H1), middle (M), second heli-case (H2), and carboxyl-terminal (C) segments. Figure 6A showsthat the N-terminal half of the protein (amino acid residues 1 to1369), comprising the N, H1, and M segments, or a fragmentcontaining the C-terminal sequence alone (amino acid residues

Chen et al.

520 mcb.asm.org Molecular and Cellular Biology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

1713 to 2163), does not interact with Ntr2. However, the carboxy-terminal half of the protein (amino acid residues 1209 to 2163)comprising H2 and C interacts with Ntr2. Thus, Ntr2 also inter-acts with the second helicase domain of Brr2, and its binding to thespliceosome may be prevented by Prp2, Prp16, and Slu7 duringthe progression of the spliceosome pathway.

To determine whether the spliceosome binding of Ntr2 can becompromised by Prp16, we performed competition assays. Splic-ing was carried out in Prp16-depleted extracts, and premixed re-combinant Ntr2 and prp16-D473A were then added to the reac-tion mixtures at different ratios with a fixed Ntr2 concentration of500 nM (Fig. 6B). The Ntr2-bound spliceosome was isolated byprecipitation with an anti-Ntr2 antibody, and the percentage of

Ntr2 that remained bound in the presence of prp16-D473A wasplotted against the ratio of the amount of prp16-D473A to that ofNtr2. Figure 6C shows that the amount of Ntr2-bound spliceo-some was reduced by more than 40% in the presence of 20 nMprp16-D473A (at a ratio of 0.04) and by 80% at 100 nM prp16-D473A (at a ratio of 0.2), indicating that Prp16 binds better thanNtr2 to the pre-Prp16 spliceosome and can compete with Ntr2 forbinding to remove NTR from the spliceosome.

A similar competition experiment was performed with Slu7.Splicing reactions were carried out in Slu7-depleted extracts byusing ACAC pre-mRNA. To prevent disassembly of the spliceo-some in the absence of Slu7, extracts metabolically depleted ofNtr2 were used for this experiment (37). Premixed recombinant

FIG 5 Differential affinity of Ntr2 for spliceosomes arrested at various stages. (A) The splicing reaction was carried out under the following conditions: splicingin heat-inactivated prp2-1 extracts (a), splicing in heat-inactivated prp2-1 extracts, followed first by ATP depletion and then by the addition of purified yeast Prp2(b), splicing in Yju2-depleted (dYju2) extracts (c), splicing in Prp16-depleted extracts (d), splicing in Prp16-depleted extracts, followed first by ATP depletion andthen by the addition of Prp16-overexpressing yeast extracts (e), splicing in Slu7-depleted extracts (f), splicing with ACAC pre-mRNA (g), splicing in the presenceof recombinant prp22-S635A (h), or splicing in Ntr1-depleted extracts (i). The reaction mixtures (lanes 1) were precipitated with an anti-Ntc20 antibody (lanes2) or an anti-HA antibody either without the addition of Ntr2-HA (lanes 3) or following the addition of 20 ng (lanes 4), 50 ng (lanes 5), 100 ng (lanes 6), 200 ng(lanes 7), or 500 ng (lanes 8) of recombinant Ntr2-HA. (B) The results shown in panel A were quantified using a phosphorimager, and the percentage of thespliceosome precipitated by the anti-Ntc20 antibody that was also precipitated by the anti-HA antibody was plotted as a function of the amount of recombinantNtr2-HA added. (C) Splicing reactions were carried out in mock- or Prp16-depleted extracts, and the reaction mixture was depleted of ATP by the addition of10 mM glucose followed by incubation at 25°C for 5 min. Upon the addition of recombinant Ntr2 (lanes 3 and 7) or an affinity-purified NTR complex (lanes 4and 8), the reaction mixtures were precipitated with an anti-Ntr2 antibody (lanes 2 to 4 and 6 to 8).

Spliceosome Disassembly and DEAH ATPases

February 2013 Volume 33 Number 3 mcb.asm.org 521

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

Ntr2 at a final concentration of 1 �M and various amounts ofSlu7-V5 protein were added to the reaction mixtures. The Ntr2-and Slu7-bound spliceosome was then precipitated by an anti-Ntr2 and an anti-V5 antibody, respectively (Fig. 6D), and the per-centage of Ntr2 that remained bound in the presence of Slu7 wasplotted against the ratio of the amount of Slu7 to that of Ntr2 (Fig.6E). Figure 6E shows that the amount of Ntr2-bound spliceosomewas reduced by 25% in the presence of 40 nM Slu7 (at a ratio of0.04), indicating that Slu7 also binds better than Ntr2 to the post-Prp16 spliceosome. The amount of Ntr2-bound spliceosome wasreduced by approximately 50% at 400 nM Slu7 (at a ratio of 0.4).Further increases in the amount of Slu7 did not prevent more Ntr2binding to the spliceosome (data not shown). Since stable bindingof Slu7 to the spliceosome is facilitated by the presence of Prp22(46), it is possible that the amount of endogenous Prp22 is notsufficient to support Slu7 binding when Slu7 is added in largeamounts. Alternatively, Prp22-dependent rejection of the spliceo-

some might prevent further inhibition of Ntr2 binding by Slu7.Furthermore, the pre-Prp16 spliceosome appeared to accumulatein larger amounts in the absence of Slu7 and accounted for afraction of the spliceosome whose binding of Ntr2 was resistant toinhibition by Slu7, as the addition of Prp16 was also able to inhibitNtr2 binding under such conditions (see Fig. S8 in the supplemen-tal material). Taken together, our results show that in the presenceof Prp16 or Slu7, binding of Ntr2 to the pre-Prp16 or post-Prp16spliceosome is competitively inhibited, providing a mechanism toprevent NTR from disassembling spliceosome intermediates un-der normal splicing conditions.

DISCUSSION

DEXD/H-box proteins Prp43 and Brr2 have been demonstratedto play roles in spliceosome disassembly (25, 27, 32, 36). Prp43associates with Ntr1 and Ntr2 to form the NTR complex, whichmediates disassembly. Ntr1 interacts with Prp43 via its G-patch

FIG 6 Competition of Prp16 and Slu7 with Ntr2 for spliceosome binding. (A) Yeast two-hybrid assays showing the region of Brr2 interacting with Ntr2. N,amino terminus; H1, 1st helicase domain; M, middle region; H2, 2nd helicase domain; C, carboxy terminus; BD, binding domain; AD, activation domain; V,vector; FL, full length. (B) Splicing reactions were carried out in Prp16-depleted extracts. To the reaction mixture were added premixed recombinant Ntr2 andprp16-D473A with a final concentration of 500 nM for Ntr2 (lanes 1 to 15) and a final concentration of 0 nM (lanes 1 to 3), 20 nM (lanes 4 to 6), 50 nM (lanes7 to 9), 100 nM (lanes 10 to 12), or 200 nM (lanes 13 to 15) for prp16-D473A. The mixtures were immunoprecipitated with an anti-Prp16 antibody (lanes 2, 5,8, 11, and 14) or an anti-Ntr2 antibody (lanes 3, 6, 9, 12, and 15). RXN, 1/10 of reaction mixture. (C) The results shown in panel B were quantified using aphosphorimager, and the percentage of Ntr2 that remained bound to the spliceosome in the presence of prp16-D473A was plotted against the ratio of the amountof prp16-D473A to that of Ntr2. (D) Splicing reactions were carried out with ACAC pre-mRNA in extracts depleted of Slu7 in vitro and metabolically depletedof Ntr2. To the reaction mixture were added premixed recombinant Ntr2 and Slu7-V5 with a final concentration of 1,000 nM for Ntr2 (lanes 1 to 15) and a finalconcentration of 0 nM (lanes 1 to 3), 40 nM (lanes 4 to 6), 100 nM (lanes 7 to 9), 200 nM (lanes 10 to 12), or 400 nM (lanes 13 to 15) for Slu7-V5. The mixtureswere immunoprecipitated with an anti-V5 antibody (lanes 2, 5, 8, 11, and 14) or an anti-Ntr2 antibody (lanes 3, 6, 9, 12, and 15). (E) The results shown in panelD were quantified using a phosphorimager, and the percentage of Ntr2 that remained bound to the spliceosome in the presence of Slu7-V5 was plotted againstthe ratio of the amount of Slu7-V5 to that of Ntr2.

Chen et al.

522 mcb.asm.org Molecular and Cellular Biology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

domain (36), which also stimulates the helicase activity of Prp43(30), and with Ntr2 via its middle region. Ntr2 mediates the bind-ing of NTR to the spliceosome and can bind itself to the spliceo-some via the interaction with Brr2 (37). Mutations in Brr2 havealso been shown to impede the dissociation of lariat-intron andthe separation of U2 and U6 from the Prp43-associated spliceo-some (32). In view of the fact that U5 is associated with the spli-ceosome early during spliceosome assembly, it is possible thatNTR can be recruited to mediate the disassembly of the spliceo-some at early steps of the pathway. Several genetic studies supportthis notion. NTR1 (also named SPP382) was also identified as asuppressor of the prp38-1 mutation. Prp38 is a component of yeasttri-snRNP and is required for the activation of the spliceosome(52). Several mutations in PRP43 affecting ATPase activity havealso been shown to suppress the growth defect of the prp38-1mutation with efficiencies inversely proportionate to the mea-sured ATPase activities (53), suggesting that reducing the activityof Prp43 could partially compensate for impaired spliceosomeassembly. Recently, it has been further demonstrated that Prp43promotes the discarding of spliceosome intermediates, cooperat-ing with the function of Prp16 and Prp22 in proofreading thesplicing reaction (38, 39). By systematic in vitro analysis, we showhere that NTR can mediate the disassembly of spliceosome inter-mediates, but only at defined stages of the pathway. NTR canfunction after the ATP-dependent action of each DEAH-box pro-tein—Prp2, Prp16, and Prp22— but not prior to their action orwhile they are associated with the spliceosome (Fig. 5A). This ob-servation indicates that NTR is functionally linked to theseDEAH-box proteins.

Disassembly of the spliceosome requires prior removal ofproteins binding to the catalytic center. The action of Prp2,Prp16, and Prp22 is associated with the release or destabilizationof spliceosomal components binding at the catalytic center at eachspecific stage. SF3b components bind to the branch site duringspliceosome assembly, and prior to catalysis, they are destabilizedor lost from the spliceosome depending on the wash conditions,indicating that the mode of their interaction with the spliceosomeis changed upon the action of Prp2 (21, 22, 24). Prior to the actionof Prp2, when SF3a/b are still tightly associated, the spliceosome isnot susceptible to disassembly, and only after SF3a/b are destabi-lized does the spliceosome become susceptible. Destabilization ofSF3a/b allows the binding of Cwc25 to promote the first catalyticreaction. In the absence of Cwc25, the stalled precatalytic spliceo-some is susceptible to disassembly, and the presence of anotherstep-one factor, Yju2, does not prevent the disassembly of thespliceosome. After lariat formation, the action of Prp16 is re-quired to remove Yju2 and Cwc25 from the spliceosome so as toprepare for the second catalytic reaction. With Yju2 and Cwc25associated, the spliceosome is not susceptible to disassembly. Therelease of Yju2 and Cwc25 allows the step-two factors, Slu7,Prp18, and Prp22, to bind to the substrate RNA at the 3= splice siteto promote the second reaction. In the absence of Slu7 and Prp22,the stalled spliceosome is also susceptible to disassembly, and sta-ble association of Prp22 and Slu7 prevents spliceosome disassem-bly. After exon ligation, Prp22 catalyzes the release of mRNA andis itself dissociated from the spliceosome together with Slu7 andPrp18. At this terminal stage, the second-step factors are removedfrom the catalytic center, and the spliceosome is readily disassem-bled. Taken together, these results strongly suggest that specificfactors binding at the catalytic center at each catalytic step have to

be removed for the spliceosome to be susceptible to NTR-medi-ated disassembly. How the binding of these proteins prevents dis-assembly is not known. RNA base pairings form the framework ofthe catalytic center of the spliceosome but are stabilized by thebinding of protein factors. At each catalytic step, destabilization ofthese proteins presumably allows more structural dynamics in thecatalytic center of the spliceosome so that the positioning of splicesites can be adjusted. It is possible that such dynamics may alsocreate a fragile environment in which the spliceosome is suscepti-ble to disassembly.

Stable binding of NTR to the spliceosome is required but notsufficient for mediating disassembly. On examining the correla-tions between the susceptibilities of different splicing complexesto disassembly and their affinities for NTR binding, we found thatsplicing complexes can be classified into three groups based ontheir affinities for Ntr2. As expected, the lariat-intron-associatedspliceosome, as the authentic substrate for NTR under normalsplicing conditions, binds Ntr2 with a much higher affinity thanany of the other complexes analyzed. Spliceosomes formed inYju2-depleted or Slu7-depleted extracts, corresponding to post-Prp2 and post-Prp16 spliceosomes, respectively, also bind Ntr2but with a lower affinity. All the complexes that are not susceptibleto disassembly bind Ntr2 poorly, except for the pre-Prp16 spliceo-some, which binds Ntr2 with an affinity comparable to that ofpost-Prp2 and post-Prp16 spliceosomes. These results suggestthat distinct structural features of the spliceosome may determineits affinity for Ntr2. Alternatively, the binding site of Ntr2 may beblocked by other spliceosomal components to preclude prema-ture disassembly of functional spliceosomes. Although complexesthat hardly bind Ntr2 are consistently not susceptible to disassem-bly, not all complexes that bind Ntr2 with intermediate affinity aresusceptible to disassembly. For example, in the case of the pre-Prp16 spliceosome, the binding of Cwc25 precludes the disassem-bly of the spliceosome.

It is worth noting that despite its ability to access spliceosomeintermediates stalled at specific stages, NTR has to be excludedfrom the splicing pathway before the completion of the reaction toavoid premature disassembly of functional spliceosomes duringthe splicing reaction. One way to exclude NTR is through com-petitive binding of specific splicing factors to the same site of thespliceosome. We show that Ntr2 interacts with Brr2 through thesecond helicase domain, which has been shown by two-hybridassays to interact with Prp2, Prp16, and Slu7 also (51). It is likelythat Brr2 serves as the platform for recruiting these factors at var-ious stages of the spliceosome pathway. Conceivably, competitiveinteraction of Prp2, Prp16, or Slu7 may block the interaction ofNtr2 with Brr2 to prevent NTR recruitment. In agreement withthis notion, the binding of Ntr2 to pre-Prp16 and post-Prp16spliceosomes is greatly reduced by the presence of Prp16 or Slu7,respectively. Furthermore, the Prp2-, Prp16-, and Slu7-boundspliceosomes all have very low capacities for Ntr2 binding, but thedisassembly-resistant pre-Prp16 spliceosome can bind Ntr2 muchbetter with none of these Brr2-interacting factors bound. Theseresults support the model of competitive exclusion of NTR fromthe spliceosome under normal splicing conditions.

For the post-Prp2 spliceosome, the binding of Cwc25 to thespliceosome is expected to be more favorable than that of Ntr2 inpreventing premature disassembly. Nevertheless, Cwc25 was notobserved to compete for Ntr2 binding to the purified post-Prp2spliceosome (data not shown). Nor does Cwc25 interact with Brr2

Spliceosome Disassembly and DEAH ATPases

February 2013 Volume 33 Number 3 mcb.asm.org 523

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

by yeast two-hybrid assays (data not shown). The mechanism un-derlying the prevention of NTR-mediated disassembly of thepost-Prp2 spliceosome is unknown. We speculate that Cwc25might be kinetically favored by the post-Prp2 spliceosome, andupon binding to the spliceosome, Cwc25 may rapidly promote thefirst reaction and remain stably bound to the spliceosome to pre-vent NTR-mediated disassembly.

Linkage of spliceosome disassembly with proofreading.DEXD/H-box ATPases have been implicated in proofreading pre-mRNA splicing at multiple steps (54–56). Prp16 was first found toenhance the fidelity of branch site recognition, since mutations inPRP16 increase the accumulation of aberrant branch site interme-diates (54). A kinetic proofreading mechanism was proposed forthe role of Prp16 in fidelity control by coupling ATP hydrolysiswith a discard pathway to remove incorrect RNA splicing inter-mediates from the normal splicing pathway (54, 57), but not untilrecently was a detailed molecular mechanism of the proofreadingprocess uncovered (23, 38, 58). Using a modified U6 with sulfursubstituting for a nonbridging oxygen at position U80, whichbinds Mg2� in the first catalytic reaction (59), Koodathingal et al.showed that Prp16 mediates the rejection of the slow spliceosomebefore 5= splice site cleavage and that Prp43 is required for thedisassembly of the rejected spliceosome (38). We showed previ-ously that Prp16 mediates the release of Yju2 and Cwc25 after thefirst catalytic reactions under normal splicing conditions butcould do so before the reaction when catalysis is slow due to mu-tations at the branch point. This result suggests that Prp16 mayfunction in proofreading by removing Cwc25 to prevent the cat-alytic reaction (23). Here we show further that NTR can mediatethe disassembly of precatalytic spliceosomes devoid of Cwc25. To-gether, these results suggest that a slow spliceosome is likely des-tined for disassembly after Prp16-mediated rejection throughCwc25 removal.

Similarly, Prp22 has been shown to repress the splicing of ab-errant intermediates and to enhance splicing fidelity by mediatingthe rejection of the spliceosome in an ATP-dependent manner(55), and the rejected intermediates have been shown to be dis-carded via Prp43 (39). The 3= splice site mutant pre-mRNA ACACformed spliceosomes that accumulate splicing intermediates.Prp22, Slu7, and Prp18 remain bound to such spliceosomes butcannot promote the second catalytic reaction (46). We show thatNTR cannot catalyze the disassembly of the purified ACAC spli-ceosome but that prior depletion of Prp22 and Slu7 from theextract rendered it susceptible to disassembly, suggesting thatPrp22 and Slu7 protect the spliceosome from disassembly. In thisview, Prp22 may mediate the rejection of the spliceosome by hy-drolyzing ATP; dissociation of Prp22 from the spliceosome to-gether with Slu7 and Prp18 then allows NTR to access the spliceo-some to elicit disassembly. In agreement with this notion,disassembly of the ACAC spliceosome in the absence of Prp22 andSlu7 was observed in the splicing reaction without prior purifica-tion of the spliceosome. We found that the amount of the spliceo-some containing splicing intermediates was consistently smallerin Prp22- and Slu7-depleted extracts than in control extracts.When splicing reaction mixtures were analyzed by glycerol gradi-ent sedimentation, free lariat intermediate was detected in thereaction mixture from Prp22- and Slu7-depleted extracts, indicat-ing that a portion of the spliceosome was disassembled during thesplicing reaction.

Prp5 has also been proposed to proofread the U2-branch site

pairing in an early step of the spliceosome pathway (56), but thefate of the rejected spliceosome is not known. Since Prp5 acts earlybefore the binding of tri-snRNP, it is questionable that NTR canbe recruited to the spliceosome to mediate disassembly at thisstage. Still, it will be interesting to follow the fate of the rejectedspliceosome mediated by Prp5.

ACKNOWLEDGMENTS

We thank J. Staley for critical comments on the manuscript. We also thankH.-C. Yeh, Ben Liu, and W.-C. Ching for help in the preparation of anti-bodies, members of S.-C. Cheng’s laboratory for helpful discussions, andH. Kuhn for English editing.

This work was supported by a grant from the Academia Sinica and theNational Science Council (Taiwan), NSC100-2745-B-001-001-ASP.

REFERENCES1. Brow DA. 2002. Allosteric cascade of spliceosome activation. Annu. Rev.

Genet. 36:333–360.2. Burge CB, Tuschl TH, Sharp PA. 1999. Splicing of precursors to mRNAs

by the spliceosome, p 525–560. In Gesteland RF, Cech TR, Atkins JF (ed),The RNA world, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

3. Wahl MC, Will CL, Lührmann RL. 2009. The spliceosome: design prin-ciples of a dynamic RNP machine. Cell 136:701–718.

4. Will CL, Lührmann R. 2006. Spliceosome structure and function, p 369 – 400. In Gesteland RF, Cech TR, Atkins JF (ed), The RNA world,3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

5. Bessonov S, Anokhina M, Will CL, Urlaub H, Lührmann R. 2008.Isolation of an active step I spliceosome and composition of its RNP core.Nature 452:846 – 850.

6. Chan S-P, Cheng S-C. 2005. The Prp19-associated complex is requiredfor specifying interactions of U5 and U6 with pre-mRNA during spliceo-some activation. J. Biol. Chem. 280:31190 –31199.

7. Chan S-P, Kao D-I, Tsai W-Y, Cheng S-C. 2003. The Prp19p-associatedcomplex in spliceosome activation. Science 302:279 –282.

8. Makarov EM, Makarova OV, Urlaub H, Gentzel M, Will CL, Wilm M,Lührmann R. 2002. Small nuclear ribonucleoprotein remodeling duringcatalytic activation of the spliceosome. Science 298:2205–2208.

9. Makarova OV, Makarov EM, Urlaub H, Will CL, Gentzel M, Wilm M,Lührmann R. 2004. A subset of human 35S U5 proteins, including Prp19,function prior to catalytic step 1 of splicing. EMBO J. 23:2381–2391.

10. Campodonico E, Schwer B. 2002. ATP-dependent remodeling of thespliceosome: intragenic suppressors of release-defective mutants of Sac-charomyces cerevisiae Prp22. Genetics 160:407– 415.

11. Chen JY-F, Stands L, Staley JP, Jackups RR, Jr, Latus LJ, Chang T-H.2001. Specific alterations of U1-C protein or U1 small nuclear RNA caneliminate the requirement of Prp28p, an essential DEAD box splicingfactor. Mol. Cell 7:227–232.

12. Raghunathan PL, Guthrie C. 1998. RNA unwinding in U4/U6 snRNPsrequires ATP hydrolysis and the DEIH-box splicing factor Brr2. Curr.Biol. 8:847– 855.

13. Schwer B. 2001. A new twist on RNA helicases: DExH/D box proteins asRNPases. Nat. Struct. Biol. 8:113–116.

14. Schwer B, Guthrie C. 1992. A conformational rearrangement in thespliceosome is dependent on PRP16 and ATP hydrolysis. EMBO J. 11:5033–5040.

15. Staley JP, Guthrie C. 1999. An RNA switch at the 5= splice site requiresATP and the DEAD box protein Prp28p. Mol. Cell 3:55– 64.

16. Fleckner J, Zhang M, Valcárcel J, Green MR. 1997. U2AF65 recruits anovel human DEAD box protein required for the U2 snRNP-branchpointinteraction. Genes Dev. 11:1864 –1872.

17. Kistler AL, Guthrie C. 2001. Deletion of MUD2, the yeast homolog ofU2AF65, can bypass the requirement for Sub2, an essential spliceosomalATPase. Genes Dev. 15:42– 49.

18. Ruby SW, Chang T-H, Abelson J. 1993. Four yeast spliceosomal proteins(PRP5, PRP9, PRP11, and PRP21) interact to promote U2 snRNP bindingto pre-mRNA. Genes Dev. 7:1909 –1925.

19. Jones MH, Frank DN, Guthrie C. 1995. Characterization and functionalordering of Slu7p and Prp17p during the second step of pre-mRNA splic-ing in yeast. Proc. Natl. Acad. Sci. U. S. A. 92:9687–9691.

Chen et al.

524 mcb.asm.org Molecular and Cellular Biology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.

20. Kim S-H, Lin R-J. 1996. Spliceosome activation by PRP2 ATPase prior tothe first transesterification reaction of pre-mRNA splicing. Mol. Cell. Biol.16:6810 – 6819.

21. Lardelli RM, Thompson JX, Yates JR, III, Stevens SW. 2010. Release ofSF3 from the intron branchpoint activates the first step of pre-mRNAsplicing. RNA 16:516 –528.

22. Ohrt T, Prior M, Dannenberg J, Odenwalder P, Dybkov O, Rasche N,Schmitzova J, Gregor I, Fabrizio P, Enderiein J, Lührmann R. 2012.Prp2-mediated protein rearrangements at the catalytic core of the spliceo-some as revealed by dcFCCS. RNA 18:1244 –1256.

23. Tseng C-K, Liu H-L, Cheng S-C. 2011. DEAH-box ATPase Prp16 hasdual roles in remodeling of the spliceosome in catalytic steps. RNA 17:145–154.

24. Warkocki Z, Odenwälder P, Schmitzová J, Platzmann F, Stark H,Urlaub H, Ficner R, Fabrizio P, Lührmann R. 2009. Reconstitution ofboth steps of Saccharomyces cerevisiae splicing with purified spliceosomalcomponents. Nat. Struct. Mol. Biol. 16:1237–1243.

25. Arenas JE, Abelson JN. 1997. Prp43: an RNA helicase-like factor involvedin spliceosome disassembly. Proc. Natl. Acad. Sci. U. S. A. 94:11798 –11802.

26. Company M, Arenas J, Abelson J. 1991. Requirement of the RNA heli-case-like protein PRP22 for release of messenger RNA from spliceosomes.Nature 349:487– 493.

27. Martin A, Schneider S, Schwer B. 2002. Prp43 is an essential RNA-dependent ATPase required for release of lariat-intron from the spliceo-some. J. Biol. Chem. 277:17743–17750.

28. Wagner JD, Jankowsky E, Company M, Pyle AM, Abelson JN. 1998.The DEAH-box protein PRP22 is an ATPase that mediates ATP-dependent mRNA release from the spliceosome and unwinds RNA du-plexes. EMBO J. 17:2926 –2937.

29. Maeder C, Kutach AK, Guthrie C. 2009. ATP-dependent unwinding ofU4/U6 snRNAs by the Brr2 helicase requires the C terminus of Prp8. Nat.Struct. Mol. Biol. 16:42– 48.

30. Tanaka N, Aronova A, Schwer B. 2007. Ntr1 activates the Prp43 helicaseto trigger release of lariat-intron from the spliceosome. Genes Dev. 21:2312–2325.

31. Bellare P, Small EC, Huang X, Wohlschlegel JA, Staley JP, SontheimerEJ. 2008. A role for ubiquitin in the spliceosome assembly pathway. Nat.Struct. Mol. Biol. 15:444 – 451.

32. Small EC, Leggett SR, Winans AA, Staley JP. 2006. The EF-G-likeGTPase Snu114p regulates spliceosome dynamics mediated by Brr2p, aDExD/H box ATPase. Mol. Cell 23:389 –399.

33. Maeder C, Guthrie C. 2008. Modifications target spliceosome dynamics.Nat. Struct. Mol. Biol. 15:426 – 428.

34. Mathew R, Hartmuth K, Möhlmann S, Urlaub H, Ficner R, LührmannR. 2008. Phosphorylation of human PRP28 by SRPK2 is required forintegration of the U4/U6-U5 tri-snRNP into the spliceosome. Nat. Struct.Mol. Biol. 15:435– 443.

35. Song EJ, Werner SL, Neubauer J, Stegmeier F, Aspden J, Rio D, HarperJW, Elledge SJ, Kirschner MW, Rape M. 2010. The Prp19 complex andthe Usp4Sart3 deubiquitinating enzyme control reversible ubiquitinationat the spliceosome. Genes Dev. 24:1434 –1447.

36. Tsai R-T, Fu R-H, Yeh F-L, Tseng C-K, Lin Y-C, Huang Y-H, ChengS-C. 2005. Spliceosome disassembly catalyzed by Prp43 and its associatedcomponents Ntr1 and Ntr2. Genes Dev. 19:2991–3003.

37. Tsai R-T, Tseng C-K, Lee P-J, Chen H-C, Fu R-H, Chang K-J, Yeh F-L,Cheng S-C. 2007. Dynamic interactions of Ntr1-Ntr2 with Prp43 and withU5 govern the recruitment of Prp43 to mediate spliceosome disassembly.Mol. Cell. Biol. 27:8027– 8037.

38. Koodathingal P, Novak T, Piccirilli JA, Staley JP. 2010. The DEAH boxATPases Prp16 and Prp43 cooperate to proofread 5= splice site cleavageduring pre-mRNA splicing. Mol. Cell 39:385–395.

39. Mayas RM, Maita H, Semlow DR, Staley JP. 2010. Spliceosome discardsintermediates via the DEAH box ATPase Prp43p. Proc. Natl. Acad. Sci.U. S. A. 107:10020 –10025.

40. Schwer B, Gross CH. 1998. Prp22, a DExH-box RNA helicase, plays twodistinct roles in yeast pre-mRNA splicing. EMBO J. 17:2086 –2094.

41. Liu Y-C, Chen H-C, Wu N-Y, Cheng S-C. 2007. A novel splicing factor,Yju2, is associated with NTC and acts after Prp2 in promoting the firstcatalytic reaction of pre-mRNA splicing. Mol. Cell. Biol. 27:5403–5413.

42. Tseng C-K, Cheng S-C. 2008. Both catalytic steps of nuclear pre-mRNAsplicing are reversible. Science 320:1782–1784.

43. Chen C-H, Tsai W-Y, Chen H-R, Wang C-H, Cheng S-C. 2001. Iden-tification and characterization of two novel components of the Prp19p-associated complex, Ntc30p and Ntc20p. J. Biol. Chem. 276:488 – 494.

44. Schwer B, Meszaros T. 2000. RNA helicase dynamics in pre-mRNAsplicing. EMBO J. 19:6582– 6591.

45. Vijayraghavan U, Parker R, Tamm J, Iimura Y, Rossi J, Abelson J,Guthrie C. 1986. Mutations in conserved intron sequences affect multiplesteps in the yeast splicing pathway, particularly assembly of the spliceo-some. EMBO J. 5:1683–1695.

46. James S, Tirmer W, Schwer B. 2002. How Slu7 and Prp18 cooperate inthe second step of yeast pre-mRNA splicing. RNA 8:1068 –1077.

47. Chiu Y-F, Liu Y-C, Chiang T-W, Yeh T-C, Tseng C-K, Wu NY, ChengS-C. 2009. Cwc25 is a novel splicing factor required after Prp2 and Yju2 tofacilitate the first catalytic reaction. Mol. Cell. Biol. 29:5671–5678.

48. Horowitz DS, Abelson J. 1993. Stages in the second reaction of pre-mRNA splicing: the final step is ATP independent. Genes Dev. 7:320 –329.

49. Hotz H-R, Schwer B. 1998. Mutational analysis of the yeast DEAH-boxsplicing factor Prp16. Genetics 149:807– 815.

50. Plumpton M, McGarvey M, Beggs JD. 1994. A dominant negative mu-tation in the conserved RNA helicase motif ‘SAT’ causes splicing factorPRP2 to stall in spliceosomes. EMBO J. 13:879 – 887.

51. van Nues RW, Beggs JD. 2001. Functional contacts with a range ofsplicing proteins suggest a central role for Brr2p in the dynamic control ofthe order of events in spliceosomes of Saccharomyces cerevisiae. Genetics157:1451–1467.

52. Xie J, Beickman K, Otte E, Rymond BC. 1998. Progression through thespliceosome cycle requires Prp38p function for U4/U6 snRNA dissocia-tion. EMBO J. 17:2938 –2946.

53. Pandit S, Lynn B, Rymond BC. 2006. Inhibition of a spliceosome turn-over pathway suppresses splicing defects. Proc. Natl. Acad. Sci. U. S. A.103:13700 –13705.

54. Burgess SM, Guthrie C. 1993. A mechanism to enhance mRNA splicingfidelity: the RNA-dependent ATPase Prp16 governs usage of a discardpathway for aberrant lariat intermediates. Cell 73:1377–1392.

55. Mayas RM, Maita H, Staley JP. 2006. Exon ligation is proofread by theDExD/H-box ATPase Prp22p. Nat. Struct. Mol. Biol. 13:482– 490.

56. Xu Y-Z, Query CC. 2007. Competition between the ATPase Prp5 andbranch region-U2 snRNA pairing modulates the fidelity of spliceosomeassembly. Mol. Cell 28:838 – 849.

57. Burgess SM, Guthrie C. 1993. Beat the clock: paradigms for NTPases inthe maintenance of biological fidelity. Trends Biochem. Sci. 18:381–384.

58. Horowitz DS. 2011. The splice is right: guarantors of fidelity in pre-mRNA splicing. RNA 17:551–554.

59. Yean S-L, Wuenschell G, Termini J, Lin R-J. 2000. Metal-ion coordina-tion by U6 small nuclear RNA contributes to catalysis in the spliceosome.Nature 408:881– 884.

Spliceosome Disassembly and DEAH ATPases

February 2013 Volume 33 Number 3 mcb.asm.org 525

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 24

Oct

ober

202

1 by

117

.146

.54.

17.