ORIGINAL PAPER

LcWRKY5: an unknown function gene from sheepgrass improvesdrought tolerance in transgenic Arabidopsis

Tian Ma • Manli Li • Aiguo Zhao • Xing Xu •

Gongshe Liu • Liqin Cheng

Received: 11 April 2014 / Revised: 11 May 2014 / Accepted: 16 May 2014

� Springer-Verlag Berlin Heidelberg 2014

Abstract

Key message The expression of LcWRKY5 was induced

significantly by salinity, mannitol and cutting treat-

ments. Arabidopsis-overexpressing LcWRKY5 greatly

increased dehydration tolerance by regulating the

expression of multiple stress-responsive genes.

Abstract Based on the data of sheepgrass 454 high-

throughout sequencing and expression analysis results, a

drought-induced gene LcWRKY5 was isolated and cloned,

and the biological role of the gene has not been reported

until now. Bioinformatics analysis showed that LcWRKY5

contains one conserved WD domain and belongs to the

group II WRKY protein family. LcWRKY5 shows high

sequence identity with predicted or putative protein pro-

ducts of Hordeum vulgare, Aegilops tauschii, Triticum

aestivum, Brachypodium distachyon, Oryza sativa, but it

has low homology with WRKYs from dicotyledonous

plants. Several drought-inducibility, fungal elicitor, MeJA-

responsiveness, endosperm, light, anoxic specific induc-

ibility, and circadian control elements were found in the

promoter region of LcWRKY5. Tissue-specific expression

patterns showed that LcWRKY5 is expressed in roots and

leaves, without expression in other tissues. The expression

of LcWRKY5 was induced significantly under salinity and

mannitol stresses but was not notably changed under cold

and Abscisic acid stress. The LcWRKY5 protein exhibits

transcription activation activity in the yeast one-hybrid

system. Overexpressing LcWRKY5 exhibited increased

rates of cotyledon greening and plant survival in transgenic

Arabidopsis compared with wild-type plants under drought

stress, and the expression levels of DREB2A and RD29A in

transgenic plants were enhanced under drought stress.

These results indicated that LcWRKY5 may play an

important role in drought-response networks through reg-

ulation of the DREB2A pathway. LcWRKY5 can be a

candidate gene for engineering drought tolerance in other

crops.

Keywords Sheepgrass � Transcriptional factor �LcWRKY5 � Drought

Abbreviations

ABA Abscisic acid

CaMV Cauliflower mosaic virus

DREB2A Dehydration-responsive element-binding

protein 2A

GFP Green fluorescent protein

GUS b-Glucuronidase

Communicated by Qiao Zhao.

T. Ma and M. Li contributed equally to this work.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00299-014-1634-3) contains supplementarymaterial, which is available to authorized users.

T. Ma � A. Zhao � G. Liu (&) � L. Cheng (&)

Key Laboratory of Plant Resources, Institute of Botany,

Chinese Academy of Sciences, Beijing 100093,

People’s Republic of China

e-mail: liugs@ibcas.ac.cn

L. Cheng

e-mail: lqcheng@ibcas.ac.cn

T. Ma � X. Xu

Agricultural College, Ning Xia University, Ningxia 750021,

People’s Republic of China

M. Li

Department of Grassland Science, College of Animal Science

and Technology, China Agricultural University, Beijing 100193,

People’s Republic of China

123

Plant Cell Rep

DOI 10.1007/s00299-014-1634-3

MS Murashige and Skoog

ORF Open reading frame

RT–PCR Reverse transcription–PCR

qRT-PCR Quantitative RT-PCR

TAIL-PCR Thermal asymmetric interlaced PCR

Introduction

Environmental stresses, such as drought, high salinity and

low temperature, have adverse effects on plant growth and

seed production (Shinozaki et al. 2003; Barnabas et al.

2008). Water availability is the major limiting factor for

food production in many countries, with agriculture con-

suming approximately 75 % of the water supply in devel-

oped countries and close to 90 % of the water supply in

many developing countries (Pennisi 2008). Therefore, the

identification and characterization of key genes that

mediate plant responses to drought stress provide a pow-

erful method to select for crop plants with enhanced tol-

erance to drought stress (Kasuga et al. 1999; Valliyodan

and Nguyen 2006).

A number of transcriptional factor (TF) families, such as

MYB, DREB, NAC and WRKY, have been reported to be

involved in the regulation of the plant response to drought

stress (Singh et al. 2002; Shinozaki and Yamaguchi-

Shinozaki 2007). The WRKY family is the largest family of

transcription factors in higher plants and is found through-

out the green lineage (green algae and land plants) (Ulker

and Somssich 2004). WRKY family proteins contain one or

two highly conserved WRKY domains (each spanning

approximately 60 amino acid residues) that are character-

ized by the hallmark heptapeptide WRKYGQK and a zinc-

finger structure (Cx4–5Cx22–23HxH or Cx7Cx23HxC)

distinct from other known zinc-finger motifs. Based on the

number of WRKY domains and pattern of the zinc-finger

motif, the WRKY superfamily members from Arabidopsis

can be classified into three groups: group I, group II, and

group III. Members of group I typically contain two WRKY

domains, whereas most proteins with one WRKY domain

belong to group II. Group III proteins also have a single

WRKY domain, but the pattern of the zinc-finger motif is

unique (Eulgem et al. 2000). The first report concerning the

structure of the WRKY domain investigated the AtWRKY4

protein, which consists of a four-stranded b-sheet and a zinc

binding pocket formed by the conserved Cys/His residues

located at one end of the b-sheet (Yamasaki et al. 2005).

The crystal structure of AtWRKY1-C is composed of a

globular structure with five b-strands, and a novel zinc

binding site is located at one end of the b-sheet between

strands b4 and b5 (Duan et al. 2007). This structural

architecture is required for protein–DNA interaction

(Yamasaki et al. 2005).

In plants, many WRKY proteins are mainly involved in

the biotic stress response or defense (Asai et al. 2002; Kalde

et al. 2003; Rushton et al. 2010). Otherwise, WRKY genes

have also been reported to be involved in responses to the

abiotic stresses of wounding (Cheong et al. 2002), drought,

cold, salinity, heat and ABA signaling (Pnueli et al. 2002;

Zhou et al. 2008; Wang et al. 2009b; Prabu et al. 2011; Niu

et al. 2012; Zhu et al. 2013). In addition, it is also evident

that some members of the WRKY family may play

important regulatory roles in the morphogenesis of tric-

homes (Johnson et al. 2002) and embryos (Alexandrova and

Conger 2002), in senescence (Robatzek and Somssich

2001), and in sugar signaling (Rushton et al. 1995; Sun et al.

2003). These reports indicate that WRKY TFs play

important role in regulating different plant processes.

Sheepgrass [Leymus chinensis (Trin.) Tzvel.] is an

important perennial grass of the Poaceae family, and it is

widely distributed on the eastern Eurasian steppe, including

Korea, Eastern Russia, Japan, Mongolia and northern

China (Wang et al. 2010). The plants have diverse adap-

tations to different harsh environments. Sheepgrass has

high tolerance to drought, low temperature and saline-

alkali (Liu et al. 2012). The identification of stress toler-

ance related gene from sheepgrass will provide valuable

gene resources for other crops and forage breeding.

In the present study, we identified a member of the

WRKY family from sheepgrass based on 454 sequence

data, and constructed its phylogenetic relationships and

tried to assign putative orthologs from barley, Arabidopsis

and rice. Further, a drought response gene LcWRKY5 was

characterized using qRT-PCR and transgenic techniques,

these results suggested the involvement of the LcWRKY5

proteins in the response to drought stress.

Materials and methods

Plant materials and treatments

Sheepgrass seedlings (Zhongke No. 2, a variety of the

Institute of Botany, Chinese Academy of Sciences, Beijing,

China) were raised at 25 �C using a 16-h light/8-h dark

photoperiod for 8 weeks before stress treatments. Seedlings

were placed in a growth chamber at 4 �C for cold stress.

For salt and drought stress treatments, seedlings were

irrigated with 400 mM NaCl and 300 mM mannitol,

100 lM ABA, cut off the top 2/3, respectively. The seed-

lings were sampled at 0, 2, 4, 8, 12, 24, 48, and 72 h after

stress treatments. Leaf, rhizome, stem, sheath, and root

tissues were collected from 2-year-old plants grown under

Plant Cell Rep

123

greenhouse conditions as described above. All the samples

were immediately frozen in liquid nitrogen and stored at

-z80 �C for RNA extraction.

Cloning and sequencing analysis of LcWRKY5

According to the data of 454 sequencing and RT-PCR

analysis results, a drought-induced gene (designated as

LcWRKY5) was selected as candidate genes for further

research. To obtain the full-length cDNA of selected

LcWRKY5, total RNA was extracted from 2-week-old

sheepgrass seedlings using TRIzol reagent (TaKaRa)

according to the manufacturer’s instructions. After DNA

was removed using RNase-free DNase I (TaKaRa), the

concentration of RNA was quantified using a Nano spec-

trophotometer. The first-strand cDNAs were synthesized

from 1 lg of total RNA. The full-length cDNAs of

LcWRKY5 were amplified using homologous primers

(forward primer: 50-ATGGAAACGGCGCGGTGGT-30

and 50-CTAATAATCCGGCAGCTTCCGCA-30) based on

sheepgrass LcWRKY5 partial sequences according to 454

sequencing data. The cDNA products were cloned into the

pMD18-T vector (TAKARA) and sequenced. Multiple

sequence alignments and phylogenetic analysis of

LcWRKY5 with complete ORFs were performed using

DNAMAN v5.0 (Lynnon Biosoft Inc., Vandreuil, Quebec,

Canada). Domain architecture analysis was performed

using SMART (http://coot.embl-heidelberg.de/SMART/).

The nuclear localization signal was analyzed by WoLF

SPORT (http://wolfpsort.org/). The 3-D structure was

predicted by CPHmodels-3.0 (http://genome.cbs.dtu.dk/

services/CPHmodels-2_0Server-3D.htm).

Expression pattern of LcWRKY5 in different tissues

and the response to abiotic stresses

Total RNA was extracted from different plant materials

according to the protocols described (TaKaRa). First-strand

cDNA was synthesized using the Primescript II first-strand

cDNA synthesis kit (TaKaRa). LcACTIN and AtACTIN

(Table 1) were used as internal reference genes to assess

gene expression levels from sheepgrass and Arabidopsis.

For semi-quantitative RT-PCR, the cycle parameters were

as follows: initial denaturation at 94 �C for 5 min; 28

cycles at 94 �C for 30 s, 56 �C for 30 s, and 72 �C for 30 s;

and a final extension at 72 �C for 10 min. The PCR pro-

ducts were analyzed by agarose gel electrophoresis. All

quantitative RT-PCR analyses were performed in a 20-ll

volume containing 10 ll of 2 9 SYBR Premix Ex Taq mix

(TaKaRa), 0.2 mM primers, and 2 ll of diluted (1:20 v/v)

first-strand cDNA, with an initial denaturation step (95 �C

for 2 min) followed by 40 cycles at 94 �C for 5 s, 60 �C for

20 s, and 72 �C for 20 s. The relative mRNA ratios were

calculated using the 2-DDCt formula (Livak and Schnittgen

2001). All semi-quantitative RT-PCR and qRT-PCR

experiments described in this section were performed using

three biological replicates. The data were expressed as

mean ± standard error. The primers for semi-quantitative

RT-PCR and qRT-PCR are listed in Table 1.

Isolation and analysis of the LcWRKY5 promoter

To identify the putative cis-acting regulatory elements, the

promoter sequence was isolated using TAIL-PCR (Liu

et al. 1995) with gene-specific primers for SP1 (50-

TATGCTGACGAACCCCATCTGC-30), SP2 (50-

CAGAAAACGAAGCCACGCAGAG-30) and SP3 (50-

AGCGGCAGACAGCACATCAA-30) and three arbitrary

degenerate (AD) primers: AD1 (50-NTCGA(G/C)T(A/

T)T(G/C)G(A/T)GTT-30), AD2 (50-NGTCGA(G/C)(A/T)

GANA(A/T)GAA-30) and AD3 (50-(A/T)GTGNAG(A/

T)ANCANAGA-30). The PCR procedure was performed

as described by Liu et al. (1995). Promoter cis-elements

were identified using the algorithm developed by Higo

et al. (1999) and are available at http://www.dna.affrc.go.

jp/PLACE/sigresult.html and Plant CARE (Plant cis-acting

Table 1 Primer used for quantitative real-time PCR

Primer Sequence Primer Sequence Function

LcACTIN-F TGCTGACCGTATGAGCAAAG LcACTIN-R GATTGATCCTCCGATCCAGA qPCR

LcACTIN-F GTGCTTTCCCTCTATGCAAGTGGT LcACTIN-R CTGTTCTTGGCAGTCTCCAGCTC RT-PCR

LcWRKY5-F AAAGGAGCAGGGAGAGCACG LcWRKY5-R CCGCCATTGATACCCGTCTT qPCR

LcWRKY5-F GCAAGAAAAGGAGCAGGGAG LcWRKY5-R TGGTGAGGTCCAGCGTGATG RT-PCR

AtACTIN-F TGCTGACCGTATGAGCAAAG AtACTIN-R GATTGATCCTCCGATCCAGA qPCR

AtABF3-F AACGCTGGGAGAGATGACTTTGGA AtABF3-R TCCCAAGACCTCCATTACTGCCAA qPCR

AtP5CS1-F TAGCACCCGAAGAGCCCCAT AtP5CS1-R TTTCAGTTCCAACGCCAGTAGA qPCR

AtDREB1A-F AGGAGACGTTGGTGGAGGCT AtDREB1A-R ACGTCGTCATCATCGCCGTC qPCR

AtDREB2A-F AAACCTGTCAGCAACAACAGCAGG AtDREB2A-R TTAAGCCTGCAAACACATCGTCGC qPCR

AtRD29A-F TGTGCCGACGGGATTTGACGGA AtRD29A-R TCCGTCTTTGGGTCTCTTCCCAGC qPCR

Plant Cell Rep

123

regulatory element database, http://bioinformatics.psb.

ugent.be/webtools/plantcare/html).

Transcriptional activation activity of the LcWRKY5

protein

The transcription activation activity of the LcWRKY 5

protein was investigated using the yeast one-hybrid system.

The full-length LcWRKY5 cDNA was amplified using the

forward primer 50-CGGAATTCATGGAAACGGCGC

GGTGGTC-30 (EcoRI site underlined) and reverse primer

50-GCGTCGACATAATCCGGCAGCTTCCGCA-30 (SalI

site underlined). The PCR products were inserted into the

corresponding restriction sites of the yeast expression

vector pBridge, containing the GAL4 DNA-binding

domain (BD), to obtain pBD-LcWRKY5. pBD-LcWRKY5,

the positive control pGAL4 (Clontech), and the negative

control pBD vector were all transformed into the yeast

strain AH109 (Clontech). The transformed yeast cells were

selected on SD medium without His and Trp to observe

yeast growth. The colony-lift filter b-galactosidase assay

was performed according to the Yeast Protocols Handbook

(Clontech).

Construction of the expression vector and plant

transformation

The ORF of LcWRKY5 was amplified using the forward

primer 50-GAAGATCTATGGAAACGGCGCGGTGGTC-

30 (BglII site underlined) and the reverse primer 50-CCACTAGTATAATCCGGCAGCTTCCGCA-30 (SpeI

site underlined), and the PCR product was cloned into the

BglII and SpeI sites of the pCAMBIA1302 vector under the

control of the LcWRKY5 promoter (W5P). The recombi-

nant plasmid pBI1302-W5P-LcWRKY5 was electroporated

into A. tumefaciens (EHA105) cells for Arabidopsis

transformation using the floral dipping method (Clough and

Bent 1998). LcWRKY5 transgenic plants were screened on

MS medium containing 50 mg ml/1 hygromycin (Roche).

Two LcWRKY5-overexpressing Arabidopsis lines (L3 and

L6) with progeny segregation ratios of 3:1 were selected

for further stress tolerance studies.

Drought tolerance analysis of transgenic plants

For determination of the seed germination rate of trans-

genic plants, the seeds of WT and transgenic plants were

planted on 1/2MS medium containing 300 mM mannitol.

After germination, the green cotyledon rates were scored at

4 days after sowing. For seedling growth experiments, T2

generation transgenic Arabidopsis seeds were grown on

1/2MS medium in a growth chamber with 16 h of light and

8 h of darkness for 1 week and then transferred to the

1/2MS medium supplemented with 300 mM mannitol for

observation. Three weeks after the transfer, the phenotype

was photographed, and the survival rates were calculated.

For phenotype on soil, WT and LcWRKY5-overexpressing

(L3 and L6) seeds were sown on 1/2MS medium for

7 days, then transferred to pot and placed in greenhouse

with light (16 h) at 25 �C (Unit) for 14 days, then withheld

irrigation for 14 days (D14d), and re-watered for 7 days

(R7d), the phenotype was photographed, and the survival

rates were calculated. The soil relative water content was

100, 3.2 and 75.6 %, respectively. Drought tolerance

experiments were repeated at least three times.

Results

Isolation and sequence analysis of LcWRKY5

from sheepgrass

One hundred twenty-eight LcWRKY ESTs were identified

from the transcription profile data of 454 sequencing.

Based on bioinformatics analysis, 18 were examined the

expression levels in stress by RT-PCR methods, and sev-

eral stress-induced full-length LcWRKY cDNAs were

cloned and identified. Among them, an unknown function

gene, designated LcWRKY5 (GenBank Accession No.

1640665), was selected for further research, because it was

remarkably induced by abiotic stresses. The LcWRKY5

gene is 987 bp in length with a 328-amino acid open

reading frame. The molecular mass of the predicted protein

is approximately 35.6 kDa, and its theoretical isoelectric

point (pI) is 7.5.

The LcWRKY5 protein domains were predicted by

SMART and WoLF SPORT software. The results showed

that LcWRKY5 contained a typical WRKY domain

(169–229 bp) and nuclear localization signals (NLSs;

PVGKKRS: AA 105-111; PVKKKVQ: AA 202-208)

bearing the similar three-dimensional structure as the

classical WRKY. LcWRKY5 belongs to the WRKY group

IIa family with one WRKY domain and contains a poten-

tial leucine zipper (LZ, L–x6–V–x6–L–x6–M–x6–L) motif

in the C-terminus that is present in group II WRKY pro-

teins, such as BhWRKY1, NtWIZZ, OsWRKY76 and At-

WRKY18 (Fig. 1a). NCBI BLAST search results showed

that LcWRKY5 has high identity with predicted protein

products of Hordeum vulgare (BAJ90915.1, 92 %), or

putative Aegilops tauschii (EMT16727.1, 82 %), Triticum

aestivum (EMS54632.1, 77 %), Brachypodium distachyon

(XP_003578125.1, 70 %), Oryza sativa (DAA05141.1,

67 %), Sorghum bicolor (XP_002462384.1, 62 %) and Zea

mays (NP_001120723.1, 59 %), but the function of these

gene products was not reported until now, so we speculated

LcWRKY5 was an unknown function gene with WRKY

Plant Cell Rep

123

domain. Otherwise, LcWRKY5 shows a lower similarity to

the dicotyledon proteins BhWRKY1 (ACI62177.1, 43 %),

NtWIZZ (BAA87058.1, 40 %), and AtWRKY18

(NP_567882.1, 37.7 %).

To examine the phylogenetic relationship of the

LcWRKY5 protein with representative members from

other plants, we performed multiple sequence alignment of

the LcWRKY5 protein. A phylogenetic tree of LcWRKY5

and stress-related representative WRKY proteins from

other plants was constructed. As shown in Fig. 1b, the

WRKY proteins were of polyphyletic origin and were

distributed among three groups, group II was further

splitted into five subgroups, namely a, b, c, d and e

according to the analysis by Rushton et al. (2010).

LcWRKY5, OsWRKY76, NtWIZZ, BhWRKY1 and At-

WRKY18 fell into the WRKY group IIa family, although

they have different identities (38–92 %) and diverse

function. Wheat WRKY2, 14, 17, 19, 27, 33, HvSUSIBA2,

Fig. 1 Domain features by SMART and phylogeny of LcWRKY5

with orthologs. a Predicted protein structure of LcWRKY5 by

SMART. The WRKY domain (AA 169-229), DNA-binding domains

(E value 1.39e–34); the WRKY DNA-binding domain [pfam03106,

E value 1.61e–31]; nuclear localization signal (NLSs, PVGKKRS:

AA 105-111; PVKKKVQ: AA 202-208); Leucine Zipper motif (AA

51-83); Alignment of the LcWRKY5 protein with the deduced amino

acid sequences from other species. b Phylogeny of LcWRKY5 was

constructed based on amino acid sequences from stress response

WRKY family members with DNAMAN tree program; c the

predicted dimensional structure of LcWRKY5 by CPHmodels-3.0.

Blue Arrow b-strand; Single line turn

Plant Cell Rep

123

IbSPF1 and AtWRKY1 belonged to group I, they have

different biological functions. TaWRKY11 and TaW-

RKY13 were classified into group III. The 3D structure of

LcWRKY5 protein contains 4 b-sheets by CPHmodels-3.0

(Fig. 1c), a characteristic that is similar to group II WRKY

proteins.

Analysis of the LcWRKY5 promoter

The promoter sequence was isolated and cloned by TAIL-

PCR method using sheepgrass genomic DNA as template

(Supplementary material 2). The PLACE (Plant Cis-acting

regulatory DNA elements) and Plant CARE (Plant cis-

acting regulatory element) databases were used to search

the cis-acting regulatory DNA elements in the promoters of

LcWRKY5. The predicted cis-acting elements in the

LcWRKY5 promoter include: a number of fungal elicitor,

MeJA, auxin, defense and stress, drought, anoxic, GA,

light, ABA responsiveness, circadian control and meristem

expression elements (Table 2). The fungal elicitor, MeJA,

drought inducibility elements appeared more times than

others in the LcWRKY5 promoter. We speculated that

LcWRKY5 might play a role in different signal pathways of

plant growth, development and response to environmental

stimuli processes.

Expression of LcWRKY5 genes under various stresses

and in tissues

The expression patterns of LcWRKY5 in different tissues

and organs, as well as with various treatments, were

investigated using RT-PCR and qRT-PCR. The results

showed that the expression patterns differed in each type of

stress. The expression of LcWRKY5 was induced signifi-

cantly by drought, NaCl and cutting treatments in sheep-

grass but was induced weakly by cold and ABA (Fig. 2a–

e). The expression of LcWRKY5 was induced and reached a

maximum 2 h after cold treatment (Fig. 2a). LcWRKY5

transcripts accumulated quickly in response to salt and

reached its peaks twice after 4 and 48 h of salt treatment

(Fig. 2b). LcWRKY5 transcripts were distinctly induced

and reached a maximum at 48 h with mannitol treatment

(Fig. 2c). The expression of LcWRKY5 was induced

weakly at 4 h after ABA treatment (Fig. 2d). LcWRKY5

Fig. 1 continued

Table 2 Predicted cis-acting elements of LcWRKY5 promoter

Cis-acting elements Function of cis-acting elements Number

TGAC Fungal elicitor responsive element 29

CAANNNNATC Involved in circadian control 1

TGACG MeJA-responsiveness 8

AACGAC Auxin-responsive element 1

ATTTTCTTCA Defense and stress responsiveness 1

GTCAT Required for endosperm expression 3

CAACTG Involved in drought-inducibility 6

CCCCCG Anoxic specific inducibility 3

AAACAGA Gibberellin-responsive element 1

CACGAC Light responsiveness 4

CACGTG Abscisic acid responsiveness 2

TGGTTT Essential for the anaerobic induction 2

GCCACT Related to meristem expression 2

Plant Cell Rep

123

transcripts were significantly induced and reached a max-

imum at 8 h with cutting treatment (Fig. 2e). The expres-

sion of LcWRKY5 was detected in roots and leaves but was

not found in other organs (Fig. 2f).

Transcriptional activation activity of the LcWRKY5

protein

The transcriptional activation activity of LcWRKY5 was

tested using the yeast one-hybrid system. All the plasmids,

pBridge-BD-WRKY5, pBridge-BD-GAL4 (positive con-

trol) and pBridge-BD (negative control), were transformed

into the yeast strain AH109 containing the upstream acti-

vating sequence (UAS), which could be specifically bound

by the GAL4-binding domain. AH109 containing pBridge-

BD could not grow on SD medium without His and Trp

(SD/-His-Trp). However, the cells harboring the pBridge-

BD-WRKY5 and pBridge-BD-GAL4 plasmids could grow

normally on the same medium and exhibited blue signals in

b-galactosidase assays upon addition of X-gal to the

Whatman filter paper (Fig. 3a–c). These results indicated

that LcWRKY5 is a transcriptional activator.

Drought tolerance analysis of LcWRKY5 transgenic

plants

To further investigate the biological function of LcWRKY5,

transgenic Arabidopsis plants were created with the

LcWRKY5 gene construct under the control of the W5P

promoter. Because previous expression analysis results

have shown that the mRNA of LcWRKY5 was significantly

induced by mannitol stress, we examined the seed germi-

nation rate of WT and LcWRKY5-overexpressing plants in

normal 1/2MS medium and 1/2MS medium supplemented

with 300 mM mannitol. No significant difference was

observed in the cotyledon greening rate between wild-type

Fig. 2 Expression patterns of

LcWRKY5 in response to

various stress treatments in

sheepgrass. a Expression

patterns of LcWRKY5 in

4-week-old sheepgrass

seedlings in low temperature

(4 �C) by qPCR. b 400 mM

NaCl/L. c 300 mM Mannitol.

d 100Lm ABA. e Cut off the

top 2/3. The samples were

collected for each condition at

0, 2, 4, 8, 12, 24, 48 and 72 h,

respectively. f Expression

profilings of LcWRKY5 in

different organs of 2-year-old

sheepgrass at the flowering

stage

Fig. 3 Transactivational ability assay of LcWRKY5. a The trans-

formed RH109 yeasts with pBD-LcWRKY5, pGAL4 (positive

control), pBridge (pBD) (negative control) were selected on SD-

Trp-His media. b b-Galactosidase activity assay (The LacZ marker

gene was examined by X-gal assay). c The position of each

transformed yeast cell

Plant Cell Rep

123

Fig. 4 Response to drought

stress of transgenic Arabidopsis

overexpressing LcWRKY5. a,

b Observation of WT and

LcWRKY5-overexpressing seeds

on 1/2MS (0, 300 mM

Mannitol). Seeds were grown on

1/2MS for 4 days before the

photographs were taken. c,

d Seven-day-old seedlings were

transferred to 1/2MS medium

supplemented with 0 or

300 mM Mannitol for 21 days

before the images shown were

taken. e Cotyledon greening rate

under drought stress. WT and

LcWRKY5-overexpressing seeds

were sown on 1/2MS medium

containing 300 mM Mannitol

for 4 days. All germination

experiments were repeated three

times. f Survival rate of

transgenic and WT plants in

1/2MS medium supplemented

with 300 mM Mannitol. g WT

and LcWRKY5-overexpressing

(L3 and L6) seeds were sown on

1/2MS medium for 7 days, then

transferred to pot and placed in

greenhouse with light (16 h) at

25 �C (Unt) for 14 days, then

withheld irrigation for 14 days

(D14d) and re-watered for

7 days (R7d). The soil relative

water content was 100, 3.2 and

75.6 %, respectively. h Survival

rate of transgenic and WT plants

after dehydration and rewater

was calculated

Plant Cell Rep

123

and transgenic plants (L3) without drought stress, though

some seeds of line L6 did not germinate normally (Fig. 4a).

However, the LcWRKY5-overexpressing plants (L3 and L6)

showed significantly higher cotyledon greening rates (79

and 67 %, respectively) than those of the WT plants (34 %)

under mannitol stress (Fig. 4b, e). The 7-day-old seedlings

of transgenic and wild-type (WT) plants were transferred to

the 1/2MS medium supplemented with 300 mM mannitol

after germination in 1/2MS medium. Images of both plants

were taken 21 days after movement to the mannitol stress

medium (Fig. 4c, d). The survival rates of transgenic plants

were more than 80 % under mannitol stress; a finding that

was significantly higher than that of WT (8 %) (Fig. 4f).

Others, transgenic lines of LcWRKY5 in reproductive stage

Arabidopsis in pot also exhibited more tolerance to water-

deficit stress than wild-type plants, and the survival rates of

overexpression lines were more than 90 %; this was dra-

matically higher than the 30 % survival rate of WT after

drought stress (Fig. 4g, h). These results indicated that the

transgenic plants were more tolerant to drought than the

WT plants. No significant difference was found in devel-

opment and growth between the WT and transgenic plants

in 1/2MS medium without stress.

Expression of abiotic stress response genes

in transgenic plants

To further elucidate the mechanism of the LcWRKY5

transgenic lines underlying the enhanced tolerance to

drought stress, the expression levels of several known

stress-responsive marker genes were analyzed in the

transgenic and WT Arabidopsis plants. The transcription

factor DREB2A and the functional genes RD29A, P5CS1

exhibited increased expression levels in transgenic plants

under drought stress treatments, but the expressions of

DREB1A, P5CS2, RAB18 were lower than that in

LcWRKY5 overexpression plants compared with WT plants

(Fig. 5).

Discussion

Drought stress is one of the biggest environmental threats to

agriculture and crop production. Thus, it is pertinent to

identify new genes that confer drought tolerance to enable

crops to better survive water-deficit stress. Sheepgrass is an

important monocotyledonous forage grass, and it plays an

important role in economic construction and ecological

protection because of its diverse adaptability and good

nutritional value (Bai et al. 2010; Wang et al. 2009a).

Investigation of the molecular mechanism of sheepgrass

adapting to adverse environments provides for potential gene

resources to improve the breeding of other crops by genetic

engineering. We were interested in transcription factors,

particularly those encoded by sheepgrass WRKY family

genes related to various stresses. Analysis of the functions of

these genes is critical to advance our understanding of the

molecular mechanisms governing plant stress response and

Fig. 5 Expression level of

drought-responsive genes in

WT and transgenic plants Total

RNA was extracted from WT

and transgenic seedlings grown

in 1/2MS medium for 2 weeks

and transferred to 1/2MS

supplemented with 300 mM

Mannitol. The samples were

taken at 0, 6, 12, and 24 h after

drought stress treatment. The

transcript levels were measured

by real-time RT-PCR. Actin

was used as an internal control.

The expression levels of

drought-responsive genes

DREB2A, RD29A, DREB1A,

P5CS1, P5CS2 and RAB18 in

WT plants and transgenic plant

lines L3 and L6 under drought

stress, respectively

Plant Cell Rep

123

tolerance, ultimately leading to enhancement of stress tol-

erance in crops through genetic manipulation.

In the current study, we isolated a WRKY family gene

(LcWRKY5) from sheepgrass based on transcriptional

profiles data using 454-sequencing. Based on BLAST

searches in GenBank and multiple sequence alignments

with other WRKY proteins, we found that the predicted

protein contains a typical WRKY domain with a

WRKYGQK motif, which has been found in Arabidopsis,

rice, wheat and barley (Zhang and Wang 2005; Mangelsen

et al. 2008; Zhu et al. 2013). The LcWRKY5 protein showed

high identity with predicted protein products of Hordeum

vulgare (92 %), putative WRKY transcription factor 40

Aegilops tauschii (82 %), Brachypodium distachyon

(70 %), Triticum aestivum (77 %), Oryza sativa (67 %),

Sorghum bicolor (62 %) and Zea mays (59 %), but these

protein products are predicted, putative or hypothetical,

and their function is not reported until now. The LcWRKY5

showed lower similarity to the dicotyledon BhWRKY1

(43 %), NtWIZZ (40 %), and AtWRKY18 (38 %)(Fig. 1). In

previous studies, BhWRKY1 participates in dehydration

tolerance by binding to the W-box elements of the ga-

lactinol synthase (BhGolS1) promoter (Wang et al. 2009b),

NtWIZZ (WRKY-type transcription regulator) plays an

important role in the immediate-early wounding response

(Hara et al. 2000), OsWRKY76 (Ryu et al. 2006), and At-

WRKY18 (Chen et al. 2002) is induced by pathogens,

indicating that the group IIa WRKYs have diverse func-

tions in plants. Wheat TaWRKY2 and TaWRKY19 were

induced by drought, salt and ABA; TaWRKY19 can also be

induced by cold, but TaWRKY2 not response to cold stress.

Transgenic Arabidopsis plants overexpressing TaWRKY2

exhibited salt and drought tolerance compared with con-

trols. Overexpression of TaWRKY19 conferred tolerance to

salt, drought and freezing stresses in transgenic plants.

LcWRKY5 has low identity with TaWRKY2 (13 %) and

TaWRKY19 (15 %), so we speculate LcWRKY5 is an

unknown function protein that may participate in diverse

pathway in plant stress response. In addition, LcWRKY5

has transactivation activity in the yeast one-hybrid system

(Fig. 3), indicating that it is a transcription activator.

More than half of these drought-inducible genes were

also reported to be induced by high salinity and/or ABA

treatment, implicating significant cross-talk between the

drought, high salinity, and ABA response pathways. By

contrast, only 10 % of the drought-inducible genes were

also induced by cold stress (Shinozaki and Yamaguchi-

Shinozaki 2007). Expression pattern analysis showed that

the expression of LcWRKY5 is detected in roots and leaves

and induced significantly by salinity and mannitol treat-

ment but only weakly induced under cold stress treatments,

indicating that LcWRKY5 might play an important role in

the response to drought and salt stress (Fig. 2).

Gene expression is often regulated by the promoters of

genes upstream, and most gene function analyses have

been conducted under the CaMV 35S promoter. Some-

times, overexpression of genes under a component pro-

moter can lead to death or negative effects on plant growth

and development, such as the dwarf or retardation pheno-

type observed in transgenic rice and other plants over-

expressing abiotic stress-related genes (Shen et al. 2003;

Wang et al. 2008). Thus, we constructed the pCAM-

BIA1302-W5P-LcWRKY5 vector for transformation using

the LcWRKY5 promoter (W5P) to obtain precise under-

standing of LcWRKY5 gene function. Overexpression of

LcWRKY5 did not affect notably normal growth in trans-

genic Arabidopsis on 1/2MS medium without stress and

improved the drought tolerance of transgenic plants under

drought stress (Fig. 4). Our results suggested LcWRKY5

improves drought tolerance during germination and seed-

ling development in transgenic Arabidopsis. Otherwise, we

found that there were no notable changes between trans-

genic lines and WT plants after salt stress treatments

(Supplementary material Figure S1).

In previous reports, AtP5CS1 was demonstrated to be

mainly responsible for proline accumulation during salt

and drought stress (Szabados and Savoure 2010). P5CS2

can be activated by avirulent bacteria, salicylic acid (SA)

and ROS signals (Fabro et al. 2004). Our results showed

that the expression of AtP5CS1 was enhanced in transgenic

lines compared with the WT plants in drought stress. The

expression level of AtP5CS2 was lower in transgenic plants

than in WT plants under stress (Fig. 5). Thus, we speculate

the reasons for high drought stress tolerance in transgenic

Arabidopsis might be achieved by increasing the accumu-

lation of AtP5CS1, preceding the raise of proline amount

under drought.

It has been reported that there are ABA-dependent and

ABA-independent pathways exist in drought and salt

stresses. DREB2s are pivotal transcription factors in ABA-

independent pathway, other several stress-responsive genes

AtRD29A, AtRAB18 and AtDREB1A also play important

roles in stress response pathways (Shinozaki and Yamag-

uchi-Shinozaki 2007), and often as marker genes in stress

response. Wheat TaWRKYs affect stress tolerance through

regulation of different downstream genes, such as the

overexpression of wheat TaWRKY2 enhances STZ expres-

sion, whereas TaWRKY19 promotes DREB2A-mediated

activation of RD29A, RD29B and Cor6.6 (Niu et al. 2012).

Here, the expression of AtDREB2A, AtRD29A, AtRAB18

and AtDREB1A was analyzed between LcWRKY5 OE lines

and the wild type under drought. The results showed the

expression levels of DREB2A and RD29A were increased

in transgenic plants under drought stress, but the expres-

sions of DREB1A and RAB18 in LcWRKY5-overexpression

plants were lower than that in WT plants; these results

Plant Cell Rep

123

suggest that the increase of drought stress tolerance in

LcWRKY5-overexpressing Arabidopsis maybe the results

of enhanced expression of transcription factors (DREB2A)

and functional genes (P5CS1 and RD29A).

The predicted cis-acting elements in the LcWRKY5

promoter showed the fungal elicitor, MeJA, drought

inducibility elements appeared more times than others in

the LcWRKY5 promoter (Table 2). The results on expres-

sion analysis and overexpression in Arabidposis indicated

the LcWRKY5 plays important role in drought stress

response. Whether LcWRKY5 plays the role on response or

resistance to fungi and MeJA stress need further

investigation.

In conclusion, we isolated and identified an unknown

function LcWRKY5 gene from sheepgrass. LcWRKY5 is

differentially up-regulated by salinity, dehydration and

cutting. Overexpression of LcWRKY5 could enhance the

DREB2A and RD29A expression levels, and improved

tolerance to drought stress in transgenic Arabidopsis,

indicating that LcWRKY5 functions as a transcriptional

activator for the expression of downstream genes that

contribute to drought tolerance in transgenic Arabidopsis

by ABA-independent signaling pathways. These results

demonstrate that the LcWRKY5 gene plays important roles

in drought stress tolerance processes.

Acknowledgments This work was supported by the National Basic

Research Program of China (‘‘973’’, 2014CB138704), the Project of

Ningxia 3 Agricultural Comprehensive Development Office (NTKJ-

2013-03(1)), the National Natural Science Foundation of China

(31170316), the National High Technology Research and Develop-

ment Program of China (‘‘863’’, 2011AA100209), and the Ministry of

Agriculture of China (2009ZX08009-097B).

Conflict of interest The authors declare no conflict of interest.

References

Alexandrova KS, Conger BV (2002) Isolation of two somatic

embryogenesis-related genes from orchardgrass (Dactylis glom-

erata). Plant Sci 162:301–307

Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-

Gomez L, Boller T, Ausubel FM, Sheen J (2002) Map kinase

signalling cascade in Arabidopsis innate immunity. Nature

415:977–983

Bai WM, Xun F, Li Y, Zhang WH, Li LH (2010) Rhizome severing

increases root lifespan of Leymus chinensis in a typical steppe of

inner 456 Mongolia. PLoS One 5:e12125

Barnabas B, Jager K, Feher A (2008) The effect of drought and heat

stress on reproductive processes in cereals. Plant Cell Environ

31:11–38

Chen W, Provart NJ, Glazebrook J, Katagiri F, Chang HS, Eulgem T

et al (2002) Expression profile matrix of Arabidopsis transcrip-

tion factor genes suggests their putative functions in response to

environmental stresses. Plant Cell 14:559–574

Cheong YH, Chang HS, Gupta R, Wang X, Zhu T, Luan S (2002)

Transcriptional profiling reveals novel interactions between

wounding, pathogen, abiotic stress, and hormonal responses in

Arabidopsis. Plant Physiol 129:661–677

Clough SJ, Bent AF (1998) Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thali-

ana. Plant J 16:735–743

Duan MR, Nan J, Liang YH, Mao P, Lu L, Li L, Wei C, Lai L, Li Y,

Su XD (2007) DNA binding mechanism revealed by high

resolution crystal structure of Arabidopsis thaliana WRKY1

protein. Nucleic Acids Res 35:1145–1154

Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY

superfamily of plant transcription factors. Trends Plant Sci

5:199–206

Fabro G, Kovacs I, Pavet V, Szabados L and Alvarez ME (2004)

Proline accumulation and AtP5CS2 gene activation are induced

by plant-pathogen incompatible interactions in Arabidopsis. Mol

Plant Microbe Interact 17:343–350

Hara K, Yagi M, Kusano T, Sano H (2000) Rapid systemic

accumulation of transcripts encoding a tobacco WRKY tran-

scription factor upon wounding. Mol Gen Genet 263:30–37

Higo K, Ugawa Y, Iwamot M, Korenaga T (1999) Plant cis-acting

regulatory DNA elements (PLACE) database: 1999. Nucleic

Acids Res 27:297–300

Johnson CS, Kolevski B, Smyth DR (2002) TRANSPARENT TESTA

GLABRA2, a trichome and seed coat development gene of

Arabidopsis, encodes a WRKY transcription factor. Plant Cell

14:1359–1375

Kalde M, Barth M, Somssich IE, Lippok B (2003) Members of the

Arabidopsis WRKY group III transcription factors are part of

different plant defense signaling pathways. Mol Plant Microbe

Interact 16:295–305

Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K

(1999) Improving plant drought, salt, and freezing tolerance by

gene transfer of a single stress-inducible transcription factor. Nat

Biotechnol 17:287–291

Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient

isolation and mapping of Arabidopsis thaliana T-DNA insert

junctions by thermal asymmetric interlaced PCR. Plant J

8:457–463

Liu JS, Wang L, Wang DL, Bonser SP, Sun F, Zhou YF, Gao Y, Teng

X (2012) Plants can benefit from herbivory: stimulatory effects

of sheep saliva on growth of Leymus chinensis. PLoS One

7:e29259

Livak KJ, Schnittgen TD (2001) Analysis of relative gene expression

data using real-time quantitative PCR and the 2(-Delta Delta C

(T)). Methods 25:402–408

Mangelsen E, Kilian J, Berendzen KW, Kolukisaoglu UH, Harter K,

Jansson C, Wanke D (2008) Phylogenetic and comparative gene

expression analysis of barley (Hordeum vulgare) WRKY

transcription factor family reveals putatively retained functions

between monocots and dicots. BMC Genom 9:194–210

Niu CF, Wei W, Zhou QY, Tian AG, Hao YJ, Zhang WK, Ma B, Lin

Q, Zhang ZB, Zhang JS, Chen SY (2012) Wheat WRKY genes

TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in

transgenic Arabidopsis plants. Plant Cell Environ 35:1156–1170

Pennisi E (2008) The blue revolution, drop by drop, gene by gene.

Science 320:171–173

Pnueli L, Hallak-Herr E, Rozenberg M, Cohen M, Goloubinoff P,

Kaplan A, Mittler R (2002) Molecular and biochemical mech-

anisms associated with dormancy and drought tolerance in the

desert legume Retama raetam. Plant J 31:319–330

Prabu G, Kawar PG, Pagariya MC, Prasad DT (2011) Identification of

water deficit stress upregulated genes in sugarcane. Plant Mol

Biol Rep 29:291–304

Plant Cell Rep

123

Robatzek S, Somssich IE (2001) A new member of the Arabidopsis

WRKY transcription factor family, AtWRKY6, is associated with

both senescence- and defence-related processes. Plant J

28:123–133

Rushton PJ, Macdonald H, Huttly AK, Lazarus CM, Hooley R (1995)

Members of a new family of DNA-binding proteins bind to a

conserved cis-element in the promoters of alpha-Amy2 genes.

Plant Mol Biol 29:691–702

Rushton PJ, Somssich IE, Ringler P, Shen QJ (2010) WRKY

transcription factors. Trends Plant Sci 15:247–258

Ryu HS, Han M, Lee SK, Cho JI, Ryoo N, Heu S, Lee YH, Bhoo SH,

Wang GL, Hahn TR, Jeon JS (2006) A comprehensive expres-

sion analysis of the WRKY gene superfamily in rice plants during

defense response. Plant Cell Rep 25:836–847

Shen YG, Zhang WK, He SJ, Zhang JS, Liu Q, Chen SY (2003) An

EREBP/AP2-type protein in Triticum aestivum was a DRE

binding transcription factor induced by cold, dehydration and

ABA stress. Theor Appl Genet 106:923–930

Shinozaki K, Yamaguchi-Shinozaki K (2007) Gene networks

involved in drought stress response and tolerance. J Exp Bot

58:221–227

Shinozaki K, Yamaguchi-Shinozaki K, Seki M (2003) Regulatory

network of gene expression in the drought and cold stress

responses. Curr Opin Plant Biol 6:410–417

Singh K, Foley RC, Onate-Sanchez L (2002) Transcription factors in

plant defense and stress responses. Curr Opin Plant Biol

5:430–436

Sun C, Palmqvist S, Olsson H, Boren M, Ahlandsberg S, Jansson C

(2003) A novel WRKY transcription factor, SUSIBA2, partic-

ipates in sugar signaling in barley by binding to the sugar-

responsive elements of the iso1 promoter. Plant Cell

15:2076–2092

Szabados L, Savoure A (2010) Proline: a multifunctional amino acid.

Trends Plant Sci 15:89–97

Ulker B, Somssich IE (2004) WRKY transcription factors: from DNA

binding towards biological function. Curr Opin Plant Biol

7:491–498

Valliyodan B, Nguyen HT (2006) Understanding regulatory networks

and engineering for enhanced drought tolerance in plants. Curr

Opin Plant Biol 9:189–195

Wang QY, Guan YC, Wu YR, Chen HL, Chen F, Chu CC (2008)

Overexpression of a rice OSDREB1F gene increases salt,

drought, and low temperature tolerance in both Arabidopsis

and rice. Plant Mol Biol 67:589–602

Wang LJ, Li XF, Chen SY, Liu GS (2009a) Enhanced drought

tolerance in transgenic Leymus chinensis plants with constitu-

tively expressed wheat TaLEA3. Biotechnol Lett 31:313–319

Wang Z, Zhu Y, Wang LL, Liu X, Liu YX, Phillips J, Deng X

(2009b) A WRKY transcription factor participates in dehydra-

tion tolerance in Boea hygrometrica by binding to the W-box

elements of the galactinol synthase (BhGolS1) promoter. Planta

230:1155–1166

Wang L, Wang DL, He ZB, Liu GF, Hodgkinson KC (2010)

Mechanisms linking plant species richness to foraging of a large

herbivore. J Appl Ecol 47:868–875

Yamasaki K, Kigawa T, Inoue M, Tateno M, Yamasaki T, Yabuki T,

Aoki M, Seki E, Matsuda T, Tomo Y, Hayami N, Terada T,

Shirouzu M, Tanaka A, Seki M, Shinozaki K (2005) Yokoyama

S. Solution structure of an Arabidopsis WRKY DNA binding

domain. Plant Cell 17:944–956

Zhang YJ, Wang LJ (2005) The WRKY transcription factor

superfamily: its origin in eukaryotes and expansion in plants.

BMC Evol Biol 5:1–12

Zhou QY, Tian AG, Zou HF, Xie ZM, Lei G, Huang J, Wang CM,

Wang HW, Zhang JS, Chen SY (2008) Soybean WRKY-type

transcription factor genes, GmWRKY13, GmWRKY21, and

GmWRKY54, confer differential tolerance to abiotic stresses in

transgenic Arabidopsis plants. Plant Biotechnol J 6:486–503

Zhu XL, Liu SW, Meng C, Qin LM, Kong LN, Xia GM (2013)

WRKY Transcription factors in wheat and their induction by

biotic and abiotic stress. Plant Mol Biol Rep 31:1053–1067

Plant Cell Rep

123