land conflicts, property rights and the rise of the

Land Conflicts, Property Rights and the Rise of the

Export Economy in Colombia, 1850–1925.*

Fabio Sánchez Torres, School of Economics, Universidad de los Andes,

Calle 19ª # 1-37E, Bloque C, Bogotá, D.C. Colombia, [email protected]

Antonella Fazio Vargas, School of Economics, Universidad de los Andes,


María del Pilar López-Uribe, School of Economics, Universidad de los Andes,


Land Conflicts, Property Rights and the Rise of the

* We are grateful to Enrique López, Jorge Orlando Melo, Jose Antonio Ocampo and the participants of the

CEDE´s seminar for their valuable observations. We would also like to thank Diego Jaramillo, Booris

Piraneque and Diana Rocha for their excellent work as research assistants. The authors appreciate the useful

and insightful referees´ and editor’s comments that certainly contributed to improve our research.

1 Full Professor, Universidad de los Andes, Bogotá.

2 Researcher at CEDE, Universidad de los Andes, Bogotá.

3 Researcher at CEDE – Instructor Professor, Universidad de los Andes, Bogotá. 1

mailto:[email protected]



Export Economy in Colombia, 1850–1925.

Abstract

This research attempts to explain the poor performance of the Colombian economy in the

world markets during the late nineteenth century. Based on data on production of

agricultural exports at county (municipal) level in 1892, coffee production in 1925 and of

public land allocation and land conflicts during the nineteenth and twentieth century, we

found that one of the greatest obstacles that faced Colombian export development was the

weakness of settlers’ property rights in the frontier lands. The quantitative results show

that in the absence of land conflicts, the per capita production of agricultural exports would

have been at least twice as much as that observed.

Introduction

The export performance of Colombia during the wave of globalization at the end of the

nineteenth century was extremely poor. Per capita exports reached only US $6.0, the

second worst performance in Latin America after Haiti and barely one tenth of the per

capita exports by Argentina or Brazil. The Colombian economy’s weak integration into

the world markets at the end of the nineteenth century was ultimately the result of the

weakness of settlers’ formal property rights in the frontier lands.

National legislation on public land allocation adapted to the boom in world demand for

primary products, facilitating land titling and protecting the peasant settlers from large

landowners´ encroachments. However, the de facto power of the large landowners and the

high transaction costs of titling land prevented all but a few peasant settlers from acquiring

formal property titles. The lack of formal property rights on the frontier together with

opportunities of higher revenue from exports of primary goods caused the emergence of 2

land conflicts4 at the turn of the twentieth century. The property rights disputes between

peasant settlers and landowners, in turn, led to a level of exportable production much lower

than its potential5.

The Colombian economy during the nineteenth century

The post Independence Colombian economy was deeply rooted in its colonial past and

inherited most of its features6. The structures of taxation, the foreign and domestic trade

and the labor force in the nineteenth century were quite similar to those of the Borbonic

period at the end of the eighteenth century. Nearly eighty percent of exports were precious

metals whose revenues were used to import mainly consumption goods, which were taxed

to provide most of the Government’s income. Thus, public finances were weak and

depended mainly on customs that made up more than fifty percent of public revenue7.

Only a small percentage of workers were free, and those workers were primarily located in

urban centers. The rest worked in the Haciendas under non-wage arrangements as

sharecroppers, tenants, peons or domestic laborers8 .

In the middle of the nineteenth century, the Colombian economy started to break free from

its colonial structure. Liberal administrations from 1850 to 1880 implemented several

reforms. They abolished slavery, began expropriating and publicly auctioning

disentailment of Church lands, passed legislation on public land settlements, eliminated

4 The conflicts are defined as the peasant settlers’ petitions to national authorities to restore their lands

invaded or encroached by large landowners.

5 Exportable production comprised the agricultural goods produced to be sold in the international markets.

6 Ocampo, Colombia y la Economía Mundial, 1830-1910.

7 Ibíd.,

8 Ocampo, Colombia y la Economía Mundial, 1830-1910, Tovar, Grandes empresas agrícolas y Ganaderas. 3

colonial taxes on aguardiente and tobacco, and no longer demanded tithes and fifths9 . In

addition, Colombia became a federal Republic (the United States of Colombia) and

adopted free trade policies (librecambio). The Conservative party gained the presidency in

1886 and remained in power until 1930. Under the Conservatives’ rule the federal

Republic was abolished, the country turned back to centralism, the Catholic Church

recovered their privileges, and the trade policy became more protectionist. At the end of

the nineteenth century Colombia underwent the One Thousand Days War (1898-1902), a

bloody civil conflict between liberals and conservatives.

During the second half of the nineteenth century, foreign trade expanded and diversified.

Precious metals as a share of exports fell, as exports of new products-- tobacco, coffee,

quinine, indigo and leather--augmented. Between 1850 and 1880 exports grew on average

four percent per year, prompting the expansion of river navigation and shipping, road

construction and banking10. Nevertheless, Colombia did not develop a stable export base

because successful export of most of the new products rose during the booms and

disappeared once they ended.

Only coffee became a major export in the long run, rising from an export share of

eight percent in 1860 to 12 percent circa 1880 to 50 percent around 1900 and 79 percent

by the mid-1920s11. Coffee remained the chief export throughout the twentieth century.

The increase of coffee production triggered the expansion of the agrarian frontier. Between

1885 and 1896 a 50 percent rise of international coffee prices spurred a movement from

the eastern regions into the central and western areas of the country, as can be seen in Map

9 Díaz, La desamortización de bienes eclesiásticos en Boyacá, Ocampo, Colombia y la Economía Mundial,

1830-1910.

10 Ocampo, Colombia y la Economía Mundial, 1830-1910.

11 GRECO, El Crecimiento Colombiano en el Siglo XX.4

1. Coffee prices halved between 1896 and 1900, ending the coffee boom, while the

fighting during the Thousand Days War disrupted harvests and exports.12 After the civil

war ended in 1902, coffee production steadily increased until the crisis of 1929. During

that expansion, the colonization of public lands in the Colombian west intensified, as

shown by the expansion of coffee production in Map 1.

The economic globalization between1850 to 1912 stimulated exports from Latin

America.13 However, Colombia’s export growth during the period was 3.5 percent, below

the average of 3.9 percent for Latin America as a whole. In 1913 Colombia’s exports of $6

per capita were among the lowest in Latin America, well below the Latin American

average of $2414. The traditional view states that price cycles and limited linkages to the

world trade circuits were the main causes of Colombia’s slow export development during

the second half of the nineteenth century.15 According to this view, Colombia exhibited

high vulnerability to the world demand cycles and was one of the Latin American countries

in which the exports gains prompted by booms were almost completely annulled during

busts. In addition, as Colombia did not become an important supplier of raw material for

12 Ocampo, Colombia y la Economía Mundial, p. 114.

13 O’Rourke and Williamson, Globalization and History. According to Madisson, at 1990 prices, world

exports rose from 7,300 million dollars in 1820 to 56,200 million in 1870, 236,300 million in 1913 and

334,400 in 1929, Maddison, Monitoring the World Economy, 1820–1992.

14 Bulmer-Thomas, The economic History of Latin America since independence. Cardoso and Pérez, Historia

Económica de América Latina.

15 The export producers did have in mind the creation of a stable export base but just to obtain easy profits as

international prices remained high. As soon as prices fell the producers abandoned their export activities.

Thus, no relationship or connections were developed between the export sector and the rest of the economy

impeding at the same time the consolidation of sectors that may have enhanced export competitiveness.

These hypotheses were called “production-speculation” and “lottery of goods”, Ocampo, Colombia y la

Economía Mundial; Bulmer-Thomas, The economic History of Latin America since independence. 5

the European manufacturing industries she was not attractive to immigrants or foreign

investors which in consequence reinforced her exporting backwardness. We offer a

supply-side complement to that explanation. The weakness of land property rights and

consequent conflict over the rights made it difficult for Colombia to take advantage of the

export opportunities available to them.

Land supply and property rights at the frontier

Population growth from two five million people between 1851 and 1913 prompted

the occupation of the vacant lands (baldios) in agrarian frontier areas. After Independence

in 1819 and more intensely after 1850, the national Government began granting public

lands or baldíos. Before the 1870s, property rights in these frontier lands were in general

weakly defined as informal agreements established the boundaries of the settlers’ terrains.

Little more was needed because the frontier land was abundant and economic opportunities

from land were limited. However, the expansion of world markets after 1870 offered new

economic prospects to producers of primary goods in the periphery as land prices in the

New World increased.16 For instance, the notary data on land sales for the Department of

Cundinamarca show that the price per fanegada (0.66 hectares) rose by more than 200

percent between the 1850s and the end of the century.17 As the demand for land rose,

agrarian producers sought more formal property rights that would allow them to take full

advantage of the opportunities offered by the world markets.18

16 An example of these new opportunities at the world level is the drastic increase in land prices in the

different regions of the world. O’Rourke and Williamson show that between 1870 and 1910 the price of land

increased by 250% in the United States, O’Rourke and Williamson, Globalization and History.

17 Sánchez et al., Precios de la Tierra en Cundinamarca.

18 The new economic opportunities brought about greater scarcity of land. Following Demsetz it was needed

the emergence of new property rights in order to internalize the new benefit-cost possibilities for land 6

Peasant settlers faced many obstacles to establishing formal title to the land they

occupied. Titling was costly since it involved hiring lawyers and surveyors, and

establishing fencing. Further, local large landowners (terratenientes) were powerful and

used every tool at their disposal to prevent land titling to peasants.19 On many occasions

big landowners successfully claimed the terrain already occupied by peasants. The

peasants responded by trying to remain on the land and farming it themselves. These

conflicts were stimulated by the weakness and instability of formal property rights in the

frontier in a context of expected higher land returns.20

According to LeGrand, there were two phases of legislation on public land allocation

during the nineteenth century. During the first phase from 1820 to 1873, the government

sought primarily to cover the expenses of the war of Independence.21 The central

“Increase internalization results from changes…stem from new technology and the opening of new markets,

changes to which old property rights are poorly attuned”, Demsetz, “Toward a Theory of Property Rigths” p.

350.

19 LeGrand, Colonización y Protesta Campesina.

20 Several incidents of large landowner’s encroachment have been described by historians. Tovar used

archival evidence to show that the practice of big landowners of claiming terrains already in hands of

peasants was quite common. For instance, in 1880 near Cauca River Mr. Máximo Duque attempted to take

crops and shacks from 80 families who had been living there for at least 5 five years, some for as many as 50

years. The peasants demanded that the government suspend the legal actions that Mr. Duque undertook

against them, Tovar, Que nos tengan en cuenta, p.108-109.

21 LeGrand, Colonización y Protesta Campesina. The expenses of independence included both internal and

foreign debts and payments to war veterans, their creditors or legitimate children, who were compensated

with lands of approximately 10 hectares, Parsons, La colonización antioqueña en el occidente colombiano.

According to Palacios until 1873 the main usage of baldios was to serve as collateral of the Colombia’s

foreign debt, Palacios, El café en Colombia, 1850-1970. Una historia economica, social y politica7

government issued bonds that were exchanged for or redeemable in public lands.22 This

policy meant that most of the public lands were allocated to rich businessmen and big

landowners. After 1873, land titling policy was redirected to bring it more in line with the

economic changes ignited by the growth in the export economy. Thus, law 61 of 1874 and

law 48 of 1882 established that settlers who occupied terrains for five years or more and

made productive use of them would be awarded property titles.23 The legislation limited as

well the concentration and unproductive use of the land. For instance, Law 48 of 1882

established that the maximum allocation would be 5,000 hectares. In 1912 it was reduced

to 2,500. The law also determined that if the land remained unproductive for more than ten

years, it would return to government’s hands24. However, the titling process typically

involved surveyors and lawyers’ fees, headed paper, stamps charges and property

registration, and the central government was not effective at enforcing land laws at the

22 The Colombian Congress issued certificates of public debt redeemable in public lands. “Such certificates

were used to back the national debt, to pay veterans of the Independence wars and to subsidize the

construction of roads and railroads. Once distributed the land certificates did not have to be exchanged for

land but could be freely bought and sold” LeGrand, Colonización y Protesta Campesina, p. 11.

23 LeGrand mentions that the legislation protected the settlers, guaranteeing them the property rights of any

baldíos they took over, thus preventing their expulsion from the lands that they occupied. Articles 2, 5 and 6

from law 48 of 1882 are examples of such legal protection. Article 2 indicated that the land cultivators

would be considered “good faith” owners and therefore could not be deprived of the property unless a

sentence ruled otherwise. Article 5 declared that should there be a case in which the cultivator lost the

property through a ruling, he could not have the land he occupied taken from him until he was compensated

with the value of the improvements he had made to the land. Lastly, article 6 stipulated that the agents of the

public Ministry must support the cultivators of baldíos in any case of land dispute against them.

24 LeGrand, Colonización y Protesta Campesina; Parsons, La Colonización Antioqueña; Brew, El Desarrollo

Económico en Antioquia. 8

local level.25 As a result, many settlers on the frontier decided not to pay the high

transactions costs and did not establish formal property rights to the land they settled.26 In

an environment of growing economic opportunities for agricultural activities, the

interaction between the settlers’ informal rights and the increase in the land returns and

export prices led to land conflicts.27

Policies to liberalize access to land during the second half of the nineteenth century

were implemented by the liberal party administrations to promote economic progress.

The government expanded the land available for economic exploitation by granting or

selling public lands (baldios), disentailing (expropriating and selling) church goods and

dissolving indigenous territories or communal lands (resguardos). Thus, between 1850

and 1930 land policies distributed nearly 6 percent of the inhabited Colombian territory

that belonged to the State to private owners.

The titling of public land followed the cycles in export prices as shown in Figure 1.

Before 1850 only about twenty square kilometers per year were titled. The titling rose to


26 “By law, every applicant for a public land grant had to hire a surveyor to measure the territory. If the parcel

was less than fifty hectares in size, the surveying costs generally exceeded the market value of the land itself.

The settler also had to pay travel costs of witnesses and local authorities from the municipal seat to the site of

the claim and back” LeGrand, Colonización y Protesta Campesina, p.30. Once the settler completed at least

five years as squatters several steps were needed to finish the titling process: a) hiring a surveyor to measure

the terrains and a lawyer to fill the request’s paperwork ; b) mailing or taking the application to the nearest

town with judiciary authorities; c) having the authority’s approval after visiting the terrains; d) paying the

property registration if approval was given. Palacios also states that sometimes the legal procedure to title a

terrain was more expensive than the terrain itself. In addition, the frequent changes in the government entities

in charge of handling baldios also contributed to curbe titling for peasants. Palacios, El café en Colombia,

1850-1970.

27 Alston et al.,“Violence and the development of property rights”, p. 152.9

ninety square kilometers from 1850 to 1865 as the export economy grew and export prices

rose. During the quinine and tobacco export booms of the 1870s land granting sky-

rocketed to nearly 4,000 square kilometers per year as the export price index rose from 300

to over 400.28 After a reduction in titling in the early 1880s, a new rise in export prices and

export growth led titling to a new peak of 3,000 square kilometer in 1891-1895.29 Land

titling reached their lowest level, right after the Thousand Days War in 1901-1905 and then

rose to its highest levels during the early 1920s.

Figure 1 also presents the number of public land grants, which did not always follow the

pattern for land titling. Before 1900 the rise of the number of titles coincided with the

increase of the amount of land titled. In contrast, during 1900-1915 as the number of land

titles increased, the quantity of land titled grew at a slower pace, implying a reduction in

the size of the lots titled

According to Table 1 during 1853–1873, 61 percent (318) of the titling allotments

were comprised of land granted to peasant settlers (a titulo de cultivador) and 39 percent

(206) to public land sales through bonds to big landowners. The average of 25.8 square

kilometers (around 6400 acres) of land per title was for the land acquired by bonds was

much higher than the 5,1 average (around 1260 acres) for titles allotted to peasants

(cultivadores) through free grants. The peasant allotments seem rather large which may

suggest that those that decided to obtain formal titles were relatively well off and willing to

pay the high transaction costs the process involved. From 1874 to 1892, when legislation

was more favorable to squatters, 68 percent (413) of land allotments were granted to them, 28 The existing data show that the quantity of land granted between 1827 and 1850 was low, since the

government did not encourage as much the colonization of frontier lands. In fact, land sales were rather

regarded as a source of fiscal revenue, LeGrand, Colonización y Protesta Campesina.

29 According to LeGrand, with the extinction of the tobacco and quinine boom, the granting process slowed

down until the beginning of the coffee boom, LeGrand, Colonización y Protesta Campesina, p. 72.10

but the average amount of land per title was smaller at 4.6 square kilometers. Hence,

despite national government policies intended to favor and to attract those who would

occupy small parcels, most of the land titled ended up in large private buyers’ hands.

As table 1 shows from 1893 to 1917 the titling activity intensified particularly to

peasant settlers that obtained 82% (1479) of the total allotments (1803). In addition, the

average size of the plots both for large landowners and peasant settlers diminished to 12

(from 21.7) and to 2.9 (from 4.6) square kilometers respectively in compliance with the

Law that limited the maximum lot size to 25. From 1918 to 1930 titling was relatively more

moderate although the average lot size rose. It was precisely during the late nineteenth and

the early twentieth centuries when export agriculture experienced a vast geographical

expansion as the number of coffee municipalities jumped from 200 in 1892 to 387 in 1925.

Export Economy, Public Land Allotments and Conflicts

The largest part of the export agriculture in particular coffee located itself in the frontier

areas. Figure 2a evidences such relationship at departmental (state) level showing the high

correlation between the share of 1925 coffee production and share of public land

allotments30. It is observed that Antioquia, Valle and Norte de Santander were the leading

coffee producers and received from during the nineteenth and early twentieth centuries the

highest proportion of public lands allotments.

The agrarian conflicts arose as a consequence of a slow titling process of public lands

occupied by peasant settlers in an environment of increasing opportunities of primary

export. As land values went up with the rise in export opportunities, peasant settlers

demanded more formal property rights over the land they settled, but the government was

slow to supply the titles. Meanwhile, large landowners increasingly sought to usurp the

30 Similar correlation is observed for 1892 export production. 11

land occupied by squatters on the frontier. Between 1827 and 1869, just one agrarian

conflict was registered. The number of conflicts then rose to 69 between 1870 and 1900,

as coffee increased its share of exports, as large landowners sought to expand their land

where they already had properties.31 A steep rise in coffee prices from 7 to 25.9 U.S. cents

between 1900 and 1929 coincided with a rise in land conflicts to 137 between 1901 and

1917 and 241 from 1918 to 193132.

Figure 2b depicts the relationship between the department’s shares in the total numbers of

land conflicts during 1850-1917 and in the total amount of public land allotments

indicating that frontier expansion and agrarian conflicts are positively correlated. Figure 2b

suggests that in some regions the occupation of new territories brought about relatively less

disputes than in others implying that some areas had better provision of formal property

rights.

Two factors impeded a wide spreading of formal property rights among squatters:

the high cost of titling and the central government’s low capacity to enforce land laws and

to effectively provide titles at local level. These factors facilitated large landowners to

appropriate for themselves encroached peasants’ terrains33. Land conflict and inadequate 31 About 63 percent of the land conflicts occurred in municipalities where land was allotted to big landowners

through bonds. Calculations based on Gaceta Oficial (1854, 1856, 1858–1861), Registro Oficial (1862–

1864), Diario Oficial (1865–1931) and LeGrand, Colonización y Protesta Campesina.


33 Alston et al. show how the agrarian polices during the 1980s in Brazil may have given incentives both

squatters and farmers to engage in violence. For instance, the fact that the Brazilian government would

expropriate private idle farms in favor of the landless peasants could have induced them to invade those

farms beforehand. At the same time, if the farmers requested the eviction of the invaders the final outcome

was higher violence, Alston et. al “ A Model of rural conflict” . In the Colombian case during the nineteenth

century the titling policy could have encouraged big landowners to usurp untitled peasant terrains expecting

to obtain for them the formal land titles. Landowners had in their favor both their ability to influence local 12

specification of property rights make investment in production of exports more difficult.

Hence, it is argued that such climate of property right insecurity contributed quite

negatively to Colombia’s performance in the world markets at the end of the nineteenth

century and even to long-term export performance in the twentieth century. In

consequence, regions with greater government supply of property rights land conflicts

could have been prevented and the export production should have performed better.

Nevertheless, as conflicts were more likely to emerge in regions where agricultural

production and expected returns on land were relatively high their probable endogeneity

should be corrected. The empirical test of this hypothesis and the identification strategy

will be presented in the next section.

Empirical model

The econometric strategy seeks to show the link between the production of agricultural

exports and the weakness of property rights, expressed as the presence of land conflicts at

the county (municipal) level. For this, the following model is estimated:

where Yji is the dependent variable measured in three ways: the natural logarithm of

municipal per capita value of exports (in pesos of 1892), per capita value of coffee

production (in pesos of 1892), or the number of per capita county (municipal) coffee trees

in 1925. For 1892, the value of per capita exports is calculated by multiplying the

production of each export product--tobacco, coffee, sugar, cacao and plantain—by their

domestic average price.

authorities and their capacity to finance a lengthy and expensive judicial process.

13

PhysicalGeographyi is a vector that includes measures of altitude, soil fertility,

precipitation, rivers in kilometers, temperature, humidity, distances to the Pacific and

Atlantic oceans and the distance to the Cauca River; DistancetoMarketsi is the distance of

each county to Bogota as the main administrative and economic center of Colombia.

Landsupplyi is a vector with the variables describing areas where took place

dissolution of indigenous communal lands during the eighteenth century, church land

disentailments from 1864 to 1884 and public land titling from 1830 to 1917. Titling

granting in a particular county indicates that frontier expansion indeed occurred there. In

fact, the first squatters may have settled years and even decades before the first titling

process occurred. The three types of land supply expansion not only influenced (positively

o negatively) production of exports in the county where they happened, but also in the

neighboring ones. In this regard, as most of the production of exports located themselves in

counties with public land allotments it is expected that some spillovers of the cropping

know-how may have transmitted to the neighboring counties. Likewise, if the agricultural

know-how was associated with traditional crops usually grown in the former indigenous

lands the spillover effect on agricultural exports was expected to be negative. In order to

observe such a spatial effect, we calculated three variables: “public land influence, 1850–

1892”, “ disentailment influence” and “dissolution of communal land influence.” Each

variable takes the value of one in a county where their existence is reported and zero if the

county is located more than 100 kilometers away from any county that had that type of

land expansion. If the county did not report that type of land expansion and is located

within 100 kilometers, it is given a value of ((100 – distance)/100)2, where distance is the

14

number of kilometers to the nearest county that reported the type of expansion was

assigned to it34.

Production1851i is a vector of dummy variables for the production of sugar, tobacco,

cacao, plantain and coffee in county i in 1851. We include this vector as it is expected that

a county that in the past had produced exports products was more likely to produce them

again if new market opportunities would arise. As Colombia exported during the

nineteenth century more tobacco than plantain or sugar in the counties with tobacco crops

in 1851 there was surely better knowledge of the export business. In this regard, different

crop production in 1851 would have different effects on export production in 1892 and

1925.

LandConflicti takes a value of 1 if any land conflicts occurred between 1827 and

1917 and 0 if not. As observed, the time span for land conflicts goes beyond 1892 the year

of production census on which one of the econometric exercises will be performed. In fact,

the report of land conflict to a Colombian court showed a) the lack of formal titles over a

terrain settled by peasants; b) that the terrain had been encroached by big landowners and

c) that the peasants attempted to restitute it for themselves through a legal process. In

consequence, property rights had been weak and quarrels between peasants and big

landowners took place while agricultural production was probably below its potential years

before the lawsuit was actually filed35.

34 We tried with other distances and although results did not change significantly the best results were

obtained with 100 kilometers,

35 One example of the weakness of property rights and quarrels between peasants and landowners long

before the legal process of restitution started was the attempt in Espiritu Santo County (Antioquia) near

Cauca River of some big landowners to appropriate for themselves in 1880 terrains that had been in hands of

eighty peasant’s families for over more than fifty years. The peasant reported the usurpation attempts to the

Courts during the 1880s. Tovar, Que nos tengan en cuenta. Palacio for instance describes the several 15

We are interested in the measuring the causal effect of land conflict on export

production, but there is a potential problem with endogeneity because land conflict itself

was likely to rise in response to higher expected land returns associated with expanded

production of exportable goods. To control for potential endogeneity bias, we use an

instrumental variable method with “closeness to colonial institutions” as the identifying

instrument. Thus, the first-stage equation for land conflicts takes the following form:

where ClosenessColonialInstitutionsi is a measure of the central government’s influence in

county i.36 In the counties where colonial institutions existed, the central government

authority at the end of the nineteenth century was stronger and it could better enforce the

land laws and property rights at local level than in those where such authority was weak or

did not exist at all. To create the variable, we determined the location of the Encomiendas

in 1560 and the places with more than 20 slaves in 1800.37 We then constructed a distance

measure with value 1 if a county had both an Encomienda in 1560 and slaves in 1800. The

value is zero if the county was more than 100 kilometers distant from the closest

disputes between large landowners and peasant settlers in the coffee zone at the beginning of the twentieth

century some of which lasted 10 or more years. Palacios, El café en Colombia, 1850-1970, chapter 13.

36 Based on the visits of 1560 transcribed by Tovar, the Spaniards began to found “villages of Indians” in the

places with indigenous populations, as they needed to use them as a workforce, Tovar, No hay caciques ni

señores. Similarly, the slave population was used to work in economic activities, such as gold extraction,

domestic work in some urban centers or on the sugar or cotton plantations, Colmenares, Historia Ecónomica

y Social de Colombia. Hence, the existence of tributary Indians and of slaves reveals the presence of the

State and of the Spanish colonial institutions.

37 Tovar, Grandes Empresas Agrícolas y Ganaderas; Tovar et al., Convocatoria al Poder del Número.16

Encomienda and the closest slave area. To obtain the value for the remaining locations we

calculated the distance to the nearest Encomienda and the distance to the nearest slave area

and then used the following formula:38

There is evidence that the power of the central government in the 1800s was

stronger and its ability to provide land formal titles more effective in locations where

encomiendas in 1560 and slaves in 1800 were located. Further, the effectiveness of

enforcing property rights was lower as the distance from these colonial locations increased.

The locations with encomiendas and slave populations had long histories of close

monitoring by central authorities. During the conquest of Latin America the Spaniards

settled in places where the indigenous labor force was relatively abundant. In order to

allocate this labor force in mining and agriculture in the early 1500s, the Crown created the

Encomienda, which commended or entrusted a Spaniard and his heirs with the right to

38 The formula was taken from Naritomi, Soares and Assuncao, Rent Seeking and the Unveiling of “De

Facto” Institutions. “Closeness to Colonial Institutions” was derived from information provided by Duque y

Sánchez, Instituciones Coloniales e Instituciones Republicanas en el Desarrollo Económico Colombiano:

¿Cuáles Pesan Más?. So as to locate colonial sites, the authors used the information on tributary Indians

compiled by Tovar who transcribed the archival data on villages, and number of Indians and their Chiefs that

the Spanish Visitador registered in 1560 Tovar, No hay caciques ni señores. So as to localize the 1560

Encomienda sites in today’s municipalities and to georeference Tovar’s data we replicated the Visitador’s

route on the current Colombian map. Using the Geographical Diccionario of Colombia (IGAC, 1996) that

contains the toponymy of more 100 thousand places we matched the 1560 Indian settlements to each of the

current Colombian municipalities,. The same methodology was used for 1800 slave population compiled by

Tovar et al, Tovar et al, Convocatoria al Poder del Número. Censos y Estadísticas de la Nueva Granada,

1750–1830.17

extract tribute goods from a group of indigenous Colombians. The Spaniard was obliged

to Christianize the indigenous group and to pay taxes to the Crown on the goods extracted.

To monitor the proper functioning of the arrangement, the Spanish Crown sent visitors and

judges to determine the taxes to be paid and to enforce the legislation for the protection of

indigenous population. Hence, in the areas where Encomiendas existed compliance of law

was indeed stronger39.

Similarly, in zones with slaves descendant from Africans the Spanish Crown

granted privileges to exploit mining deposits and also limited and controlled the miners’

usage rights of deposits and nearby water sources. The authority regulated the mining

technology to be employed. Likewise, the Reales de Minas –villages inhabited by mining

slaves- were constantly visited by Crown’s officers who verified the observance of laws

and regulations regarding those settlements40. In both of these regions the Spanish Crown

or the local cabildos granted land titles and enforced property rights. In particular, the

central government discouraged the encroachment onto peasant settlers’ lands by

landowners, reducing the existence of conflicts. Since the types of exports in 1892 and

1925 were dramatically different from those in 1560 with the Encomienda or in mining

with slaves in 1800 these variables are suitable instruments.

Empirical Results

Table 2 shows the results of the empirical strategy. We use OLS and TSLS models to

explain the per capita levels of 1892 production of exports and of 1925 coffee production.

Columns 2 and 5 show the OLS results. The bias of the coefficient for conflict coefficient

39 Colmenares, Historia Económica y Social de Colombia, Burkholder and Johnson, Colonial Latin America.

40 Colmenares, Historia Económica y Social de Colombia.18

is expected to be positive because as export augmented so did land disputes. In fact, the

OLS coefficients for both years are not statistically different from zero. Columns 4 3-4 and

6-7 contain the first and second stage estimates for production of exports in 1892 and of

coffee production in 1925 respectively. Column 3 and 6 that the instrument for land

conflicts “closeness to colonial institutions” is negative and significant at 99 percent,

suggesting that counties with or close to colonial institutions in the past experienced a

lower probability of land conflicts at the end of the nineteenth century as property rights

were better defined. In those counties, the central government could more strongly enforce

the land laws and deter landowners’ encroachments41.

As expected both the closer to the markets –higher land returns but more formal

property rights- and the farther away from them –small land returns- the lower would be

the likelihood of land disputes. This result is maintained for 1892 and 1925 and is quite

important for the paper’s hypothesis since it indicates that whatever the impact of land

conflicts on production it will certainly capture only such effect. In other words, counties

located at the same distance to Bogotá would differ in production of exports depending

ceteris paribus upon land disputes.

Columns 4 and 7 of the same table exhibit the second stage results for production

of export in 1892 and of coffee in 1925. In both models land conflicts have a negative and

significant impact on the presence of exportable production. Thus, land conflicts lowered

agriculture for exports in 1892 and coffee in 1925 confirming that the weakness of

property rights contributed to the poor performance of the export economy and hence to

the meager integration of Colombia in the international markets at the end of the nineteenth

41 Although the variable land conflicts is dichotomous with values 0 and 1, the first stage values are predicted

with OLS. However, no predicted value is greater than 1 and 139 (out of 712) are lower than zero.

Nevertheless, only 11 predicted values are below –0.1.19

century42. As robustness check we also ran second stage models using the probit

predicted values of land conflicts obtaining coefficients similar to TSLS. After calculating

the bootstrapped standard errors the significance of the predicted land conflict coefficients

both for 1892 and 1925 was above 99% (See appendix 2)

As for the effects of other variables, public land allotments in a county increased in

0.6 log points (0.75 standard deviations) the production of exports in 1892 and in 1.26 log

points (0.57 standard deviations) coffee production in 1925. Alternatively, the existence of

disentailed Church assets raised agriculture of exports in 0.26 log points (0.32 standard

deviations) only for 1892 In contrast, dissolution of communal lands during the eighteenth

century impacted quite negatively (nearly 0.57 standard deviations) 1925 coffee production

as those lands turned into Haciendas strongly oriented to cattle raising and foodstuff crops

for the domestic market43.

This model specification allows testing the weakness of the instrument. The F-test

indicates that the null hypothesis that the instrument equation is weakly identified is

rejected as its value is 14.2 (p=0.0011). In addition, critical values for the Stock and Yogo

weak instrument test44 (5% significance) based on the TSLS size with exact identification

is 16.38 for the 10% size distortions and 8.96 for the 15%. The value for Cragg-Donald

weak identification test obtained is 14.2 very close to most stringent critical value. Thus,

the hypothesis of weak instrument is rejected (see table 2). Finally, the endogeneity tests

42 We also estimated instrumental variables probit and tobit models for presence and per capita level of export

agriculture. The results obtained for both estimation are similar to TSLS’s ones (see appendix 2).

43 The highland Haciendas produced mainly livestock and agricultural goods for the domestic markets

(potatoes, corn) The low lands Haciendas produced sugar cane for panela (a product derived form sugar cane

with high caloric contain) Tovar, Hacienda Colonial y Formación Social.

44 Stock and Yogo, “Testing for weak instruments in linear IV regression”. 20

both for 1892 and 1925 indicate that the land conflict variable is indeed endogenous and

should be instrumented.

In order to determine the impact of the conflicts on exportable agriculture we just

compare the mean values of Yij (the observed production with land disputes) against the Yij

–β5*LandConflicti (the production without land disputes). The result indicates that, in 1892

in absence of land conflicts per capita exportable production would have been twice as

much higher than the observed actual production. Thus, the average per capita exportable

output in 1892 was 1.77 pesos whereas in the absence of land conflicts it would have been

3.50 pesos. Likewise the average number of coffee trees in 1925was 62 while in the

absence of conflicts it would have been 31045.

In summary, the econometric results confirm the hypothesis that the poor

integration of the Colombian economy into the world market at the end of the nineteenth

century was to a large extent the result of the weakness of property rights in agrarian

frontier that prompted an important number of land conflicts. The peasant settlers’ lack of

land titles fed their fear of encroachment, which may have inhibited them from sowing or

increasing productivity to their highest potential. The limited transformation of informal

property rights into formal ones, more in line with the economic opportunities of

globalization, was one of the factors that heavily contributed to delay export development.

Thus land conflicts as manifestations of weak property rights affected production of

exports at the end of the nineteenth century and even more severely coffee production at

the beginning of the twentieth century. Hence, property rights institutions (or the lack of

45 Similar results are found if the calculations are carried out taken into account only counties with 1925

production greater than zero. In this case, average number of per capita coffee trees in absence of land

conflicts rises from 109 to 518.21

them) have a substantial effect on economic performance, as other research has extensively

confirmed46.

Conclusions

This article shows the relationship between the expansion of the agrarian frontier,

land conflicts and the production of exportable goods at the end of the nineteenth century.

It starts out with the hypothesis that land conflicts were the result of the combination of

economic opportunities offered by globalization and the lack of formal property rights on

the frontier. As large landowners had incentives to encroach on those lands that had been

occupied by peasant settlers the latter restrained themselves from sowing or investing,

which may have determined that the production of agricultural exports was below its

potential.

So as to correct the likely endogeneity of the “land conflicts” variable, we used as

instrument the average distance – standardized from 0 to 1 – between a county with no

colonial institutions and the nearest one that had colonial institutions (Encomienda in 1560

or more than 20 slaves in 1800). Our econometric evidence indicates that land conflicts

had a negative effect on the potential production of exports. In fact, it is estimated that, in

the absence of land conflict, production of exports in 1892 could have been two times

larger. For the 1925 coffee production the negative effect was even more critical. Other

results indicate the existence of a positive and strong relationship between the production

of exportable goods and allotments of public lands.

46 Acemoglu and Johnson contrast the effect of the contracting institutions with the property rights

institutions and they find that the latter affect the most countries’ long-term economic performance, either

measured by income per capita or by the rate of investment, Acemoglu and Johnson, “Unbundling

Institutions”. 22

This article concludes that internal factors, namely the informal structure of

property rights on the frontier areas and the central government’s incapacity to restrict the

encroaching behavior of the landowners, significantly curbed the Colombian export

development during the late nineteenth and early twentieth centuries.

Appendix 1

Variable Definition Source

Production of

exportable products

per capita (Log

1892)

Logarithm of the value of the production of exportable

products that includes coffee, cacao, sugar, plantain and

tobacco in 1892 prices.

Boletín Trimestral de la

Estadística Nacional (1894)

Coffee production

per capita (Log

1892) Logarithm of the value of the coffee production in 1892 prices.

Boletín Trimestral de la

Estadística Nacional (1894)

Coffee production

per capita (Log

1925) Logarithm of the quantity of coffee trees in existence in 1925. Monsalve (1927)

Distance from

colonial institutions

Calculated as the normalization of the average distance

(between 0 and 1) of a county with respect to the nearest

counties where there were Encomiendas in 1560 and more

than 20 slaves in 1800. Takes a value of 1 in the counties

where there were both institutions and 0 if there was neither

institution in the counties at a maximum of 100 km distance.

Tovar (1988) and Duque percent

Sánchez (2007)

Distance from

disentailments

Calculated taking into account the distance between the county

in question and the nearest county with disentailed church

properties. It takes a value of 1 when the county had

disentailed properties and 0 if the nearest county with this

institution was at more than 100 km distance. For those

counties within the 100 km range, a value of between 0 and 1

Archivo General de la Nación

(AGN), Sección República,

Fondo de Bienes

Desamortizados (Rolls 1 to 30),

Registro Oficial 1862–1864 and

23

was calculated, depending on the distance to the nearest

county that reported this institution. Diario Oficial 1865–1884

Distance from

public lands


in question and the nearest county with public land

concessions. It takes a value of 1 when the county had public

land concessions and 0 if the nearest county with this




county that reported this institution.

Registro Oficial (1862–1864)

and Diario Oficial (1865–1931)

Distance from

dissolution of

communal lands in

18th century


in question and the nearest county with dissolution of

communal lands in the eighteenth century. It takes a value of

1 when the county had dissolution of protection in the

eighteenth century, and 0 if the nearest county with this




county that reported this institution. Tovar (1980) and Tovar (1988)

Dummy conflict

1827–1917

It takes a value of 1 if the county had land conflict between

1827 and 1917 and 0 if not. LeGrand (1988)

Dummy conflict

1827–1931

It takes a value of 1 if the county had land conflict between

1827 and 1931 and 0 if not. LeGrand (1988)

Dummy production

1851

Matrix of variables of the production of sugar, tobacco, cacao,

plantain and coffee that takes a value of 1 if the product was

produced in the county in 1851 and 0 if not.

Geografía Física y Política de la

Confederación Granadina,

volumes I, II, III, IV, V, directed

by general Agustín Codazzi

(2002)

Geographical Variables

Altitude Meters above sea level. Sánchez percent Nuñez (2000)

Fertility Index reflecting the aptitude of the land for agricultural Sánchez percent Nuñez (2000)

24

activities (drainage, erosion, natural slopes, sodium contents,

etc.).

Precipitation Average rain lprecipitation in cubic centimeters per year. Sánchez percent Nuñez (2000)

Rivers

Index of extension of primary, secondary and tertiary rivers

that run through the area of a county.

Sánchez percent Nuñez (2000)

Temperature Average centigrade degrees in the county. Sánchez percent Nuñez (2000)

Distance to River

Cauca

Index of minimum distance of the county from the River

Cauca.


Distance to Bogotá Index of minimum distance of the county from Bogotá. Sánchez percent Nuñez (2000)

Distance to Atlantic

Ocean

(Barranquilla) Index of minimum distance of the county from Barranquilla.


Distance to Pacific

Ocean

(Buenaventura) Index of minimum distance of the county from Buenaventura.


Appendix 2

25

Panel A: Reports the second stage of the estimation both of the probit and the tobit for the dummy of export

production for 1892 and 1925 and log of the export production per capita as dependent variables,

respectively. This panel also reports the second stage estimation of the 2TSLS for the coffee production per

capita in 1892. Others controls included are altitude, fertility, precipitation, rivers, temperature, distance to

river Cauca, Distance to Barranquilla, Distance to Cali and Distance to Buenaventura.

Panel B: Reports the first stage for the two models with conflict (1827–1917) as a dependent variable. The

instrumental variable is the average distance from Encomienda for the year 1560 and from municipalities

with more than 20 slaves in 1800. Others controls included in both stages are: altitude, soil fertility, rain

precipitation, kilometers of rivers, temperature, distance to Cauca river, distance to Barranquilla and Distance 26

to Buenaventura. Standard error in brackets. Critical values for the Stock and Yogo weak instrument test (5-

percent significance) based on TSLS size with exact identification are 16.38, 8.96, 6.66 and 5.53, for the 10-

percent, 15-percent, 20-percent, and 25-percent sizes respectively.

Primary sources

Archivo General de la Nación (AGN), Sección República, Fondo de Bienes

Desamortizados (Rollo 1 to 30).

Geografía Física y Política de la Confederación Granadina, volumes I, II, III, IV, V,

under the direction of the General Agustín Codazzi (2002).

Gaceta Oficial (1854, 1856, 1858–1861).

Registro Oficial (1862–1864).

Diario Oficial (1865–1931).

Boletín Trimestral de la Estadística Nacional (1894).

GRECO, El Crecimiento Colombiano en el Siglo XX, Aspectos Globales, Bogotá: Banco

de la República, 2002.

Instituto Geográfico Agustín Codazzi. Diccionario Geográfico de Colombia, Bogotá,

1996.

Monsalve, Diego. Colombia Cafetera, 1927.

Tovar, Hermes. Grandes Empresas Agrícolas y Ganaderas, Bogotá: Universidad Nacional

de Colombia, 1980.

Tovar, Hermes. No Hay Caciques ni Señores, Barcelona: Sendai Ediciones,1988.

Tovar, Hermes; Tovar, Camilo; Tovar, Jorge. Convocatoria al Poder del Número. Censos

y Estadísticas de la Nueva Granada, 1750–1830. Bogotá: Archivo General de la Nación,

1994.

Bibliography

27

Acemoglu, Aaron; Johnson, Simon. “Unbundling Institutions”, Journal of Political

Economy, 113, no 5 (2005): 949–995.

Alston, Lee, Liebcap, Gary, Mueller Bernardo “A model of rural conflict: violence and land reform policy in

Brazil”, Environment and Development Economics4 (1999): 133-160.

Alston, Lee; Libecap, Gary; Mueller, Bernardo “Violence and the Development of

Property Rights to Land in the Brazilian Amazon” in The Frontiers of the New Institutional

Economics, Drobak, John and Nye, John (Editors), Academic Press, 1997.

Brew, Roger. El Desarrollo Económico de Antioquia desde la Independencia Hasta 1920,

Medellín: Editorial Universidad de Antioquia, 2000.

Bulmer-Thomas, Victor. The Economic History of Latin America since Independence,

New York: Cambridge University Press,1994. .

Burkholder, Mark, Johnson, Lyman. Colonial Latin America, New York: Oxford

University Press, 2008.

Cardoso Ciro; Pérez Héctor. Historia Económica de América Latina, Barcelona: Editorial

Crítica, 1987.

Colmenares, Germán. Historia Económica y Social de Colombia, 1537–1719, Vol. 1,

Bogotá: Tercer Mundo Editores, 1999Bogotá.

Demsetz, Harold “Toward a Theory of Property Rigths”, American Economic Review 57,

Issue 2. (1967): 347-359.

Díaz, Fernando. La desamortización de bienes eclesiásticos en Boyacá, Tunja: UPTC,

1977.

Duque, Valentina; Sánchez, Fabio. Instituciones Coloniales e Instituciones Republicanas

en el Desarrollo Económico Colombiano: ¿Cuáles Pesan Más?, Mimeo, 2007.

Furubotn, Eirik; Richter, Rudolf. Institutions and Economic Theory. The Contribution of

the New Institutional Economics, The University of Michigan Press, 2005.

28

Instituto Geográfico Agustín Codazzi, www.igac.gov.co.

LeGrand, Catherine. Colonización y Protesta Campesina en Colombia: 1850–1930,

Bogotá: Universidad Nacional de Colombia, 1988.

Maddison, Angus. Monitoring the World Economy, 1820–1992, París: OECD, 1995.

Naritomi, Joana; Soares, Rodrigo; Assuncao, Juliano (2007) Rent Seeking and the

Unveiling of ‘De Facto’ Institutions: Development and Colonial Heritage within Brazil,

Mimeo.

Ocampo, José Antonio. Colombia y la Economía Mundial, 1830–1910, Bogotá: Tercer

Mundo Editores, 1984.

O’Rourke, Kevin; Williamson, Jeffrey. Globalization and History, Massachusetts: The

MIT Press, 1999.

Palacios, Marco. El Café en Colombia, 1850-1970. Una Historia Económica, Social y

Política, Thrid Edition, Bogota, Editorial Planeta 2002.

Parsons, James. La Colonización Antioqueña en el Occidente Colombiano, Bogotá: El

Áncora Editores y Banco de la República, 1997.

Sánchez, Fabio; Fazio, Antonella; López-Uribe, María del Pilar Precios de la Tierra en

Cundinamarca durante el Siglo XIX, Mimeo, 2009.

Sánchez, Fabio; Nuñez, Jairo “La Geografía y el Desarrollo Económico: una

Aproximación Municipal”, Desarrollo y Sociedad, 46 (2000).

Stock, James; Yogo, Motohiro “Testing for weak instruments in linear IV regression”,

NBER, Technical Working Paper, 284 (2002): 1-73.

Tovar, Hermes. Que nos tengan en cuenta, Bogotá: Colcultura-Tercer Mundo Editores,

1995.

Table 1. Land allocation by type of titling, 1853–1930.29

Source: Gaceta Oficial (1854, 1856, 1858–1861), Registro Oficial (1862–1864), Diario

Oficial (1865–1931) and authors’ calculates.

Table 2. Econometric Results. Dependent Variables: Exportable Production in 1892 and in

1925 (Per Capita Values).

30

The table reports the OLS and the first and second stage of the TSLS using the log of the exportable

production per capita in 1892 and 1925 as dependent variable. The number of counties with conflicts is 110.

The instrumental variable is the average distance from Encomienda for the year 1560 and from counties with

more than 20 slaves in 1800. Others controls (not reported) are: altitude, soil fertility, rain precipitation,

kilometers of rivers, temperature, distance to Cauca River, distance to Barranquilla, Distance to Cali and

Distance to Buenaventura. Standard error in brackets.

Critical values for the Stock and Yogo weak instrument test (5-percent significance) based on TSLS size with

exact identification are 16.38, 8.96, 6.66 and 5.53, for the 10-percent, 15-percent, 20-percent, and 25-percent

sizes respectively.

31

Figure 1. Export Price Index, Number of transactions and square kilometers of public lands

titled 1850–1910 (in five-year periods).

0

50

100

150

200

250

300

350

400

450

500

0

1000

2000

3000

4000

5000

6000

1851-55 1856-60 1861-65 1866-70 1871-75 1876-80 1881-85 1886-90 1891-95 1896-00 1901-05 1906-10

Num

ber o

f tra

nsac

tions

and

Exp

orta

tion

Price

Inde

x

KM2

Number of square kilometres of Public Land Allocated Number of Public Lands Allotments Export Price Index

Source: Gaceta Oficial (1854, 1856, 1858–1861), Registro Oficial (1862–1864), Diario

Oficial (1865–1931), Ocampo (1990) and authors’ calculations

Figure 2a. Departmental share of land allotments and coffee production in 1925.

32

CALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCAL

NARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAG

SANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSAN

NORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNOR

RISRISRISRISRISRISRISRISRISRISRIS

HUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUI

VALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVAL

CUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUN

QUIQUIQUIQUIQUIQUIQUIQUI

TOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOL

ANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANT

05

1015

2025

Dep

arm

enta

l sha

re o

f cof

fee

prod

uctio

n (%

)

0 5 10 15 20Departmental share of land allotments (%)

Figure 2b. Departmental share of land allotments and conflicts lands in 1925.

BOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOL

SUCSUC

CAUCAUCAUCAU

SUCSUC

CAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAU

SUCSUC

CAU

SUC

CAU

SUCSUC

CAUCAU

SUC

CAUCAU

SUC

CAU

SUCSUC

CAUCAUCAU

SUCSUCSUCSUCSUC

CAUCAUCAU

SUC

CORCORCORCORCORCORCORCORCORCORCORCORCORCORCOR

CHOCHOCHOCHOCHOCHOCHOCHOCHOCHOCHOCHOCHO

CESCESCESCESCESCESCESCESCESCESCESCES

CALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCAL

NARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNAR

MAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAG

SANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSAN

METMETMETMETNOR

BOYBOY

NOR

BOYBOYBOYBOYBOY

NORNOR

BOYBOYBOYBOYBOYBOYBOYBOYBOYBOY

NOR

BOYBOY

NORNORNOR

BOY

NOR

BOYBOYBOYBOYBOYBOYBOYBOYBOYBOY

NOR

BOYBOYBOYBOYBOYBOY

NORNORNORNORNORNORNORNOR

BOYBOYBOY

NOR

BOY

NOR

BOY

NOR

BOYBOYBOY

NORNOR

BOY

NORNOR

BOYBOYBOYBOY

NOR

BOYBOYBOYBOYBOYBOY

NOR

BOYBOY

NOR

BOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOY

NOR

BOY

NOR

BOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOY

NOR

BOYBOYBOYBOYBOYBOYBOY

NOR

BOYBOYBOY

NOR

BOYBOYBOY

NOR

BOYBOYBOY

NOR

RISRISRISRISRISRISRISRISRISRISRIS

HUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUI

VALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVAL

CUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUN

QUIQUIQUIQUIQUIQUIQUIQUI

TOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOL

ANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANT

05

1015

Dep

arm

enta

l sha

re o

f con

flict

land

s (%

)

0 5 10 15 20Departmental share of land allotments (%)

Source: Boletín Trimestral de Estadística Nacional (1894), LeGrand (1988), Gaceta Oficial

(1854, 1856, 1858–1861), Registro Oficial (1862–1864), Diario Oficial (1865–1893),

authors’ calculations.

Map 1. Presence of coffee production in 1851, 1892 and 1925.

33

Source: Geografía Física y Política de la Confederación Granadina, volumes I, II, III, IV,

V (2002), Boletín Trimestral de Estadística (1894), Monsalve (1927).

34

land conflicts, property rights and the rise of the

Documents