jingfu wang

16
Jingfu wang The role of WT1 gene in neuroblastoma Department of Pediatric Oncology Key Laboratory of Cancer Prevention and Therapy of Tianjin, Tianjin Medical University Cancer Institute and Hospital

Upload: adrian-porter

Post on 03-Jan-2016

38 views

Category:

Documents


0 download

DESCRIPTION

The role of WT1 gene in neuroblastoma. Jingfu wang. Department of Pediatric Oncology Key Laboratory of Cancer Prevention and Therapy of Tianjin, Tianjin Medical University Cancer Institute and Hospital. Background /purpose. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Jingfu wang

Jingfu wang

The role of WT1 gene in neuroblastoma

Department of Pediatric OncologyKey Laboratory of Cancer Prevention and Therapy of Tianjin, Tianjin Medical University Cancer Institute and Hospital

Page 2: Jingfu wang

The recurrence of neuroblastoma due to minimal residual disease (MRD) is often seen.

Immunotherapy is an attractive therapeutic option for controlling MRD.

Wilms tumor gene (WT1) was firstly identified as a suppressor involved in the

development of Wilms tumor. However, oncogenic properties of WT1 were recently

observed in various hematological and solid malignancies.

Over the past years, the immunotherapy using peptide vaccines against WT1 in adults

with leukemia and various solid cancers was promising.

To determine whether WT1 vaccines are applicable for neuroblastoma, firstly, we must

understand the exact function of WT1 in neuroblastoma. So the aim of this study was to

probe it.

Background/purpose

Page 3: Jingfu wang

WT1 mRNA expression in the tumor tissue of 22 neuroblastomas (NBs), 5

ganglioneuromas (GNs) and 4 NB cell lines: conventional and real-time RT-

PCR.

WT1 protein expression in 20 NBs and 5 GNs: immunohistochemistry.

Effect of WT1 gene knockdown on NB cell (NB19 and NB69) proliferation:

siRNA against WT1; WST-1 assay.

Materials and methods

Page 4: Jingfu wang

Table 1 Sequence of primers and probes in conventional and real time PCR

Types of PCR Primer and probe Sequence (5'-3' orientation)

Conventional PCR

WT1-F GGCATCTGAGACCAGTGAGAA

WT1-R GAGAGTCAGACTTGAAAGCAGT

GAPDH-F TGAAAGTGCTGTCTCCATGC

GAPDH-R ACCTTTGGTGAGACCTGTGG

Real time PCR WT1-F GATAACCACACAACGCCCATC

WT1-R CACACGTCGCACATCCTGAAT

WT1-P FAM-ACACCGTGCGTGTGTATTCTGTATTGG-TAMRA

β-actin-F CCCAGCACAATGAAGATCAAGATCAT

β-actin-R ATCTGCTGGAAGGTGGACAGCGA

β-actin-P FAM-TGAGCGCAAGTACTCCGTGTGGATCGGCG-TAMRA

F: forward; R: reverse; P: probe.

Materials and methods (continue)

Page 5: Jingfu wang

Patient Pathology WT1 mRNA level

1 GN 7.61×10-3

2 GN 2.60×10-3

3 GN 2.30×10-3

4 GN 2.70×10-4

5 GN 1.70×10-3

6 NB 3.49×10-3

7 NB 2.45×10-3

8 NB 3.98×10-3

9 NB 8.40×10-6

10 NB 4.90×10-3

11 NB 3.40×10-4

12 NB 1.10×10-5

13 NB 2.10×10-4

14 NB 2.30×10-3

15 NB 1.30×10-3

16 NB 5.10×10-5

17 NB 7.10×10-5

18 NB 3.40×10-5

19 NB 4.30×10-3

20 NB 1.10×10-4

21 NB 4.10×10-4

22 NB 2.30×10-3

23 NB 1.45×10-3

24 NB 2.30×10-2

25 NB 4.30×10-5

26 NB 2.70×10-3

27 NB 1.00×10-4

Comparison between neuroblastoma and ganglioneuroma

Mann-Whitney Test

p=0.261

There was no difference between neuroblastoma and ganglioneuroma

Correlation of WT1 mRNA levels and histological grade

0.00E+00

5.00E-03

1.00E-02

1.50E-02

2.00E-02

2.50E-02

GN NB

WT1 mRNA expression in NBs and GNs

Page 6: Jingfu wang

Comparison among Stage , , and in neuroblastomaⅠ Ⅱ Ⅲ Ⅳ

Correlation of WT1 mRNA levels and clinical stagePatient Pathology Stage WT1 mRNA level

1 NB Ⅰ 3.49×10-3

2 NB Ⅰ 2.45×10-3

3 NB Ⅰ 3.98×10-3

4 NB Ⅰ 8.40×10-6

5 NB Ⅰ 4.90×10-3

6 NB Ⅰ 3.40×10-4

7 NB Ⅱ 1.10×10-5

8 NB Ⅱ 2.10×10-4

9 NB Ⅱ 2.30×10-3

10 NB Ⅱ 1.30×10-3

11 NB Ⅱ 5.10×10-5

12 NB Ⅲ 7.10×10-5

13 NB Ⅲ 3.40×10-5

14 NB Ⅲ 4.30×10-3

15 NB Ⅲ 1.10×10-4

16 NB Ⅲ 4.10×10-4

17 NB Ⅲ 2.30×10-3

18 NB Ⅳ 1.45×10-3

19 NB Ⅳ 2.30×10-2

20 NB Ⅳ 4.30×10-5

21 NB Ⅳ 2.70×10-3

Kruskal-Wallis Test

P=0.412

There was no difference among stage groups

0.00E+00

5.00E-03

1.00E-02

1.50E-02

2.00E-02

2.50E-02

Ⅰ Ⅱ Ⅲ Ⅳ

WT1 mRNA expression in NBs and GNs (continue)

Page 7: Jingfu wang

Correlation of WT1 mRNA levels and prognosis

Log-Rank test: p=0.193

Patients Pathology WT1/actin Status survival time (months)

1 NB 8.40×10-6 alive 240.5

2 NB 1.10×10-5 alive 225.5

3 NB 3.40×10-5 alive 241

4 NB 4.30×10-5 alive 160

5 NB 5.10×10-5 alive 96

6 NB 7.10×10-5 dead 216

7 NB 1.00×10-4 alive 163

8 NB 1.10×10-4 alive 232

9 NB 2.10×10-4 alive 222

10 NB 3.40×10-4 alive 165

11 NB 4.10×10-4 alive 217.5

12 NB 1.30×10-3 alive 111

13 NB 1.45×10-3 dead 9.5

14 NB 2.30×10-3 alive 155

15 NB 2.30×10-3 dead 10

16 NB 2.45×10-3 alive 31

17 NB 2.70×10-3 dead 4

18 NB 3.49×10-3 alive 38

19 NB 3.98×10-3 alive 28

20 NB 4.30×10-3 alive 235

21 NB 4.90×10-3 alive 226

22 NB 2.30×10-2 alive 236

The WT1 mRNA expression levels did not affect the prognosis

Median: 8.55×10-4

WT1 mRNA expression in NBs and GNs (continue)

Page 8: Jingfu wang

WT1 mRNA expression in neuroblastic cell lines

The highest expression appeared in NB69 without MYCN amplification (relatively low malignancy)

Page 9: Jingfu wang

The levels of WT1 mRNA expression were not correlated with

histological grade, clinical stage and prognosis.

Among the four neuroblastic cells, NB69 with relatively low

malignancy exhibited the highest WT1 mRNA expression.

Summary1

WT1 does not play a significant role in the oncogenicity of

neuroblastoma.

Page 10: Jingfu wang

WT1 proteins were more strongly expressed in mature ganglion cells than neuroblastic cells

Neuroblastic cells Ganglion cells

WT1 protein expression in NBs and GNs

Page 11: Jingfu wang

Expression of WT1 protein in NBs and GNs (immunohistochemistry)

Tumor types

Polyclonal (C-19) Monoclonal (6F-H2)

No. of positive cases Ratio (%) No. of positive cases Ratio (%)

Neuroblastoma 2/20 10* 6/20 30**

Ganglioneuroma 5/5 100* 5/5 100**

Fisher's Exact Probability Test: *p=0.000; ** p=0.009. NB: neuroblastoma; GN: ganglioneuroma.

The positive rate was significantly higher in GNs than in NBs

WT1 protein expression in NBs and GNs (continue)

Page 12: Jingfu wang

Higher WT1 protein expression in ganglion cells and higher positive rate

in GNs provides a clue that WT1 protein may be a candidate factor

inducing primitive neuroblastic cells to differentiate into mature ganglion

cell.

Summary2

Page 13: Jingfu wang

A and B, Conventional RT-PCR (A) and real-time RT-PCR (B) revealed that WT1 gene was obviously knocked down in NB19 and NB69 cells.

C and D, There was no significant change on cell proliferation of NB19 between negative control and WT1 siRNA group (* p=0.937). However, silencing of WT1 gene prompted cell

growth in NB69 cell which possessed the highest WT1 mRNA expression (** p=0.001).

Effect of WT1 gene knockdown on NB cell (NB19 and NB69) proliferation

Page 14: Jingfu wang

The silence of WT1 gene promoting cell growth in NB69 cells notes that

WT1 may be a factor inhibiting neuroblastic cells growth.

Summary3

Page 15: Jingfu wang

WT1 may be related to cell differentiation and suppression of cell

proliferation in NB.

WT1 gene does not act as an oncogene, but participates in the

maturation of NB.

In conclusion

Page 16: Jingfu wang

How to understand our findings contrast to that in adults

The adult cancers with high WT1 expression are generally derived from epithelial cells. These tumors will undergo an epithelial-mesenchymal transition (EMT), and this is often related to a worse prognosis.

In contrast, neuroblastoma is derived from primitive mesenchymal cells and WT1 normally plays a role of mesenchymal-epithelial transition (MET). The effect of forcing the cells towards an epithelial state is linked to a favorable prognosis.

Epithelial cells Mesenchymal cells

A common role of WT1:

regulating the mesenchymal-epithelial balance