isolation, biochemical characterization and dna ... · isolation, biochemical characterization and...

Isolation, Biochemical Characterization and

DNA Identification of Yoghurt Starters

Streptococcus Thermophilus & Lactobacillus

Delbrueckii ssp. Bulgaricus

ن الستربتوكوكاس والجينية لبادئات اللبالبيوكيميائية عزل وتحديد الخصائص ثيرموفيالس والالكتوباسيالس ديليبروكي تحت نوع بولجاريكاس

By

Ismail Mosbah Alquqa

Supervised by

Dr. Kamal Elkahlout

Assis. prof. of Biotechnology

Dr. Tarik Elbashiti

Assoc. prof. of Biotechnology

A thesis submitted in partial fulfillment

of the requirements for the degree of

Master of Science in Biotechnology

Apr. /2018

ـزةبغـ اإلســـــالميــةـة ـــــــــامعـالج

عمادة البحث العلمي والدراسات العليا

ـــــــــــــــومة العلـــــــــــــــــــــــليــــــك

ــةالتكنولوجيا الحيويــــــــــــماجستير

The Islamic University of Gaza

Deanship of Research & Graduate Studies

Faculty of Science

Master of Biotechnology

I

إقــــــــــــــرار

أنا الموقع أدناه مقدم الرسالة التي تحمل العنوان:

Isolation, Biochemical Characterization and DNA

Identification of Yoghurt Starters Streptococcus

Thermophilus & Lactobacillus Delbrueckii ssp.

Bulgaricus

بتوكوكاس ن الستر اللب اللبن والجينية لبادئات البيوكيميائيةعزل وتحديد الخصائص ا ثيرموفيالس والالكتوباسيالس ديليبروكي تحت نوع بولجاريكاس

د، وأن أقر بأن ما اشتملت عليه هذه الرسالة إنما هو نتاج جهدي الخاص، باستثناء ما تمت اإلشارة إليه حيثما ور

لنيل درجة أو لقب علمي أو بحثي لدى أي مؤسسة االخرين الرسالة ككل أو أي جزء منها لم يقدم من قبلهذه

تعليمية أو بحثية أخرى.

Declaration

I understand the nature of plagiarism, and I am aware of the University’s policy on

this.

The work provided in this thesis, unless otherwise referenced, is the researcher's own

work, and has not been submitted by others elsewhere for any other degree or

qualification.

إسماعيل مصباح القوقا اسم الطالب: Student's name: Ismail Mosbah Alquqa

إمساعيل القوقا التوقيع: Signature: Ismail Alquqa

Date: 20/6/2018 20/6/2018 التاريخ:

III

Abstract

Fermented dairy products are manufacured by specific bacterial strains which are

known as starters. Yoghurt is prepared from milk by the synergetic action of well-known

starters Streptococcus thermophilus and Lactobacillus delbrueckii ssp. bulgaricus. These

starters by lactic acid fermentation cause milk coagulation and other features, such as sourness,

aroma, and consistency. Old-style approaches, using parts of a former batch to inject a new

batch for centuries. These styles produce inconstant performance, but industrial production

needs consistency. With this perspective, this study aims to isolate starters from households of

geographical regions of the Gaza strip and to define their phonotypic and genotypic

characteristics.

M17 and MRS culture media were used to pick out streptococci and lactobacilli,

respectively from rural yoghurt samples. Under anaerobic environments, all plates incubated

at 37ºC for 3 days by anaerobic gars. Strains, which identified as L.bulgaricus and

S.thermophilus by simple physiological examinations, i.e. morphology, CO2 production from

glucose, NaCl resistance , growing at different temperatures, were identified by carbohydrate

fermentation profiles using API 50 CHL identification system and species- specific primers

by PCR using 16S rRNA sequences to confirm preliminary tests.Then, the isolated starters

injected in milk to evaluate it on yoghurt making, microbiological and biochemical changes

that take place during fermentation of milk were also studied. Generally, mixed yoghurt

culture presented superior growth, more sourness comparing with the single starter cultures.

In conclusions, genetic tools in combination with API 50 CHL were shown to be

reliable and quick approaches to identify S. thermophilus and L. delbrueckii isolates at the

subspecies level and to differentiate these species from other lactic acid bacteria without prior

preliminary isolation. The natural starters' identification is a required for the preservation and

protection of natural LAB diversity in the Gaza Strip, not only for the dairy Industry which

still imports starters abroad.

Keywords: Streptococcus thermophilus, Lactobacillus delbrueckii ssp. Bulgaricus,

Yoghurt, Starters, 16S rRNA, PCR.

IV

الملخص

لتصنيع منتجات من الحليب المخمر. الخاصة والمعروفة بإسم البادئاتالبكتيرية سالالتالتستخدم الستربتوكوكاس ثيرموفيالس لبادئاتافري ظمن الحليب بواسطة سلوك ت اللبن عادة يصنع

وخصائص البادئات إلى تخثر الحليب هذهتقود .بولجاريكاسوالالكتوباسيالس ديليبروكي تحت نوع الطرق التقليدية جزء تستخدم .الالكتيكعن طريق تخمر حمض أخرى، مثل الحامضية، النكهة والِقوام

اج المزارع إلى كفاءة متغيرة، ولكن االنتاج المصنعي يحت هذهتقود دفعة جديدة. حقنمن دفعة سابقة ل، مناطق جغرافية لقطاع غزةعزل البادئات من هذه الدراسة إلى تهدفإلى الِقوام. من هذا المنظور،

تحديد الخصائص المظهرية والجينية لها.ومن ثم الترتيب من على والالكتوباسياليالستربتوكوكاي لعزل MRS و M17األوساط الغذائية تم استخدام

أيام تحت ظروف درجة مئوية لثالث 37ة على درجة حرار جميع االطباق ضينتم تحعينات لبن ريفية. ستربتوكوكاس ثيرموفيالس أنهاالهوائية. السالالت التي ُحددت على حاويات الهوائية باستخدام

كل، النمو عند درجات االختبارات الفسيولوجية البسيطة مثل الش بواسطة والكتوباسيالس بلجاريكاس ا أيضاتم التعرف عليه ج ثاني أكسيد الكربون من الجلوكوز، مقاومتها لملح كلوريد الصوديومامختلفة، إنت

برايمرات للنوع متخصصة وبواسطة API 50 CHLبواسطة فحص تخمر الكربوهيدرات باستخدام التغيرات ةتم دراس . بعد ذلكلتأكيد الفحوصات األولية PCR تقنيةواسطة ب 16S rRNA استخدامب

ام، عالميكروبيولوجية والبيوكيميائية الحادثة أثناء تخمر الحليب المحقون بالبادئات المعزولة. بشكل مقارنة مع مزارع البادئات المفردة. أكثرمزارع البادئات المختلطة نموًا أعلى وحموضة أظهرت ت طرق موثوقة وسريعة لتحديد عزال لتصبح API 50 CHLبجانب الجينية وسائلالثبتت أأخيرًا،

كتيك ولتمييز هذه األنواع من بكتيريا حمض الال بلجاريكاس الستربتوكوكاس ثيرموفيالس والالكتوباسيالساألخرى بدون عزل تمهيدي مسبق. التحديد للبادئات الطبيعية هو احتياج ليس لمصانع األلبان فحسب،

عية في والتي ال تزال تستورد البادئات من الخارج، لكن أيضًا لحفظ التنوع لبكتيريا حمض الالكتيك الطبي قطاع غزة.

،بادئات، نلب ،ستبرتوكوكاس ثيرموفيالس، الكتوباسيالس ديليبروكي بلجاريكاس :المفتاحيةالكلمات

16S rRNA، PCR.

VI

Dedicated

To

My Mother

A strong and gentle soul who taught me to trust in

Allah, believe in hard work and that so much

could be done with little

My Father

For earning an honest living for us and for

supporting and encouraging me to believe in

myself

My Wife

Who leads me through the valley of darkness

with light of hope and support

The little darling, my Daughter,

" Dania "

My Beloved

Brothers and Sisters

VII

Acknowledgment

Foremost, I would like to express my sincere gratitude to my supervisor Dr. Kamal

Elkahlout for the continuous support of my MSc. study and research, for his patience,

motivation, enthusiasm, and immense knowledge. His guidance helped me in all the

time of research and writing of this thesis. I could not have imagined having a better

advisor and mentor for my Msc. study.

My sincere thanks also goes to Dr. Tarik Elbashiti, the second supervisor, for

enlightening me the first glance of research, for his Directives in hard times during my

research study, and for his all kind of help.

Also special thanks to Mr. Hussein Ajrami & Mr. Husam AboTayyem for their useful

contributions, and sharing their valuable science experiences.

Last but not the least, I would like to thank my parents for giving birth to me at the

first place and supporting me spiritually throughout my life.

VIII

contents

DECLARATION .......................................................................................................... I

ABSTRACT IN ENGLISH ......................................................................................... II

ABSTRACT IN ARABIC ......................................................................................... III

DEDICATION ............................................................................................................. V

ACKNOWLEDGMENT ........................................................................................... VI

LIST OF TABLES ....................................................................................................... X

LIST OF FIGURES .................................................................................................. XI

LIST OF ABBREVIATIONS ................................................................................. XIV

CHAPTER 1 INTRODUCTION ................................................................................. 1

1.1 Background and Context ................................................................... 2

1.2 Objectives .................................................................................... 3

1.2.1General objective: ............................................................................................ 3

1.2.2Specific objective: ............................................................................................ 3

1.3 Signification ................................................................................. 3

1.4 Limitations ................................................................................... 3

1.5 Overview of Thesis ......................................................................... 4

CHAPTER 2 LITERATURE REVIEW ..................................................................... 5

2.1 What is Yoghurt? ........................................................................... 6

2.2 The History of Yoghurt .................................................................... 6

2.3 Microorganisms used in starters for cultured dairy products ......................... 7

2.4 Yoghurt Starter Cultures ................................................................. 12

2.4.1 Streptococcus thermophilus ......................................................................... 14

2.4.2 Lactobacillus delbrueckii subsp. buglaricus ………………….…………..17

2.5 Protocooperation between S.thermophilus & L.bulgaricus ......................... 19

2.5.1 Factors of protocooperation .......................................................................... 20

2.7 classification of LAB based on by-products of suger................................ 23

2.7.1 Homofermentative LAB ............................................................................... 23

2.7.2 Heterofermentative LAB .............................................................................. 23

2.7.3 Other Gas Producing Pathways: ................................................................... 23

2.8 Types of Yoghurt ......................................................................... 24

2.9 Yoghurt Processing ....................................................................... 26

IX

2.9.1 Initial Treatment of Milk .............................................................................. 27

2.9.2 Standardization of Milk Components ........................................................... 27

2.9.2.1 Standardization of fat content: ............................................................... 27

2.9.2.2 Standardization of solid (nonfat) content: ............................................. 28

2.9.3 Addition of additives .................................................................................... 28

2.9.4 Homogenization ............................................................................................ 28

2.9.5 Heat Treatment ............................................................................................. 29

2.9.6 Fermentation Process .................................................................................... 29

2.9.7 Cooling and Storage ...................................................................................... 30

2.10 Factors affecting slow growth of starter cultures and yoghurt quality: .......... 30

2.10.1 Compounds that are naturally present in milk ............................................ 30

2.10.2 Effect of incubation temperature and inoculation rate ................................ 31

2.10.3 Mastitis milk and somatic cell count .......................................................... 31

2.10.4 Antibiotic residues ...................................................................................... 31

2.10.5 Detergent and disinfectant residues ............................................................ 32

2.10.6 Environmental pollution ............................................................................. 32

2.10.7 Bacteriophages ............................................................................................ 32

2.10.8 Bacteriocins ................................................................................................ 33

2.11 Molecular identification: ............................................................... 33

CHAPTER 3 MATERIALS AND METHODS ........................................................ 35

3.1 Materials ................................................................................... 36

3.1.1 Chemicals and Reagents ............................................................................... 36

3.1.2 Equipments ................................................................................................... 37

3.2 Methodology: .............................................................................. 37

3.2.1 Drinking yoghurt samples ............................................................................. 37

3.2.2 Isolation of lactic acid bacteria ..................................................................... 37

3.2.2.1 Selective Media and Growth Conditions .............................................. 37

3.2.3 Phenotypic identification of isolates ............................................................. 38

3.2.3.1 Gram Staining ........................................................................................ 38

3.2.3.3 Gas Production from Glucose ................................................................ 38

3.2.3.4 Growth at Different Temperatures ......................................................... 39

3.2.3.5 Growth at Different NaCl Concentrations ............................................. 39

X

3.2.3.6 Carbohydrate Fermentation profiles ...................................................... 39

3.2.3.6.1 Preparation of active cell culture free from sugar: ......................... 40

3.2.3.6.2 Combination of Active Cell Culture free from sugar and tested

sugar: .............................................................................................................. 40

3.2.4 Molecular identification for Isolated Bacteria ............................................. 40

3.2.4.1 DNA isolation ........................................................................................ 40

3.2.4.2 Primers ................................................................................................... 40

3.2.4.3 PCR conditions ...................................................................................... 41

3.2.4.4 Restriction analysis of 16S rRNA gene product ................................... 41

3.2.4.5 Separation of Amplification Products .................................................... 41

3.2.4.5.1 Preparation of Agarose Gel ............................................................. 41

3.2.4.5.2 Loading of Agarose Gel .................................................................. 42

3.2.4.5.3 Electrophoresis of the Products ...................................................... 42

3.2.5 Assessment of technological performance of strains: ................................... 42

3.2.5.1 Preparation of fermented milk ............................................................... 42

3.2.5.2 Measurement of pH and titratable acidity .............................................. 42

CHAPTER 4 RESULTS AND DISCUSSION .......................................................... 44

4.1 Isolation and Biochemical identification of S. thermophilus and L. delbrueckii

ssp. bulgaricas .......................................................................................................... 45

4.2: DNA Identification ...................................................................... 48

4.3: Assessment of technological performance of strains ............................... 50

4.3.1: Microbiological analysis .............................................................................. 50

4.3.1.1 The viable counts of starter cultures during fermentation ..................... 50

4.3.2: Biochemical analysis ................................................................................... 54

4.3.2.1: Changes in the Total acidity and pH ..................................................... 54

CHAPTER 5 CONCLUSIONS AND RECOMMENDATIONS .............................. 62

REFERENCES ........................................................................................................ 64

APPENDIXES ........................................................................................................... 72

APPENDIX A.................................................................................. 73

APPENDIX B .................................................................................. 75

APPENDIX C .................................................................................. 76

XI

LIST OF TABLES

Table (2.1): Microorganisms Used In Starter Culture For Fermented Milk Products

And Their Functions. .................................................................................................. 9

Table (2.2): Features Of Mesophilic Starters Used For Fermented Milk Products. 10

Table (2.3): Features Of Thermotolerant Starters Used For Fermented Milk

Products. ................................................................................................................... 11

Table (2.4): Required & Optional Composition Of Yoghurt Bacteria ..................... 14

Table (2.5): The Composition Of Regular, Low-Fat & Non-Fat Yoghurt. .............. 23

Table (3.1): Chemicals, Reagents And Cultures Mediums ....................................... 36

Table (3.2): Major Equipments Used In The Present Study. .................................... 37

Table (4.1): Ability Of The Tested Strains To Utilize The 49 Carbon Sources Included

In The Identification System API50 CHL. ............................................................... 47

Table (4.2): The Changes On The Viable Counts Of The Starter Culture Strains

During Fermentation Of Milk For 8h At 42ºc ........................................................... 50

Table (4.3): Effect Of Culture Composition On Acidification Characteristics Of Pure

& Mixed Cultures Grown On Milk At Different Times On 42ºc. ............................ 54

Table (4.4): Effect Of Culture Composition On Total Acidity Of Pure & Mixed

Cultures Grown On Milk At 42ºc. ............................................................................. 58

Table (A.1): MRS Medium ....................................................................................... 73

Table (A.2): M17 Medium ........................................................................................ 74

XII

LIST OF FIGURES

Figure (2.1): (A) Streptococcus thermophilus Cells Under Microscope.1000x

Magnification. (B) St Cells Observed By Scanning Electron Microscope. ............... 15

Figure (2.2): Stained Cells Of Streptococcus thermophilus Under A Light

Microscope. ................................................................................................................ 16

Figure (2.3): (A) Lactobacillus delbrueckii (Lb) Cells Under Microscope. 1000x

Magnification. (B) Lb Cells As Observed By Scanning Electron Microscopy. ........ 17

Figure (2.4): Stained Cells Of Lactobacillus delbrueckii subsp. bulgaricus Under A

Light Microscope ....................................................................................................... 18

Figure (2.5): An Approximation Of The Relative Concentration Between

L.bulgaricus And S.thermophilus From The Point Of Inoculum. ............................. 19

Figure (2.6): Scheme For Proto-Cooperation Between S.thermophilus and

L.bulgaricus ............................................................................................................... 21

Figure (2.7): Behaviour Of Single And Mixed Strain Yoghurt Cultures Propagated At

Different Temperature . ............................................................................................ 22

Figure (2.8): Behaviour Of Single And Mixed Strain Yoghurt Cultures Propagated At

40ºc. ........................................................................................................................... 22

Figure (2.9): Manufacturing Process Of Set & Stirred Yoghurt .............................. 25

Figure (2.10): Flow Chart Of Yoghurt .................................................................. 27

Figure (2.11): Scanning Electron Micrograph Illustrating (A) A Healthy

S.thermophilus Culture And (B) The Lysis Of Cells After Invasion With A Virulent

Bacteriophage. ........................................................................................................... 33

Figure (4.1): Microscopic Appearance Of Cocci And Bacilli Isolates ..................... 45

Figure (4.2): Partial Amplification Of The Methionine Biosynthesis Gene In Rural

Yoghurt Isolates. Lanes 1, 2 : Coccus B1 , Lanes 3,4 : Coccus B2, Lanes 5, 6: Coccus

B3, Lanes 7, 8 : Bacillus A1, Lanes 9, 10 : Bacillus A2, Nc: Negative Control, M: 100

Bp DNA Ladder. ........................................................................................................ 48

Figure (4.3): Amplification Of 16S rRNA Gene From Isolates That Amplified

Methionine Biosynthesis Gene Product. Lanes 1–4 : Lactobacilli A1,A2 Respectively,

Lanes 5-10: Streptococci B1,B2,B3 Respectively, M: 100 Bp DNA Ladder. .......... 49

Figure (4.4): Restriction Analysis Of 16S rRNA Gene With Eco RI. (1-4) Restriction

Analysis Of 16S rRNA Gene With Eco Ri For Lactobacilli A1,A2 Respectively (5-

XIII

10) Restriction Analysis Of 16S rRNA Gene With Eco RI For Streptococci B1,B2,B3

Respectively, M: 100 Bp DNA Ladder. .................................................................... 49

Figure (4.5): Changes In The Viable Counts Of The Starter L.Bulgaricus A1,

S.Thermophilus B1 & Combination Of L. Bulgaricus Plus S.Thermophilus (1: 1)

During Fermentation Of Raw Milk For 8h At 42ºc. .................................................. 51


S.Thermophilus B2 & Combination Of L.Bulgaricus Plus S.Thermophilus (1:1) During

Fermentation Of Raw Milk For 8h At 42ºc. .............................................................. 51













Figure (4.11): Changes In The PH Of The Starter L.Bulgaricus A1, S.Thermophilus

B1 & Combination Of L.Bulgaricus Plus S.Thermophilus (1:1) During Fermentation

Of Raw Milk At Different Times On 42ºc. ................................................................ 55










XIV







Figure (4.17): Changes In Total Titratable Acidity Of The Starter L.Bulgaricus A1,






Figure (4.19): Changes In Total Titratable Acidity Of The Starterculture L.Bulgaricus

A1, S.Thermophilus B3 & Combination Of L.Bulgaricus Plus S.Thermophilus (1:1)

During Fermentation Of Raw Milk For 6h At 42ºc. .................................................. 59

Figure (4.20): Changes In Total Titratable Acidity Of The Starter Culture

L.Bulgaricus A2, S.Thermophilus B1 & Combination Of L.Bulgaricus Plus

S.Thermophilus (1:1) During Fermentation Of Raw Milk For 6h At 42ºc. ............... 60







XIV

List of Abbreviations

:Percentage % :microliter µl :micrometer µm :Amplified Ribosomal DNA Restriction Analysis ARDRA :Base pair Bp :colony forming unit CFU

:Celsius Co

:Deoxyribonucleic acid DNA

:Deoxynucleotide triphosphate dNTP

:Ethylene Diamide Tetra Acetic Acid EDTA

:Exopolysaccaride EPS

:Figure Fig.

:Gram G

:hour H

:Hexsose Monophosphate HMP

:International unit IU

:kilo base pair kbp

:Kilogram Kg

:liter L

:Lactobacillus L.

:Lactic acid bacteria LAB

:milligram Mg

:minute Min.

:Milliliter Ml

:de-man, Rogosa and sharpe medium MRS

:non-fat milk solids NFMS

:ribonucleic acid RNA

:round per minute rpm

:polymerase chain reaction PCR

:Streptococcus S.

:Solid- non fat SNF

:subspecies ssp.

:Tris Acetate EDTA TAE

:Tris Borate EDTA TBE :Tris-EDTA TE

1

Chapter 1

Introduction

2

Chapter 1

Introduction

1.1 Background and Context

Acidifying milk by microbial cells has been used since long time as natural protective

methods. These methods were tamed to make man-made fermented dairy products such as

yoghurt. However, with the onset of the 20th century, fermentation of milk was uncontrolled

process and the researchs were empiric and relied on trials and errors to improve it. (Caplice

& Fitzgerald, 1999).

Products of fermented milk have been enormously developed with the discovery of

lactic acid bacteria (LAB). Over the last fifty years, great efforts have been devoted to augment

our information regarding the physiology, biochemistry and molecular biology of LAB. Other

than to promote our understanding of the life of microbe, these efforts have allowed dairy

microbiologists and cheesemakers to pick out better strains and change for the better quality,

productivity, and safety of the final products (Amanze & Amanze, 2011).

Lactic acid bacteria characterizations have boosted the rational development of

mixtures of defined strains of bacteria, now widely known as starter cultures, which are

increasingly changing the undefined mixtures that were conventionally employed by the dairy

makers. This method causes it simpler to control the acid production and, somewhat, phage

invasions. Regrettably, it is also noticed that this method reduces the much desirable flavour

of fermented products that were created by undefined strains. Therefore, the study about LAB

cultures that yield desirable aroma and tastes still a major challenge for the dairy industry

(Vadeboncoeur & Moineau, 2004).

Yoghurt is uncomplicated ecological unit whose successful manufacturing depends

on correlation among two thermophilic LAB, Streptococcus thermophilus and Lactobacillus

delbreckii subsp. bulgaricus. This correlation among S. thermophilus and L. bulgaricus in milk

fermentation is known as proto-cooperation. Proto-cooperation is ground for making a

synergetic relationship among the two species (S.thermophilus and L.bulgaricus) and

collaborated metabolism with affirmative outcomes on the ultimate fermented product

(Angelov et al., 2009).

3

S.thermophilus and L.bulgaricus are thermophilic LAB species extensively used for

making yoghurt that wants high temperatures. The availability of genome for these species

will give the opportunety to apply the methods of molecular biology (Vadeboncoeur &

Moineau, 2004). The microbial compositions of traditional fermented milk products have been

subjected to microbiological assays and molecular researches at genus and species level


1.2 Objectives

1.2.1 General objective:

o Isolation, Biochemical characterization and DNA identification of yoghurt starters

Streptococcus thermophilus & Lactobacillus delbrueckii ssp. bulgaricus.

1.2.2 Specific objective:

o Identification the strains of two Yoghurt Starters Streptococcus thermophilus &

Lactobacillus delbrueckii ssp. bulgaricus from cow’s yoghurt samples that produced

by traditional ways.

o Biochemical characterization and DNA identification of isolated yoghurt starter.

o Evaluation of the isolated starters on production of yoghurt.

1.3 Signification

According to our knowledge, this is the first thesis in Gaza sheds the light on the isolation,

biochemical and molecular characterization of S.thermophilus and L. bulgaricus cultures from

fermented milk transformed into home-production yoghurt supplied from geographical

regions of the Gaza strip. We, in this study seek to select future starters of S.thermophilus &

L. bulgaricus from traditional dairy products. It is a significant way to maintain the genetic

pool of the wild cultures.

1.4 Limitations

Even though the research has achieved its aims, there were some unavoidable drawbacks.

o Time limitation for compelling the project.

o Limitation of cost that DNA identification is required.

o Delayed arrival of some materials that the project is needed.

4

1.5 Overview of Thesis

Milk is one of diets for human nourishment and yoghurt is a style of fermented milk as a

result of lactic acid strains of bacteria, L.bulgaricus and S.thermophilus.

This study aims to isolate and identify yoghurt starters with several biochemicals,

physiological and molecular features, then assess these starters on yoghurt production.

Samples of cow’s traditional yoghurt were gathered from the households of 3 geographical

areas of the Gaza strip.

Then, blends of L.bulgaricus and S.thermophilus isolates were carried out in order to

produce yoghurt. Experiments of yoghurt production were conducted by combinations oftwo

L.bulgaricus and S.thermophilus isolates and compare them with single isolates. The isolates

approximately have the primary count of 107-108 cells/ml. The sugars in yoghurt of cow milk

are fermented via the bacterial cells into lactic acid which make the properties of curd; the acid

depresses to pH of the yoghurt.

5

Chapter 2

Literature Review

6

Chapter 2

Literature Review

2.1 What is Yoghurt?

Basically yoghurt is the product of useful bacterial cells which causes milk

fermentation and turn it into coagulated, sour diet that will persist freshness longer than milk

itself and that yoghurt possesses millions of bacterial cells that are received by the human gut.

Yoghurt can be soft and runny, or dense and firm. It is a ground of numerous vital nutrients,

comprising protein, calcium, potassium, phosphorus, vitamins B2 and B12, and act as a vehicle

for immunization (Moreno et al., 2012).

2.2 The History of Yoghurt

The word “yoghurt” is origionally a Turkish word “yoğurmak” which indicates to

thicken, clot, or curdle (Donovan, 2006). Nowadays it is pronounced yogurt, yoghurt, or

yogourt, with yogurt being the most prevalent American spelling (Fisberg & Machado, 2015).

It’s possible that the emergence of yoghurt was achieved by accident in Mesopotamia

nearly 5,000 BC, when milk-producing animals were firstly tamed. The milk was likely

maintained and moved in bags constructed from the guts of these animals, the digestive juices

and bacterial cells in the guts lining cause the thickening and sourness of the milk and keep it

for long periods of time (Weerathilake et al., 2014).

Or possibly, a herdsman put milk in a pots that accomodate some types of friendly bacteria,

during a warm times of the year. When he turns back to these pots to restore his milk, he

founded that the milk had curdled into a thick consistency with agreeably tangy flavor. Then

he founded that if he left curdled milk in the vessel and added more milk he could repeat the

process with similar results (Amanze & Amanze, 2011).

There are also some records of yoghurt being used as a cleaning product and a beauty

lotion nearly 2000 BC. The sourness of the yoghurt enables to remove dirtness and corrosion,

and also allows eliminating dead cells of skin and nourishing intact cells of skin.

Yoghurt was widespread in the Greeks and Romans empires where the Greeks were the earliest

to state it in written references in 100 BC, pointing out that the use of yoghurt via barbaric

societies (Fisberg & Machado, 2015). In the Bible (Book of Job), Abraham owed his long life

and fertility to yoghurt utilization, and there is reference to the “Land of Milk and Honey,”

which many historians have interpreted to be a reference to yoghurt (Anukam & Reid, 2007;

Batmanglij, 2007; Weerathilake et al., 2014).

7

The Turks were also the first to estimate the medicinal uses of yoghurt for a many of diseases

and symptoms, such as diarrhea, cramps and to reduce the discomfort of sunburned skin

(Donovan & Shamir, 2014).

It was not until the 20th century that researchers gave an enterpretation for the health

benefits that were related to yoghurt utilization. In 1905, Stamen Grigorov, a Bulgarian student

from medicine, was the first one who discovered Bacillus bulgaricus that is still used in

yoghurt making to now. Based on Grigorov’s findings, in 1909, Yllia Metchnikoff from the

Pasteur Institution in France indicated that lactobacilli in yoghurt were related with long life

in the Bulgarian rural people (Anukam & Reid, 2007).

At the starting of the 20th century, yoghurt became familiar due to its health benefits

and it was offered in pharmacies as a medication. Yoghurt realized commercial boom when

Isaac Carasso from Spain begun making yoghurt with jams. Then, Dannon (Danone in France)

founded by Daniel Carasso, Isaac Carasso’s son, after escaping from the Nazi invasion. In

1932, in France, the first laboratory and factory for yoghurt were opened while the first

laboratory and factory in the United States were opened in 1941. (Estrada et al., 2011).

For thousands of years, Yoghurt was a popular diet in the Middle East and it has been

a necessary of the Eastern European food. It’s currently eaten all over the world as a main

meal, a snack or an ingredient in many recipes. It has achieved extensive popularity in United

States in the lastest forty or fifty years, in keeping with general tendencies toward organic,

cultured and nutrient-dense foods (Amanze & Amanze, 2011).

.

Currently, yoghurt is made by addition two bacterial cultures to pasteurized

milk: Streptococcus thermophilus and Lactobacillus bulgaricus. These bacterial cultures

give the properties of yoghurt taste and aroma, and also improve digestion and absorption of

protein, calcium, and phosphorus naturally existing in milk (Donovan, 2006). Other bacterial

cultures such as Lactobacillus acidophilus, Lactobacillus casei and Bifidobacterium bifidus

are often supplemented to yoghurt to support the immune system, lower cholesterol levels,

and keep a healthy digestive system (Weerathilake et al., 2014).

2.3 Microorganisms used in starters for cultured dairy products:

The microbial cells that used as starters for manufacture of fermented dairy products

are divided into two groups, based on the optimal temperature at which they work. The LAB

incubated at 20–30Cº are termed mesophilic starters while those incubated at temperatures

above 35ºC are termed thermophilic starters. (Vedamuthu, 2006; Hutkins, 2008; Chandan,

2014).

8

Mesophilic starters include Lactococcus lactis subspecies and Leuconostoc species.

Lactococcus lactis ssp. lactis that ferment citrate is often referred to as “Lactococcus lactis

ssp. lactis biovar diacetylactis” in the writings. The other subspecies are Lactococcus lactis

ssp. cremoris and ssp. lactis. The Leuconostoc bacterial strains usually used in dairy

fermentations in connection with lactococci are Leuconostoc lactis and Leuconostoc

mesenteroides ssp. cremoris (Chandan, 2014).

Thermophilc starter employed for fermentation of milk involves Streptococcus

thermophilus and Lactobacillus spp. Amongst the lactobacilli, two subspecies of

Lactobacillus delbruechii ssp. bulgaricus and lactis are extensively used for making fermented

dairy products. Lactobacillus acidophilus, Lactobacillus helveticus and Lactobacillus casei

ssp. casei are additional lactobacilli used in fermented milk products in combining with other

particular microorganisms. (Chandan, 2014).

Yoghurt is created by thermophilic starters, which work in cooperation with each other. In

contrast, tart cream or cultured cream is created by mesophilic starters lactococci and

leuconostocs. (Kilara & Chandan, 2013; Chandan, 2014).

Microorganisms and some of the physiological and biochemical features of starters

are brief in Tables 2.1, 2.2 and 2.3.

9

Table 2.1: Microorganisms used in starter culture for fermented milk products

and their functions. ՙՙ Source: Chandan & Shahani (1995), pp.390-391. ՚՚

Major Function of

Culture

Incubation

Temperature

and Time

Secondary/

Optional

Microorganism(s)

Primary Microorganism(s) Product

Acidity, texture,

aroma, flavor,

probiotic

43-45ºC/2.5

hours

Lactobacillus

acidophilus

Bifidobacterium

longum/bifidum/infant

is

Lactobacillus

casei/lactis/jugurt/

Helveticus

Lactobacillus delbrueckii subsp.

Bulgaricus

Stretococcus Salivarius subsp.

thermophilus

Yogurt

Acidity, Flavor,

aroma

22ºC/ 12-14

hours

Leuconostoc lactis

Leuconostoc

Mesenteroides subsp.

cremoris

Lactococcus lactis subsp. Lactis

Lactococcus lactis subsp.

Cremoris Lactococcus lactis subsp. Lactis

var. diacetylactis

Cultured

buttermilk

and sour

cream

Acidity, flavor,

probiotic

22-37ºC/8-14

hours

Lactococcus lactis

subsp.

Lactis/cremoris

Streptococcus salivarius subsp.

Thermophilus

Lactobacillus acidophils

Bifidobacterium longum/bifidus

Fermented

milk

Acidity, probiotic 37-40ºC/ 16-

18 hours

Lactobacillus acidophilus Acidophilus

milk

Acidity, probiotic 37-40ºC/ 8-12

hours


bulgaricus Bulgarian

buttermilk

Acidity, aroma,

flavor, gas (CO2),

alcohol, probiotic

15-22ºC/24-

36 hours

Lactococcus lactis subsp.

Lactis/cremoris


Bulgaricus


Lactis

Lactobacillus

casei/helveticus/brevis/Kefir

Leuconostoc mesenteroides/

dextranicum

Yeasts:

Kluyveromyces marxianus subsp.

Marxianus

Torulaspora delbrueckii

Saccharomyces cerevisiae

Candida Kefir

Acetic acid bacteria:

Acetobacter aceti

Kefir


Bulgaricus

Lactobacillus kefir/lactis

Koumiss

Acidity, alcohol,

flavor, gas (CO2)

20-25ºC/12-

24 hours

Yeasts:

Saccharomyces lactis

Saccharomyces cartilaginosus

Mycoderma spp.

Acetic acid bacteria:

Acetobacter aceti

Acidity, probiotic 30-37ºC/16-

18 hours

Lactobacillus casei Yakult

10

Table 2.2: Features of mesophilic starters used for fermented milk products.

ՙՙSource: Chandan and Shahani (1995), p.396. ՚՚

Leuconostoc

mesenteroides

subsp.

dextranicum

Leuconstoc

mesenteroides

subsp.

cremoris

Lactococcus

lactis subsp.

Lactis

biovar

diacetylactis

Lactococcus

lactis subsp.

cremoris

Lactococcus

Lactis

subsp.

Lactis

Characteristic

Cocci, pairs,

chains

Cocci, pairs,

short/long

chains

Cocci, pairs,

short chains

Cocci,

pairs,

short/long

chains

Cocci,

pairs, short

chains

Cell shape and

configuration

- - - - - Catalase reaction

20-25

4-10

37

20-25

4-10

37

28

8-10

40

22

8-10

37-39

28-31

8-10

40

Growth

temperature (ºC)

Optimum

Minimum

Maximum

22 22 22-28 22-30 21-30 Incubation

temperature (ºC)

- - + -

+ -

+ -

Heat tolerance

(60ºC/30 min)

D(-) D(-) L(+) L(+) L(+) Lactic acid isomers

0.1-0.3 0.1-0.3 0.8-1.0 0.8-1.0 0.8-1.0 Lactic acid

produced in milk

(%)

0.2-0.4 0.2-0.4 - - - Acetic acid

production (%) + -

+ -

+ - - Gas (Co2)

production + -

+ - + + + Proteolytic activity

+ -

+ -

+ -

+ -

+ - Lipolytic activity

+ + + - - Citrate

fermentation

+++ +++ +++ + + Flavor/aroma

compound

Dextran from

sucrose

No dextran

from sucrose

+ -

+ -

+ -

Mucopolysaccaride

production + -

+ - + + + Hydrogen peroxide

production + -

+ -

+ -

+ -

+ -

Alcohol production

6.5 6.5 4.0-6.5 4.0 4-6.5 Salt tolerance (%

max)

11

Table 2.3: Features of thermotolerant starters used for fermented milk products.

ՙՙSource: Chandan and Shahani (1995), p.397. ՚՚

Lactobacillus

casei subsp.

casei

Lactobacillus

acidophilus Lactobacillus

delbrueckii

subsp. lactis

Lactobacillus

delbrueckii

subsp.

bulgaricus

Streptococcus

thermophilus Characteristic

Rods with

square ends,

short/long

chains

Rods with

round ends,

single, pairs,

short chains,

no meta-

chromatic

granules

Rods with

round ends,

meta-

chromatic

granules

Rods with

round ends,

single, short

chains, meta-

chromatic

granules

Spheroidal to

ovoid, pairs

to long

chains

Cell shape and

configuration

- - - - - Catalase reaction

37

15-20

40-45

37

20-22

45-48

40-45

22

52

40-45

22

52

40-45

20

50

Growth

temperature (ºC)

Optimum

Minimum

Maximum

37 37 40-45 42 40-45 Incubation

temperature (ºC)

- - +

+

++ Heat tolerance

(60ºC/30 min)

L(+) DL D(-) D(-) L(+) Lactic acid isomers

1.2-1.5 0.3-2.0 1.5-3.0 1.5-4.0 0.7-0.8 Lactic acid

produced in milk

(%)

+

-

+

-

Trace Trace Trace Acetic acid

production (%) + -

+ -

+ - - Gas (Co2)

production + -

+ - + +

+ - Proteolytic activity

+ -

+ -

+ -

+ -

+ - Lipolytic activity

- - - - - Citrate

fermentation + -

+ + ++ ++ Flavor/aroma

compound + -

- -

++

+ -

Mucopolysaccaride

production +

+ + +

+ -

Hydrogen peroxide

production

Trace Trace Trace Trace - Alcohol production

2.0 6.5 2.0 2.0 2.0

Salt tolerance (%

max)

12

2.4 Yoghurt Starter Cultures:

Starter cultures or “starters” for short are food-grade that involves carefully chosen

microbial cells added to milk to make desired changes that result in the production of a specific

fermented dairy product with some desired features (Gandhi, 2006, Doyle & Meng, 2006).

One type of starters is called undefined "artisanal" cultures. It contains mixtures of

starter cells. The actual identities of the cells existing in a blended culture are often not known,

and the types of unique species may not have been characterised biochemically or

microbiologically. The ratio of different cells in a blended culture may be a variable from one

product to another. Hence, the chief disadvantage of undefined cultures is that they may

produce products of changeful quality. Additionally, fermentation ratios may differ from day

to day, influencing production programmes. In large facilities of production where accurate

programmes are necessary and regular quality of product is predicted so, undefined starters

can not be used. Defined starters as an alternative have become prevalent (Durso and Hutkins

2003; Erkuş, 2007). Defined starters have known physiological, biochemical and molecular

characterization strains, which are used as single or mix cultures. Most of the defined strains

have been isolated from wild or artisanal cultures (Hebert et al., 2000; Erkuş, 2007). They are

characterized and screened for the desired characters. Hence they give constant quality, and

softness to improve the productivity, quality and safety (Erkuş, 2007).

The whole fermented dairy product making is depends on the viability of the starter cells.

Starters not only initiate but also carry through each change needed to achieve the required

body, texture and flavour in the fermented dairy product. Moreover, starters play a preserving

role in repressing the organisms of rot, thus it raises the shelf-life. Additional vital roles related

to their protecting purpose in delaying or stopping pathogen organisms, and to the creation of

toxins in the finished fermented dairy product. Shortly, starters determine the shelf-life and

the security of fermented dairy products. In probiotic products, the supplemented cultures

provide health-promoting properties to the consumer (Chandan & O’Rell, 2006).

As mentioned, starters are composed of alive entities. Alive organisms necessitate

suitable environments to boom and achieve their tasks. Environmental conditions involve

optimal temperature ranges, suitable nutrition and pH range, lack of lethal elements or

byproducts and cautious handling procedures (Vedamuthu, 2006).

The two most starters frequently used in yoghurt making are now categorized to

Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus thermophilus ssp. thermophilus,

usually shortened as L.bulgaricus and S.thermophilus, respectively. Both are Gram-positive,

13

facultative anaerobic, non-motile and non spore-forming cells. Negative for endospore and

capsule staining, Negative with catalase and oxidase (El Bashiti, 2010).

The yoghurt culture contains S.thermophilus and L.bulgaricus. Moreover, a majority

of the yoghurt sold contains optional bacteria that have been shown to possess probiotic

features, including bifidobacteria, Lactobacillus acidophilus, Lactobacillus casei and other

Lactobacilli, which are famous as “probiotic bacteria”. Some yoghurt makers combine them

after fermentation of yoghurt, while others co-culture them with yoghurt starters (Chandan &

O’Rell, 2006).

S.thermophilus and L.bulgaricus are fairly well-matched with one another and are

synergetic for growth in milk medium. On the other hand, the optional organisms not

necessarily display compatibility with S.thermophilus and L.bulgaricus. Wise selection of

yoghurt starters and the optional organisms is basic to ensure the viability of all the organisms

in starters' components.

However, product appearances especially flavour may be considerably changed from old-style

yoghurt flavour when yoghurt is co-cultured with optional cells, particularly bifidobacteria

(Schmidt, 2004).

Generally, the yoghurt starters are responsible for the flavour and aroma creation of

yoghurt through the production of acetaldehyde, diacetyl and acetic acid through the

fermentation course. Lactic acid, non-volatile substance, donates the acidic and refreshing

flavour of yoghurt, while the volatile by-products donate the pleasant and aroma characteristic.

Regarding volatile flavor substances, acetaldehyde nearly about 90%. However,

bifidobacteria create more acetic acid than lactic acid. Hence, if they are used in the culture

make-up, the total flavor profile will develop as a result of higher acetic-acid content (Erkuş,

2007).

The compositions of yoghurt starters are shown in Table 2.4; also presented some

supplementary organisms found in yoghurt or yoghurt-like products marketed in various parts

of the world (Schmidt, 2004).

14

Table 2.4: Required & optional composition of yoghurt bacteria

ՙՙSource: Adapted from Chandan 1990. ՚՚

Required by FDA standard of Optional additional bacteria

identity for yoghurt used or suggested

Streptococcus thermophiles ST Lactobacillus acidophilus

Lactobacillus delbrueckii ssp. bulgaricus LB Lactobacillus casei

Lactobacillus casei ssp. rhamnosus

Lactobacillus reuteri

Lactobacillus helveticus

Lactobacillus gasseri ADH

Lactobacillus plantarum

Lactobacillus lactis

Lactobacillus johnsoni LA1

Lactobacillus fermentum

Bifidobacterium longum

Bifidobacterium breve

Bifidobacterium bifidum

Bifidobacterium adolescentis

Bifidobacterium animalis

Bifidobacterium infantis

2.4.1 Streptococcus thermophilus: Streptococcus salivarius ssp. thermophilus is the only species in the streptococcus

genus that used in fermented dairy product as starters (Sfakianakis & Tzia, 2014). These

organisms are thermotolerant and they are used in dairy making that want a little higher

temperature for incubation and processing (temperature range: 35–43°C for incubation; 48–

53°C for processing or cooking of certain cheeses).

Young cultures of S. thermophilus are rounded and display in chains but elder cultures or

colonial growth on solid media often exhibit new morphology, nearly close to short rod cells

(Vedamuthu, 2006; White, Kilara & Hui, 2008).

Figure 2.1 is show the typical features of S.thermophilus, which discriminate it from

lactococci using in making of cheese, buttermilk and sour cream. S.thermophilus originate

specially in the dairy environments, thus it can simply be isolated. These cells anaerobic,

15

nonmotile, Gram-positive and catalase-negative cells with round/ovoid forms of 0.7–0.9 μm

diameter (Erkuş, 2007). It may live at 60°C for 30min (Chandan and Nauth, 2012). It doesn't

survive at 10°C. Even though the best growing temperature for S.thermophilus at 37°C, these

strains grow well in co-operation with L.bulgaricus at 43°C (yoghurt incubation temperature).

In the course of yoghurt fermentation, S.thermophilus initially wants for a nitrogen source

which comes from the free amino acids found in the milk medium.As fermentation proceeds;

the peptides created via L.bulgaricus are digested by the peptidases of S.thermophilus to

produce free amino acids to meet its nutritive requirements (Chandan & O’Rell, 2006).

Figure 2.1: (a) Streptococcus thermophilus cells under microscope.1000x magnification. (b)

ST cells observed by scanning electron microscope.

Milk is a good media for S.thermophilus development. It can ferment glucose,

fructose, mannose, sucrose and lactose. Lactose in milk is moved through the cell membranes

of starters with the aid of galactoside permease enzymes which located within the membrane.

Then the lactose in the cells is digested by lactase or β -galactsidase enzyme. S. thermophilus

creates significant levels of lactase which stimulates the hydrolysis of lactose to glucose and

galactose. Glucose is altered to pyruvic acid by Embden–Meyerhof pathway. Pyruvic acid is

break down to lactic acid by lactic dehydrogenase. In most cultures, glucose is readily

consumed in milk medium whereas lactic acid and galactose piling up. Some cultures can

consume galactose; these show activity of galactokinase enzyme, changing galactose to

galactose-1-phosphate which is additional changed to glucose-1-phosphate or galactose-6-

phosphate and moreover metabolized to lactic acid. The produced lactic acid is L (+) lactic

acid. S.thermophilus is repressed by accumulative levels of lactic acid. At around 1.0%

concentration (pH 4.3) it's growing is stopped and cell numbers reach steadiness. At this phase

16

the fermented mass presentations S.thermophilus counts of 107-108 CFU/g (Chandan &

O’Rell, 2006).

The lactase activity of S.thermophilus has a physiological significance in aiding the

breakdown of lactose in the human gut subsequent intake of yoghurt by lactose-intolerant

persons. When milk incubated at 43°C, numerous strains seem round, happening in diploid or

in elongated chains of 10–20 cells. Most cells seem as diplococci. At high sourness levels in

milk, if the cells are elderly or if grown on solid media, S. thermophilus may display elongated

chains. When plated on solid media, S. thermophilus seems as pinpoint colonies. The

appearance of abnormal shapes gotten from liquid media is an index of stress conditions

affecting the organism, especially bacteriophage invasion and inhibitors (sanitizers,

antibiotics, cleaning compounds, etc.) in the growing medium. S. thermophilus is oversensitive

to materials of repression, especially antibiotics. It's easily repressed by 0.005 IU penicillin/ml

of milk. It must be noticed that S. thermophilus is more often invaded by phages than

L.bulgaricus (Chandan & O’Rell, 2006).

Figure 2.2: Stained cells of Streptococcus thermophilus under a light microscope.

Additionally, EPS cab produced by S. thermophilus in fermentation of yoghurt to

achieve a gelatinous form and soft consistency. The physiology and genetics of EPSs creation

by coccus are nowadays well understood. More details on the inheritances of S.thermophilus

are available in the collected works.These polymers may work as texturizers, viscosifiers, or

emulsifying agents to enhance the texture and consistency of dairy products (Vaningelgem et

al., 2004). EPSs that are formed by lactic acid bacteria have been shown to play a significant

role in the avoidance of whey separation (syneresis), a common challenging in manufacture

of yoghurt (Grobben et al., 1996; Zhang et al., 2011). In situ creation of EPSs by yoghurt

starters have been recommended to be used as a substitute to the adding of stabilizers, e.g.

animal hydrocolloids (gelatin and casein) or chemically modified plant carbohydrates (starch,

pectin) (Vaningelgem et al., 2004; Zhang et al, 2011).

17

2.4.2 Lactobacillus delbrueckii subsp. bulgaricus:

These bacteria firstly described in 1919 by Orla Jensen as thermobacterium

bulgaricum. Depended on molecular researchs, four subspecies of L.delbrueckii are

categorized as bulgaricus, leichmannii, lactis and delbrueckii. Lactobacilli generally are rod-

shaped as shown in figure 2.3. Some occur as long, slender, straight rods; others are curved;

others still are short, almost coccoid rods. A few display pleomorphic cells (Vedamuthu,

2006).

Figure 2.3: (a) Lactobacillus delbrueckii (LB) cells under microscope. 1000X

magnification. (b) LB cells as observed by scanning electron microscopy.

Lactobacilli do not ferment pentoses but ferment hexoses via HMP to lactic acid.

L.bulgaricus is positive with Gram stain, negative with catalase test and it nonmotile

bacterium. These cells are an anaerobic/aerotolerant homofermentative that yields D (−) lactic

acid and some H2O2. It may yield big amounts of lactic acid (up to 1.8%) but the strains which

produce mild acid are chosen for yoghurt making. Similar S.thermophilus, L.bulgaricus gives

lactase to breakdown lactose into glucose and galactose and glucose will metabolize to lactic

acid whereas galactose will gather in the growing media (White, Kilara & Hui, 2008). The

cells of L.bulgaricus look like slender rods with curved edges under microscope. These cells

appear individually or in the form of chains 3 or 4 short rods (0.5–0.8; 2.0–9.0 μm). In young

and vigorous conditions, the cells exhibit commonly single or in pairs. Under microscope,

newer L.bulgaricus cells don't display volutin grains (metachromatic). With increasing age

(20–24h), these cells will extend and the volutin grains become more obvious. Abundant

grains occur in nutritious stress in the rods. L.bulgaricus cells have a greater resistance to

antibiotics than S.thermophilus cells but repressed at 0.3–0.6 IU penicillin/ml of milk

(Vedamuthu, 2006).L.bulgaricus is an oversensetive cells. Absence of certain critical nutrients

18

and minerals in the growth media impacts on the integrity of these bacterial cells and these

cells display unusual morphology under nutritive stress. Furthermore, the preparations of rod

cultures commercially are enormously challenging task due to oversensitivity for

environmental and nutritional conditions (temperature- pH-controlling, rejection of air)

associated with harvesting and preservation processes (Vedamuthu, 2006).

The ideal growing temperature of L.bulgaricus is 45°C, but 42–43°C is utilized to

accommodate the lower ideal growing temperature of S.thermophilus in yoghurt making.

Glucose, lactose, fructose are consumed via L.bulgaricus. Also, galactose is consumed to yield

as high as D (−) lactic acid 1.8% in some cultures. It’s resists low pH much better than

S.thermophilus. Not like S.thermophilus, L.bulgaricus can convert casein (β -casein, specially)

to peptides, via proteinase enzymes bounded in cell walls. L.bulgaricus must depend on

S.thermophilus which has an active peptidase action to convert the resulting peptides to free

amino acids (White, Kilara & Hui, 2008).

Figure 2.4: Stained cells of Lactobacillus delbrueckii ssp. bulgaricus under a light

microscope.

2.5 Protocooperation between S.thermophilus & L.bulgaricus

Lactic acid bacteria are oversensitive cells and because of milk scarcity in necessary

nutriments, their grown is often limited in it. Thus successful fermentation of milk depends

mostly on the interaction between S.thermophilus and L.bulgaricus. Because both types of

cells are able to propagate alone in milk, this indirect affirmative relation is called

protocooperation. This relation often has a useful influence on growing of cells and on the

creation of lactic acid and aroma compounds (Courtin & Rul, 2004; Erkmen & Bozoglu,

2016). Some of the effectors of this relationship have been well-known and result from the

metabolic actions of the two bacteria (Angelov et al., 2009).

The grouping of the two bacterial partners is called “rod–coccus”. Rod–coccus mixtures show

a synergistic evolution response in milk. Strains of the bacterial cells should be combined with

precaution after carry out trial with numerous mixes to make the most of the synergistic effect

(Vedamuthu, 2006).

19

Actually, the stimulation the growth of L.bulgaricus achieved by pyruvic acid, formic

acid and CO2 production through S.thermophilus. Thus, L.bulgaricus yields peptides and

amino acids that encourage the growing of S.thermophilus, as S.thermophilus is only

inadequately proteolytic when compared with Lactobacillus. In contrast, although the

influence of coupling these species are often affirmative, they can also be neutral or injurious

based on the strains of cells used, the nature of milk, the process utilized for heat the milk and

the temperature of incubation for fermented milk (Courtin & Rul, 2004; Erkmen & Bozoglu,

2016).

Figure 2.5: An approximation of the relative concentration between L.bulgaricus and

S.thermophilus from the point of inoculum.

(Source:www.microbewiki.kenyon.edu/index.php/yogurt)

2.5.1 Factors of protocooperation Starter cells of yoghurt show obligate cooperative interactions through their growing

in milk media. The amounts of acidity and flavour production that are formed by yoghurt

starters having both S.thermophilus and L.bulgaricus togehter are much higher than of the two

organisms grown individually (Chandan & O’Rell, 2006). Cosidering of the characteristics of

the mutual growth of the two species, some writers consider that the term "symbiosis" has to

be replaced by the term "associative growth" (Tamime & Robinson, 2007; Angelov et al,

2009).

S. thermophilus is more aerotolerant than L.bulgaricus. It drives more rapidly through lag-

phase for reducing the pH from 6.7 to 5.7. As a result S. thermophilus support the growing of

20

L.bulgaricus primarily by generating lactic acid and formic acid (Kosikowski & Mistry, 1977;

Tamime & Robinson, 2007, Angelov et al., 2009).

Throughout the incubation at early stages, S.thermophilus propagates more rapidly

and be more numerous than L.bulgaricus by 3–4 to 1. However, at pH 5.0 in the later stages,

S. thermophilus growing slow down owing to contrary effect of acid development and the

number of L.bulgaricus approaches gradually to the population of S.thermophilus. Thus,

accomplishing of the production of acid happens in the initial stage of incubation in the main

by S. thermophilus, and in the following stage basically by L.bulgaricus (Chandan & O’Rell,

2006). S.thermophilus assimilates O2 in the milk more rapidly thus forming favourable

environments for growth of L.bulgaricus (Kosikowski & Mistry, 1977; Tamime & Robinson,

2007, Angelov et al., 2009).

Corresponding to some authors, S. thermophilus yields large amount of CO2 which is

not a product of lactose fermentation because LAB forming that kind are homo-fermentative

(Driessen et al, 1982; Angelov et al., 2009). Creation of CO2 is due to the production of urease

enzyme by S.thermophilus, which breakdowns milk urea to CO2 and NH3, ammonia acts as a

weak buffer (Chandan & O’Rell, 2006; Angelov et al., 2009). Collected works are comprised

also the theory which states that the CO2 is produced by S.thermophilus during the hydrolysis

of urea in the milk encourages the growth of L.bulgaricus when grown together (Driessen et

al., 1982; Louaileche et al., 1993; Louailèche et al.,1996; Tamime & Robinson, 2007).

S.thermophilus promotes the growth of L.bulgaricus in milk in numerous ways: a decline of

the pH, change of the redox potential, consuming of dissolved O2 and forming CO2, as

presented in fig.2.6; S.thermophilus generates the required anaerobic environments.

21

Figure 2.6: Scheme for proto-cooperation between S.thermophilus & L.bulgaricus

In the milk, the conjoint growing of two forms is specified by the metabolism of them.

For example, the lactose turns to glucose and galactose and those are used in different ways

by these two species of the mixed culture. The streptococcus and lactobacillus digested the

glucose and turn this into D (-) lactic acid. Not like glucose, which is assimilated by the two

species, the galactose consumed by S.thermophilus via Leloir' metabolic pathway and turning

this into lactic acid and CO2. This confirms the anaerobic conditions for lactobacillus growth


As it's known that some strains of S.thermophilus don't have urease enzyme and can't

produce carbon dioxide. Hence the Leloir' metabolic pathway is a probable way to realize the

anaerobic environments, which is considered as a good clarification of protocooperation in the

lack of urease enzymes. (Angelov et al., 2009). L.bulgaricus yields short peptides and amino

acids that promote the evolution of S.thermophilus (Tammam et al., 2000). Histidine,

threonine, and Valine are the most important amino acids required for the conjoint growth of

both strains (Tamime & Robinson, 2007). S.thermophilus often has low proteolytic activity

due to shortage of protease in the cell wall for these strains. So, their growing is limited because

of deficiency of an adequate amount of amino acids and peptides in the milk wanted for these

starins. In contrast, L.bulgaricus is able to produce amino acids and small peptides from the

casein of milk because of these strains have protease activity in the cell walls. This conjoint

growing to both species leads to more formation of effective acid, more concentration of final

cells and it in addition rises specific growing speed comparing with monocultures from both

species (Driessen et al, 1982; Rajagopal & Sandine, 1990, Chandan & O’Rell, 2006; Angelov

et al., 2009).

22

Due to the differences in the metabolism of both strains, the formation of the

organoleptic profile of milk is occurring. Acetate, lactate, diacetyl and acetaldehyde are the

main components which provide the flavour and aroma complex. Acetate, formate,

acetaldehyde and diacetaldehyde are produced from the pyruvate by streptococcus strains,

whereas diacetyl and glycine are produced by lactobacillus strains from threonine. It was

found the diacetyl/acetaldehyde in the proportions 1:1 to 1:5 are the best organoleptic profile

of the milk (Angelov et al., 2009). Tamime concluded that the productivity of promoting

factors from starters occur during coagulation phase of milk. L.bulgaricus produces the

required ingredients (amino acids) for S.thermophilus and then streptococcus produces

formate which supports the development of lactobacillus (Tamime & Robinson, 2007; Erkmen

& Bozoglu, 2016).

Some authors mentioned that the balance between lactobacillus and streptococcus is

limiting for the yoghurt's flavour. When streptococcus dominates in the yoghurt, taste becomes

mild with fuller aroma of diacetyl and acetaldehyde whereas when the lactobacillus dominates

in the yoghurt, a sharp acid with good fermented milk aroma are produced (Marshall, 1987).

Figure

2.7: Behaviour of single and mixed strain yoghurt cultures propagated at different

temperature (source: Tamime, 1997).

30ºC 35ºC 40ºC 45ºC 50ºC.

Figure 2.8: Behaviour of single and mixed strain yoghurt cultures propagated at 40ºC. (Source: Tamime, 1997).

5

23

2.7 classification of LAB based on by-products of suger

Lactic acid bacteria may be classed depending on their by-products of carbohydrates

fermentation as homofermentative or heterofermentative.

2.7.1 Homofermentative lactic acid bacteria

Lactic acid is the main by-product which produces from fermentation of glucose.

Lactococcus ssp. are considered one of examples of homofermentative lactic acid bacteria

which are used in applications of dairy starters where the quick formation of lactic acid and

decline in the pH are desirable. L.bulgaricus, L.acidophilus, Streptococcus thermophilus and

thermophilic cultures that might be used in cheese manufacturing (e.g., L.helveticus) are other

examples of homofermentative LAB. Other Streptococcus spp., Enterococcus, Pediococcus

and Aerococcus are additional homofermentative cocci that might be originate in milk and

dairy products, but they are seldom used as starter cultures.

2.7.2 Heterofermentative lactic acid bacteria

Lactic acid, ethanol/acetic acid and carbon dioxide are by-products which produce

from fermentation of glucose. In general, the detection of gas (e.g. CO2) is used to examine

the heterofermentative cultures. Heterofermentative lactic acid bacteria are seldom used as

dairy starters. If significant numbers are allowed to be grown, they can cause faults related to

their acidity and production of CO2, such as slots in hard cheeses or swollen the packaging of

other dairy products. Leuconostoc spp. (Gram-positive cocci) and L.brevis, L.fermentum, L.

reuteri (Gram-positive rods) are considered examples of heterofermentative lactic acid

bacteria.Other Lactobacillus species comprise L.plantarum, L.casei and L.curvatus are

considered facultatively heterofermentative, this mean they will make CO2 and other by-

products only under certain environments or from limited substrates.

2.7.3 Other Gas Producing Pathways:

Other substrates comprising citrate, gluconate and certain amino acids are used to

produce gas by other lactic acid bacteria. Some citrate-fermentors are used in certain dairy

products to make flavour as diacetyl. Manufacturing products such as buttermilk, sour cream

and cultured butter are often occurring by Leuconostoc mesenteroides ssp. cremoris and

Lactococcus lactis ssp. lactis biovar diacetylactis. These organisms can also happen as wild

contaminants causing defects in dairy products wherever some flavours and gas are not

desired.

24

2.8 Types of Yogurt

Depending on fat content, method of production, flavour and physical state of yoghurt,

it can be classified (Erkmen & Bozoglu, 2016).

A) Based on the chemical composition of the product

Yoghurt can be characterized into three main varieties namely, regular yoghurt, low-

fat yoghurt and non-fat yoghurt. Regular yoghurt should have at least 3.25% of milk fat where

is made from the full fat milk (Trachoo, 2002). In contrast, low-fat yoghurt and non-fat yoghurt

are made from low fat milk or partially-skim milk, and skim milk respectively. Table 2.5

shows the content of fat at the side of pH and titratable acidity of these three forms of yoghurt

(Weerathilake, 2014).

Table 2.5: The Composition of regular, low-fat & non-fat yoghurt

Parameter Regular yoghurt Low-fat yoghurt Non-fat yoghurt

Fat (%) ≥ 3.25 0.5-2.0 ≤0.5

Solid Non Fat (%) ≥8.25 ≥8.25 ≥8.25

Titratable Acidity (%) ≥0.9 ≥0.9 ≥0.9

pH ≤4.5 ≤4.5 ≤4.5

B) Based on method of production

(i) Set yoghurt: It's incubated and cooled in the final packaging. It's fermented in retail

containers and after the fermentation route, no further agitating or water exclusion occurs. (ii)

Strained (Stirred or Greek style) yoghurt: It's made by inoculation of starters and incubation

in containers. It's fermented in containers under mild continuous agitating and after the ending

fermentation process; a portion of the whey is eliminated. Gel construction of yoghurt is

fragmented by stirring before cooling and packaging. The manufacturing routes of the set and

strained yoghurt are shown in the (fig. 2.9). (iii) Drinking yoghurts: It's commonly going

through a homogenization process with the aim of reduce the particle size that assured

hydrocolloidal distribution and stabilization of the proteins suspension. It is formed from

strained yoghurt with low viscosity (level of solids 11%) (Sfakianakis & Tzia, 2014:

Weerathilake, 2014; Erkmen & Bozoglu, 2016).

C) Based on physical state

(i) Liquid/viscous yoghurt. (ii) Semi solid yoghurt: it's concentrated/condensed yoghurt.

(iii) Solid yoghurt: it's soft/hard-frozen yoghurt. (iv) Yoghurt powder: it's dried yoghurt and

may be formed by sun-drying, spray-drying, or freeze-drying (Erkmen & Bozoglu, 2016).

25

Standardization of milk

Homogenization

55ºC and 15-20/5 MPa

Pasteurization

80-85ºC for 30 min or 90-95ºC for 5 min

Cooling to incubation temperature (43-45ºC)

Inoculation of starter culture (2% V/V)

Packaging into individual containers Fermentation/Incubation (42-45ºC)

(until desired pH is reached)

Fermentation/Incubation (42-45ºC)

Cooling (until pH reached to 4.6)

Stirring

cold storage(˂4ºC) Cooling and

Cooling, pumping and packaging

Cold storage (˂4ºC)

Figure 2.9: Manufacturing process of set & stirred yoghurt.

D) Based on added flavouring

Adding flavours would promote the consumer demand, as a result manufacturing

variety of yoghurt products. Flavours may be added immediately before or after the

homogenization. Yoghurts can be classified into plain, fruit and flavoured yoghurt based on

the particular flavour of the yoghurt (Weerathilake, 2014).

(i) Plain (natural yoghurt): it is made conventionally with typical sharp flavours (Erkmen &

Bozoglu, 2016). This form is the simplest and the least adulterated of the yoghurt made by

LAB of pasteurized milk so as to get the characteristics of texture and flavour. In other words,

it can be defined as the plain and unsweetened fermented milk product having no added color

or any other additives. Hence, it is closer to the nutritional value of milk which provides all of

the benefits connected with fermentation whereas providing fewer quantities of calories.

Stirred-yoghurt

Set-yoghurt

26

Additionally, plain yoghurt provides the pure yoghurt flavour and holds the richest calcium

content among the yoghurt products (Weerathilake, 2014).

(ii) Fruit yoghurt: it's formed by adding fruit such as strawberry, grape, apple, banana, etc.

(Erkmen & Bozoglu, 2016). There are two types of fruit yoghurts: The first one has the fruits

set at the bottom of the packaging (sundae-style yoghurt) whereas the second one has the fruit

homogeneously distributed within the yoghurt itself (Swiss-style yoghurt). Fruit pieces or pulp

that produces diverse flavours are added at production stage (Weerathilake, 2014, Erkmen &

Bozoglu, 2016).

(iii) Flavoured yoghurt: it's formed by adding synthetic flavouring, colouring and sweetening

agents to yoghurt (Erkmen & Bozoglu, 2016). Generally, flavours are added to yoghurt during

production stage and the additions of flavours lead to not only a wide array of tastes but also

increase sweetness of the product (Weerathilake, 2014).

In some countries a layer of fruit syrup on the upper of set yoghurt is a common

substitute. In other countries thicker stirred yoghurt is desired. This can be prepared by

addition dried skimmed milk (at around 50g/l) to the milk before pasteurising. Using additional

thickeners such as starch and pectin is as well possible, but generally unnecessary (Sfakianakis

& Tzia, 2014).

2.9 Yoghurt Processing

Yoghurt making starts from milking of the animal then passes through several

processes and the last step is the packaging of the final product (Sfakianakis & Tzia, 2014).

Yoghurt is basically made from bovine milk and milk from other animals is employed for

yoghurt making also. Yoghurt resulting from non-bovine species tends to be different in

several sensory and physicochemical features due to differencies in the composition of milk.

For instance, yoghurt resulting from milk with high content of fat (e.g., sheep, goat, and

buffalo) have creamier comparing with milk having lower content of fat (e.g., bovine, mare,

and ass). Thus, the species of the milk-producing animal meaningfully affect on the features

of the formed yoghurt (Tamime & Robinson, 2007; Sfakianakis & Tzia, 2014). Yoghurt

processing comprises following steps: 1-Standardization 2-pasteurization 3-homogenization

of milk 4-inoculation with starters 5-adding of flavours (optional) 6-incubation 7-cooling 8-

packaging (Fig. 2.7) (Erkmen & Bozoglu, 2016).

27

Figure 2.10: Flow Chart of yoghurt (Source: Erkmen & Bozoglu, 2016).

2.9.1 Initial Treatment of Milk

In the manufacturing of dairy products, the raw milk undergoes into clarification via

centrifugation to eliminate somatic cells and any other solid contaminations. Next,

thermalization (mild heating) is done at temperature ranged from 60–69 °C for 20–30 s and

aims to kill a lot of vegetative germs and the fractional inhibition of some enzymes. then, the

milk is cooled at <5 °C or inoculated with LAB or other cells to regulate the development of

the psychrotrophic bacterial cells (Tamime & Robinson, 2007).

2.9.2 Milk components standardization:

The standardization of milk refers to the adjustment of fat and solid-non-fat content (SNF).

2.9.2.1 Fat content standardization:

Fat content of bovine milk ranged from 3.2%–4.2%. The fat content of the milk is

adjusted to range from <0.5% for skim milk, 1.5%–2% for semi-fat milk, 3.5% for full fat milk

(Sfakianakis & Tzia, 2014). According to consumer demands, the fat content varieties from

0.1%–10% (Erkmen & Bozoglu, 2016).

For the reason that the fat content of the milk plays essential role about the yoghurt

features, so the standardization is an important process. The increase in fat content of milk

leads to an increase in the consistency and viscosity of yoghurt. Too, the content fat in milk

Milk+ supplements

Homogenization

(at 100-200 atm. and 50-60ºC)

Pasteurization

(at 90-95ºC for 5-10min)

Fermentation

(at 43ºC for 3 to 6h)

Cooling (to 29ºC)

Packaging and storage

Starter culture

Cooling (to 43ºC)

28

affects on the maximum rate of pH decline and pH lag phase through yoghurt making

(Soukoulis et al.; 2007; Sfakianakis & Tzia, 2014).

Practically, achieving the considered fat level, either the adding of skim milk, milk fat or the

separation of fat from milk by centrifugation and blending milk fat with skimmed milk is

carried out (Tamime & Robinson, 2007).

2.9.2.2 Solid (nonfat) content standardization:

The SNF constituents of milk primarily are composed of lactose, protein and minerals;

SNF content differs from 11% to 14% in the milk whereas the SNF of yoghurt ranged from

9% to 16%. In some cases, the SNF content of milk intended for yoghurt making is improved

by makers so as to achieve the preferred characteristics of the coagulum; greater SNF level in

yoghurt, greater resulting viscosity and firmness. In some countries, adding native milk

constituents such as powdered milk (skim or full fat), whey protein concentrates or powdered

casein is allowed to yoghurt and fermented dairy products. It's relatively common in yoghurt

production to reach at the desired SNF content thus leads to increase in firmness and stability.

It should be noted that the fat and SNF content of milk have an effect on the fermentation

process. Particularly, the interactions of SNF content of milk and incubation temperature play

a significant role in the duration of the fermentation process; increasing SNF increases the

duration of the fermentation process (Kristo et al., 2003; Sfakianakis & Tzia, 2014).

2.9.3 Addition of additives:

The following additives can be used in yoghurt making (50 mg /kg

in final product):

sorbic acid and its salts (K+, Na+, Ca+2), sulfur dioxide and benzoic acid proposed by food and

agricultural organization (FAO) and world health organization (WHO). Gelatin, starch and

agar also can be used as stabilizer (0.1–0.5%) and supplemented into yoghurt to enhance gel

structure, creaminess, viscosity, firmness, water-holding capacity and protein stability

(Erkmen & Bozoglu, 2016).

2.9.4 Homogenization:

Increases in viscosity and coagulation steadiness of the yoghurt occurred by

homogenization of the milk (Erkmen & Bozoglu, 2016). It leads to reduce the globules sizes

of fat into 1-2μm. It also stops the separation of fat during production. Thus; it enhances the

incorporation of other materials as powdered skim milk. After homogeneousness, membranes

of the fat globules are destroyed then lipase enzymes attack these globules. Therefore, to

prevent lipolysis, heat treatment of milk should occur directly after homogenization (Erkuş,

2007).

29

2.9.5 Heat Treatment: Pasteurized milk treated thermally either by passing it through plate heat exchanger at 90-

95°C for 5-10 min or in process vessel at 80-85°C for 30 min (Erkuş, 2007). Heat treatment

has several functions in milk as follows:

Partially hydrolysing and denaturing casein, liberating glycopeptide from κ-casein,

causing interchain cross-linkage (increases in micelle size), deactivating

immunoglobulins and making active SH group.

Increasing the hydrophilic properties of casein and forming stable coagulum.

Deactivating protease, lipase and microbial cells.

Denaturing proteins, creating peptides and flavour compounds.

Leading to form lactones and ketones (flavour) compounds.

Destructing some water-soluble vitamins as C, B1, B6, B12 and folic acid (Erkmen &

Bozoglu, 2016).

2.9.6 Fermentation Process

Treated milk is cooled to 43°C to inoculate starter cultures (Erkmen & Bozoglu,

2016). The amount of inoculation may vary from 0.5-5 % but 2% is the optimal value. Yoghurt

starters are S.thermophilus and L.bulgaricus. Additional Lactobacilli ssp are also utilized such

L.lactis, L.casei, L.jugurticus and L.helveticus. Generally, S.thermophilus and L.bulgaricus

are produced as blends in (1:1) ratio for inoculation and they are propagated together at 43°C.

The starters are mixed with milk by stirring. Inoculated milk are incubated at 43°C for 3- 6 h

until reach to the wanted acid. The lactic acid percentage of good ended yoghurt is about 0.85–

0.90 % (pH 4.2) (Erkuş, 2007).

During the fermentation process, cocci grow initially followed by bacilli with the purpose of

the counts of two strains become nearly equal after around 3h. At pH 4.2–4.4, S.thermophilus

tends to be repressed whereas L.bulgaricus can resist the pH in the range 3.5–3.8. Resulting

biological and physical modifications happen in milk throughout fermentation as following:

(i)The starters consume lactose in milk to create lactic acid and energy.

(ii) Casein micelles destabilized by lactic acid.

(iii) Aggregation for casein micelles and partially combine once reaching pH to the isoelectric

point 4.6–4.7.

(iv) α-Lactoalbumin and β-lactoglobulin interact with κ-casein and keeps the micelles from

complete disruption (Erkmen & Bozoglu, 2016).

30

2.9.7 Cooling and Storage:

The yoghurt is cooled to around 5°C after the pH reached 4.7–4.3. This stops the

growth and metabolism of the starters and stops the increase in sourness. Cooling may be in

one or two phases. One-phase cooling comprises the quick decrease of the coagulum

temperature to less than 10°C whereas the fermentation process is stopped and leads to produce

low viscosity of yoghurt. Two-phase cooling starts with rapid decrease in temperature to less

than 20°C and then slowly reaching to 4°C (storage temperature) leading to increase in

viscosity and restricted syneresis for yoghurt. This is fairly common in the yoghurt making,

particularly when fruits are added (Tamime & Robinson, 2007; Sfakianakis & Tzia, 2014).

Yoghurt are kept at 4°C for 7-14 day. Cooling decreases, the metabolic activity of the starters

thus controls the acidity of the yoghurt. Fresh yoghurt contains around 109

cell/gram, which

may decline to 106

cell/gram throughout storage. Bacilli generally drop more rapidly than cocci

and L.bulgaricus is more sensitive than S.thermophilus to low temperature (Erkmen &

Bozoglu, 2016).

2.10 Factors affecting slow growth of starter cultures and Yoghurt

quality:

To get a high quality of yoghurt with desired flavour, aroma, viscosity, consistency

and appearance, free from synersis and have long duration,there are numerous factors should

be controlled throughout the processing of yoghurt.The factors that affect on the quality of

yoghurt are standardization of milk, additives which are used to enhance the texture and

viscosity of yoghurt, homogenization, treatment by heating, starter strains, invasion of phages,

and inhibitory substances as disinfectants, detergents and antibiotics (Erkmen & Bozoglu ,

2016).

2.10.1 Compounds that are naturally present in milk

Numerous antimicrobial systems occur in milk to protect the suckling animals from

infections and diseases. Lactenins, the inhibitory complexes, are heat sensitive and they are

damaged when heating the milk at 68–74°C. Peroxidase system, another bactericidal

component found naturally in milk, comprises lactoperoxidase /thiocyanate/hydrogen

peroxide [LP/SCN- /H2O2] shortened as LPS.The inhibitory compounds in this systems are the

outcome of oxidation reactions where in the presence of H2O2, the LP stimulates the oxidation

of thiocynate to non-inhibitory compounds (SO42-, CO2 and NH3) next more oxidation to form

intermediate inhibitory substances as hypothiocyanate or higher oxyacids. In the presence of

some reducing substances (e.g. cysteine and dithionite), the inhibition became reversible. Most

31

starters are resistant to LP systems but some lactic cultures may cause sensitive mutants.

Otherwise, continual proliferation of starters in sterilized milk may affect on the sensitivity of

the cells to the LP system. Adding peroxidase or reducing agents like cysteine and dithionite

into sterilized milk are a preventative measure. LP systems deactivated by heating milk at

85°C for 16 sec. Heat treatment of yoghurt milk at 85°C for 30min or at 90–95°C for 5–10min

are adequate to destroy the natural inhibitors .Other inhibitory systems which must be taken

in consideration are: (a) bacterial agglutinin, causing agglutination of the starters, can affect

on the growth and metabolic activity (b) certain forms of forage (i.e; musty silage, turnips,

vetch), resulting in a milk containing inhibitory substances, can decline the amount of acid

producing by starters even after heating the milk for 15 min at 90°C (Tamime & Robinson,

1999).

2.10.2 Inoculation rate and Incubation temperature

The optimal rate for acid development is obtained within a very short period when the

starters are incubated at 40–50°C. The growth manners of S. thermophilus and L.bulgaricus

(single or blended cultures) have been shown in Fig. 2.7 but in industrial conditions, yoghurt

is manufactured over a short or long period using fermentation temperatures at 30°C or 45°C,

respectively. In the previous method of production, a reduced rate of acid development

becomes unavoidable although this effect is controlled by processing conditions, thus the

quality of the end product can be influenced. The inoculation rate may also affect on the rate

of acid development during production of yoghurt. Imprecise rates of starters' addition to the

milk can influence on the acid development of S.thermophilus and L.bulgaricus (Tamime &

Robinson, 1999).

2.10.3 Somatic cell count and Mastitis milk

35% of decline in the action of yoghurt starter caused by the large numbers of somatic

cells in milk but heating the milk to 90°C for 20 min or boiling for 2 min deactivates the cells

absolutely (Tamime & Robinson, 1999).

2.10.4 Antibiotic residues

Mastitis can influence on the quality and yield of milk. Antibiotic therapy, particularly

intra mammary injection, is extensively used to treat of mastitis in the mammal animals. The

most common antibiotics used are penicillin, neomycin, streptomycin, tetracycline,

chloramphenicol, erythromycin, sulfonamide, spiramycin, ampicillin and cloxacillin. These

antibiotics are concentrated in the udder cells then progressively diffuse in milk and pollute it.

32

Subsequently, the milk shouldn't be got from animals' treated with antibiotic within 72h. Slight

amounts of antibiotic can influence on the viability of the starters. The main outcome of

antibiotic remains in yoghurt milk causing collapse in the cooperative growth among

S.thermophilus and L.bulgaricus or a slowdown in the acid development rate (i.e. longer

processing time) and this can lead to syneresis or wheying-off. Antibiotic residues in milk and

other dairy products are also unsafe on public health (Tamime & Robinson, 1999 & Erkmen

& Bozoglu, 2016).

2.10.5 Disinfectant and detergent residues

Disinfectant and detergent are extensively used in the dairy industry to disinfect and

clean dairy apparatus. Those are chlorine compounds, quaternary ammonium compounds,

iodophore, ampholytes, and alkaline. Some dairy manufacturers add biocidal compounds

(e.g. H2O2) to milk to enhance and maintain the quality. This later method is not

recommended for public health reasons and the existence of such compounds in milk can

adversely influence or completely deactivates the growth of starters (Tamime & Robinson,

1999 & Erkmen & Bozoglu, 2016).

2.10.6 Environmental pollution

Cases of insecticide residues in milk are stated and this incidence may be due either

to post-milking contamination or by fodder sprayed with insecticide gave as feeding for

cattle. Heating the milk contaminated with pesticide and the fermentation process

contributed towards the degradation of pesticides (Tamime & Robinson, 1999).

2.10.7 Bacteriophage

Bacteriophage are viruses which can invade and damage the yoghurt starters and cause

failure in lactic acid production lead to poor coagulation of the processed milk. Until recently,

phages of mesophilic LAB which are used in cheese manufacture occupy the most attention.

However, the phage problems of yoghurt starters become more common and they cause

serious economic losses because of the vast increase in the production of yoghurt around the

world (Erkuş, 2007). Phage in yoghurt ordinarily represses S.thermophilus. Phages are

removed by heating of milk at 85°C for 20min (Erkmen & Bozoglu, 2016).

33

Figure 11: Scanning electron micrograph illustrating (A) a healthy S.thermophilus culture

and (B) the lysis of cells after invasion with a virulent bacteriophage (Source: Tamime &

Robinson, 1999).

2.10.8 Bacteriocins

Antibacterial materials are formed by a wide range of bacteria including dairy

starter's starins (Tamime & Robinson, 1999).

2.11 Molecular identification:

Old-style identification techniques based on physiological characteristics, besides

innovative phenotypic methods, such as cell wall composition analysis, whole-cell protein

fingerprinting and fatty acid analysis, often have need of considerable times and expertises,

and the outcomes are not always acceptable, mainly in cases of phylogenetically closely

related species ( Papadelli et al., 2003 ; Dellaglio & Felis, 2005 ; Tabasco et al., 2007 ),

Therefore, a clear identification into species may sometimes be very hard (Giraffa et al.,

1998).

Recently, investigations have focused on applying molecular techniques for reliable

differentiation of LAB and a variety of phenotypic and genotypic approaches is now

obtainable (Drake et al. 1996; Khaled et al. 1997; Quere et al. 1997; Tilsala-Timisjarvi and

Alatossava 1997; Giraffa et al., 1998; Papadelli et al., 2003).

Gathering data related to the sequences of the 16S rRNA, 23S rRNA, the 16S–23S

rRNA intergenic spacer regions or genes encoding enzymes have allowed identification of

LAB using specific oligonucleotides as probes or in PCR assays (Ward et al., 1998; Flint et

al., 1999; Deasy et al., 2000; Igarashi et al., 2001; Fortina et al., 2001; Chagnaud et al., 2001;

Papadelli et al., 2003).

34

To attain a quick and reliable identification of species, PCR- based approaches using

species-specific primers targeting the 16S rRNA gene sequence diversity have become very

popular (Coeuret et al., 2003; Tabasco et al., 2007). 16S ribosomal DNA is a part of the

ribosomal RNA- a 1542 nucleotide long component of the small prokaryotic ribosomal subunit

(30S). 16S rRNA sequence is provide precise basis for phylogenetic studies (Kermanshahi &

Peymanfar, 2012) as it is highly conserved between different species of bacteria. DNA

primers, for use in the PCR, can be designed to the highly-conserved sequences on the 16S

rRNA, which often flank hypervariable regions that can provide species-specific signature

sequences useful for identification.

Detecting and identifying various species of LAB with rapid means is considered as a

major importance among others in order to control the quality of dairy products, in particular,

when blended cultures are present and to monitor fermentation processes (Papadelli et al.,

2003).

35

Chapter 3

Materials and Methods

36

Chapter 3

Materials and Methods

3.1 Materials

3.1.1 Chemicals and Reagents

Chemicals, cultures medium and reagents used in this study are shown in Table 3.1

Table (3.1): Chemicals, reagents and cultures mediums that were used in this work

Reagents & Cultures Media Manufacture Country

Agar HiMedia India

Yeast extract HiMedia India

Tween 80 HiMedia India

Meat Extract HiMedia India

D(+) Glucose HiMedia India

Sodium Acetate HiMedia India

D(+) Lactose HiMedia India

Triammonium citrate HiMedia India

Trisodium Citrate Dihydrate HiMedia India

O2.7H4MgSO HiMedia India

2MgCl HiMedia India

O2.4H4MnSO HiMedia India

NaCl HiMedia India

4HPO2K HiMedia India

NaOH HiMedia India

Glycerol HiMedia India

Skim milk HiMedia India

Bromocresol purple Sigma-Aldrich USA

Hydrogen peroxide (30%) HiMedia India

Gas generating kit Oxoid UK

Gram stain kit HiMedia India

API 50 CH fermentation assays BioMerieux France

Phenolphthalein HiMedia India

Agarose HiMedia India

Promega wizard Genomic DNA Purification

Kit

Promega USA

Primers Invitrogen USA

PCR Master Mix 2X Kit Invitrogen USA

DNA Ladder 100bp Invitrogen USA

Eco RI enzyme Invitrogen USA

37

3.1.2 Equipments

The major equipments used are listed in Table 3.2.

Table (3.2): Major Equipments used in the present study.

Instrument Manufacturer Country

Centrifugation DRE USA

Shaker Grant UK

Incubator IKS international USA

PCR BioRad USA

Gel Electrophoresis Biometra Germany

Light microscopic Olympus Japan

Anaerobic jars Oxoid UK

3.2 Methodology:

3.2.1 Traditional yoghurt samples

Six samples of cow’s traditional yoghurt samples were gathered from the households

of 3 geographical areas of the Gaza strip (Rafah, Khanyonis and Gaza cities). The samples

gathered in sterile cups and saved cool until they could be taken to the laboratory, where

they kept at 4ºC for further use.

3.2.2 Isolation of starter cultures

Ten grams of homogenized samples are diluted in 90 ml sterile saline solution (0.85%

NaCl) followed by making 7- fold serial dilution for isolation.

3.2.2.1 Selective Media and Growth Conditions

One in ten milliliter from each dilution subcultured twice in M17 and MRS plates used

for cocci and bacilli respectively. Avoiding yeast contaminants, the media complemented

with 100mgl-1 of cycloheximide antibiotic before being incubated at 42ºC for 2-3 days. The

MRS and M17 plates incubated anaerobically using the gas pack system to provide the

optimum gas for L.bulgaricus and S.thermophilus respectively. Colonies randomly

selected, then streak plate method was used to get purified, next kept at 4ºC for MRS and

M17 agar plates and at -20ºC for M17 and MRS broths supplemented by 20% glycerol as

a cryoprotective agent for further use (Mathara et al.,2004).

38

3.2.3 Phenotypic identification of isolates

Initially, all isolates examined for Gram stain and catalase activity (Harrigan and McCance,

1976). Cultures that gave Gram positive and catalase negative reactions lastly used for further

identification (Sharpe et al., 1979).

3.2.3.1 Gram Staining

The Gram status of the isolated bacteria were determined by the microscopic

examination of Gram-stained isolates. Ten μl of cell suspension was pipetted to a microscopic

slide and they were Gram stained after drying and fixation by exposure to a flame. The main

steps in Gram Staining procedure were as follows:

• Crystal violet staining for 1 min then removing the excess stain by washing under tap water.

• Staining with Gram’s iodine solution for 1 min then washing under tap water.

• Fixation the slide with decolourizer for 15sec then washing under tap water.

• Counter staining with safranin for 30 s then washing under tap water.

• Drying the slide then examine it under microscope to observe bacterial cells.

Gram-positive bacteria Deep violet to blue gram-negative bacteria Pink to red

3.2.3.2 Catalase Test

Catalase enzyme splits H2O2 into H2O and O2. Both L.bulgaricus and S.thermophilus

negative with catalase test.Small amount of culture placed onto a clean slide. Add a few drops

of 3% H2O2 onto the smear.

Positive result Rapid evolution of O2 (bubbling)

Negative result No bubbles / only a few scattered bubbles

3.2.3.3 Gas Production from Glucose

It's a major criterion for identifying the nature of isolated strains about homofermentative

or heterofermentative. Broth media of MRS or M17 containing inverted Durham tubes are

used for evaluation of gas production. Bubbles trapped within the Durham tube indicate the

production of gas. Even a single bubble is significant and means evidence of gas production

(Forbes et al., 2002). No bubbles within the Durham tube indicate a non-gas producing

organism (Mac Faddin, 1976).

39

Fifty μl of reactivated cultures are inoculated into 5 ml MRS containing Durham tubes

and incubated at 42°C for 5 days.

Homofermentative Accumulation of gas in the Durham tubes

Heterofermentative No gas in the Durham tubes

3.2.3.4 Growth at Different Temperatures

The criterion which is commonly used for the classification of bacilli is the Growing at

15°C and 45 °C, where L.bulgaricus can't grow at 15°C but can grow at 45°C. For cocci

isolates, growing at 10°C and 45°C are used. S. thermophilus can't grow at 10°C but can grow

at 45°C.To determine the growing of isolates at given temperatures, MRS and M17 media

containing bromocresol purple are used. Colour change 5+indicate lactic acid production and

cell growth (Hammes and Vogel 1995).

Fifty microliter of reactivated cultures are inoculated into 5 ml test media at 42ºC for

5 days (Erkuş, 2007).

Positive result Colour change from purple to yellow

Negative result No change in colour

3.2.3.5 Growth at Different NaCL Concentrations

The tolerance of isolates at different levels of salts is also evaluated (Ali, 2011).

L.bulgaricus and S.thermophilus are oversensitive to NaCl. S. thermophilus does't grows even

at 2% NaCl, but there is no data available for L.bulgaricus. The most commonly used NaCl

concentration for identification of bacilli are 4% and 6.5%. Therefore, the growth at 2% and

4% for cocci isolates and the growth at 4% and 6.5% for bacilli isolates are used in NaCl test

medium (Appendix B).

Fifty microliter of reactivated cultures are inoculated into 5ml NaCl test media at 42ºC

for 5 days (Erkuş, 2007).

Positive result Colour change from purple to yellow

Negative result No change in colour

3.2.3.6 Carbohydrate Fermentation profiles

Carbohydrate fermentation tests aims to determe the ability of organisms to ferment a

specific suger. It can be used to differentiate among bacterial groups or species. It detected by

the colour change of a pH indicator as forming acid products. Colour change only happens

40

when enough acid products have been produced by fermentation of the suger to low pH (6.8

or less). This test achieve by two steps as follows:

3.2.3.6.1 Preparation of active cell culture free from sugar:

• Ten ml MRS and M17 media are used for overnight activation of isolates at 37°C.

• Five ml of each bacterial culture pelleted by Centrifugation for 10 min at 10.000 rpm then

wash the pellet twice with sterile physiological saline (0.9%) (Tanigawa and Watanabe, 2011).

3.2.3.6.2 Combinations of active cell culture free from sugar and tested sugar:

An API 50 CH fermentation assay is a ready-to-use medium which allows the fermentation

of the 49 carbohydrates. The main steps this assay were as follows:

Transferring 100 µl of suspension into each of the 50 wells on the API 50 CH strips

except the first strip served as a control well.

Covering wells with parafin oil to affect anaerobiosis.

Incubating the strips at 42°C for 48h and monitoring the colour changes.

Positive result Colour change from purple "bromocresol purple indicator" to yellow.

For the esculin (tube no. 25), a change in colour from purple to black.

Negative result No change in colour.

The biochemical profile obtained for the strain after the final reading can be identified using

ABIS online for bacterial identification.

3.2.4 Molecular identification for isolated bacteria

3.2.4.1 DNA isolation

Ten ml MRS and M17 media are used for overnight activation of isolates at 37°C.

Harvest the isolates at 6.000 rpm for 5 min then remove the supernatant.

Genomic DNA of the isolated bacteria were extracted by Genomic DNA Purification

Kit Brand WISARD Promega® for isolation of Gram positive bacteria follow the

manufacturer instructions that presented in appendix C.

The extracted DNA was stored at –20 °C until use as a template for PCR.

3.2.4.2 Primers

cysmet2F (forward): 5′ GGAACCTGAAGGCTCAAT 3′

cysmet2R (reverse): 5′ GTCAACCACGGTAAAGGTC 3′

Primers for the methionine biosynthesis gene

41

9699–9700 primers are used for the amplification of 16S rRNA gene.

9699 5′ ATCCGAGCTCAGAGTTTGATCCTGGC 3′

9700 5′ TCAGGTCGACGCTACCTTGTTACGAC 3′

Primers for the amplification of 16S rRNA gene

3.2.4.3 PCR conditions

PCR amplifications are made on thermal cycler (BioRad, USA). For the analysis of

methionine biosynthesis gene, PCR conditions and reaction mixture was as follows:

Step 1: 94 ºC for 2 min (initial denaturation)

Step 2: 94 ºC for 30sec (denaturation)

Step 3: 54 ºC for 40 sec (annealing) 45 cycles

Step4: 72 ºC for 45 sec (elongation)

Step 1: 72 ºC for 10 min (final annealing)

The total reaction volume of PCR was 30μl and the amount of DNA was 1µl.

For 16S rRNA gene, PCR conditions and reaction mixture were as follows:

Step 1: 95 ºC for 2 min (initial denaturation)

Step 2: 95ºC for 1min (denaturation)

Step 3: 56 ºC for 1min (annealing) 35 cycles

Step4: 72 ºC for 1min (elongation)

Step 1: 72 ºC for 10 min (final annealing)

The total reaction volume of PCR was 30μl and the amount of DNA was 1µl.

3.2.4.4 Restriction analysis of 16S rRNA gene product

By Eco RI as the endonuclease enzyme, the restriction of 16S rRNA gene product

carried out. The reaction mixture contained 1x of the restriction enzyme buffer, 10 µl of PCR

product and 0.5 µl Eco RI (Delley & Germond, 2002).

3.2.4.5 Separation of Amplification Products

3.2.4.5.1 Preparation of Agarose Gel:

Dissolve 1.5 % agarose in 100µl 1x TAE buffer by boiling (Appendix C). It's cooled

to 45º C. Add 15µl ethidium bromide solution (Appendix C) with stirring. Pour the agarose

gel in casting stand then place the combs (Markiewicz et al., 2008).

42

3.2.4.5.2 Loading of Agarose Gel:

5µl of PCR products are mixed with 2μl of gel loading dye. Start from the second

well to load the samples into the wells. In the first well, load DNA ladder of 100 bp which is

used as marker (DNA molecular weight).

3.2.4.5.3 Electrophoresis of the Products:

PCR products are electrophoresed at 80V for 1h. Visualize the Amplified products in

a gel documentation system. Images can capture in a photodocumentation device. The

presence 1500-2000bp DNA fragment sizes point to that the amplification is achieved.

3.2.5 Assessment of technological performance of strains:

3.2.5.1 Preparation of fermented milk

Five liter pasteurized milk used for yoghurt production and milk powder with adding

(60g/L).

The mix was heated at 80ºC for 15 min in water bath, homogenized and then rapidly

cooled to 45ºC.

One % inocula (106 - 107 cfu/ml) of isolated yoghurt starters reactivated by incubation

in 10% (w/v) sterilized reconstituted skimmed milk and incubated at 37ºC for 18-24h

before experimentation involving pasteurized milk as the growth medium.

Each milk was inoculated with 5% (106 - 107 cfu/ml) of S.thermophilus, L.bulgaricus

and mixed yoghurt culture (1:1) with stirring after inoculation and incubated at 43oC

in a shaker water-bath for 8h.

Fiftty ml of samples were taken in aseptic sterile cups for microbiological and

biochemical tests every 1½-2hrs. The experiment was repeated 3 times.

3.2.5.2 Measurement of pH and titratable acidity

To measure the pH: Inserting the pH probe directly into a homogenized sample of the

fermented milk to determine pH.

Rinsing the electrode between samples with D.W and drying with tissue.

To determine the titratable acidity (lactic acid %): Titrating 1 ml of homogenized

fermented milk by 0.1 N NaOH using phenolphthalein indicator (0.1%, 3drops) with

continuously stirring until the indicator change to a definite pink colour lasting for 30

sec.

Recording the volume of NaOH required to neutralize the acidof yoghurt and calculate

the titratable acids using the following formula:

43

LA% = 10∗V NaOH ∗ 0.009∗0.1

𝑊∗ 100%

Where 10= Dilution factor; W=Weight of sample for titration; V NaOH= Volume of

NaOH used to neutralize the lactic acid; 0.1= Normality of NaOH (Arslan & Bayrakci,

2016).

44

Chapter 4

Results and Discussion

45

Chapter 4

Results and Discussion

4.1. Isolation and Biochemical identification of S. thermophilus and L. delbrueckii ssp.

bulgaricus:

In total six of cow’s traditional samples of home made yoghurt were used for the

isolation of yoghurt starters bacteria. Under anaerobic conditions at 42°C, bacterial cells were

isolated with MRS and M17 agar media for 3 days. M17 was used in order to isolate of S.

thermophilus and MRS was used in order to isolate of L. delbrueckii ssp. bulgaricus.

Has been observed under light microscope that the isolated strains gave blue- purple colour;

hence they were Gram positive bacteria. The morphology of the isolates coming from M17

plates were cocci with round or ovoid shape and it's appeared predominantly as pairs or

forming chains while the morphology of the isolates coming from MRS plates were long

bacilli with curved ends and it's appeared mostly as single or a chain of 3-4 cells. Light

microscopic images of cocci and bacilli isolates were given in Figure 4.1.

Figure 4.1: Microscopic appearance of cocci and bacilli isolates

46

The isolates were examined for catalase activity. Has been observed that all isolates

give a negative result with this test (no bubbles).

Additionally, when subjected to examine the gas production from glucose

fermentation and the test tubes left for 5 days, it was no observed gas accumulation in test

tubes. This means that tha isolates behave as homofermentative when ferment glucose.

With respect to the ability of isolates on growth at different concentrations of NaCl;

no record shows the ability of S.thermophilus growth even at 2% NaCl concentration but for

the isolates of bacilli, the most considerably used NaCl concentration was 4% and 6.5% for

identification. Bacilli isolates were sensitive to 4% and 6.5% NaCl concentration.

The ability of isolates on growth at different temperatures is another criterion for

classification. The ability of cocci isolates on growth at 10°C and 45°C were examined. S.

thermophilus were not able to grow at 10°C, but it grew well at 45°C. L. bulgaricus can't grow

at 15°C, but can grow at 45°C. Any that the isolates of cocci didn't show their ability to grow

at 10°C, also the isolates of bacilli didn't show their ability to grow at 15°C.

The worthiest examination to identify the differences among strains is carbohydrate

fermentation using API 50 CHL assays which allow the fermentation of 49 different sugars as

shown in table 4.1. The attained profile for the strains after the final reading can be identified

using ABIS online for bacterial identification.

After processing of the obtained results with software ABIS online, the strains

Lactobacillus and Streptococcus isolates were identified as Lactobacillus dekbrueckii ssp.

bulgaricus and Streptococcus thermophilus strains with high percentage of reliability.

According to MRS isolates, glucose, fructose, lactose and mannose were affirmative

with these isolates but with respect to S. thermophilus, the gathered data from different

studies show the variability of S. thermophilus for fermentation of sugars. It was noticed the

agreement all the scientists about affirmative fermentation of glucose, lactose and fructose

for S. thermophilus. In contrast mannose, galactose, sucrose, maltose, melibiose and

raffinose fermentations were variable. Consequently, in the estimation of data, affirmative

strains with glucose, lactose and fructose were specified to be S. thermophilus.

47

Table 4.1: Ability of the tested strains to utilize the 49 carbon sources included in

the identification system API50 CHL.

9 8 7 6 5 4 3 2 1 0 #

MDX ADO LXYL DXYL RIB LARA DARA ERY GLY NC SUGER

- - - - - - - - - - BACILLUS A1

- - - - - - - - - - BACILLUS A2

- - - - - - - - - - COCCUS B1

- - - - - - - - - - COCCUS B2

- - - - - - - - - - COCCUS B3

19 18 17 16 15 14 13 12 11 10 #

SOB MAN INO DUL RHA SBE MNE FRU GLU GAL SUGER

- - - - - - + + + - BACILLUS A1

- - - - - - + + + - BACILLUS A2

- - - - - - - - + + COCCUS B1

- - - - - - - - + - COCCUS B2

- - - - - - - + + + COCCUS B3

29 28 27 26 25 24 23 22 21 20 #

LAC MAL CEL SAL ESC ARB AMY NAG MDG MDM SUGER

+ - - - - - - + - - BACILLUS A1

+ - - - + - - + - - BACILLUS A2

+ - - - - - - + - - COCCUS B1

+ - - - - - - - - - COCCUS B2

+ - - - - - - - - - COCCUS B3

39 38 37 36 35 34 33 32 31 30 #

GEN XLT GLYG AMD RAF MLZ INU TRE SAC MEL SUGER

- - - - - - - - - - BACILLUS A1

- - - - - - - - - - BACILLUS A2

- - - - - - - - + - COCCUS B1

- - - - - - - - + - COCCUS B2

- - - - - - - - + - COCCUS B3

49 48 47 46 45 44 43 42 41 40 #

5KG 2KG GNT LARL DARL LFUC DFUC TAG LYX TUR SUGER

- - - - - - - - - - BACILLUS A1

- - - - - - - - - - BACILLUS A2

- - - - - - - - - - COCCUS B1

- - - - - - - - - - COCCUS B2

- - - - - - - - - - COCCUS B3

ABBREVIATIONS:

NC: NEGATIVE CONTROL, GLY:GLYCEROL, ERY: ERYTHRIOL,DARA: D-ARABINOSE, LARA: L-ARABINOSE, RIB: RIBOSE, DXYL: D-XYLOSE, LXYL: L-XYLOSE, ADO: ADONITOL, MDX: β-METIL-D-XYLOSIDE, GAL:

GALACTOSE, GLU: D-GLUCOSE, FRU: D-FRUCTOSE, MNE: D-MANNOSE, SBE: L-SORBOSE, RHA: RHMANOSE,

DUL: DULCITOL, INO: INOSITOL, MAN: MANNITOL, SOB: SORBITOL, MDM: α-METHYL-D-MANNOSIDE, MDG: α-METHYL-D-GLUCOSIDE, NAG: N-ACETYL-GLUCOSAMINE, AMY: AMIGDALIN, ARB: ARBUTIN, ESC:

ESCULIN, SAL: SALICIN, CEL: CELLOBIOSE, MAL: MALTOSE, LAC: LACTOSE, MEL: MELIBIOSE, SAC:

SACCAHROSE, TRE: L-TREHALOSE, INU: INULIN, MLZ: MELEZITOSE, RAF: D-RAFFINOSE, AMD: AMIDON,

GLYG: β-GLYCOGEN, XLT: XYLITOL, GEN: β-GENTIOBIOSE, TUR: D-TURANOSE, LYX: D-LYXOSE, TAG:

TAGAROSE, DFUC: D-FUCCOSE, LFUC: L-FUCCOSE, DARL: D-ARABITOL, LARL: L-ARABITOL, GNT:

GLUCONATE, 2KG: 2-KETO-GLUCONATE, 5KG: 5-KETO-GLUCONATE.

48

4.2: DNA Identification

Molecular approaches are proposed to emphasis the former results provided from the

physiological and biochemical assays to identify and diagnose Streptococci and Lactobacilli

isolates using PCR method and to achieve selective identification for proposed isolates. This

is realized by methionine biosynthesis gene and primers (cysmet2F and cysmet2R) to

identify the isolated strains of yoghurt samples. PCR method that used to amplify these

genes offer partial amplification of the methionine biosynthesis gene at 700 bp product in all

isolates as expected (Fig 4.2).

1kb

0.5kb

Figure 4.2: Partial amplification of the methionine biosynthesis gene in rural yoghurt isolates. Lanes

1, 2: Coccus B1, lanes 3,4: Coccus B2, Lanes 5, 6: Coccus B3, Lanes 7, 8: Bacillus A1, Lanes 9, 10:

Bacillus A2, NC: Negative control (no DNA control), M: 100 bp DNA ladder.

And to discriminate of lactobacilli from streptococci, this is realized by ARDRA

using endonucleases Eco RI. When we amplifying the 16S rRNA genes, the amplified

product was nearly 1500bp in all proposed isolates of lactobacilli and streptococci (Fig 4.3).

Then, the entire amplified product digested by Eco RI restriction enzyme. Two sizes of

lactobacilli were around 700,850bp whereas the two sizes of streptococci were around

650,850bp.

This is remarkable that supposed lactobacilli produced a different profile than that of

supposed streptococci when performing restriction analysis (Fig 4.4 a-b) and these result

agree with those obtained by Delley & Germond (2002).

NC 1 2 3 4 5 6 7

1 M 2 3 4 6 5 10 9 8

8

7

9 10 M

49

1.5kb

1kb 0.5kb

Figure 4.3: Amplification of 16S rRNA gene from isolates that amplified methionine biosynthesis

gene product. Lanes 1–4: Lactobacilli A1, A2 respectively, lanes 5-10: Streptococci B1, B2, B3

respectively, M: 100 bp DNA ladder.

1kb 0.5kb

Figure 4.4: Restriction analysis of 16S rRNA gene with Eco RI. (1 - 4) Restriction analysis of 16S

rRNA gene with Eco RI for Lactobacilli A1, A2 respectively (5 -10) Restriction analysis of 16S rRNA

gene with Eco RI for Streptococci B1, B2, B3 respectively, M: 100 bp DNA ladder.

This study seeks just to identify yoghurt starters. As stated in studies the amplicons

of the methionine biosynthesis genes display also in L.lactis and L.helveticus thus, it is

needed for discrimination of these cells. The discrimination of L.bulgaricus, L.lactis and

L.helveticus, attained by ARDRA as informed by Delley & Germond (2002).

This study offered here quick, selective identification of L.bulgaricus and S. thermophilus

from blended cultures using a specific PCR method of methionine biosynthesis gene and

restriction analysis method of 16S rRNA gene using Eco RI.

2

M

3

1

3

4

2

5

4

5

6

6

7

8

8

7

9

9

10

10 1

M

50

4.3: Assessment of technological performance of strains

4.3.1: Microbiological analysis

4.3.1.1 The viable counts of starter cultures during fermentation

The Changes in viable counts of the isolated strains a long fermentation period are

presented in table 4.2 and figures 4.5 to 4.10. These numbers, before fermentation, were

approximately similar at the initial counts for the inoculated raw milk and still stable with

minor increases after 2 h of incubation. The populations of starters for all cultures throughout

fermentation times became greater than before and L.bulgaricus A2 manifests the fastest

growing among all single cultures. Furthermore, counts of L.bulgaricus A2 at any estimated

time interval were often more numerous than the other single strains while those counts of S.

thermophilus B1 were least numerous. According to the blends of L. bulgaricus plus S.

thermophilus (A1:B3) at 8 h, the end of the fermentation process, it shown more counts

compared with single & other blends of isolates. Abu-Tarboush (1996) opposed this finding,

he stated that the lactobacilli were always less numerous than the streptococci during

fermentation of camel milk for 4h at 42ºC. In contrast, Lore et al. (2005) researched the total

LAB counts in suusac (Kenyan traditional fermented camel milk) were 6.8 log10 cfu/ml and

the prominent genus was Lactobacillus ssp. Likewise, Abdel Moneim et al. (2006) have stated

the main genus was Lactobacillus in garris product (Sudanese traditional fermented camel

milk).

Table 4.2: The changes on the viable counts of the starter culture strains during

fermentation of milk for 8h at 42ºC.

Isolated strains Viable counts of the starter culture strains

(log10 cfu-ml)

0h 2h 4h 6h 8h

Lb. bulgaricus A1 3.95 4.04 5.41 6.30 7.61

Lb. bulgaricus A2 4.54 4.61 5.65 6.90 8.03

S. thermophilus B1 4.39 4.66 5.05 5.80 6.71

S. thermophilus B2 4.61 4.82 5.32 6.43 7.26

S. thermophilus B3 4.11 4.48 5.51 6.68 7.52

Mix ( A1 : B1 ) 4.70 4.95 6.05 7.48 8.20

Mix ( A1 : B2 ) 4.63 4.91 6.39 7.64 7.91

Mix ( A1 : B3 ) 4.76 5.02 6.18 7.61 8.33

Mix ( A2 : B1 ) 3.93 4.33 6.30 7.07 7.61

Mix ( A2 : B2 ) 3.98 4.53 6.54 7.34 8.05

Mix ( A2 : B3) 4.84 4.91 5.57 7.12 8.02

51

Figure 4.5: Changes in the viable counts of the starter L.bulgaricus A1,

S.thermophilus B1 & combination of L. bulgaricus plus S thermophilus (1: 1) during fermentation of raw milk for 8h at 42ºC.


S.thermophilus B2 & combination of L.bulgaricus plus S.thermophilus (1:1) during fermentation of raw milk for 8h at 42ºC.

0

1

2

3

4

5

6

7

8

9

0 2 4 6 8 10

L.bulgaricus A1

S.thermophilus B1

Mix (A1:B1)

Log

CFU

/ml

Time

0

1

2

3

4

5

6

7

8

9

0 2 4 6 8 10

L.bulgaricus A1

S.thermophilus B2

Mix (A1:B2)

Log

CFU

/ml

Time

52





0

1

2

3

4

5

6

7

8

9

0 2 4 6 8 10

L.bulgaricus A1

S.thermophilus B3

Mix (A1:B3)

Log

CFU

/ml

Time

0

1

2

3

4

5

6

7

8

9

0 2 4 6 8 10

L.bulgaricus A2

S.thermophilus B1

Mix (A2:B1)

Log

CFU

/ml

53





0

1

2

3

4

5

6

7

8

9

0 2 4 6 8 10

L.bulgaricus A2

S.thermophilus B2

Mix (A2:B2)

Log

CFU

/ml

Time

0

1

2

3

4

5

6

7

8

9

0 2 4 6 8 10

L.bulgaricus A2

S.thermophilus B3

Mix (A2:B3)

Log

CFU

/ml

Time

54

4.3.2: Biochemical analysis

4.3.2.1: Changes in the Total acidity and pH

Tables (4.3 - 4.4) and figures (4.11 to 4.22) show the changes in pH and total titratable

acidity (% lactic acid) at 43ºC of the raw milk contained isolated strains of starter at difference

times. The decline in pH accompanied by a rise in the percentage of lactic acid which produced

with an increase in fermentation time. The results manifest that the raw milk fermented by the

blending L. bulgaricus plus S. thermophilus (1:1) gave higher acidity and lower pH comparing

with the isolated cultures alone. Rajagopal and Sandine (1990) and Carrasco et al. (2005)

agree these results, they stated that the pH for blend cultures were much lower than those for

the pure cultures. Also when Abu-Tarboush (1996) studied the action of various strains of

commercial cultures in whole camel milk, he displayed that the last pH of the blends L.

bulgaricus 12 with the other isolates of S. thermophilus gave lower pH comparing with isolates

alone at 42ºC for 4h. The existing results here show that the pH of the fermented raw milk by

the isolated starters ranged from 4.20 to 4.98 which is compatible with (Lore et al., 2005)

results that described in suusac (pH 4.30), but higher than the results described in garris (pH

3.25 - 3.40) a Sudanese traditional fermented camel milk.

Table 4.3: Effect of culture composition on acidification characteristics of pure &

mixed cultures grown on milk at different times on 42ºC.

Isolated strains

pH during incubation time

0h 2h 4h 6h 8h 24h

Lb. bulgaricus A1 6.39 6.28 5.90 5.44 4.98 4.88

Lb. bulgaricus A2 6.39 6.24 5.86 4.73 4.71 4.67

S. thermophilus B1 6.39 6.33 5.73 5.17 4.88 4.80

S. thermophilus B2 6.40 6.38 6.11 5.29 5.01 4.98

S. thermophilus B3 6.38 6.35 6.05 5.15 4.99 4.85

Mix (A1:B1) 6.39 5.99 5.45 4.88 4.68 4.64

Mix (A1:B2) 6.39 6.20 4.90 4.71 4.63 4.57

Mix (A1:B3) 6.40 6.21 5.16 4.83 4.67 4.61

Mix (A2:B1) 6.40 6.12 5.02 4.83 4.67 4.40

Mix (A2:B2) 6.41 6.14 5.10 4.61 4.58 4.50

Mix (A2:B3) 6.39 6.17 4.93 4.41 4.38 4.20

55

Figure 4.11: Changes in the pH of the starter L.bulgaricus A1, S.thermophilus B1 &

combination of L.bulgaricus plus S.thermophilus (1:1) during fermentation of raw milk at different times on 42ºC.


combination of L.bulgaricus plus S.thermophilus (1:1) during fermentation of raw

milk at different times on 42ºC.

0

1

2

3

4

5

6

7

0 5 10 15 20 25 30

L.bulgaricus A1

S.thermophilus B1

Mix (A1:B1)

pH

Time

0

1

2

3

4

5

6

7

0 5 10 15 20 25 30

L.bulgaricus A1

S.thermophilus B2

Mix (A1:B2)

pH

Time

56







0

1

2

3

4

5

6

7

0 5 10 15 20 25 30

L.bulgaricus A1

S.thermophilus B3

Mix (A1:B3)

pH

Time

0

1

2

3

4

5

6

7

0 5 10 15 20 25 30

L.bulgaricus A2

S.thermophilus B1

Mix (A2:B1)

pH

Time

57





0

1

2

3

4

5

6

7

0 5 10 15 20 25 30

L.bulgaricus A2

S.thermophilus B2

Mix (A2:B2)

pH

Time

0

1

2

3

4

5

6

7

0 5 10 15 20 25 30

L.bulgaricus A2

S.thermophilus B3

Mix (A2:B3)

pH

Time

58

Table 4.4: Effect of culture composition on Total acidity of pure & mixed cultures

grown on milk at 42ºC.

Total acidity during incubation time

Isolated strain 6h 4.5h 3h 1.5h 0h

1.20 0.70 0.48 0.44 0.17 Lb. bulgaricus A1

1.38 1.18 0.50 0.40 0.17 Lb. bulgaricus A2

0.51 0.31 0.23 0.19 0.18 S. thermophilus B1

0.47 0.36 0.27 0.22 0.18 S. thermophilus B2

0.63 0.44 0.31 0.24 0.18 S. thermophilus B3

1.66 0.84 0.54 0.44 0.17 Mix (A1:B1)

1.88 0.12 0.60 0.54 0.17 Mix (A1:B2)

1.76 1.36 0.78 0.54 0.17 Mix (A1:B3)

1.90 1.32 0.74 0.52 0.18 Mix (A2:B1)

1.84 1.46 0.66 0.54 0.18 Mix (A2:B2)

2.80 1.80 1.16 0.48 0.17 Mix (A2:B3) .

Figure 4.17: Changes in total titratable acidity of the starter L.bulgaricus A1, S.thermophilus

B1 & combination of L.bulgaricus plus S.thermophilus (1:1) during fermentation of raw milk for 6h at 42ºC.

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

0 1 2 3 4 5 6 7

L.bulgaricus A1

S.thermophilus B1

Mix (A1:B1)

59

Figure 4.18: Changes in total titratable acidity of the starter L.bulgaricus A1,


Figure 4.19: Changes in total titratable acidity of the starterculture L.bulgaricus A1,


0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

0 1 2 3 4 5 6 7

L.bulgaricus A1

S.thermophilus B2

Mix (A1:B2)

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

0 1 2 3 4 5 6 7

L.bulgaricus A1

S.thermophilusB3

60

Figure 4.20: Changes in total titratable acidity of the starter culture L.bulgaricus A2,




0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

0 1 2 3 4 5 6 7

L.bulgaricus A2

S.thermophilus B1

Mix (A2:B1)

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

0 1 2 3 4 5 6 7

L.bulgaricus A2

S.thermophilus B2

Mix (A2:B2)

61



0

0.5

1

1.5

2

2.5

3

0 1 2 3 4 5 6 7

L.bulgaricus A2

S.thermophilus B3

Mix (A2:B3)

62

Chapter 5

Conclusions and

Recommendations

63

Chapter 5

Conclusions and Recommendations

Two isolates of L.delbrueckii ssp. bulgaricus and S.thermophilus are selected to

produce starters. These starters with low cost can be used in production of yoghurt at small

and large scale.

The overall data proved the need to conjoint phenotypic and molecular methods for

identifying natural yoghurt starters L.bulgaricus and S.thermophilus which are often

imprecisely identified by phenotypic and biochemical tests only. PCR-ARDRA is

recommended as the tool of choice for identification of homofermentative thermophilic dairy

species or subspecies. The distinguish between isolated cultures by PCR-ARDRA can be used

in combination along with API 50 CHL.

After testing and assessing the isolated strains on yoghurt production, the data

indicated that certain microbial and biochemical changes happen during fermentation of milk.

The results showed that microorganisms differed in growth, acid production and titratable

acidity. Generally, mixed yoghurt culture manifest superior growth, acid production and

titratable acidity than single starter cultures.

Ultimately, Identification the starters of yoghurt, in fact, is the first step for using these

starters in dairy industry. Thus, it should also be screened for their technological parameters.

Technological parameters basically include acidifying activity, aroma compounds production

particularly acetaldehyde and diacetyl, EPS production and resist to bacteriophage invasion.

Determination of such characteristics would be helpful for industrial applications in the future.

Analysis of yoghurt starters are a complicated process and the use of various

techniques, especially molecular-based phenotypic or genomic techniques, are recommended.

64

References

65

The References List

Abdel Moneim ES, Abdalla, AI and Ahmed, EE (2006). Chemical and microbiological

quality of Garris, Sudanese fermented camel's milk product. International Journal of

Food Science Technology, (41): 321-328.

Abu-Tarboush HM (1996). Comparison of associative growth of yogurt starter in whole

milk from camels and cows. Journal of Dairy Science, (79): 366-371.

Ali, A. A. (2011). Isolation and Identification of lactic acid bacteria isolated from

traditional drinking yoghurt in Khartoum State, Sudan. Current Research in

Bacteriology, 4(1), 16-22.

Amanze, K. O., & Amanze, J. O. (2011). Quality evaluation of yoghurt from cowmilk,

soymilk and cow/soymilk. Journal of Research and National Development, 9(2), 44-

47.

Angelov, M., Kostov, G., Simova, E., Beshkova, D., & Koprinkova-Hristova, P. (2009).

Proto-cooperation factors in yogurt starter cultures. Revue Genie Industruiel , (3), 4-

12.

Angelov, M., Kostov, G., Simova, E., Beshkova, D., & Koprinkova-Hristova, P. (2009).

Oxygen influence in the mutual metabolism of S. thermophilus and Lb. bulgaricus in

yogurt starter cultures. Revue Genie Industruiel , (3), 13-23.

Anukam, K. C., & Reid, G. (2007). Probiotics: 100 years (1907-2007) after Elie

Metchnikoff’s observation. Communicating current research and educational topics

and trends in applied microbiology, 1, 466-474.

Arslan, S., & Bayrakci, S. (2016). Physicochemical, functional, and sensory properties of

yogurts containing persimmon. Turkish Journal of Agriculture and Forestry, 40(1),

68-74.

Batmanglij, N. (2007). A taste of Persia: an introduction to Persian cooking. IB Tauris.

Caplice, E., & Fitzgerald, G. F. (1999). Food fermentations: role of microorganisms in

food production and preservation. International journal of food microbiology, 50(1),

131-149.

Carrasco MS, Scarinci EH, Simonetta AC (2005). Associative growth of lactic acid

bacteria for cheese starter: Acidifying and proteolytic activities and redox potential

development. Journal of Food and Agriculture Environment, 3(2): 116-119

Chagnaud, P., Machinis, K., Coutte, L. A., Marecat, A., & Mercenier, A. (2001). Rapid

PCR-based procedure to identify lactic acid bacteria: application to six common

Lactobacillus species. Journal of Microbiological Methods, 44(2), 139-148.

66

Chandan, R. C. (2014). 18 Dairy–Fermented Products. Food Processing: Principles and

Applications, Seconed Edition, 405-436.

Chandan, R. C., & O’Rell, K. R. (2006). Principles of yogurt processing (pp. 195-197).

Oxford, England: Blackwell Publishing.

Chandan, R. C., & Nauth, K. R. (2012). Chapter 12: Yogurt. YH Hui (Administrative

Associate Ed), EO Evranuz (Associate Ed), RC Chandan, L Cocolin, EH Drosinos, L

Goddick, A Rodrigues, F Toldra (Eds), Handbook of Animal-Based Food and

Beverage Technology. CRC Press, Boca Raton, FL, 213-233.

Chandan, R. C., & Shahani, K. M. (1995). Other fermented dairy products. Biotechnology

Set, Second Edition, (9), 385-418.

Coeuret, V., Dubernet, S., Bernardeau, M., Gueguen, M., & Vernoux, J. P. (2003).

Isolation, characterisation and identification of lactobacilli focusing mainly on cheeses

and other dairy products. Le Lait, 83(4), 269-306.

Courtin, P., & Rul, F. (2004). Interactions between microorganisms in a simple ecosystem:

yogurt bacteria as a study model. Le Lait, 84(1-2), 125-134.

Deasy, B. M., Rea, M. C., Fitzgerald, G. F., Cogan, T. M., & Beresford, T. P. (2000). A

rapid PCR based method to distinguish between Lactococcus and

Enterococcus. Systematic and Applied Microbiology, 23(4), 510-522.

Dellaglio, F., & Felis, G. E. (2005). Taxonomy of lactobacilli and

bifidobacteria. Probiotics and prebiotics: scientific aspects, 25-50. Edited by G.W.

Tannock, Caister Academic press, Norfolk, UK.

Delley, M., & Germond, J. E. (2002). Differentiation of Lactobacillus helveticus,

Lactobacillus delbrueckii subsp bulgaricus, subsp lactis and subsp delbrueckii Using

Physiological and Genetic Tools and Reclassification of some Strains from the ATCC

Collection. Systematic and applied microbiology, 25(2), 228-231.

Donovan, M. (2006). On food and cooking: the science and lore of the kitchen.

Gastronomica, 6(4),117.

Donovan, S. M., & Shamir, R. (2014). Introduction to the yogurt in nutrition initiative and

the First Global Summit on the health effects of yogurt. The American journal of

clinical nutrition, 99(5), 1209S-1211S.

Doyle, M. P., & Meng, J. (2006). Bacteria in food and beverage production. In The

prokaryotes (pp. 797-811). Springer New York.

Drake, M., Small, C. L., Spence, K. D., & Swanson, B. G. (1996). Rapid detection and

identification of Lactobacillus spp. in dairy products by using the polymerase chain

reaction. Journal of Food Protection, 59(10), 1031-1036.

67

Driessen, F. M., Kingma, F., & Stadhouders, J. (1982). Evidence that Lactobacillus

bulgaricus in yogurt is stimulated by carbon dioxide produced by Streptococcus

thermophilus. Netherlands Milk and Dairy Journal (Netherlands), (36),135-144.

Durso, L., Hutkins, R., 2003. “Starter Cultures”, in Encyclopedia of Food Science and

Nutrition, edited by B. Caballero, L. Trugo, P. Finglas (Academic Press, United

Kingdom), pp. 5583-5593.

El Bashiti, T. (2010). Production of Yogurt by locally isolated starters: Streptococcus

thermophilus and Lactobacillus bulgaricus. Journal of Al Azhar University–Gaza, 12,

56-58.

Erkmen, O., & Bozoglu, T. F. (2016). Food Microbiology: Principles into Practice. John

Wiley & Sons.

Erkuş, O. (2007). Isolation, phenotypic and genotypic charecterization of yoghurt starter

bacteris (Master’s Thesis, Izmir Institute of Technology).

Estrada, A., Coates Estrada, R., Meritt Jr, D., Bojic Bultrini, D., Klein, A. M., Steffan

Dewenter, I., ... & Argenti, O. (2011). World livestock 2011: livestock in food

security (No. FAO 363.8 W927 2011). FAO, Roma (Italia).

Fisberg, M., & Machado, R. (2015). History of yogurt and current patterns of

consumption. Nutrition reviews, 73(suppl 1), 4-7.

Flint, S. H., Ward, L. J., & Brooks, J. D. (1999). Streptococcus waius sp. nov., a

thermophilic streptococcus from a biofilm. International Journal of Systematic and

Evolutionary Microbiology, 49(2), 759-767.

Forbes, B. A., Sahm, D. F., Weissfeld, A. S., Scott, E. G., & Bailley, W. R. (2002).

Diagnostic microbiology. Bailey & Scott1s Diagnostic Microbiology, 11(1), 11-14.

Fortina, M. G., Ricci, G., Mora, D., Parini, C., & Manachini, P. L. (2001). Specific

identification of Lactobacillus helveticus by PCR with pepC, pepN and htrA targeted

primers. FEMS microbiology letters, 198(1), 85-89.

Gandhi, D. N. (2006). Food and Industrial Microbiology: Microbiology of Fermented

Dairy Products. Principal Scientist Dairy Microbiology Division National Dairy

Research Institute, Karnal.

Giraffa, G., De Vecchi, P., & Rossetti, L. (1998). Note: identification of Lactobacillus

delbrueckii subspecies bulgaricus and subspecies lactis dairy isolates by amplified

rDNA restriction analysis. Journal of Applied Microbiology, 85(5), 918-918.

Grobben, G. J., Smith, M. R., Sikkema, J., & De Bont, J. A. M. (1996). Influence of

fructose and glucose on the production of exopolysaccharides and the activities of

enzymes involved in the sugar metabolism and the synthesis of sugar nucleotides in

68

Lactobacillus delbrueckii subsp. bulgaricus NCFB 2772. Applied Microbiology and

Biotechnology, 46(3), 279-284.

Hammes, W. P., & Vogel, R. F. (1995). The genus lactobacillus. In The genera of lactic

acid bacteria (pp. 19-54). Springer, Boston, MA.

Harrigan, W. F., & McCance, M. E. (1976). Laboratory methods in food and dairy

microbiology. Academic Press Inc.(London) Ltd.

Hébert, E. M., Raya, R. R., Tailliez, P., & de Giori, G. S. (2000). Characterization of

natural isolates of Lactobacillus strains to be used as starter cultures in dairy

fermentation. International journal of food microbiology, 59(1), 19-27.

https:// www.microbewiki.kenyon.edu/index.php/yogurt.

Hutkins, R. W. (2008). Microbiology and technology of fermented foods (Vol. 22). John

Wiley & Sons.

Igarashi, T., Yamamoto, A., & Goto, N. (1996). Direct detection of Streptococcus mutans

in human dental plaque by polymerase chain reaction. Oral microbiology and

immunology, 11(5), 294-298.

Kermanshahi, R. K., & Peymanfar, S. (2012). Isolation and identification of lactobacilli

from cheese, yoghurt and silage by 16S rDNA gene and study of bacteriocin and

biosurfactant production. Jundishapur journal of Microbiology, 5(4), 528-532.

Khaled, A. D., Neilan, B. A., Henriksson, A., & Conway, P. L. (1997). Identification and

phylogenetic analysis of Lactobacillus using multiplex RAPD-PCR. FEMS

microbiology letters, 153(1), 191-197.

Kilara, A., & Chandan, R. C. (2013). Greek‐style yogurt and related

products. Manufacturing Yogurt and Fermented Milks, 297-318.

Kosikowski, F., & Mistry, V. V. (1977). Cheese and fermented milk foods.

Kristo, E., Biliaderis, C. G., & Tzanetakis, N. (2003). Modelling of the acidification

process and rheological properties of milk fermented with a yogurt starter culture using

response surface methodology. Food Chemistry, 83(3), 437-446.

Lore TA, Mbugua SK, Wangoh J (2005). Enumeration and identification of microflora in

Suusac, a Kenyan traditional fermented camel milk product. Lebensmittel-

Wisseschaft Technol. 38(2): 125-130.

Louailèche, H., Bracquart, P., Guimont, C., & Linden, G. (1996). Carbon dioxide fixation

by cells and cell-free extracts of. Journal of dairy research, 63, 321-325.

69

Louaileche, H., Bracquart, P., Saulnier, F., Desmazeaud, M., & Linden, G. (1993). Carbon

dioxide effects on the growth and metabolites of morphological variants of

Streptococcus thermophilus. Journal of dairy science, 76(12), 3683-3689.

Mac Faddin, J. F. (1976). Biochemical tests for identification of medical bacteria.

Williams & Wilkins Co.

Markiewicz, L. H., Wasilewska, E., & Bielecka, M. (2008). Identification of Lactobacillus

strains present in fermented dairy products and their differentiation using molecular

methods. Polish Journal of Food and Nutrition Sciences, 58(2).

Marshall, V. M. (1987). Lactic acid bacteria: starters for flavour. FEMS Microbiology

Reviews, 3(3), 327-336.

Mathara, J. M., Schillinger, U., Kutima, P. M., Mbugua, S. K., & Holzapfel, W. H. (2004).

Isolation, identification and characterisation of the dominant microorganisms of kule

naoto: The Maasai traditional fermented milk in Kenya. International journal of food

microbiology, 94(3), 269-278.

Mirghani AA (1994). Micrbiological and biochemical properties of fermented camel milk

(gariss). M.Sc. Thesis. University of Khartoum. Sudan.

Moreno, A. L., Cervera, R. P., Ortega, A. R., Díaz, M. J., Baladia, E., Basulto, J., ... &

Rodríguez, R. E. (2012). [Scientific evidence about the role of yogurt and other

fermented milks in the healthy diet for the Spanish population]. Nutricion

hospitalaria, 28(6), 2039-2089.

Papadelli, M., Manolopoulou, E., Kalantzopoulos, G., & Tsakalidou, E. (2003). Rapid

detection and identification of Streptococcus macedonicus by species-specific PCR

and DNA hybridisation. International journal of food microbiology, 81(3), 231-239.

Quere, F., Deschamps, A., & Urdaci, M. C. (1997). DNA probe and PCR-specific reaction

for Lactobacillus plantarum. Journal of Applied Microbiology, 82(6), 783-790.

Rajagopal, S. N., & Sandine, W. E. (1990). Associative growth and proteolysis of

Streptococcus thermophilus and Lactobacillus bulgaricus in skim milk. Journal of

dairy science, 73(4), 894-899.

Schmidt, K. A. (2004). Dairy: Ice cream. Food processing–Principles and applications,

287-296.

Sfakianakis, P., & Tzia, C. (2014). Conventional and innovative processing of milk for

yogurt manufacture; development of texture and flavor: a review. Foods, 3(1), 176-

193.

Sharpe, M. E., Fryer, T. F., & Smith, D. G. (1979). Identification of the lactic acid

bacteria. Identification methods for microbiologists, 157, 233-259.

70

Soukoulis, C., Panagiotidis, P., Koureli, R., & Tzia, C. (2007). Industrial yogurt

manufacture: monitoring of fermentation process and improvement of final product

quality. Journal of dairy science, 90(6), 2641-2654.

Tabasco, R., Paarup, T., Janer, C., Peláez, C., & Requena, T. (2007). Selective

enumeration and identification of mixed cultures of Streptococcus thermophilus,

Lactobacillus delbrueckii subsp. bulgaricus, L. acidophilus, L. paracasei subsp.

paracasei and Bifidobacterium lactis in fermented milk. International Dairy

Journal, 17(9), 1107-1114.

Tamime, A. Y. (1997). Some aspects of the production of yoghurt and condensed

yoghurt (unpublished Doctoral dissertation, University of Reading).

Tamime, A. Y., & Robinson, R. K. (1999). Microbiology of yoghurt and “bio” starter

cultures. Yoghurt science and technology, 2, 389-431.

Tamime, A. Y., & Robinson, R. K. (2007). Ch. 2, Background to manufacturing

practice. Tamime and Robinson's yoghurt: science and technology, (Ed. 3), 13-161.

Tammam, J. D., Williams, A. G., Noble, J., & Lloyd, D. (2000). Amino acid fermentation

in non‐starter Lactobacillus spp. isolated from Cheddar cheese. Letters in applied


Tanigawa, K., & Watanabe, K. (2011). Multilocus sequence typing reveals a novel

subspeciation of Lactobacillus delbrueckii. Microbiology, 157(3), 727-738.

Tilsala-Timisjärvi, A., & Alatossava, T. (1997). Development of oligonucleotide primers

from the 16S-23S rRNA intergenic sequences for identifying different dairy and

probiotic lactic acid bacteria by PCR. International journal of food


Trachoo, N. (2002). Yogurt: The fermented milk. Songklanakarin J. Sci. Technol, 24(4),

726-736.

Vadeboncoeur, C., & Moineau, S. (2004). The relevance of genetic analysis to dairy

bacteria: building upon our heritage. Microbial cell factories, 3(1), 15.

Vaningelgem, F., Zamfir, M., Adriany, T., & De Vuyst, L. (2004). Fermentation

conditions affecting the bacterial growth and exopolysaccharide production by

Streptococcus thermophilus ST 111 in milk‐based medium. Journal of applied

microbiology, 97(6), 1257-1273.

Vaningelgem, F., Zamfir, M., Mozzi, F., Adriany, T., Vancanneyt, M., Swings, J., & De

Vuyst, L. (2004). Biodiversity of exopolysaccharides produced by Streptococcus

thermophilus strains is reflected in their production and their molecular and functional

characteristics. Applied and environmental microbiology, 70(2), 900-912.

71

Vedamuthu, E. R. (2006). Starter cultures for yogurt and fermented milks. Manufacturing

yogurt and fermented milks, 89.

Ward, L. J., Brown, J. C., & Davey, G. P. (1998). Two methods for the genetic

differentiation of Lactococcus lactis ssp. lactis and cremoris based on differences in

the 16S rRNA gene sequence. FEMS microbiology letters, 166(1), 15-20.

Weerathilake, W. A. D. V., Rasika, D. M. D., Ruwanmali, J. K. U., & Munasinghe, M. A.

D. D. (2014). The evolution, processing, varieties, and health benefits of

yoghurt. International Journal of Scientific and Research Publications, 4(4), 1-10.

White, C. H., Kilara, A., & Hui, Y. H. (2008). Manufacturing yogurt and fermented milks.

R. C. Chandan (Ed.). John Wiley & Sons.

Zhang, T., Zhang, C., Li, S., Zhang, Y., & Yang, Z. (2011). Growth and

exopolysaccharide production by Streptococcus thermophilus ST1 in skim

milk. Brazilian Journal of Microbiology, 42(4), 1470-1478.

72

Appendixes

73

APPENDIX A

Recipes for Culture Media and Biochemical Tests

Table (A.1): MRS medium

g/l Ingredients

10.0 Peptone

10.0 Meat extract

5.0 Yeast Extract

20.0 D(-) Glucose

1ml Tween 80

2 K2HPO4

5.0 Sodium acetate

2.0 Triammonium citrate

0.2 MgSO4.7H2O

0.05 MnSO4.4H2O

Modified MRS Broth For Testing The Growth At Different NaCl

Concentrations

0.04 Bromocresol purple

20,40,65 for the concentration of 2%,

4% and 6.5%

NaCl

Modified MRS Broth For Testing The Growth At Different Temperatures


MRS Agar

15 Agar

Final pH: 6.3

74

Table (A.2): M17 medium

g/l Ingredients

5.0 Peptone from soymeal

2.5 Peptone from meat

2.5 Peptone from casein

2.5 Yeast extract

5.0 Meat extract

5.0 Lactose monohydrate

0.5 Ascorbic acid

19.0 Sodium β-glycerophosphate

0.25 Magnesium sulfate

Modified M17 Broth For Testing The Growth At NaCL concentations


20,40 for the concentration of 2% and

4%

NaCl

Modified M17 Broth For Testing The Growth At Different Temperatures


M17 agar

12.75 Agar

Final pH: 6.9

75

APPENDIX B Isolation of Genomic DNA from Gram positive and Gram negative bacteria

76

APPENDIX C

C1: Buffers and Stock Solutions for Molecular Characterization

1X TAE

20ml of 50 X TAE buffer was taken and the volume was adjusted to 1 L with

deionized water. The 1x working solution was 40 mM Tris-acetate/1 mM EDTA.

Ethidium Bromide Stock Solution (10mg/ml)

0.5g ethidium bromide was dissolved in 50ml deionized water and the solution

was stored in dark bottle at room temperature.

C2: PCR recipes

PCR Mixture

Mg free Taq DNA polymerase buffer 5μl

MgCl2 (25Mm) 3μl

Sterile deionized water 32μl

Oligo forward 10 picomole/μl 1μl

Oligo reverse 10 picomole/μl 1μl

dNTP (2 mM each) 5μl

dNTP (10X)

Twenty microliters of each 100mM dATP, dCTP, dGTP, and dTTP are taken and mixed in

an eppendorf tube. 920μl of sterile deionized water was added to a final concentration of

2mM. Solution was mixed gently and stored at -20°C.

C3: Restriction Enzymes Used for Molecular Characterization

Restriction Enzyme Reaction Mixture

Restriction enzyme buffer 5μl

Sterile deionized water 34.5μl

Restriction Enzyme 0.5μl (from 5U)

DNA 10μl

isolation, biochemical characterization and dna ... · isolation, biochemical characterization and...

Documents