introduc)on*to*molecular*biology*...
TRANSCRIPT
Introduc)on to Molecular Biology and Bioinforma)cs Workshop
Biosciences eastern and central Africa -‐ Interna2onal Livestock Research Ins2tute Hub (BecA-‐ILRI Hub), Nairobi, Kenya
May 11-‐22, 2015
Francesca Stomeo Capacity Building Scien2st, BecA-‐ILRI Hub
• Introduc2ons • Lab groups • General informa2on • Objec2ves • Workshop
- Objec2ves - DNA Barcoding - Workshop plan
• Lab manual
Content
Introduc2ons • Resource persons
– Val Aloo • Health and safety trainer
– Ephy Khaemba • Mol Biol Lab trainers
– Moses Njahira – Eunice Machuka – Mercy Macharia – Pauline Asami – Sarah Osama – Tina Kyalo
• Par)cipants: name; posi2on; ins2tute; country; your expecta2ons of
the workshop; how you plan to use the acquired skills in your research
• BFX trainers – Joyce Njuguna – Dr Mark Wamalwa – Dedan Githae – Tina Kyalo
• SegoliP Unit – Ben Kiawa
• Lab Management - Julius Osaso
Simba (lion) Tutor: Moses Njahira 1. Cecelia Dak Padiet Akol 2. Cynthia Nyunja 3. Abdirahim Mohamed Ahmed 4. Ismail Abdelrahim Abaker
Mohamed 5. Odoch Terence Amoki 6. Doreen Asiimwe Buhwa
Swara (gazelle) Tutor: Dr Roger Pelle/Eunice Machuka Francophone 1. Rasolondravoavy Charles 2. Ache Neh Acha 3. Andry Herizo Rasolomaharavo 4. Adama Sow 5. Laibane’ Dieudonne’ Dahourou 6. Abakar Mahamat Fayiz 7. Christelle Dassi 8. Assamoi Jean-‐Bap2ste
Animal
Muhogo (cassava) Tutor: Pauline Asami 1. Yaqub Ali Moalim 2. Shukuru Baha2 3. Geoffrey O2m 4. Becky Aloo 5. Yewubdar Shewaye Ishetu 6. Esperance Munganyinka
Kunde (cowpea) Tutor: Mercy Macharia/Sarah Osama 1. Emmanuel Afutu 2. Eblate Ernest Mjingo 3. Yakobo Lema 4. Jus2ne Assenga 5. Gloria Ivy Mensah 6. Mi2ma Kashosi Theophile
Plant Lab Groups
Addi2onal trainees for BFX: 1. Ben Kiawa
Addi2onal trainer 1. Tina Kyalo
• Please be punctual • Bus leaves Pride Inn at 0745 each day • Strictly observe 2mes for breaks and lunch
• Always wear your badge on campus • Few lab access cards available • Molecular biology: Lab 4 – Mon 11th to Sat 16th • Bioinforma2cs: JVC – Mon 18th to Fri 22nd
• Travel/accommoda2on/per diem/health: Val Aloo • Course issues: Francesca Stomeo/ Wellington Ekaya or your group tutor
• Wireless internet available throughout campus • IMBB workshop website:
hhp://hpc.ilri.cgiar.org/beca/training/IMBB_2015/welcome.html
General Informa2on
• Do not leave laptops or personal effects unahended • Phones on silent • Avoid taking calls in the laboratory and lectures
• Tea/coffee in tent • Lunch at poolside • Breakfast and dinner at Pride Inn • Bathrooms • Bus leaves from ILRI recep2on
• Dinner on Saturday 16th, 1600-‐1830 • Rest Day on Sunday 17th • BBQ Dinner at ILRI on Friday 22tnd, 1800-‐2000
• Security
General Informa2on
• Make the workshop interac2ve
• Don’t be afraid to ask ques2ons. Asking ques2ons is not a sign of stupidity! Those who ask lots of ques2ons will gain more from the workshop.
• All par2cipants will be expected to ‘present’ their group results and discuss them.
• We will have a QUIZ at end of each day: be prepared to answer ques2ons and to ask ques2ons.
• Keep a laboratory note book: A4 hardback notebook is provided. Keep it up to date. Record everything you do in the lab as you do it, methods, your thoughts and ideas, your results, and interpreta2on of results. We will display examples of par2cipants’ lab books during the workshop.
General Informa2on
No One Leo Behind! • Support each other in your group! • Everyone on the bus!
All posters to be submiNed to Val Aloo by end of today!
Workshop
Workshop objec2ves
• Provide prac2cal skills and concepts in basic molecular biology and bioinforma2cs
• Experience the discovery process as a team • Provide skills to establish basic molecular biology and bioinforma2cs
at your home ins2tute • Understand basic concepts of molecular biology and bioinforma2cs
for understanding various contemporary areas of research and their applica2ons and for communica2ng with other researchers in these fields
• Help establish links between researchers and with BecA
DNA barcoding: a new diagnos2c tool for rapid species recogni2on, iden2fica2on, and discovery. DNA barcoding is based on a simple concept. DNA barcoding is a taxonomic method that uses a specific short gene2c marker in an organism's DNA to iden2fy it as belonging to a par2cular species. In 2003, Paul D.N. Hebert from the University of Guelph, Canada, proposed the compila2on of a public library of DNA barcodes that would be linked to named specimens. This library would "provide a new master key for iden;fying species, one whose power will rise with increased taxon coverage and with faster, cheaper sequencing".
DNA barcoding
ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTACTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACA
Organism is sampled DNA is extracted
Sequenced DNA is compared with sequences in a barcode database to iden)fy the organism
How Barcoding works
The PCR product is sequenced
a small region of DNA (the Barcode DNA) is
PCR amplified
hhp://www.boldsystems.org/
DNA barcoding
Barcode of Life Database: Sequence sta2s2cs (as of April 28, 2014) Barcode Sequences 3,993,422 Species coverage (formally described) Animals 158,195 Plants 62,135 Fungi & Other Life 18,255
Applica2ons of DNA barcoding (1) Facilita2ng iden2fica2on and recogni2on of named (described) species: • Plant leaves (when flowers or fruit are not available) • Linking life history stages, genders • Differen2a2ng cryp2c species • Iden2fying gut contents (e.g. 2cks, mosquitoes, bi2ng insects) • Human and plant disease vectors • Agricultural pests • Biosecurity: detec2ng invasive insect pests at port of entry • Inventory of species in genebanks • Food, herbal medicines (market subs2tu2on) • Bushmeat and illegally sold products of endangered species
(2) Surveying biodiversity; e.g., flagging poten2ally new (undescribed) species.
Muscle Uniden2fied species
Animal
Ribulose-‐1, 5-‐bisphosphate
carboxylase oxygenase large subunit gene
(rubisco; rbcL) from the plas2d genome
DNA
Polymerase Chain Reac)on (PCR)
Mitochondrial cytochrome c oxidase subunit 1 (CO1) gene
Analyse DNA sequence to iden)fy species
Plant
Leaf Uniden2fied species
Learning molecular biology and bioinforma2cs through DNA barcoding
? ?
Workshop plan
Tissues Purify DNA
PCR
Purify PCR product
Restric2on
Analyse PCR products (Gel)
Analyse purified PCR product
(Nanodrop/Gel)
Gel
DNA sequencing
Analyse DNA (Nanodrop/Gel )
Bioinforma)cs
PCR Op2misa2on
Workshop plan
Tissues Purify DNA
PCR
Purify PCR product
Restric2on
Analyse PCR products (Gel)
Analyse purified PCR product
(Nanodrop/Gel)
Gel
DNA sequencing
Analyse DNA (Nanodrop/Gel)
Bioinforma)cs
PCR Op2misa2on
Day 1
Workshop plan
Tissues Purify DNA
PCR
Purify PCR product
Restric2on
Analyse PCR products (Gel)
Analyse purified PCR product
(Nanodrop/Gel)
Gel
DNA sequencing
Analyse DNA (Nanodrop/Gel)
Bioinforma)cs
PCR Op2misa2on
Day 2
Workshop plan
Tissues Purify DNA
PCR
Purify PCR product
Restric2on
Analyse PCR products (Gel)
Analyse purified PCR product
(Nanodrop/Gel)
Gel
DNA sequencing
Analyse DNA (Nanodrop/Gel)
Bioinforma)cs
PCR Op2misa2on
Day 3
Molecular biology (Lab 4)
Bioinforma2cs (JVC)
Rest Day
1 2 3 4 5 6 7 8 9 10 11 12
Day
WEEK 1
WEEK 2
Workshop plan
Lab Manual
• Using a Micropipehe • Lab Math • Step by step guide to all methods • Internet resources and further reading
Bioinforma2cs sooware download
• Download CLC Main Workbench hhp://www.clcbio.com/products/clc-‐main-‐workbench/Download > Get a Free Trial
• Download user manual hhp://www.clcbio.com/files/usermanuals/CLC_Main_Workbench_User_Manual.pdf
Acknowledgements
Thank you
Pre-‐workshop test
• Go to IMBB workshop website: hNp://hpc.ilri.cgiar.org/beca/training/IMBB_2015/welcome.html • Go to Programme > Workshop Test
• Add your name and date
• Complete all 22 mul2ple choice ques2ons
• Submit