inhibition of hepatitis c virus replication using adeno-associated virus vector delivery of an...

VIRAL HEPATITIS

Inhibition of Hepatitis C Virus Replication Using Adeno-Associated Virus Vector Delivery of an Exogenous Anti–

Hepatitis C Virus MicroRNA ClusterXiao Yang,1 Virginia Haurigot,1 Shangzhen Zhou,1 Guangxiang Luo,2 and Linda B Couto1

RNA interference (RNAi) is being evaluated as an alternative therapeutic strategy for hepatitisC virus (HCV) infection. The use of viral vectors encoding short hairpin RNAs (shRNAs) hasbeen the most common strategy employed to provide sustained expression of RNAi effectors.However, overexpression and incomplete processing of shRNAs has led to saturation of the en-dogenous miRNA pathway, resulting in toxicity. The use of endogenous microRNAs (miRNAs)as scaffolds for short interfering (siRNAs) may avoid these problems, and miRNA clusters can beengineered to express multiple RNAi effectors, a feature that may prevent RNAi-resistant HCVmutant generation. We exploited the endogenous miRNA-17-92 cluster to generate a polycis-tronic primary miRNA that is processed into five mature miRNAs that target different regions ofthe HCV genome. All five anti-HCV miRNAs were active, achieving up to 97% inhibition ofRenilla luciferase (RLuc) HCV reporter plasmids. Self-complementary recombinant adeno-asso-ciated virus (scAAV) vectors were chosen for therapeutic delivery of the miRNA cluster. Expres-sion of the miRNAs from scAAV inhibited the replication of cell culture–propagated HCV(HCVcc) by 98%, and resulted in up to 93% gene silencing of RLuc-HCV reporter plasmids inmouse liver. No hepatocellular toxicity was observed at scAAV doses as high as 53 1011 vectorgenomes per mouse, a dose that is approximately five-fold higher than doses of scAAV-shRNAvectors that others have shown previously to be toxic in mouse liver. Conclusion: We have dem-onstrated that exogenous anti-HCV miRNAs induce gene silencing, and when expressed fromscAAV vectors inhibit the replication of HCVcc without inducing toxicity. The combination ofan AAV vector delivery system and exploitation of the endogenous RNAi pathway is a potentiallyviable alternative to current HCV treatment regimens. (HEPATOLOGY 2010;52:1877-1887)

Hepatitis C virus (HCV) infection remains amajor worldwide health care problem,because approximately 3% of the world pop-

ulation is chronically infected with this virus, whichcauses viral hepatitis and can lead to cirrhosis and he-patocellular carcinoma.1 HCV replicates in the cyto-plasm by a virally encoded RNA-dependent RNA po-lymerase (nonstructural protein 5B [NS5B]), and likemost RNA polymerases, NS5B has low fidelity andincorporates mutations into its genome at a rate of�10�4 base substitutions/nucleotide,2 generating �onemutation per round of replication. Thus, HCV showsextraordinary genetic diversity with six major geno-types, at least 50 subtypes, and millions of quasispe-cies. This feature of HCV has made vaccine and drugdevelopment extremely challenging. Although HCVinfections are currently managed with a combinationof pegylated interferon-a and ribavirin, this regimen issuccessful in achieving a sustained virological responsein only approximately 50% of patients infected with

Abbreviations: AAV, adeno-associated virus; ALT, alanine aminotransferase;ApoE, apolipoprotein E; FFLuc, firefly luciferase; hAAT, human a1-antitrypsin;HCR, hepatic control region; HCV, hepatitis C virus; HCVcc, cell culture–propagated HCV; HDTV, hydrodynamic tail vein; Huh, human hepatoma;IgG, immunoglobulin G; miRNA, microRNA; NS5B, nonstructural protein5B; QRT-PCR, quantitative real-time reverse transcription polymerase chainreaction; Rluc, Renilla luciferase; RNAi, RNA interference; sc, self-complementary; shRNA, short hairpin RNA; siRNA, short interfering RNA; vg,vector genomes; UTR, untranslated region.From the 1Division of Hematology and Center for Cellular and Molecular

Therapeutics, Children’s Hospital of Philadelphia, Philadelphia, PA;2Department of Microbiology, Immunology, and Molecular Genetics, Universityof Kentucky College of Medicine, Lexington, KY.Received June 24, 2010; accepted August 2, 2010.This work was funded by the Center for Cellular and Molecular

Therapeutics, Children’s Hospital of Philadelphia, Philadelphia, PA.Address reprint requests to: Linda B. Couto, Ph.D., 5330 Colket

Translational Research Center, 3501 Civic Center Boulevard, Philadelphia, PA19104. E-mail: [email protected]; fax: 215-590-3660.CopyrightVC 2010 by the American Association for the Study of Liver Diseases.View this article online at wileyonlinelibrary.com.DOI 10.1002/hep.23908Potential conflict of interest: Nothing to report.Additional Supporting Information may be found in the online version of

this article.

1877

HCV genotype 1. The goal of these studies was todesign an alternative therapeutic strategy for treatingHCV infection. We chose to combine the powerfulgene silencing mechanism of RNA interference(RNAi)3 and viral vector-mediated gene transfer to ac-complish this.RNAi is an evolutionarily conserved mechanism

used to suppress gene expression,3 and it has generatedenormous interest as a new therapeutic modality totreat diseases that result from overexpression or aber-rant expression of genes. RNAi is mediated by a vari-ety of small regulatory RNAs that differ in their bio-genesis,3,4 including short interfering RNAs (siRNAs),short hairpin RNAs (shRNAs), and microRNAs (miR-NAs). The products of these pathways induce genesilencing after one strand (guide or antisense strand) ofthe RNA duplex is loaded into the RNA-inducedsilencing complex, where Argonaut proteins guide theendonucleolytic cleavage or translational repression ofcognate messenger RNAs.5 Many previous studies wereperformed to identify targets within the HCV genomethat were susceptible to RNAi. Using cell lines con-taining autonomously replicating HCV replicons,many siRNAs and shRNAs targeting the 50 untrans-lated region (UTR), the structural and the nonstruc-tural regions of HCV, were shown to inhibit HCVreplication.6 Most studies, with the exception of onewhich used lentivirus vectors,7 used cationic lipids orphysical methods (i.e., electroporation) to deliver ei-ther siRNAs or plasmids expressing shRNAs. Thesedelivery methods have been shown to be inefficient,toxic, or both to cells in culture, and are thus not suit-able for in vivo applications.8 In addition, an in vivostudy reported gene silencing of luciferase-HCV re-porter plasmids after hydrodynamic tail vein (HDTV)injection of mice with plasmids expressing shRNAs.9

Again, although this study validated RNAi as a poten-tial therapeutic modality, the delivery methodemployed is not appropriate for drug administrationto humans. Currently, novel nonviral delivery formula-tions are being developed for in vivo delivery of siR-NAs,8,10 but at the present time, viral vector deliveryis the most efficient means of gene transfer, and theonly method that provides sustained expression ofRNAi. Although adeno-associated virus (AAV) andlentivirus vectors themselves appear to be safe, robustand sustained expression of RNAi effectors from AAVvectors in the form of shRNAs resulted in serious tox-icity in both mouse liver11 and brain,12,13 and in somecases fatalities occurred.11 Toxicity correlated withshRNA expression levels and an abundance of unpro-cessed shRNA precursors, suggesting saturation of the

endogenous miRNA pathway. In contrast, the use ofexogenous miRNAs prevented this competition14 andeliminated the toxicity seen in mice.12,13 Thus, maxi-mal gene silencing can be achieved with miRNA-basedRNAi effectors, without the accumulation of precursorand nonprocessed products that may disrupt endoge-nous miRNA biogenesis and lead to toxicity.In this study, we chose to pursue the exogenous

miRNA platform to design a therapeutic strategy forHCV. The endogenous miR-17-92 cluster15,16 wasmodified by replacing the first five mature miRNAs ofthe cluster with inhibitory RNAs targeting HCV. Allfive miRNAs were effective in knocking down expres-sion of Renilla luciferase (RLuc)-HCV reporter plas-mids, both in vitro and in vivo, by up to 97%. AAVvectors were used for delivery of the exogenous poly-cistronic miRNA gene, and upon use of these vectors,approximately 98% inhibition of cell culture-propa-gated HCV (HCVcc) was observed. In addition, thisvector resulted in gene silencing of RLuc-HCV report-ers in mouse liver, with no signs of toxicity. Thus, thisvector efficiently targets the HCV genome, causing in-hibition of viral replication, and is a promising candi-date for the treatment of HCV infection.

Materials and Methods

DNA Constructs and AAV Vectors. A detaileddescription of all the DNA constructs used in thesestudies and the methods for production of AAV vec-tors can be found in the Supporting Methods.In Vitro Gene Silencing Assays. Human hepatoma-

7 (Huh-7) cells were seeded in 24-well plates at 4 �104 cells/well. Approximately 48 hours later, the cellswere cotransfected, using Arrest-in (Open Biosystems,Huntsville, AL) according to the manufacturer instruc-tions, with an miRNA-expressing plasmid (125 ng) orpUC19 (125 ng) and an miRNA-specific RLuc-HCVreporter plasmid (125 ng) or the RLuc-HCV reporterthat encodes all five HCV targets. Twenty-four hoursafter transfection, cells were washed with phosphate-buffered saline and lysed using Passive Lysis Buffer(Promega, Madison WI). Firefly luciferase (FFLuc)and RLuc activities were assessed using the Dual-Lucif-erase Assay system (Promega, Madison, WI). Lumines-cence readings were acquired using an automated Veri-tas luminometer (Turner Biosystems, Sunnyvale, CA).In Vitro HCVcc Inhibition Assays. HCVcc was

produced according to Cai et al.,17 and the physicaland infectious titers were determined by quantitativereal-time reverse transcription polymerase chain reaction

1878 YANG ET AL. HEPATOLOGY, December 2010

(QRT-PCR) and according to Kato et al.,18 respec-tively. For inhibition experiments, Huh-7.5 cells(Apath, Brooklyn, NY) were plated in six-well plates at2 � 105 cells/well. Twenty-four hours later, cells wereinfected with either scAAV2-HCV-miR-Cluster 1 orscAAV2–enhanced green fluorescent protein (eGFP), atone of three multiplicities of infection (MOIs; 1 �104, 1 � 105, 1 � 106 vector genomes [vg]/cell), andincubated for 24 hours. At this time, the media wasreplaced and HCVcc was added (�0.2 focus-formingunit [FFU]/cell) for 2 hours. The media was replacedand the cells were incubated for an additional 48hours. Supernatants were collected from wells for viralRNA isolation and cells were lysed in TRIzol reagent(Invitrogen, Carlsbad, CA) for total cellular RNA puri-fication. Cells from duplicate wells were prepared forwestern blot analyses.HCV RNA Quantitation. HCV RNA was quanti-

fied by QRT-PCR19 using in vitro–transcribed JFH-1(Japanese fulminant hepatitis 1) RNA as a standard.18

Northern Blot Analyses. A description of HCVccRNA and miRNA analyses can be found in the Sup-porting Methods.Western Blot Analyses. Total protein (18 lg) was

separated on a 4%-10% Bis-Tris gel (Invitrogen, Carls-bad, CA) and transferred to a nitrocellulose membrane(Invitrogen, Carlsbad, CA), which was probed withtwo primary antibodies: anti-HCV Core antigenmonoclonal antibody (Thermo, Rockford, IL) and rab-bit anti-actin polyclonal antibody (Sigma, St. Louis,MO). The membrane was washed and then incubatedwith IRDye800CW-conjugated goat anti-mouse im-munoglobulin G (IgG) and IRDye680-conjugatedgoat anti-rabbit IgG secondary antibodies (LI-CORBiosciences, Lincoln, NE). The Odyssey InfraredImaging System (LI-COR Biosciences) was used forscanning and analysis.Animal Procedures. All animal studies were con-

ducted at the Children’s Hospital of Philadelphia withapproval from the Institutional Animal Care and UseCommittee. Male BALB/c mice were purchased fromCharles River Labs (Wilmington, MA). HDTV injec-tions of mice were performed as described elsewhere20

by coinjecting an miRNA-expressing plasmid orpUC19 DNA with a RLuc-HCV fusion plasmid. Toanalyze the scAAV8-HCV-miR-Cluster 1 vector forgene silencing, 5 � 1011 vg of the vector was injectedinto the tail vein of BALB/c mice using low pressure.Control animals received scAAV8-eGFP vectors (5 �1011 vg/mouse). Two weeks later, an HDTV injectionof one of five RLuc-HCV reporter plasmids was per-formed. Two days following the HDTV injections,

mice were sacrificed for dual luciferase analyses. Forassessment of liver toxicity, four other cohorts of micewere injected with scAAV8-HCV-miR-Cluster 1 at oneof four doses (5 � 108, 5 � 109, 5 � 1010, 5 � 1011

vg/mouse), and serum was analyzed for alanine amino-transferase (ALT) levels (TECO Diagnostics, Anaheim,CA) according to manufacturer instructions.Biochemical Analysis of Mouse Liver. Lysates of

the ground liver were prepared by adding 200 lL ofPassive Lysis Buffer (Promega, Madison, WI) to �100mg frozen ground liver. The luciferase activity in 10lL of liver lysate was determined using the Dual Lu-ciferase Assay (Promega, Madison, WI) on a Veritasluminometer (Turner Biosystems, Sunnyvale, CA).Statistical Analysis. Two-tailed Student t tests were

performed. P values < 0.05 were considered statisti-cally significant.

Results

Construction of Polycistronic Anti-HCV miRNAVector. To enhance the probability of creating func-tional miRNAs targeting the HCV genome, we sur-veyed the literature for siRNAs and shRNAs that hadpreviously been shown to inhibit autonomously repli-cating HCV replicons by greater than 80%.6 Three ofthe five siRNAs chosen target the 50 UTR of HCV(UTR1, UTR2, UTR3), and the two others targetsequences in one structural (Core) and one nonstruc-tural (NS5B) gene. We used the endogenous miR-17-92 cluster (Fig. 1A)15 to develop a multiplexed plat-form for inhibiting HCV, similar to one designed toinhibit HIV.16 A liver-specific promoter was used toensure expression in hepatocytes. The HCV targetsequences, their location in HCV 1b, the names of themiRNAs designed to cleave them, and the miRNAsthey replace in the endogenous miR-17-92 cluster areshown in Table 1. Three HCV miRNA clusters wereconstructed: HCV-miR-Cluster 1 contains in order:miR-UTR1, miR-UTR2, miR-UTR3, miR-Core, andmiR-NS5B (Fig. 1B); HCV-miR-Cluster 1 þ Introncontains the same sequence of miRNAs and includes anintron (Fig. 1C); and HCV-miR-Cluster 2 contains inorder: miR-UTR2, miR-UTR1, miR-UTR3, miR-Core,and miR-NS5B (Fig. 1D). In addition, plasmids express-ing the individual miRNAs were constructed by remov-ing four of five miRNAs from HCV-miR-Cluster 1.In Vitro Activity of Anti-HCV miRNAs. A series

of RLuc-HCV reporter plasmids were constructed byfusing HCV target sequences downstream of the RLucgene in the plasmid psiCheck2. These were used toevaluate the ability of the miRNAs to cleave their target

HEPATOLOGY, Vol. 52, No. 6, 2010 YANG ET AL. 1879

sequences. In addition, a reporter plasmid that con-tained all five HCV target sequences was constructed.Each plasmid also contained a FFLuc gene to normal-ize for transfection efficiency. When the miRNAs wereexpressed individually or from Cluster 1 or Cluster 1þ Intron, similar results were observed. That is, fourof the five miRNAs were able to inhibit their cognateHCV sequence by 34%-84% (P < 0.01 relative topUC19 controls; Fig. 2A,B). Only miR-UTR2 wasunable to induce gene silencing (Fig. 2A,B).

In HCV-miR-Cluster 1, miR-UTR2 was insertedinto endogenous miR-18 (Fig. 1B). We hypothesizedthat the mature miRNA was not properly processedfrom the primary miRNA or precursor miRNA,4 dueto its position within the cluster. Therefore, we con-structed a second cluster (HCV-miR-Cluster 2), whichcontained the same five miRNAs but in a differentorder: miR-UTR2, miR-UTR1, miR-UTR3, miR-Core, and miR-NS5B (Fig. 1D). In this cluster, miR-UTR2 replaced endogenous miR-17 and miR-UTR1replaced endogenous miR-18. In this orientation,miR-UTR2 was active, inhibiting its target by 72% 60.5% (P < 0.01) (Fig. 2C). In contrast, this changeresulted in a loss of activity for miR-UTR1, suggestingthat mature miRNAs are not processed correctly fromthe miR-18 scaffold, a finding confirmed by northernanalysis (see below).In Vivo Activity of Anti-HCV miRNAs. Efficacy of

an exogenous polycistronic miRNA has not been pre-viously evaluated in vivo. We determined the efficacy

Fig. 1. Schematic of the endog-enous miR-17-92 primary miRNAcluster and the exogenous HCV-miRNA clusters. (A) Structure ofendogenous miR-17-92 cluster.(B) Structure of HCV-miR-Cluster1. (C) Structure of HCV-miR-Clus-ter 1 þ Intron. (D) Structure ofHCV-miR-Cluster 2. Numbersbetween pre-miRNAs represent nu-cleotides. ApoE, human apolipo-protein E hepatic control region;hAAT, human a1-antitrypsin pro-moter; pA, bovine growth hormonepolyadenylation signal.

Table 1. Anti-HCV miRNAs Used in Studies

Anti-HCV miRNA HCV Target sequence

Location

in HCV 1b

Endogenous

miRNA Replaced

miR-UTR1 CCAUAGUGGUCUGCGGAAC 138-156 miR-17, miR-18

miR-UTR2 AAAGGCCUUGUGGUACUGCCU 274-294 miR-17, miR-18

miR-UTR3 AGGUCUCGUAGACCGUGCA 321-339 miR-19A

miR-Core AACCUCAAAGAAAAACCAAAC 358-378 miR-20

miR-NS5B GACACUGAGACACCAAUUGAC 7983-8003 miR-19B


of the five anti-HCV miRNAs in mouse liver by coin-jecting the plasmids expressing the HCV-miR Clusterswith the RLuc-HCV reporter plasmids via HDTVinjection.20 Two days following the injection, micewere sacrificed, livers were harvested, and dual lucifer-ase assays were performed on liver lysates. Control

mice received injections of the same RLuc-HCVreporters and a pUC19 plasmid. Four of the five miR-NAs expressed from HCV-miR-Cluster 1 þ Intronwere highly active in inhibiting their individual cog-nate reporters (Fig. 3A). Furthermore, using the RLucreporter containing all five HCV targets, 94% 6 2%

Fig. 2. In vitro inhibition ofRLuc-HCV reporter plasmids bymiRNAs targeting HCV. Huh-7 cellswere cotransfected with 125 lg ofan RLuc-HCV reporter plasmid(UTR1, UTR2, UTR3, Core, NS5B,or all five targets) and 125 lg ofa plasmid expressing one of fiveanti-HCV miRNAs (miR-UTR1, miR-UTR2, miR-UTR3, miR-Core, miR-NS5B), a plasmid expressing anHCV-miR-Cluster, or pUC19.Twenty-four hours after transfection,cell lysates were prepared anddual luciferase (FFLuc and RLuc)assays were performed. NormalizedRLuc expression in cells cotrans-fected with pUC19 was set as100% activity or 0% inhibition ofthe target, and the percent inhibi-tion achieved by each miRNA wascompared to the pUC19 control.Mean values of triplicate samplesfrom at least three independentexperiments (unless stated other-wise) are shown (6 standard devi-ation [SD]). (A) Inhibitory activityof individually expressed anti-HCVmiRNAs (miR-UTR1, miR-UTR2,miR-UTR3, miR-Core, miR-NS5B)against individual reporters or thereporter encoding all five targets.(B) Inhibitory activity of anti-HCVmiRNAs when expressed from HCV-miR-Cluster 1 or HCV-miR-Cluster1 þ Intron against individual cog-nate targets or the reporter encod-ing all five targets (data for HCV-miR-Cluster 1 þ Intron versus fivetargets are from triplicate transfec-tions of one experiment). (C) Inhib-itory activity of anti-HCV miRNAswhen expressed from HCV-miR-Cluster 2 against individual cog-nate targets or the reporter encod-ing all five targets (data are fromtriplicate transfections of two inde-pendent experiments).


inhibition was observed (P < 0.01). Similar to whatwas found in Huh-7 cells, miR-UTR2 was completelyinactive. In all cases, higher silencing activity by thefour active miRNAs was observed in vivo, as comparedto that seen in vitro. The higher activity was not dueto nonspecific silencing as demonstrated by the failureof HCV-miR-Cluster 1 þ Intron to inhibit a reporterlacking HCV sequences (psiCheck2) (Fig. 3A). The

lack of inhibition of the RLuc-HCV UTR1 reporterby a plasmid expressing only HCV-miR-Core, alsodemonstrated that the higher levels of inhibitionobserved in vivo are not due to nonspecific targeting(data not shown).As mentioned above, we constructed a second

miRNA cluster (HCV-miR-Cluster 2) to evaluate theactivity of miR-UTR2 when inserted into endogenousmiR-17, rather than miR-18. This change in positionresulted in a highly active miR-UTR2, capable of in-hibiting its target by 97% 6 0.5% (P < 0.01 relativeto pUC19 control) (Fig. 3B). The reciprocal place-ment of miR-UTR1 into endogenous miR-18 frommiR-17 completely abolished its activity (Fig. 3B),again suggesting that mature miRNAs are not proc-essed correctly from a pre-miR-18 scaffold. Similar toHCV-miR-Cluster 1, HCV-miR-Cluster 2 was alsoable to silence the HCV reporter containing all fivetargets by 92% 6 2.7% (P < 0.01 relative to pUC19control) (Fig. 3B). Thus, two separate HCV-miR clus-ters are able to express four potent miRNAs that targetHCV sequences, and mediate gene silencing in vivo.The gene silencing results were corroborated by

northern blot analyses, which demonstrated that themature forms of the four active miRNAs expressedfrom HCV-miR-Cluster 1 or HCV-miR-Cluster 1 þIntron were produced in mouse liver (Fig. 4A,C-E).Very little precursor miRNAs, with predicted lengthsof 70-87 nucleotides, were observed, demonstratingthat efficient processing of miR-UTR1, miR-UTR3,miR-Core, and miR-NS5B from the precursor miRNAwas achieved. Using synthetic siRNA standards, weestimated that approximately equal amounts (�1fmol) of the four active miRNAs were present in 25lg of total liver RNA, suggesting that these four miR-NAs were processed from the primary and precursormiRNA with similar efficiencies. In contrast, nomature miR-UTR2 was observed (Fig. 4B), consistentwith the lack of inhibition of the RLuc-HCV UTR2reporter plasmid that was observed in the dual lucifer-ase assays. However, when the orientation of miR-UTR1 and miR-UTR2 was reversed in HCV-miR-Cluster 2, mature miR-UTR2 (Fig. 4F), but nomature miR-UTR1 was produced (Fig. 4G), consistentwith the gene silencing data using this cluster.Inhibition of HCVcc Replication Using AAV Vec-

tors Expressing HCV-miRNA-Cluster 1. With theultimate goal of developing a safe and effective treat-ment for HCV infection, we used recombinant AAVvectors as delivery vehicles for HCV-miRNA-Cluster1. These vectors are currently being evaluated forsafety in multiple gene therapy clinical trials, and thus

Fig. 3. In vivo inhibition of RLuc-HCV reporter plasmids by miRNAstargeting HCV. HDTV injections of BALB/c mice were performed using12 lg of plasmid HCV-miR-Cluster 1 þ Intron, plasmid HCV-miR-Clus-ter 2, or pUC19, and 12 lg of one of the RLuc-HCV fusion reporterplasmids or psiCheck2 in a volume of 2 mL phosphate-buffered sa-line. Two days later, animals were sacrificed, livers harvested, and liverlysates were assayed for both FFLuc and RLuc activity. NormalizedRLuc expression in the animals that received the pUC19 negative con-trol plasmid was set as 100% activity or 0% inhibition of the target,and the percent inhibition achieved by each miRNA was compared tothe pUC19 control. Cohorts of five mice were used for each reporterplasmid injected. Three independent liver lysates were prepared andanalyzed from each mouse, and the results are reported as the meanand SD of these values. (A) Inhibitory activity of anti-HCV miRNAswhen expressed from HCV-miR-Cluster 1 þ Intron against individualreporter plasmids, the reporter encoding all five HCV targets (5 Tar-gets), or a plasmid encoding no HCV targets (psiCheck2). (B) Inhibi-tory activity of anti-HCV miRNAs when expressed from HCV-miR-Cluster2 against individual reporter plasmids, the reporter encoding all fiveHCV targets, or a plasmid encoding no HCV targets (psiCheck2).


far, no evidence of any serious safety issues have beenseen,21 although careful evaluation of anti-AAVimmune responses have not always been systematicallyperformed.22 A self-complementary (sc) AAV2 vectorexpressing HCV-miR-Cluster 1 (scAAV2-HCV-miR-Cluster 1) was produced because these vectors lead tohigher transduction levels than traditional single-stranded AAV vectors.23 A control vector that expressesthe enhanced GFP protein (scAAV2-eGFP) was alsoproduced. To evaluate the inhibitory potential of theanti-HCV miRNAs on HCVcc replication, Huh-7.5cells were treated with scAAV2-HCV-miR-Cluster 1 orscAAV2-eGFP at one of three doses, and 24 hourslater, HCVcc was added. Using 104, 105, and 106 vg/cell of scAAV2-HCV-miR-Cluster 1, the amount ofHCVcc in the supernatants decreased in a dose-de-pendent manner, resulting in 65%, 83%, and 88% in-hibition of HCVcc replication, respectively (Fig. 5A).The decrease in HCVcc RNA levels found in the

supernatants correlated with a 57%-93% decrease inthe presence of intracellular genomic HCVcc RNA, asmeasured by northern blot (Fig. 5B). These resultswere confirmed using QRT-PCR to quantify intracel-lular HCVcc RNA (data not shown). Finally, HCVcccore protein also declined by 69%-98% as the dose ofscAAV2-HCV-miR-Cluster 1 increased (Fig. 5C).Thus, four independent methods demonstrated thatscAAV2-HCV-miR-Cluster 1 has the ability to inhibitbona fide HCVcc replication by up to 98%.AAV Vectors Expressing HCV-miRNA-Cluster 1

Are Safe and Effective In Vivo. The combined datadescribed above demonstrate that plasmids expressingthe anti-HCV miRNAs are capable of HCV genesilencing both in vitro and in vivo, and that AAV vec-tors expressing this cluster inhibit HCVcc replicationin vitro. We were next interested in determining if theAAV vector system could efficiently deliver themiRNA cluster to liver and mediate gene silencing of

Fig. 4. Northern blot analyses of miRNA transcripts in murine liver RNA. Mice were injected with a plasmid expressing HCV-miR-Cluster 1 (A-E), HCV-miR-Cluster 1 þ Intron (A-G), HCV-miR-Cluster 2 (F-G), or pUC19. Synthetic siRNAs were used as probe-specific positive controls: 0.4,2.0, 10.0, and 50.0 fmol (D only). A c-P32-labeled Decade RNA molecular weight marker (Ambion, Austin, TX) was included (M). The miRNAtranscripts were detected using c-P32-labeled oligonucleotide probes specific for the antisense strand (miRNA guide strand): (A) miR-UTR1 probe:(50-CCATAGTGGTCTGCGGAAC-30); (B) miR-UTR2 probe: (50-AAAGGCCTTGTGGTACTGCCT-30); (C) miR-UTR3 probe: (50-AGGTCTCGTAGACCGTGCA-30);(D) miR-Core probe: (50-AACCTCAAAGAAAAACCAAAC-30); (E) miR-NS5B probe: (50-GACACTGAGACACCAATTGAC-30); (F) miR-UTR2 probe: (50-AAAGGCCTTGTGGTACTGCCT-30); (G) miR-UTR1 probe: (50-CCATAGTGGTCTGCGGAAC-30). Blots were stripped and reprobed with a U6 shRNA probe:(50-TATGGAACGCTTCACGAATTTGC-30) to confirm equal sample loading.


RLuc-HCV reporter plasmids. BALB/c mice wereinjected via the tail vein with 5 � 1011 vg of scAAV8-HCV-miR-Cluster 1 or scAAV8-eGFP, and 2 weekslater an HDTV injection of one of the five RLuc-

HCV reporter plasmids was performed. Mice were sac-rificed 2 days later, and liver lysates were analyzed fordual luciferase activity. As shown in Fig. 6, 73% (P <0.01) inhibition of the RLuc-HCV UTR1 reporter

Fig. 5. AAV vectors expressing HCV-miRNA-Cluster 1 inhibits HCVcc replication. Huh-7.5 cells were plated at 2 � 105 cells/well in a six-wellplate. Twenty-four hours later, cells were infected with either scAAV2-HCV-miR-Cluster 1 or the control vector scAAV2-eGFP at one of three MOIs(1 � 104, 1 � 105, 1 � 106 vg/cell), and incubated for 24 hours. At this time, the media was replaced and HCVcc was added (�0.2 FFU/cell) and allowed to infect cells for 2 hours. The media was replaced and cells were incubated for an additional 48 hours. A total of 4 independ-ent experiments were performed, and representative data from one experiment are shown. Controls included wells of Huh-7.5 cells that were nottransduced by AAV vectors, but were either treated with HCVcc alone or with HCVcc plus interferon-a (100 U/mL), or were uninfected. (A) Super-natants were collected and viral RNA was quantified by QRT-PCR. Percent inhibition was determined by comparing the number of HCVcc copies inwells infected with the scAAV2-HCV-miR-Cluster 1 divided by the number of HCVcc copies in wells infected with the scAAV2-eGFP vector. (B) CellularRNA was purified and 1 lg total RNA was analyzed by northern blot using an a-P32-labeled 9.6-kB fragment of plasmid pJFH-1 as a probe. The mem-brane was exposed to film and to a phosphor screen for quantification of band intensities. (C) Cells were washed, lysed, and 18 lg of total proteinwas analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and western blot, using a combination of two primary anti-bodies (mouse anti-HCV core antibody and rabbit anti-actin antibody). IRDye 800CW-conjugated goat anti-mouse IgG and IRDye 680-conjugatedgoat anti-rabbit IgG were used as secondary antibodies. Protein bands were visualized by using an Odyssey Infrared Imaging System.


was observed; similarly, 67% (P < 0.01), 93% (P <0.01), and 80% (P < 0.01) inhibition of the RLuc-HCV-UTR3, Core, and NS5B reporters was observed,respectively. Consistent with the in vitro and in vivodata using plasmids to express the cluster, no inhibi-tion of the RLuc-HCV UTR2 reporter was observed.These data demonstrate that AAV vectors can effi-ciently deliver miRNAs to the liver, and four of thefive miRNAs expressed from Cluster 1 are effectiveinhibitors of HCV.To evaluate the scAAV8-HCV-miR-Cluster 1 for he-

patocellular toxicity, cohorts of mice were injected withone of four doses of the vector (5 � 108, 5 � 109, 5 �1010, 5 � 1011 vg/mouse), and ALT levels were measuredat multiple time points over the course of 10 weeks. Noelevations in ALT were observed at any time, even at thehighest dose of vector, which is approximately five-foldhigher than the dose of scAAV-shRNA vectors that resultedin hepatic toxicity.11 Thus, the use of a polycistronicmiRNA scaffold to express anti-HCV RNAi effectorsappears to be safer than using shRNAs to mediate RNAi.13

Discussion

In this study, we exploited the endogenous RNAimechanism to design a novel treatment for HCV

infection, because the current therapy is not equallyeffective against all HCV genotypes and has numerousside effects.1 In designing this alternative strategy, wetook advantage of the results gleaned from previousattempts to inhibit HCV using RNAi. In particular,we relied on the literature to identify HCV targetsequences, and incorporated validated siRNA andshRNA sequences6 into the endogenous miR-17-92cluster. The use of a polycistronic miRNA to expressfive RNAi effectors that target different regions ofHCV increases the likelihood of inhibiting the virus.In addition, four of the five RNAi effectors target con-served regions of all six HCV genotypes, providingbroader applicability to this approach than drugs cur-rently in use and those in development. We used miR-NAs, rather than shRNAs, to mediate RNAi to avoidinterference with the endogenous miRNA pathway.12-14 The mature miRNAs were designed to mimic thesecondary structure of their endogenous counterpartsand to have low internal stability at their 50 ends,because these characteristics have been associated withpreferential incorporation of the guide strand into theRNA-induced silencing complex,24,25 a feature thatwill minimize off-target effects. The use of a liver-spe-cific promoter to express the miRNAs ensured expres-sion in hepatocytes, which will also minimize potentialoff-target effects. In addition to safety, the genomic or-ganization of polycistronic miRNAs is amenable to si-multaneous expression of multiple miRNAs, which hasthe potential to prevent the emergence of escapemutants, a problem that plagues all traditional anddirect-acting anti-HCV drugs,26 as well as RNAi-basedtechnologies.27 This concept was validated using justtwo siRNAs, which limited HCV escape mutant evolu-tion.27 In addition, computer modeling predicted thatif each RNAi effector is 75% effective in cleaving itstarget, three effectors will be sufficient to preventescape mutant generation, assuming efficient genetransfer.28 When the probability of target cleavagedecreased to 70%, four RNAi effectors were required.Thus, although not yet tested, the combination of fivepotent anti-HCV miRNAs should dramaticallydecrease the evolution of escape mutants. To achieveefficient gene transfer, we chose AAV vectors, becausethis delivery system has already been used in the clinicto mediate gene transfer to numerous tissues, includingliver. In our studies, it allowed for safe and efficientgene delivery and sustained expression of the RNAieffectors, a feature that may result in complete clear-ance of HCV over time.Proof-of-concept was demonstrated using RLuc re-

porter plasmids, because four of five miRNAs in two

Fig. 6. AAV vectors expressing HCV-miRNA-Cluster 1 mediate HCVgene silencing in vivo. Male BALB/c mice (6-8 weeks old) wereinjected with 5 � 1011 vg of scAAV8-HCV-miR-Cluster 1 via the tailvein. Two weeks later, separate cohorts of mice (n ¼ 5) were injectedwith one of five RLuc-HCV reporter plasmids using the HDTV proce-dure. Control mice were injected with scAAV8-eGFP and one of thefive reporter plasmids. Mice were sacrificed 2 days later and liverlysates were analyzed for dual luciferase activity. Normalized RLucexpression in mice infected with scAAV8-eGFP and transfected with aRLuc-HCV reporter plasmid was set as 100% activity or 0% inhibitionof the target. Percent inhibition achieved by each miRNA was deter-mined by comparing normalized RLuc activity in the mice injected withscAAV8-HCV-miR-Cluster 1 to animals injected with the scAAV8-eGFPvector. Three independent liver lysates were prepared and analyzed foreach liver, and the results are reported as the mean 6 SD of thesevalues for each cohort.


different HCV-miRNA clusters had good activity, withsome miRNAs achieving almost complete gene silenc-ing of their target sequence. One miRNA in each clus-ter was inactive due to its placement in the endoge-nous miR-18 scaffold, and this correlated with thelack of the mature miRNA species in mouse liver. It isnot clear why this scaffold did not support the genera-tion of an active miRNA. The miRNAs that arearranged in clusters and expressed from a single pro-moter often exhibit similar expression patterns. How-ever, clustered miRNAs may accumulate differentiallyin vivo as a result of posttranscriptional processing orstability,29 and endogenous miR-18 appears to beexpressed at lower levels than the other miRNAs inthe liver.30 Thus, it might not be possible to engineerthis miRNA scaffold to achieve high-level expressionof mature exogenous miRNAs in the liver, and the useof the last miRNA in the cluster (i.e., miR-92), as anexogenous miRNA scaffold, may be a better choice.We chose AAV vectors to evaluate the ability of the

miRNA cluster to inhibit replication of HCVcc inHuh-7.5 cells. It should be noted that the level ofHCVcc RNA observed in these cells is much higher(�50-fold)31 than that seen in chronically infectedhuman hepatocytes. Thus, this represents a stringentsystem for evaluating the efficacy of the miRNA clus-ter. At the highest dose of scAAV2-HCV-miR-Cluster1, nearly 100% inhibition of HCVcc replication wasobserved, as demonstrated using four independentmethods. The data indicate that the HCV sequencecan be targeted by at least one of the five anti-HCVmiRNAs, and future studies will be designed to deter-mine the contribution of each anti-HCV miRNA ininhibiting HCVcc and the mechanism of action (i.e.,target cleavage or cleavage-independent repression).When expressed from plasmids, we estimated that

the amount of the four active miRNAs expressed inliver from HCV-miR-Cluster 1 þ Intron is �1.0 fmol(or 6 � 108 miRNAs) in 25 lg total liver RNA.Using the hepatocellularity number that has beenreported for mice of 1.38 � 108 cells/g liver tissue,32

we calculated that �155 miRNAs were expressed percell. Because we expect only �20%-40% of the hepa-tocytes to be transfected using the HDTV procedure,20

we estimated that the transduced hepatocytes expressed�400-800 miRNAs/cell. Although �56% of hepato-cytes in chronically infected individuals harbors HCVgenomic RNA at any time, HCV replication occurs inonly a subset (�14%) of them, and replication occursat a low level (�33 genomic RNA molecules/infectedhepatocyte).33 Thus, based on our estimates, it shouldbe possible to achieve therapeutic quantities of miR-

NAs. In addition, in a gene therapy setting, whereAAV vectors may be present in the liver for months toyears, we expect sustained expression of miRNAs,which over time may completely suppress the cellularviral load. Even if previously infected hepatocytes donot benefit from AAV vectors, uninfected cells may beprotected from a new infection, and this alone wouldrepresent a new and potentially effective stand-alone oradjunct approach to HCV infection management.In summary, we have demonstrated that exogenous

anti-HCV miRNAs induce gene silencing, and whenexpressed from AAV vectors, they inhibit the replica-tion of HCVcc. To our knowledge, this is the first dem-onstration of the activity of an exogenous polycistronicmiRNA cluster against HCVcc and against reporterplasmids in vivo. The combination of the AAV vectordelivery system and exploitation of the endogenousRNAi pathway represents a new therapeutic platformand a potentially viable alternative to the current HCVtreatment regimen, and thus warrants further evaluationin animal models of HCV, such as human hepatocytexenograft models and HCV-infected chimpanzees.Acknowledgment: We thank Dr. Steel (Drexel Uni-

versity College of Medicine, Philadelphia, PA) for gen-erously providing the Huh-7 cell line, and Drs. Mar-garitis, Mingozzi, and Podsakoff (Children’s Hospitalof Philadelphia, Philadelphia, PA) for critical readingof the manuscript.

References1. Sarbah SA, Younossi ZM. Hepatitis C: an update on the silent epi-

demic. J Clin Gastroenterol 2000;30:125-143.2. Bartenschlager R, Lohmann V. Replication of hepatitis C virus. J Gen

Virol 2000;81:1631-1648.3. Zamore PD, Haley B. Ribo-gnome: the big world of small RNAs. Sci-

ence 2005;309:1519-1524.4. Kim VN, Han J, Siomi MC. Biogenesis of small RNAs in animals.

Nat Rev Mol Cell Biol 2009;10:126-139.5. Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded

RNA. Nature 2004;431:343-349.6. Wilson JA, Richardson CD. Future promise of siRNA and other

nucleic acid based therapeutics for the treatment of chronic HCV.Infect Disord Drug Targets 2006;6:43-56.

7. Henry SD, van der Wegen P, Metselaar HJ, Tilanus HW, Scholte BJ,van der Laan LJ. Simultaneous targeting of HCV replication and viralbinding with a single lentiviral vector containing multiple RNA inter-ference expression cassettes. Mol Ther 2006;14:485-493.

8. Wu SY, McMillan NA. Lipidic systems for in vivo siRNA delivery.AAPS J 2009;11:639-652.

9. McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, KayMA. RNA interference in adult mice. Nature 2002;418:38-39.

10. Davis ME. The first targeted delivery of siRNA in humans via a self-assembling, cyclodextrin polymer-based nanoparticle: from concept toclinic. Mol Pharm 2009;6:659-668.

11. Grimm D, Streetz KL, Jopling CL, Storm TA, Pandey K, Davis CR,et al. Fatality in mice due to oversaturation of cellular microRNA/shorthairpin RNA pathways. Nature 2006;441:537-541.


12. Boudreau RL, Martins I, Davidson BL. Artificial microRNAs as siRNAshuttles: improved safety as compared to shRNAs in vitro and in vivo.Mol Ther 2009;17:169-175.

13. McBride JL, Boudreau RL, Harper SQ, Staber PD, Monteys AM, Mar-tins I, et al. Artificial miRNAs mitigate shRNA-mediated toxicity inthe brain: implications for the therapeutic development of RNAi. ProcNatl Acad Sci U S A 2008;105:5868-5873.

14. Castanotto D, Sakurai K, Lingeman R, Li H, Shively L, Aagaard L,et al. Combinatorial delivery of small interfering RNAs reduces RNAiefficacy by selective incorporation into RISC. Nucleic Acids Res 2007;35:5154-5164.

15. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identificationof novel genes coding for small expressed RNAs. Science 2001;294:853-858.

16. Liu YP, Haasnoot J, ter Brake O, Berkhout B, Konstantinova P. Inhibi-tion of HIV-1 by multiple siRNAs expressed from a single microRNApolycistron. Nucleic Acids Res 2008;36:2811-2824.

17. Cai Z, Zhang C, Chang KS, Jiang J, Ahn BC, Wakita T, et al. Robustproduction of infectious hepatitis C virus (HCV) from stably HCVcDNA-transfected human hepatoma cells. J Virol 2005;79:13963-13973.

18. Kato T, Date T, Murayama A, Morikawa K, Akazawa D, Wakita T.Cell culture and infection system for hepatitis C virus. Nat Protoc2006;1:2334-2339.

19. Takeuchi T, Katsume A, Tanaka T, Abe A, Inoue K, Tsukiyama-KoharaK, et al. Real-time detection system for quantification of hepatitis Cvirus genome. Gastroenterology 1999;116:636-642.

20. Liu F, Song Y, Liu D. Hydrodynamics-based transfection in animals bysystemic administration of plasmid DNA. Gene Ther 1999;6:1258-1266.

21. Daya S, Berns KI. Gene therapy using adeno-associated virus vectors.Clin Microbiol Rev 2008;21:583-593.

22. Frank KM, Hogarth DK, Miller JL, Mandal S, Mease PJ, Samulski RJ,et al. Investigation of the cause of death in a gene-therapy trial. N EnglJ Med 2009;361:161-169.

23. McCarty DM, Monahan PE, Samulski RJ. Self-complementaryrecombinant adeno-associated virus (scAAV) vectors promote efficienttransduction independently of DNA synthesis. Gene Ther 2001;8:1248-1254.

24. Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, Zamore PD.Asymmetry in the assembly of the RNAi enzyme complex. Cell 2003;115:199-208.

25. Khvorova A, Reynolds A, Jayasena SD. Functional siRNAs and miR-NAs exhibit strand bias. Cell 2003;115:209-216.

26. Sarrazin C, Zeuzem S. Resistance to direct antiviral agents in patientswith hepatitis C virus infection. Gastroenterology 2010;138:447-462.

27. Wilson JA, Richardson CD. Hepatitis C virus replicons escape RNAinterference induced by a short interfering RNA directed against theNS5b coding region. J Virol 2005;79:7050-7058.

28. Leonard JN, Schaffer DV. Computational design of antiviral RNAinterference strategies that resist human immunodeficiency virus escape.J Virol 2005;79:1645-1654.

29. Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E,Ambros V. Expression profiling of mammalian microRNAs uncovers asubset of brain-expressed microRNAs with possible roles in murine andhuman neuronal differentiation. Genome Biol 2004;5:R13.

30. Boggs RM, Moody JA, Long CR, Tsai KL, Murphy KE. Identification,amplification and characterization of miR-17-92 from canine tissue.Gene 2007;404:25-30.

31. Wakita T, Pietschmann T, Kato T, Date T, Miyamoto M, Zhao Z,et al. Production of infectious hepatitis C virus in tissue culture from acloned viral genome. Nat Med 2005;11:791-796.

32. Sohlenius-Sternbeck AK. Determination of the hepatocellularity num-ber for human, dog, rabbit, rat and mouse livers from protein concen-tration measurements. Toxicol In Vitro 2006;20:1582-1586.

33. Chang M, Williams O, Mittler J, Quintanilla A, Carithers RL Jr, Per-kins J, et al. Dynamics of hepatitis C virus replication in human liver.Am J Pathol 2003;163:433-444.


inhibition of hepatitis c virus replication using adeno-associated virus vector delivery of an...

Documents